www.sciencemag.org/content/350/6267/1521/suppl/DC1

Supplementary Materials for

Rice perception of symbiotic arbuscular mycorrhizal fungi

requires the karrikin receptor complex

Caroline Gutjahr, Enrico Gobbato, Jeongmin Choi, Michael Riemann, Matthew G. Johnston, William Summers, Samy Carbonnel, Catherine Mansfield,

Shu-Yi Yang, Marina Nadal, Ivan Acosta, Makoto Takano, Wen-Biao Jiao, Korbinian Schneeberger, Krystyna A. Kelly, Uta Paszkowski*

*Corresponding author. E-mail: up220@cam.ac.uk

Published 18 December 2015, Science 350, 1521 (2015) DOI: 10.1126/science.aac9715

This PDF file includes:

Materials and Methods Figs. S1 to S6 Tables S1, S2, S3, S5, and S7 References

Other Supplementary Material for this manuscript includes the following: (available at www.sciencemag.org/cgi/content/full/350/6267/1521/DC1)

Tables S4 and S6

Materials and Methods:

Plant material, growth conditions and inoculation with fungi. The hebiba mutant in

the Oryza sativa ssp. japonica cv. Nihonmasari background and the trangenic line

complemented with a genomic fragment containing the AOC gene are described in (17).

The d3-1 mutant Oryza sativa ssp. japonica cv. Shiokari background (32) was provided

by Mikio Nakazono (Nagoya University, Japan). The d14-1 mutant Oryza sativa ssp

japonica cv Shiokari and the D14L RNAi line Ri43 (23) in the Nipponbare background

were provided by the lab of Junko Kyozuka (Graduate School of Agriculture and Life

Sciences, University of Tokyo). Rice growth conditions, sources of fungal material and

inoculation of plants with Rhizophagus irregularis, Gigapora rosea, Piriformospora

indica and Magnaporthe oryzae are described in (10, 27) For the production of

germinated spore exudates (GSE), R. irregularis spores generated in axenic cultures

using the split plates method, were incubated in liquid minimal M medium (32) at 30 C

in a 2% CO2 enriched environment. After 7 days of incubation the germinated mycelium

was removed and the GSE were filter sterilized using a 0.45M syringe filter. For GSE

treatment each plant received a volume of exudates corresponding to approximately

15,000 spores.

AM assays. Roots colonized by R. irregularis or Gi.rosea were stained with trypan blue

and percent root length colonization was quantified according to a modified gridline

intersect method as described (10). To assess restoration of AM colonization in hebiba

lines transgenically complemented with AOC (hebibaAOC) driven by its native promoter, a

population of 10 T2 hebibaAOC lines representing independent transformation events were

examined. Since hebiba has a strongly elongated mesocotyl at seedling stage, which is

based on jasmonate deficiency (17, 34), the transgenic plants were examined for reduced

mesocotyl length before starting the AM colonization assay. Furthermore, after root

sampling the plant lines were allowed to grow to maturity for seed setting. The

production of seed on all lines was indicative of successful complementation of hebiba by

AOC since jasmonate hebiba results in male sterility of the non-complemented

homozygous mutant (17, 34). To examine the effect of exogenously applied karrikin 2

(Toronto Research Chemicals, Toronto, Canada), plants were watered three times a week

with 10ml of 0.1 µM or 1µM karrikin 2 (stock solution: 10mM in 50% methanol).

Control plants were watered with equal amounts of solvent.

Gene expression analysis. For the RNAseq experiments plants were treated following

the experimental design shown in tab. S2. Seeds from wild type and hebibaAOC plants

were sterilized with 0.3% Sodium Hypochlorite and pre-germinated on 0.9% bactoagar

plates at 30 C. Seven day old seedlings were transferred to sterilized sand and grown for

two weeks without fertilizer. Plantlets were then transferred to liquid ½ Hoagland

containing 25M phosphate for another week before treating them either with GSE,

karrikin 2 (at a final concentration of 1M, diluted from a stock of 10mM in 50%

methanol) or non-supplemented ½ Hoagland (mock). Root material was collected at the

time points indicated in tab. S2, and total RNA was extracted as previously described (10)

from pools of 2 plants. Following DNaseI treatment, the integrity and concentration of

the RNA was determined. The Illumina® TruSeq® RNA Sample Prep Kit v2 (stranded)

was used to generate indexed RNAseq libraries from 4ug of total RNA from each of the

samples. Final library quality and concentration were measured using the DNA High

Sensitivity Kit on a Bioanalyzer 2100 system (Agilent Technology). Indexed samples

(final concentration of 5nM for each sample) were mixed to form two pools, each

containing half of the libraries. Each pooled sample was sequenced (100 base pair (bp)

paired-end reads) on a separate lane of a HiSeq 2000 sequencer by BGI TECH

SOLUTIONS (Hong Kong). The samples were de-multiplexed by BGI TECH

SOLUTIONS (tab. S3). Genome and annotation files used in the analysis were

downloaded from the Rice Genome Annotation Project:

ftp://ftp.plantbiology.msu.edu/pub/data/Eukaryotic_Projects/o_sativa/annotation_dbs/pse

udomolecules/version_7.0/all.dir/. Cufflinks v2.2.1 (36) was used to build a reference

transcriptome using the all.con and all.gff3 files. The resulting fasta file was employed to

build bowtie2 indices (bowtie2-2.2.4, 37). After quality assessment, the reads were

mapped to the reference transcriptome using the parameters --very-sensitive -a -X 800.

The overall alignment rate across all 27 samples is 81%. To account for multiply mapping

reads, eXpress-1.5.1 (38) was used to count reads mapping to each gene, with parameters

--rf-stranded --no-bias-correct. The differential expression analysis was performed using

the Bioconductor (39) package, baySeq_2.1.17 (40), in R version 3.1.2. The estimated

counts and effective lengths from eXpress were used. To determine genes with average

differences in expression between genotypes or treatments, the error was estimated by

treating all the data for a genotype/treatment combination as replicates and genes were

considered to be significant if the False Discovery Rate (FDR) was less than 0.05. Since

measurements had been made at different times to capture as many of the early responses

as possible, models making stronger assumptions than an average difference between

groups could be fitted. Seven models were fitted to the data one specifying no change

with time, one each for a change for each time point (3, 6, 9, 12, 24 hours post treatment,

hpt) and a ‘catchall’ to detect patterns in the data not accounted for by the other models.

For example, the equivalence sets {WT.M.0, WT.M.3, WT.M.6, WT.M.9, WT.M.12,

WT.M.24, WT.G.3}, {WT.G.6, WT.G.9, WT.G.12, WT.G.24} specify a model in which

there is a change at 6 hpt. The assumption was made that most genes are not differentially

expressed and the error was estimated conservatively by treating all the data included in a

comparison as replicates. The most likely model for each gene was selected and then, for

each model a list of the genes for which this was the most likely model was generated.

For each model, the gene list was tested for enrichment of GO terms with the

R/Bioconductor package GOstats 2.32.0 (41) using the all.GOSlim_assignment file from

the Rice Genome Annotation Project. To allow for multiple testing, only p-values less

than 0.001 were considered significant. The Venn diagram was made using the R package

Vennerable 3.0 (42) and the heatmaps using the function aheatmap from package NMF

0.20.5 (43).

For the validation of RNAseq based gene expression analyses, RNA extraction, cDNA

synthesis and real-time RT-PCR were performed as described (10). For quantitative RT-

PCR each sample was represented by three technical replicates. Primers for AM marker

genes were taken from (10). All other primers are shown in tab. S7.

Cloning for RNAi , complemention of hebibaAOC and localizaton experiments. The

plasmids pCG75 and pCG76 for RNAi were constructed as described (44) using the

primers shown in tab. S7. The plasmid pCG87 for complementation of hebibaAOC with

LOC_Os03g32270 was constructed as follows: The maize ubiquitin promoter and Nos

Terminator were cut with HindIII and SacI from pCXUN (45) and inserted into pTFT101

resulting in the plasmid pCaGu1. The ubiquitin promoter was removed from pCaGu1 by

restriction digest with HindII and XmaI. A genomic fragment containing the D14L gene

including a promoter region of 2331bp upstream of ATG and a 3’ region of 518bp

downstream of the stop codon was PCR amplified from genomic DNA of Oryza sativa

ssp. japonica cv. Nihonmasari using the primers shown in tab. S7 and inserted into the

pCaGU1 vector lacking the ubiquitin promoter by blunt ligation. For construction of the

plasmids pCG51 (containing LOC_Os03g0438200) and pCG53 (containing

LOC_Os03g32302) available cDNA clones

(http://www.dna.affrc.go.jp/distribution/distdna.html) 001-105-G09 and 002-184-F03,

respectively, were used. The cDNAs were liberated by restriction digest using XmaI and

AvrII (001-105-G09) or XmaI and BamHI (002-184-F03) and then ligated into the

corresponding restriction sites of pCaGu1. For the plasmid pCG50 for transgenic

complementation of hebibaAOC with LOC_Os05g32490 the cDNA was amplified with

primers indicated in tab. S7 and ligated into the DglII restriction site of pCaGu1. A

pENTR-pD14L vector was used to transfer pD14L into the destination pHGWFS7.0

vector (46) by LR reaction.

To perform localization experiments the coding region of D14L was amplified from rice

(Nihonmasari) cDNA and cloned into pENTRYTM/D-TOPO vector (Invitrogen) to

generate the pENTR-D14L cDNA vector (tab. S7). The resulting plasmid was

recombined into the modified pH7FWG2 vector where the 35S promoter was replaced

with the maize polyubiquitin promoter. Full-length D14L including its native promoter

(2331bp upstream of the start codon) was amplified from genomic DNA and cloned into

the pENTRYTM/D-TOPO vector (Invitrogen) to generate pENTR-pD14L:D14L. The

resulting plasmid was recombined into the pGWB553 vector 11.

Stable and transient rice transformation. Stable rice transformation was performed as

previously described (44). For rice protoplast transformation rice seedlings (Nipponbare)

were grown in magenta boxes containing half-strength MS media with 1% phytagel for 8

days at 30° C in the dark. Roots were harvested for protoplast isolation and transformed

as previously described (47) with minor modifications: 0.3% Pectolyase Y-23 (Duchefa

Direct, St.Louis, MO, USA) was added to the enzyme solution.

Subcellular localization. Images were taken using a confocal laser scanning microscope

(Leica TCS SP5) 12 h post transfection. GFP, mRFP and DAPI were excited by 488nm

argon, 594nm HeNe and 405 diode laser, respectively. The emission was captured with a

490-550nm, 610-710nm and 430-460nm filter, respectively. The overlay image was

produced using Fiji (ver2.0.0, 48).

Arabidopsis hypocotyl elongation assay. The Arabidopsis rice cDNA fox line K02821

(49, Col-0 background) was crossed to htl-2 (Ler background, provided by Min Ni,

University of Minnesota, USA (24). Two F3 populations homozygous for the htl-2

mutation and the Fox-insertion were used for hypocotyl elongation assays. For these,

sterilized A. thaliana seeds were sown on solid 0.5MS medium and stratified for 3d at 4°

C in the dark. Subsequently, seedlings were vertically grown for 5d at 22° C with 16h-

light / 8h-dark cycles. Plates were scanned and hypocotyl lengths were measured using

ImageJ (http://imagej.nih.gov/ij/).

Rice mesocotyl elongation assay. Seeds from Nihonmasari wild type, hebibaAOC,

hebibaAOC,D14L line C4, Shiokari wild type, d14-1 and d3-1 plants were surfaced sterilised

in 0.3% sodium hypochlorite and sown on 0.9% bactoagar plates without supplement

(mock) or supplemented with either 1M karrikin 2 (Toronto Research Chemicals,

Toronto, Canada) diluted from a 10mM stock in 50% methanol or with 10M GR24

(Leadgen Labs, USA) diluted from a 10 mM stock in acetone. Plates were incubated in

the dark at 30 C. After 7 days of incubation digital photographs were taken of seedlings

using a Leica M165 FC stereoscope connected to a Leica DFC310FX camera. Mesocotyl

length was measured using ImageJ (http://imagej.nih.gov/ij/).

References

32. S. Ishikawa et al., Plant Cell Physiol. 46, 79 (2005).

33. G. Bécard, J. A. Fortin, New Phytol. 108, 211 (1988).

34. M. Riemann et al., Plant Physiol. 133, 1820 (2003).

35. R, Core, Team, in R Foundation for Statistical Computing. (http://www.R-

project.org/, Vienna, Austria, 2015).

36. C. Trapnell et al., Nat. Protocols 7, 562 (2012).

37. B. Langmead, S. Salzberg, Nat. Methods 9, 357 (2012).

38. A. Roberts, L. Pachter, Nat. Methods 10, 71 (2013).

39. R. Gentleman et al., Genome Biol. 5, R80 (2004).

40. T. J. Hardcastle, K. A. Kelly, BMC Bioinformatics 11, 422 (2010).

41. S. Falcon, R. Gentleman, Bioinformatics 23, 257 (2007).

42. J. Swinton, http://R-Forge.R-project.org/projects/vennerable, (2013).

43. R. Gaujoux, C. Seoighe, BMC Bioinformatics 11, 367 (2010).

44. S.-Y. Yang et al., Plant Cell 24, 4236 (2012).

45. S. Chen, P. Songkumarn, J. Liu, G.-L. Wang, Plant Physiol. 150, 1111 (2009).

46. M. Karimi, D. Inzé, A. Depicker, Trends Plant Sci. 7, 193.

47. Y. Zhang et al., Plant Methods 7, 30 (2011).

48. J. Schindelin et al., Nat. Methods 9, 10.1038/nmeth.2019 (2012).

49. T. Sakurai et al., Plant Cell Physiol. 52, 265 (2011).

Fig. S1. Pharmacological and genetic complementation of JA deficiency of hebiba

and effect on AM colonization.

(A) Roots of hebiba and wild type stained with trypan blue to visualize AM fungal

structures six wpi with Rhizophagus irregularis. A total of 48 plants were grown in two

experiments, 12 for each genotype and treatment combination. Plants were watered once

a week with jasmonate solution or with solvent control starting at two wpi. Plants were

harvested 24h after the last jasmonate treatment. A representative image is displayed for

each genotype and treatment, grown in two independent experiments. Labels refer to A,

arbuscules; EH, extraradical hypha; V, vesicle; size bar = 100 µm. (B) Marker gene

expression analysis by RT-PCR. Transcript levels of Allene Oxide Synthase 1 (AOS1) and

PT11 served to monitor jasmonate perception and arbuscule colonization, respectively.

Cyclophilin2 was used to normalize for quantities of template. (C) Roots of hebiba,

transgenically complemented with a genomic fragment containing AOC driven by the

AOC promoter (hebibaAOC), and wild type stained with trypan blue to visualize fungal

structures six wpi with Rhizophagus irregularis. Images are representative of ten T2

hebibaAOC plants and three wild type plants. Labels refer to JA, jasmonate; A, arbuscule;

EH, extraradical hypha; V, vesicle; scale bar = 100 µm.

Fig. S2. Arbuscular mycorrhizal phenotype of transgenic D14L suppression lines.

(A) Trypan blue stained roots at six wpi with Rhizophagus irregularis: micrographs refer

to wild type cultivar Nipponbare, and D14L silenced transgenic plants as indicated. A,

arbuscule; V, vesicle. Size bar = 50 µm. (B) Root length colonization (RLC) expressed as

% of WT colonization at six wpi for independent RNAi lines silenced for D14L. Values

represent means and standard errors from 3-6 replicate plants. Due to non-normality, a

model contrasting the RNAi lines with the wild type was fitted to the ranks and compared

with the null model using a likelihood ratio (LR) test. The same procedure was performed

for each RNAi line separately. The overall difference between groups was statistically

significant (LR test, p = 0.018). Symbols indicate statistically significant differences with

respect to the wild-type (LR test, † p < 0.10; * p < 0.05; ** p < 0.001). (C) D14L

transcript levels were assessed by real time RT-PCR in two biological replicates of each

RNAi line. The averages were plotted against the corresponding average total root length

colonization (RLC). The Spearman rank correlation was calculated and squared to give

the proportion of the variation accounted for by the correlation.

Fig. S3. Role of rice D14L for Arabidopsis hypo- and rice mesocotyl elongation.

(A) Hypocotyl elongation of Arabidopsis htl-2, htl-2 transgenic for p35S:OsD14L

(K02821 #18 and #23) and control genotypes as indicated. (B) Effect of mutation in

D14L (cv. Nihonmasari, upper graph) or D3 and D14 (cv. Shiokari, lower graph) on rice

mesocotyl elongation in the dark in response to karrikin 2 and GR24 treatment. For the

box-whisker plots open circles indicate data points outside the 1.5 interquartile range

(IQR). The bold black line represents the median; the box, the IQR and the whiskers the

lowest or highest data point within 1.5 IQR of the lower or upper quartile. The letters

above each box plot indicate groups that were not significantly different in post hoc

pairwise comparisons (p <0.05) following a Kruskal-Wallis test of the overall difference

between groups (p <0.001). The agricolae package in R version 3.1.2 (32) was used. The

group sizes were 48-60 for (A) 9-18 for the upper panel and 6-12 for the lower panel of

(B).

Fig. S4. Defense gene expression analysis and hebibaAOC root infection with

Piriformospora indica and Magnaporthe oryzae.

(A and B) Activation of defense marker genes was monitored by real-time RT-PCR at

two weeks post inoculation (wpi) with the AM fungus Rhizophagus irregularis (R.i.).

Expression of the marker genes Pr10a (A) and Pr10b (B) genes was monitored as

indicated. For each treatment and genotype results are shown separately for two

independent biological replicates (designated exp. 1 and 2). Expression values were

normalized to the expression values of the constitutively expressed gene Cyclophilin2

(LOC_Os02g02890). Error bars represent standard errors of three technical replicates.

Abbreviations refer to WT: wild-type; AM: inoculated with R. irregularis. (C and D)

Colonization of hebibaAOC and wild type roots by Piriformospora indica (C) at five wpi

as evidenced by trypan blue staining. Laser scanning confocal microscopy images of

colonization of hebibaAOC and wild type roots by Magnaporthe oryzae (D) expressing

GFP at five days post inoculation (dpi). Cell walls are counter-stained with propidium

iodide displayed in red. All scale bars indicate 50µM.

Figure S5

Fig. S5. Validation of gene expression changes.

Quantitative RT-PCR based transcript levels of three representative genes

LOC_Os12g36910, LOC_Os08g40690 and LOC_Os06g01590 selected by their

differential expression pattern in RNASeq analyses. (A) Relative gene expression mean

values for the five time points post treatment with germinated spore exudates (GSE) of

wild type and hebibaAOC (hbAOC) as determined by RNAseq and qRT-PCR, respectively.

The asterisks in the heatmap indicate significant differences between mock and GSE

treatments (Kruskal-Wallis test p<0.01). (B) Fold change in gene expression of the three

representative genes in response to 3h GSE treatment of roots of wild-type (WT),

hebibaAOC (hbAOC) and the D14L complementation lines (hbAOC,D14L) in two independent

biological replicates. Error bars indicate the standard deviation for three technical

replicates.

Fig. S6. AM colonization in rice in response to exogenous application of karrikin 2.

Quantitative colonization of wild type and hebibaAOC roots by R. irregularis at seven

weeks post inoculation (wpi) after treatment with solvent control, 0.1 µM and 1 µM

karrikin 2. Using analysis of variance, the colonization level is significantly different

between the wildtype and hebibaAOC for all fungal structures. A p-value threshold of

0.001 was used to allow for multiple testing.

Table S1: Genes used for genetic complementation of hebibaAOC

Four genes were selected for reintroduction into the hebibaAOC background. Gene models

were retrieved from both available Rice Annotation projects, LOC_Os03g32490,

LOC_Os03g32302 and LOC_Os03g32270 from the MSU Rice Genome Annotation

Project Release 7 (http://rice.plantbiology.msu.edu/) and Os03g0438200 from RAP-DB

(http://rapdb.dna.affrc.go.jp/). The wild-type AM colonization phenotype was restored in

independent transformants expressing the D14L gene (Fig.2A-C).

Gene ID Annotation Background Phenotype

LOC_Os03g32490 Unknown DUF 1230 hebibaAOC hebibaAOC-like

Os03g0438200 hypothetical protein hebibaAOC hebibaAOC-like

LOC_Os03g32302 hypothetical protein hebibaAOC hebibaAOC-like

LOC_Os03g32270 D14L hebibaAOC WT-like

Table S2: RNASeq experimental design

WT WT WT WT WT WT

hebibaAOC

hebibaAOC

hebibaAOC

hebibaAOC

hebibaAOC

hebibaAOC

WT WT WT WT WT

hebibaAOC

hebibaAOC

hebibaAOC

hebibaAOC

hebibaAOC

KAR2 - WT WT WT WT WT

Tre

atm

en

t Mock

GSE -

6hpt 24 hpt0 hpt 3 hpt 9 hpt 12 hpt

Time point

Table S3: RNAseq summary of libraries generated and alignment rates

Total Reads Align

concordantly Align Discordantly Align as singles Overall Alignment

Rate

WT.M.00 14,352,621 11,073,295 239,068 1,041,433 82.45%

WT.M.03 12,257,808 9,338,955 325,064 1,173,707 83.63%

WT.M.06 18,070,135 12,873,180 749,930 2,206,967 81.50%

WT.M.09 40,997,113 31,567,467 901,898 3,861,003 83.91%

WT.M.12 30,617,092 23,860,345 826,152 2,969,695 85.48%

WT.M.24 7,293,636 5,236,164 116,680 502,634 76.84%

hbAOC.M.00 6,405,188 4,132,467 126,149 483,693 70.26%

hbAOC.M.03 10,306,888 6,545,899 312,548 953,408 71.17%

hbAOC.M.06 11,503,420 6,982,385 829,967 2,176,546 77.37%

hbAOC.M.09 12,509,575 9,824,289 160,545 849,262 83.21%

hbAOC.M.12 22,259,783 16,906,659 533,870 2,428,196 83.80%

hbAOC.M.24 10,187,563 7,749,794 117,560 1,039,337 82.33%

WT.G.03 7,677,782 5,844,841 188,545 748,855 83.46%

WT.G.06 10,002,734 7,869,797 278,326 934,128 86.13%

WT.G.09 16,952,807 13,123,115 379,168 1,238,560 83.30%

WT.G.12 19,809,183 14,518,086 701,734 2,371,435 82.82%

WT.G.24 12,164,336 9,458,468 200,811 904,023 83.12%

hbAOC.G.03 8,048,085 4,954,097 237,795 689,218 68.79%

hbAOC.G.06 4,632,326 3,542,667 96,096 308,779 81.88%

hbAOC.G.09 9,146,540 6,951,446 316,655 860,634 84.17%

hbAOC.G.12 32,954,076 25,296,127 576,874 2,833,834 82.81%

hbAOC.G.24 8,248,922 6,063,517 237,921 803,528 81.26%

WT.K.03 7,119,416 5,562,511 199,000 722,513 86.00%

WT.K.06 48,710,223 32,301,119 1,573,077 4,540,540 74.20%

WT.K.09 8,988,578 5,996,486 261,820 772,561 73.92%

WT.K.12 15,476,129 11,888,053 459,139 1,888,618 85.88%

WT.K.24 15,746,638 11,728,413 539,212 1,588,880 82.95%

Table S4: Summary for genes with an FDR <0.05 in at least one comparison.

Displayed as separate excel spread sheet.

Table S5: Summary of differentially expressed genes

Comparison Total DE Up

regulated*

Down

regulated*

*

WT Mock v hebibaAOC Mock 104 82 22

WT Mock v WT+GSE 140 126 14

hebibaAOC Mock v hebibaAOC +GSE 6 3 3

WT Mock v WT+karrikin 0 0 0

* Second group has higher expression than the first

** Second group has lower expression than the first

Table S6: Gene lists for each significant GO category for genes with a significant

change in expression at 3 hours post treatment (a) and 6 hours post treatment (b)

and for genes differentially expressed between mocked treated wild type and

hebibaAOC (c). Displayed as separate excel spread sheet.

Table S7. Primer sequences

Gene Purpose Forward Reverse

D14L Cloning of

RNAi plasmid

pCG75

CACCCCGGTTGTGGTGTCTGAGT

A

GTCGGGTGATTCAGTGGAGT

Os03g32470 Cloning of

RNAi plasmid

pCG76

CACCGGACACGATTTCTGGAGAG

C

ACACATGCAAACATGCACCT

D14L Cloning of

complementat

ion plasmid

pCG87

GGTACTAGGGTTCGGCCCTACAA

C

CGGAAAATATGGAAACTACCG

Os03g32490 Cloning of

complementat

ion plasmid

pCG50

AGATCTATATACACACCGGGCCA

CCG

AGATCTGCAAATGTTGCGTCGAT

CAAGC

Hpt Genotyping of

d14l RNAi

lines

GTTTATCGGCACTTTGCATCGGC

CG

GATTTGTGTACGCCCGACAGTCC

D14L Genotyping of

hebibaAOC

complemente

d with pCG87

CGAACCTGGACATCTCAACA CCGGCTTTACGGTGTATTTG

heb Genotyping of

the hebiba

deletion

CCTCATGCCACATAGAAGGATC GGCGGGGTTAAATCTAGAGG

AOC RT-PCR CAGCTTCTACTTCGGCGACT TTGAAGGGGAAGACGATCTG

AOS1 RT-PCR GGAAGGGGAGATGCTGTTC GGAGTCGTATCGGAGGAAGA

D14L RT-PCR GAAGCCATGGGGTCAAACTA GCGGCTAAACTCCTGAACTG

Os06g01590 RT-PCR GCCAACCCGTTTATATATGCCC AAGCTTCGATCGACCGACATA

Os08g40690 RT-PCR ACGGAGGAGTGATGCTTTGG CTGATGATGGAGGCACACGT

Os12g36910 RT-PCR CTCAACGCACAACAGCTTCA GAGACTCAAAACAGTACTTGACC

Os02g14190 RT-PCR AGACGCATGTGTACACCGAG ACACTTGTGCATCTCGACCT

Os07g26100 RT-PCR TCCTCCTTTGTTGAGCTCCA CCAAACTCCGGCCAACCTTA

Os09g09210 RT-PCR ATCCCCTAACTCTGTCCTTGC ACCCATAATCTCCACAATCGTT

Full Reference List 1. S. Smith, D. Read, Mycorrhizal Symbiosis (Academic Press, London, ed. 3, 2008).

2. C. Gutjahr, M. Parniske, Cell and developmental biology of arbuscular mycorrhiza symbiosis. Annu. Rev. Cell Dev. Biol. 29, 593–617 (2013). Medline doi:10.1146/annurev-cellbio-101512-122413

3. K. Akiyama, K. Matsuzaki, H. Hayashi, Plant sesquiterpenes induce hyphal branching in arbuscular mycorrhizal fungi. Nature 435, 824–827 (2005). Medline doi:10.1038/nature03608

4. F. Maillet, V. Poinsot, O. André, V. Puech-Pagès, A. Haouy, M. Gueunier, L. Cromer, D. Giraudet, D. Formey, A. Niebel, E. A. Martinez, H. Driguez, G. Bécard, J. Dénarié, Fungal lipochitooligosaccharide symbiotic signals in arbuscular mycorrhiza. Nature 469, 58–63 (2011). Medline doi:10.1038/nature09622

5. A. Genre, M. Chabaud, C. Balzergue, V. Puech-Pagès, M. Novero, T. Rey, J. Fournier, S. Rochange, G. Bécard, P. Bonfante, D. G. Barker, Short-chain chitin oligomers from arbuscular mycorrhizal fungi trigger nuclear Ca2+ spiking in Medicago truncatula roots and their production is enhanced by strigolactone. New Phytol. 198, 190–202 (2013). Medline doi:10.1111/nph.12146

6. C. Gough, J. Cullimore, Lipo-chitooligosaccharide signaling in endosymbiotic plant-microbe interactions. Mol. Plant Microbe Interact. 24, 867–878 (2011). Medline doi:10.1094/MPMI-01-11-0019

7. G. E. Oldroyd, Speak, friend, and enter: Signalling systems that promote beneficial symbiotic associations in plants. Nat. Rev. Microbiol. 11, 252–263 (2013). Medline doi:10.1038/nrmicro2990

8. X. Zhang, W. Dong, J. Sun, F. Feng, Y. Deng, Z. He, G. E. Oldroyd, E. Wang, The receptor kinase CERK1 has dual functions in symbiosis and immunity signalling. Plant J. 81, 258–267 (2015). Medline doi:10.1111/tpj.12723

9. K. Miyata, T. Kozaki, Y. Kouzai, K. Ozawa, K. Ishii, E. Asamizu, Y. Okabe, Y. Umehara, A. Miyamoto, Y. Kobae, K. Akiyama, H. Kaku, Y. Nishizawa, N. Shibuya, T. Nakagawa, The bifunctional plant receptor, OsCERK1, regulates both chitin-triggered immunity and arbuscular mycorrhizal symbiosis in rice. Plant Cell Physiol. 55, 1864–1872 (2014). Medline doi:10.1093/pcp/pcu129

10. C. Gutjahr, M. Banba, V. Croset, K. An, A. Miyao, G. An, H. Hirochika, H. Imaizumi-Anraku, U. Paszkowski, Arbuscular mycorrhiza-specific signaling in rice transcends the common symbiosis signaling pathway. Plant Cell 20, 2989–3005 (2008). Medline doi:10.1105/tpc.108.062414

11. C. Camps, M. F. Jardinaud, D. Rengel, S. Carrère, C. Hervé, F. Debellé, P. Gamas, S. Bensmihen, C. Gough, Combined genetic and transcriptomic analysis reveals three major signalling pathways activated by Myc-LCOs in Medicago truncatula. New Phytol. 208, 224–240 (2015). Medline doi:10.1111/nph.13427

12. M. Nadal, U. Paszkowski, Polyphony in the rhizosphere: Presymbiotic communication in arbuscular mycorrhizal symbiosis. Curr. Opin. Plant Biol. 16, 473–479 (2013). Medline doi:10.1016/j.pbi.2013.06.005

13. M. T. Waters, D. C. Nelson, A. Scaffidi, G. R. Flematti, Y. K. Sun, K. W. Dixon, S. M. Smith, Specialisation within the DWARF14 protein family confers distinct responses to karrikins and strigolactones in Arabidopsis. Development 139, 1285–1295 (2012). Medline doi:10.1242/dev.074567

14. Y. Guo, Z. Zheng, J. J. La Clair, J. Chory, J. P. Noel, Smoke-derived karrikin perception by the α/β-hydrolase KAI2 from Arabidopsis. Proc. Natl. Acad. Sci. U.S.A. 110, 8284–8289 (2013). Medline doi:10.1073/pnas.1306265110

15. S. Toh, D. Holbrook-Smith, M. E. Stokes, Y. Tsuchiya, P. McCourt, Detection of parasitic plant suicide germination compounds using a high-throughput Arabidopsis HTL/KAI2 strigolactone perception system. Chem. Biol. 21, 988 (2014). Medline doi:10.1016/j.chembiol.2014.07.005

16. G. R. Flematti, E. L. Ghisalberti, K. W. Dixon, R. D. Trengove, A compound from smoke that promotes seed germination. Science 305, 977 (2004). Medline doi:10.1126/science.1099944

17. M. Riemann, K. Haga, T. Shimizu, K. Okada, S. Ando, S. Mochizuki, Y. Nishizawa, U. Yamanouchi, P. Nick, M. Yano, E. Minami, M. Takano, H. Yamane, M. Iino, Identification of rice Allene Oxide Cyclase mutants and the function of jasmonate for defence against Magnaporthe oryzae. Plant J. 74, 226–238 (2013). Medline doi:10.1111/tpj.12115

18. K. J. V. Nordström, M. C. Albani, G. V. James, C. Gutjahr, B. Hartwig, F. Turck, U. Paszkowski, G. Coupland, K. Schneeberger, Mutation identification by direct comparison of whole-genome sequencing data from mutant and wild-type individuals using k-mers. Nat. Biotechnol. 31, 325–330 (2013). Medline doi:10.1038/nbt.2515

19. C. Gutjahr, H. Siegler, K. Haga, M. Iino, U. Paszkowski, Full establishment of arbuscular mycorrhizal symbiosis in rice occurs independently of enzymatic jasmonate biosynthesis. PLOS ONE 10, e0123422 (2015). Medline doi:10.1371/journal.pone.0123422

20. T. Arite, M. Umehara, S. Ishikawa, A. Hanada, M. Maekawa, S. Yamaguchi, J. Kyozuka, d14, a strigolactone-insensitive mutant of rice, shows an accelerated outgrowth of tillers. Plant Cell Physiol. 50, 1416–1424 (2009). Medline doi:10.1093/pcp/pcp091

21. C. Hamiaux, R. S. Drummond, B. J. Janssen, S. E. Ledger, J. M. Cooney, R. D. Newcomb, K. C. Snowden, DAD2 is an α/β hydrolase likely to be involved in the perception of the plant branching hormone, strigolactone. Curr. Biol. 22, 2032–2036 (2012). Medline doi:10.1016/j.cub.2012.08.007

22. L.-H. Zhao et al., Cell Res. (2015). 10.1038/cr.2015.122

23. S. Yoshida, H. Kameoka, M. Tempo, K. Akiyama, M. Umehara, S. Yamaguchi, H. Hayashi, J. Kyozuka, K. Shirasu, The D3 F-box protein is a key component in host strigolactone responses essential for arbuscular mycorrhizal symbiosis. New Phytol. 196, 1208–1216 (2012). Medline doi:10.1111/j.1469-8137.2012.04339.x

24. X.-D. Sun, M. Ni, HYPOSENSITIVE TO LIGHT, an alpha/beta fold protein, acts downstream of ELONGATED HYPOCOTYL 5 to regulate seedling de-etiolation. Mol. Plant 4, 116–126 (2011). Medline doi:10.1093/mp/ssq055

25. A. Scaffidi, M. T. Waters, Y. K. Sun, B. W. Skelton, K. W. Dixon, E. L. Ghisalberti, G. R. Flematti, S. M. Smith, Strigolactone hormones and their stereoisomers signal through two

related receptor proteins to induce different physiological responses in Arabidopsis. Plant Physiol. 165, 1221–1232 (2014). Medline doi:10.1104/pp.114.240036

26. Z. Hu, H. Yan, J. Yang, S. Yamaguchi, M. Maekawa, I. Takamure, N. Tsutsumi, J. Kyozuka, M. Nakazono, Strigolactones negatively regulate mesocotyl elongation in rice during germination and growth in darkness. Plant Cell Physiol. 51, 1136–1142 (2010). Medline doi:10.1093/pcp/pcq075

27. S. Marcel, R. Sawers, E. Oakeley, H. Angliker, U. Paszkowski, Tissue-adapted invasion strategies of the rice blast fungus Magnaporthe oryzae. Plant Cell 22, 3177–3187 (2010). Medline doi:10.1105/tpc.110.078048

28. M. Chabaud, A. Genre, B. J. Sieberer, A. Faccio, J. Fournier, M. Novero, D. G. Barker, P. Bonfante, Arbuscular mycorrhizal hyphopodia and germinated spore exudates trigger Ca2+ spiking in the legume and nonlegume root epidermis. New Phytol. 189, 347–355 (2011). Medline doi:10.1111/j.1469-8137.2010.03464.x

29. M. T. Waters, A. Scaffidi, Y. K. Sun, G. R. Flematti, S. M. Smith, The karrikin response system of Arabidopsis. Plant J. 79, 623–631 (2014). Medline doi:10.1111/tpj.12430

30. S. D. S. Chiwocha, K. W. Dixon, G. R. Flematti, E. L. Ghisalberti, D. J. Merritt, D. C. Nelson, J.-A. M. Riseborough, S. M. Smith, J. C. Stevens, Karrikins: A new family of plant growth regulators in smoke. Plant Sci. 177, 252–256 (2009). doi:10.1016/j.plantsci.2009.06.007

31. P.-M. Delaux, X. Xie, R. E. Timme, V. Puech-Pages, C. Dunand, E. Lecompte, C. F. Delwiche, K. Yoneyama, G. Bécard, N. Séjalon-Delmas, Origin of strigolactones in the green lineage. New Phytol. 195, 857–871 (2012). Medline doi:10.1111/j.1469-8137.2012.04209.x

32. S. Ishikawa, M. Maekawa, T. Arite, K. Onishi, I. Takamure, J. Kyozuka, Suppression of tiller bud activity in tillering dwarf mutants of rice. Plant Cell Physiol. 46, 79–86 (2005). Medline doi:10.1093/pcp/pci022

33. G. Bécard, J. A. Fortin, Early events of vesicular-arbuscular mycorrhiza formation on Ri T-DNA transformed roots. New Phytol. 108, 211–218 (1988). doi:10.1111/j.1469-8137.1988.tb03698.x

34. M. Riemann, A. Muller, A. Korte, M. Furuya, E. W. Weiler, P. Nick, Impaired induction of the jasmonate pathway in the rice mutant hebiba. Plant Physiol. 133, 1820–1830 (2003). Medline doi:10.1104/pp.103.027490

35. R Core Team, in R Foundation for Statistical Computing (Vienna, Austria, 2015), http://www.R-project.org/.

36. C. Trapnell, A. Roberts, L. Goff, G. Pertea, D. Kim, D. R. Kelley, H. Pimentel, S. L. Salzberg, J. L. Rinn, L. Pachter, Differential gene and transcript expression analysis of RNA-seq experiments with TopHat and Cufflinks. Nat. Protoc. 7, 562–578 (2012). Medline doi:10.1038/nprot.2012.016

37. B. Langmead, S. L. Salzberg, Fast gapped-read alignment with Bowtie 2. Nat. Methods 9, 357–359 (2012). Medline doi:10.1038/nmeth.1923

38. A. Roberts, L. Pachter, Streaming fragment assignment for real-time analysis of sequencing experiments. Nat. Methods 10, 71–73 (2013). Medline doi:10.1038/nmeth.2251

39. R. C. Gentleman, V. J. Carey, D. M. Bates, B. Bolstad, M. Dettling, S. Dudoit, B. Ellis, L. Gautier, Y. Ge, J. Gentry, K. Hornik, T. Hothorn, W. Huber, S. Iacus, R. Irizarry, F. Leisch, C. Li, M. Maechler, A. J. Rossini, G. Sawitzki, C. Smith, G. Smyth, L. Tierney, J. Y. Yang, J. Zhang, Bioconductor: Open software development for computational biology and bioinformatics. Genome Biol. 5, R80 (2004). Medline doi:10.1186/gb-2004-5-10-r80

40. T. J. Hardcastle, K. A. Kelly, baySeq: Empirical Bayesian methods for identifying differential expression in sequence count data. BMC Bioinformatics 11, 422 (2010). Medline doi:10.1186/1471-2105-11-422

41. S. Falcon, R. Gentleman, Using GOstats to test gene lists for GO term association. Bioinformatics 23, 257–258 (2007). Medline doi:10.1093/bioinformatics/btl567

42. J. Swinton, http://R-Forge.R-project.org/projects/vennerable (2013).

43. R. Gaujoux, C. Seoighe, A flexible R package for nonnegative matrix factorization. BMC Bioinformatics 11, 367 (2010). Medline doi:10.1186/1471-2105-11-367

44. S.-Y. Yang, M. Grønlund, I. Jakobsen, M. S. Grotemeyer, D. Rentsch, A. Miyao, H. Hirochika, C. S. Kumar, V. Sundaresan, N. Salamin, S. Catausan, N. Mattes, S. Heuer, U. Paszkowski, Nonredundant regulation of rice arbuscular mycorrhizal symbiosis by two members of the phosphate transporter1 gene family. Plant Cell 24, 4236–4251 (2012). Medline doi:10.1105/tpc.112.104901

45. S. Chen, P. Songkumarn, J. Liu, G.-L. Wang, A versatile zero background T-vector system for gene cloning and functional genomics. Plant Physiol. 150, 1111–1121 (2009). Medline doi:10.1104/pp.109.137125

46. M. Karimi, D. Inzé, A. Depicker, GATEWAY vectors for Agrobacterium-mediated plant transformation. Trends Plant Sci. 7, 193–195 (2002). Medline doi:10.1016/S1360-1385(02)02251-3

47. Y. Zhang, J. Su, S. Duan, Y. Ao, J. Dai, J. Liu, P. Wang, Y. Li, B. Liu, D. Feng, J. Wang, H. Wang, A highly efficient rice green tissue protoplast system for transient gene expression and studying light/chloroplast-related processes. Plant Methods 7, 30 (2011). Medline doi:10.1186/1746-4811-7-30

48. J. Schindelin, I. Arganda-Carreras, E. Frise, V. Kaynig, M. Longair, T. Pietzsch, S. Preibisch, C. Rueden, S. Saalfeld, B. Schmid, J.-Y. Tinevez, D. J. White, V. Hartenstein, K. Eliceiri, P. Tomancak, A. Cardona, Fiji: An open-source platform for biological-image analysis. Nat. Methods 9, 676–682 (2012). 10.1038/nmeth.2019 doi:10.1038/nmeth.2019

49. T. Sakurai, Y. Kondou, K. Akiyama, A. Kurotani, M. Higuchi, T. Ichikawa, H. Kuroda, M. Kusano, M. Mori, T. Saitou, H. Sakakibara, S. Sugano, M. Suzuki, H. Takahashi, S. Takahashi, H. Takatsuji, N. Yokotani, T. Yoshizumi, K. Saito, K. Shinozaki, K. Oda, H. Hirochika, M. Matsui, RiceFOX: A database of Arabidopsis mutant lines overexpressing rice full-length cDNA that contains a wide range of trait information to facilitate analysis of gene function. Plant Cell Physiol. 52, 265–273 (2011). Medline doi:10.1093/pcp/pcq190