www.sciencetranslationalmedicine.org/cgi/content/full/7/283/283ra51/DC1

Supplementary Materials for

PI3K inhibition results in enhanced estrogen receptor function and dependence in hormone receptor–positive breast cancer

Ana Bosch, Zhiqiang Li, Anna Bergamaschi, Haley Ellis, Eneda Toska, Aleix Prat,

Jessica J. Tao, Daniel E. Spratt, Nerissa T. Viola-Villegas, Pau Castel, Gerard Minuesa, Natasha Morse, Jordi Rodón, Yasir Ibrahim, Javier Cortes, Jose Perez-Garcia,

Patricia Galvan, Judit Grueso, Marta Guzman, John A. Katzenellenbogen, Michael Kharas, Jason S. Lewis, Maura Dickler, Violeta Serra, Neal Rosen,

Sarat Chandarlapaty,* Maurizio Scaltriti,* José Baselga*

*Corresponding author. E-mail: chandars@mskcc.org (S.C.); scaltrim@mskcc.org (M.S.); baselgaj@mskcc.org (J.B.)

Published 15 April 2015, Sci. Transl. Med. 7, 283ra51 (2015)

DOI: 10.1126/scitranslmed.aaa4442

This PDF file includes:

Materials and Methods Fig. S1. Western blot of MCF7 and T47D cells treated in vitro with BYL719 for a series of time points. Fig. S2. T47D transcriptional profile upon p110α inhibition. Fig. S3. GSEA for T47D microarray expression data set. Fig. S4. Western blot of CAMA1 cells treated with BYL719 or MK2206 for 48 hours. Fig. S5. CAMA1 transcriptional profile after AKT inhibition. Fig. S6. ER target genes induced by AKT inhibition in ER-positive/PTENmut/null breast cancer cells. Fig. S7. ESR1 expression induced by PI3Kα inhibition in ER-positive/PIK3CAmut breast cancer cells. Fig. S8. ESR1 transcription increased by PI3Kα inhibition. Fig. S9. Induction of ESR1 and its target genes by different PI3K inhibitors. Fig. S10. Comparison of induction of ESR1 and its target genes between BYL719 and the mTORC1 allosteric inhibitor rapamycin. Fig. S11. Decreased expression of ER target genes after anti-ER therapy, with no effect on ESR1 mRNA. Fig. S12. Up-regulation of ER target genes reversed by combining BYL719 with anti-ER treatment.

Fig. S13. Better tumor control in vivo after combining BYL719 with fulvestrant. Fig. S14. Analysis of the effect of PI3Kα inhibition alone or with anti-ER therapy on the cell cycle. Table S1. GSEA to assess ER-dependent signatures enriched in MCF7 cells treated with BYL719. Table S2. GSEA to assess ER-dependent signatures enriched in CAMA1 cells treated with MK2206. Table S3. Clinical and pathologic features corresponding to paired pretreatment and BYL719-treated tumor samples. References (43–45)

Other Supplementary Material for this manuscript includes the following: (available at www.sciencetranslationalmedicine.org/cgi/content/full/7/283/283ra51/DC1)

Table S4. Raw data (provided as an Excel file).

Supplementary Materials and Methods

Cell lines and chemical compounds

MCF7, MDA-MB-361, EFM-19, T47D, BT474, CAMA1, MDA-MB-415, and ZR-75-1 breast cancer cells were purchased from ATCC. MCF7

and CAMA1 were maintained in Dulbecco's Modified Eagle's Medium (DMEM):Ham's F-12 1:1, and the remaining cell lines in RPMI 1640.

Both media were supplemented with 10% fetal calf serum (FCS), 2 mmol/L l-glutamine, 20 units/ml penicillin, and 20 µg/ml streptomycin.

For experiments in Figures 3 A-C, MCF7 cells were pre-incubated for 48 hours in steroid hormone-depleted medium supplemented with

10% charcoal-stripped serum (CSS).

All the cell lines were incubated at 37°C in a humidified atmosphere and 5% CO2. BYL719, MK2206, GDC0032, GDC0941, and BKM120

were obtained from the Stand Up to Cancer (SU2C)/PI3K Dream Team mouse pharmacy. BAY 80-6946 was kindly provided by Bayer.

Fulvestrant was purchased from Selleck Chemicals, 4-hydroxytamoxifen (4-OHT) and 17β-estradiol (E2) were purchased from Sigma-

Aldrich. All compounds were dissolved in dimethyl sulfoxide (DMSO) for in vitro experiments, except BAY 80-6946, which was dissolved in

DMSO/5 mM trifluoroacetic acid, and 4-OHT, which was dissolved in ethanol. Control (Ctrl) samples were treated with the corresponding

solvent depending on the compound tested in vitro.

Western blotting

Cells were washed with ice-cold PBS and scraped into ice-cold RIPA lysis buffer (150 mM NaCl, 1% NP-40, 0.5% 0.5% Na-deoxycholate,

0.1%sodium dodecyl sulfate, 10 mM TrisHCl pH 8) supplemented with phosphatase and protease inhibitor cocktails (Complete Mini and

PhosphoStop, F. Hoffmann-La Roche Ltd). Lysates were cleared by centrifugation at 15,000 rpm for 15 minutes at 4°C, and supernatants

were removed and assayed for protein concentration using the Pierce BCA Protein Assay Kit (Thermo Scientific Inc.). Equal amounts of

protein from total lysate (20 μg) were denatured with Laemmli sample buffer, resolved on NuPAGE 4-12% Bis-Tris gels (Life

Technologies), and electrophoretically transferred to Immobilon-PVDF transfer membranes (Millipore). Membranes were blocked for 1

hour in 5% bovine serum albumin (BSA) in Tris-Buffered Saline (TBS)-Tween and then hybridized using the following primary antibodies in

5% BSA TBS-Tween: phospho-AKT (Ser473) and phospho-S6 (Ser235/6)(1:500-1:1000, Cell Signaling Technology), and ERα and PGR

(1:1000, Thermo Scientific Inc.). β-actin was used as a loading control (1:1000, Cell Signaling Technology), also in 5% BSA TBS-Tween.

Mouse and rabbit horseradish peroxidase (HRP)-conjugated secondary antibodies (1:50,000, Amersham Biosciences) were diluted in 5%

BSA in TBS-Tween. Protein–antibody complexes were detected by chemiluminescence with SuperSignal West FemtoChemiluminescent

Substrate (Thermo Scientific Inc.), and images were captured with a G-BOX camera system.

Quantification of fold changes in ERα expression with respect to βACTIN and with respect to vehicle-treated samples was done using the

ImageJ software.

Luciferase assays

MCF7 cells were seeded 24 hours before transfection in 12-well plates. Transfection was carried out with Lipofectamine 2000 (Invitrogen)

according to the manufacturer's instructions. To measure ER-dependent transcription, 0.6 μg 3XERE-TATA-Luc was transfected together

with 0.2 μg of pRL-TK Renilla Luciferase per well. Fresh medium containing vehicle (DMSO) or BYL719 (1 μM) was added 24 hours after

transfection, and cells were incubated for 12 hours. Finally, cells were harvested and assayed with the Promega dual luciferase kit

(Promega Corp.) following the instructions from the manufacturer.

FOXO3A knock-down experiments

MCF7 cells were seeded 24 hours before transfection in 6 cm plates. Non-target siRNA (ON-TARGETplus non-targeting pool, Cat#D-

001810-10) and FOXO3 siRNA (SMARTpool: ON-TARGETplus FOXO3A siRNA, Cat#L-003007-00) were purchased from Dharmacon

RNAi Technologies. Transfection was carried out with Lipofectamine RNAiMAX (Invitrogen) and 200 pmol of siRNA per plate. Cells were

treated with vehicle (DMSO) or BYL719 1 μM during a 24-hour period, 48 hours after transfection. Cell lysates were collected and total

RNA extracted as described below.

Imaging ER Response to PI3K treatment via PET

16α-18F-fluoro-17β-estradiol (18F-FES) was provided by the Radiochemistry and Molecular Imaging Probes Core Facility at MSKCC.

Mice treated with drug or placebo (n=3 for each group) were injected with 150 μCi of 18F-FES via the lateral tail vein. Whole body PET

images were acquired on mice anesthetized with 1.5-2.0% isoflurane (Baxter Healthcare) in oxygen 1 hour after injection (p.i.) using a

microPET Focus 120 PET scanner (Concorde Microsystems). Images were reconstructed via filter back projection and subsequently

analyzed with ASIPro VMTM software (Concorde Microsystems). Volumes of interest (VOI) were measured on various planar sections of

the acquired image by manually drawing on the tumor site. The average VOI was calculated and expressed as % injected dose per gram

of tumor tissue (%ID/g). Data values were expressed as the mean ± SD unless otherwise stated. Statistical analysis was performed with

GraphPad Prism version 6.02 software using a non-parametric Kruskal-Wallis test. A p value of

Immunohistochemistry (IHC)

For IHC on xenografts, dissected tissues were fixed immediately after removal in a 4% buffered formalin solution overnight at room

temperature before being dehydrated with 70% ethanol and paraffin-embedded. Samples were blocked with normal goat serum and

incubated with ER (SP1) (Ventana, 790-4324), pAKT (S473) (D9E) (Cell Signaling Technology, 4060), pS6 (240/4) (Cell Signaling

Technology, 5364), and pS6 (235/6) (Cell Signaling Technology 4857) antibodies on a Ventana Discovery XT processor platform.

mRNA expression analysis and chromatin immunoprecipitation (ChIP)

Total RNA was generated using the QIAGEN RNeasy kit. RNA (1 μg) was reverse-transcribed into cDNA at 25°C for 10 minutes and 37°C

for 2 hours using a high-capacity cDNA reverse transcription kit (Applied Biosystems). The cDNA products were amplified by qPCR using

two different methods: for Fig. 1E and 2A and fig. S6, S7, S9 and S11, we used the SYBR Select Master Mix (Applied Biosystems).

Specific primers for β-actin, ESR1, PGR, GREB-1, and IGFBP4 were purchased from Life Technologies. Primers were β-actin, forward, 5′-

CGTCTTCCCCTCCATCGT-3′, reverse, 5′-GAAGGTGTGGTGCCAGATTT-3′; ESR1, forward, 5′-TTACTGACCAACCTGGCAGA-3′,

reverse, 5′-ACCTGATCATGGAGGGTCAA-3′; PGR, forward, 5′-GGCATGGTCCTTGGAGGT-3′, reverse, 5′-CCACTGGCTGTGGGAGAG-

3′; GREB-1, forward, 5′-GTGGTAGCCGAGTGGACAAT-3′, reverse, 5′-ATTTGTTTCCAGCCCTCCTT-3′; IGFBP4, forward, 5′-

AACTTCCACCCCAAGCAGT-3′, reverse, 5′-GGTCCACACACCAGCACTT-3′.

For Fig. 2F, 3C and 3D, and figs. S10 and S12, qPCR reactions were performed with TaqMan PCR Master Mix (Applied Biosystems) using

the ViiA 7 Real-Time PCR system. All reactions were carried out in triplicate. Taqman primers were purchased from Applied Biosystems as

indicated: FOXO3A (Hs00921424_m1), ESR1 (Hs00174860_m1), β-actin (4352935E), PGR (Hs01556707_m1), GREB1

(Hs00206396_m1), IGFBP4 (Hs01057900_m1), and XBP1 (Hs00964359_m1).

All reactions were carried out in triplicate. Quantitative real-time PCR (qPCR) was run in the ViiA™ 7 Real-Time PCR System (Applied

Biosystems). Results were normalized according to β-actin quantification in the same sample reaction. The threshold cycle (Ct) was

determined, and then the relative gene expression was expressed as follows:

Relative amount= 2-Δ(ΔCt); where ΔCt=Ct (target)−Ct (β-actin), and Δ(ΔCt)=ΔCt (treated)−ΔCt (control).

mRNA microarray-gene expression procedure

For microarray-gene expression analysis, total RNA was extracted from MCF7, T47D, and CAMA1 cell lines using the QIAGEN RNeasy

kit. Total RNA from MCF7 xenografts and patient-derived xenografts was obtained using the same kit preceded by tissue homogenization

with TRIzol (Thermo Fisher Scientific Inc). Gene expression analysis was performed according to the Illumina-recommended protocol

using Illumina HumanHT-12 v4 revise 2 Expression BeadChip (Illumina, Inc.) containing probes for over 28000 well-annotated genes.

Hybridization was conducted by the gene expression analysis service at MSKCC. Briefly, Agilent Bioanalyzer nano chip was used to

check the RNA quality and integrity. cRNA amplification and labeling with biotin were performed using Illumina TotalPrep RNA

amplification kit (Ambion, Inc.), with 200 ng of total RNA as input material. cRNA yields were quantified with Agilent Bioanalyzer, and 750

ng of cRNAs were hybridized to the HumanHT-12 v4 Expression BeadChip. All reagents and equipment used for hybridization were

purchased from Illumina. The cRNA was hybridized to arrays for 16 h at 58°C, washed, and stained with streptavidin-Cy3 according to the

manufacturer's protocol. The bead chips were centrifuged to dry and scanned on the Illumina BeadArray Reader confocal scanner. The

data were analyzed with GenomeStudio using Illumina default analysis settings. Raw gene expression data for cell lines and xenografts

were deposited in Gene Expression Omnibus (GSE64033).

Cell cycle analysis

To study the effect of PI3K pathway inhibition on cell cycle distribution alone or in combination with fulvestrant, 5x105 cells were plated and

serum starved overnight followed by addition of fresh medium supplemented with 10% FCS and containing BYL719 (300 nM), fulvestrant

(50 nM), or the combination. Cells were incubated in drug for 24 hours before collection, fixation with 70% ethanol, treatment with 0.5

μg/μL RNAse for 1 hour, and staining with 0.01 μg/μL propidium iodide. Samples were analyzed in a BD Fortessa flow cytometer, running

the samples at low rate. DNA content was measured and cell cycle distribution calculated through the Dean/Jett/Fox method (after

eliminating debris, dead cells, and doublets) using FlowJo version 9.5.2.

Chromatin immunoprecipitation (ChIP) Analysis

Two ChIP methods were performed: for Fig. 1F, ChIP assays were performed as described before (43,44). Briefly, cells were crosslinked,

collected, and resuspended in lysis buffer with protease inhibitors. Lysates were sonicated on ice to yield 200-800 bp DNA fragments.

Chromatin was incubated overnight at 4°C with 2 μg of specific antibodies or nonspecific IgG. Immunoprecipitates were washed, and

crosslinks were reversed by heating to 65°C overnight and treated with proteinase K for 1 h at 55°C. Chromatin was purified using

QiaQuick PCR clean-up columns. ER-specific antibody used for these experiments was ER HC-20 (Santa Cruz Biotechnology).

ChIP primers used in this study were: PGR promoter forward 5’-AGGGAGGAGAAAGTGGGTGT-3’, reverse 5’-

GGAGAACTCCCCGAGTTAGG’-3; GREB1 promoter, forward 5’-GAAGGGCAGAGCTGATAACG-3’, reverse 5’-

GACCCAGTTGCCACACTTTT-3’; IGFBP4 promoter, forward 5’-CTTTCTTGCTGCAAAGTCCC-3’, reverse 5’-

ATGGCCTTCCATGCTACAAG-3’; βActin, forward 5’-AGACCTTCAACACCCCAGCC-3’, reverse 5’-GTCACGCACGATTTCCCGCT-3’.

For Fig. 2G, 3A and B, and fig. S8, ChIP assays were performed using the Pierce agarose ChIP kit according to the manufacturer’s

protocol. Briefly, after crosslinking, chromatin was broken down into 200-1000 bp fragments through MNase digestion and sonication,

followed by an overnight incubation at 4°C with 1 µg of specific antibodies and non-specific IgG. Immunoprecipitates were washed, and

crosslinks reversed by adding proteinase K and incubating overnight at 65°C. DNA was then recovered using Qiagen PCR purification kit.

The specific antibodies used were FOXO3A antibody (ab12162, Abcam), ERα antibody (HC-20, Santa Cruz Biotechnology), and RNA

polymerase II antibody (05-623, EMD Millipore). Primer sequences used for FOXO3A ChIP were: ESR1 promoter FOXO3A binding site 1,

forward: 5’- CAAGGCTCACCAAGATGAGTT -3’, reverse: 5’- AGCCCAAGAAGTTCAGTAAAGG -3’; binding site 4, forward: 5’-

CAGAGACCGGCCACTCCTG -3’, reverse: 5’- GACACCCAATGGAGGCTTTGT -3’. For ERα ChIP, the primers were: PGR promoter,

forward: 5’-GCCTGACCTGTTGCTTCAAT-3’, reverse: 5’-GCAGGACGACTTCTCAGACC-3’; GREB1 promoter ERE1, forward: 5’-

TCTGTGGAGTGCCTGAAGTG-3’, reverse: 5’-GCCAATGCTTTGCCATTATT-3’(20); GREB1promoter ERE2, forward: 5’-

AGCAGTGAAAAAAAGTGTGGCAACTGGG-3’, reverse: 5’-CGACCCACAGAAATGAAAAGGCAGCAAACT-3’; Primers sequences used

for RNA polymerase II ChIP were: ESR1 pol, forward: 5’-TTGTGCCTGGAGTGATGTTT-3’, reverse: 5’-GCATTACAAAGGTGCTGGAG-3’.

Figure S1. Western blot of MCF7 and T47D cells treated in vitro with BYL719 for a series of time points. MCF7 and T47D cells were

treated with vehicle (Ctrl) or BYL719 1 μM for 48 hours, and protein lysates were extracted at the specified time points and probed against

the indicated proteins.

Figure S2. T47D transcriptional profile upon p110α inhibition. T47D cells were treated with BYL719 1

μM over a period of 48 hours. RNA was isolated at the specified time points, and expression microarray

analysis performed. Heat map represents genes whose expression differed significantly across different

time points with a FDR ≤1%. Each of the columns under the experimental conditions represents one

biological replicate.

Figure S3. Gene set enrichment analysis for T47D microarray expression data set. GSEA

analysis was performed to determine which gene sets were enriched in the T47D data set at the

48 hour time point with a FDR ≤ 25%. Graph represents enrichment for ERα-associated signature

as described in (45).

Figure S4. Western blot of CAMA1 cells treated with

BYL719 or MK2206 for 48 hours. CAMA1 cells were treated

with BYL719 1 μM or MK2206 2 μM for 48 hours, and protein

lysates were extracted at the specified time points and probed

against the indicated proteins.

Figure S5. CAMA1 transcriptional profile after AKT inhibition. A) CAMA1

cells were treated with MK2206 2 μM over a period of 48 hours. RNA was

isolated at specified time points and expression microarray analysis performed.

Heat map represents genes whose expression differed significantly across

different time points with a FDR ≤ 1%. Each of the columns under the

experimental conditions represents one biological replicate. B) GSEA analysis

was performed to determine which gene sets were enriched in the CAMA1 data

set at the 24 hour time point with a FDR ≤ 25%. Graph represents enrichment for

ERα-associated signature as described in (42).

Figure S6. ER target genes induced by AKT inhibition in ER-positive/

PTENmut/null breast cancer cells. A panel of ER-positive PTENmut/null cell lines

was treated with either vehicle (Ctrl) or the allosteric pan-AKT inhibitor MK2206

(2 μM). mRNA was isolated, and qPCR was performed to detect expression of

βACTI N, PGR, and GREB1.The data are presented relative to βACTIN and to

expression levels in the vehicle-treated samples. Error bars denote the SEM of

two independent experiments each with three technical replicates.

Figure S7. ESR1 expression induced by PI3Kα inhibition in ER-positive/ PIK3CAmut breast

cancer cells. A panel of ER-positive/PIK3CAmut breast cancer cell lines was treated in vitro with

BYL719 1 μM for 24 hours. RNA was extracted and qPCR performed to detect βACTIN and

ESR1 expression. The data are presented relative to βACTIN and to expression levels of ESR1 in

vehicle-treated control (Ctrl). Two-tailed Student's unpaired t test was performed to compare Ctrl

versus BYL treated cells. Error bars denote the SEM of two independent experiments, each with

three technical replicates.

Figure S8. ESR1 transcription increased by PI3Kα inhibition. MCF7 cells were treated with vehicle or

BAY80-6946 50 nM (BAY) for 8 hours. ChIP was performed with anti-RNA polymerase II antibody or control

IgG. Primers to amplify the RNA polymerase II-binding regions of the ESR1 promoter region were used for

qPCR to determine fold enrichment relative to input. Two-tailed Student's unpaired t test was performed to

compare Ctrl vs. BAY-treated cells. Error bars represent the SEM of five independent experiments.

Figure S9. Induction of ESR1 and its target genes by

different PI3K inhibitors. MCF7 cells were treated with

vehicle (Ctrl), GDC0032 50 nM, GDC0941 1 μM, BAY80-6946

(BAY) 50 nM, or BKM120 (BKM) 0.75 µM for 24 hours. mRNA

was isolated, and qPCR was performed to detect expression

of βACTIN, ESR1, PGR, GREB1, and IGFBP4. The data are

presented relative to βACTIN and to expression in the vehicle-

treated samples. For the experiments with GDC0032 and

GDC0941, we used a one-way ANOVA statistical test to

compare gene expression between each treatment and

vehicle (Ctrl) treated cells, applying the Bonferroni method to

correct for multiple comparisons. In the experiments with BAY

and BKM120, a two-tailed Student's unpaired t test was

performed to compare Ctrl vs. BAY or BKM120-treated cells.

Error bars represent the SEM of two independent experiments,

each with three technical replicates.

Figure S10. Comparison of induction of ESR1 and its target genes between BYL719 and the mTORC1 allosteric inhibitor

rapamycin. MCF7 cells were treated with vehicle (DMSO), BYL719 1 µM, or rapamycin 50 nM, and total RNA was collected at the

indicated times. qPCR was performed to detect expression of βACTIN, ESR1, PGR, and GREB1. The relative expression of ESR1 and its

target genes is represented relative to βACTIN and to the expression of vehicle-treated samples (at 0 hours). Statistical analysis was

performed with the one-way ANOVA test comparing gene expression between each treatment and time point. The significant p values in

the comparison of each treatment arm at the specified time points are represented in the graph.

Figure S11. Decreased expression of ER target genes after anti-ER therapy, with no effect on ESR1 mRNA. MCF7 cells were

treated with vehicle (Ctrl), BYL719 (BYL), fulvestrant (FULV), or 4-hydroxy-tamoxifen (4-OHT) for a period of 12 hours. Total RNA was

collected, and expression of the indicated genes was analyzed by qPCR. Graphs represent fold change in expression with respect to the

house-keeping gene βACTIN and to the expression in vehicle-treated cells. A one-way ANOVA statistical test was performed to compare

expression between Ctrl and the rest of the treated cells, with the Bonferroni correction for multiple comparisons. Error bars represent the

SEM of three independent experiments, each with three technical replicates.

Figure S12. Up-regulation of ER target genes reversed by combining BYL719 with anti-ER treatment. MCF7 cells were treated with

BYL719 1 μM (BYL) alone or in combination with 4-OH-Tamoxifen 1 μM (4-OHT) or fulvestrant 100 nM (FULV). mRNA was isolated at the

indicated times, and qPCR was performed to detect expression of βACTIN, IGFBP4, and XBP1. The data are presented relative to

βACTIN and to expression in the vehicle-treated samples at time 0. One-way ANOVA statistical test was used to compare gene

expression between each treatment and vehicle-treated cells, applying the Bonferroni method to correct for multiple comparisons. The

statistical analysis is for the comparisons between the 16 hour time point and 0 hours. Error bars denote the SEM of two independent

experiments, each with three technical replicates.

Figure S13. Better tumor control in vivo after combining BYL719 with fulvestrant. T47D in vivo xenograft was treated with vehicle,

BYL719, fulvestrant, or the combination at the indicated doses and schedule. Graph shows the fold change in tumor size with respect to

day 0 of treatment. One-way ANOVA statistical test was used to compare fold change on the last day of treatment between each treatment

arm and vehicle, applying the Bonferroni method to correct for multiple comparisons. Error bars represent SEM.

Figure S14. Analysis of the effect of PI3Kα inhibition alone or with anti-ER therapy on the cell cycle. MCF7 cells were treated with

vehicle (Ctrl), BYL719 300 nM (BYL), fulvestrant 50 nM (FULV), or the combination for 24 hours after a 12 hour period of serum starvation.

Cycle analysis was performed after appropriate fixation and staining. Graphs depict % cells in G1 phase (left panel) or % cells in S phase

(right panel). Statistical analysis was performed to compare the effect of each treatment on cell cycle arrest, using the one-way ANOVA

statistical test with the Bonferroni correction for multiple comparisons.

NAME SIZE ES NES NOM p-val FDR q-val BHAT_ESR1_TARGETS_VIA_AKT1_DN 51 0.670 2.751 0.000 0.000

GOZGIT_ESR1_TARGETS_DN 396 0.462 2.535 0.000 0.000 BHAT_ESR1_TARGETS_NOT_VIA_AKT1_DN 62 0.586 2.492 0.000 0.000

YANG_BREAST_CANCER_ESR1_UP 28 0.652 2.280 0.000 0.000 VANTVEER_BREAST_CANCER_ESR1_UP 97 0.494 2.264 0.000 0.000

DOANE_BREAST_CANCER_ESR1_UP 72 0.509 2.203 0.000 0.000 WANG_METASTASIS_OF_BREAST_CANCER_ESR1_DN 10 0.688 1.817 0.011 0.005

WILLIAMS_ESR1_TARGETS_DN 4 0.911 1.750 0.004 0.012 YANG_BREAST_CANCER_ESR1_LASER_UP 17 0.515 1.630 0.025 0.027 YANG_BREAST_CANCER_ESR1_BULK_UP 16 0.496 1.501 0.068 0.047

GOZGIT_ESR1_TARGETS_UP 46 0.356 1.450 0.038 0.060

Table S1. GSEA to assess ER-dependent signatures enriched in MCF7 cells treated with BYL719. The transcriptional profile of

MCF7 cells treated with BYL719 for 24 hours was compared to control by exploring the ER-related signatures obtained from the Molecular

Signatures Data Base (MSigDB) v4.0 from GSEA. The table shows the signatures enriched in the treated samples. Size= number of genes

in each gene set after filtering out those genes not in the expression data set. ES= enrichment score. NES= Normalized ES. NOM p-val=

Nominal p value. FDR q-val= False discovery rate q value.

NAME SIZE ES NES NOM p-val FDR q-val VANTVEER_BREAST_CANCER_ESR1_UP 103 0.595 2.555 0.000 0.000

BHAT_ESR1_TARGETS_VIA_AKT1_DN 55 0.632 2.460 0.000 0.000 BHAT_ESR1_TARGETS_NOT_VIA_AKT1_DN 61 0.611 2.379 0.000 0.000

DOANE_BREAST_CANCER_ESR1_UP 66 0.540 2.180 0.000 0.000 GOZGIT_ESR1_TARGETS_DN 320 0.425 2.133 0.000 0.000

YANG_BREAST_CANCER_ESR1_UP 28 0.626 2.079 0.000 0.000 YANG_BREAST_CANCER_ESR1_LASER_UP 27 0.582 1.910 0.000 0.001 YANG_BREAST_CANCER_ESR1_BULK_UP 14 0.533 1.484 0.061 0.040

WILLIAMS_ESR1_TARGETS_DN 4 0.740 1.364 0.102 0.088 WANG_METASTASIS_OF_BREAST_CANCER_ESR1_DN 11 0.474 1.224 0.224 0.175

GOZGIT_ESR1_TARGETS_UP 49 0.239 0.893 0.650 0.656 Table S2. GSEA to assess ER-dependent signatures enriched in CAMA1 cells treated with MK2206. The transcriptional profile of

CAMA1 cells treated with MK2206 for 24 hours was compared to control by exploring the ER-related signatures obtained from the

Molecular Signatures Data Base (MSigDB) v4.0 from GSEA. The table shows the signatures enriched in the treated samples. Size=

number of genes in each gene set after filtering out those genes not in the expression data set. ES= enrichment score. NES= Normalized

ES. NOM p-val= Nominal p value. FDR q-val= False discovery rate q value.

Patient # Initial

diagnosis PIK3CA

mutation BYL dose

(mg) Treatment

combination Lesion

biopsied PAM50 subtype

PRE BYL719 PAM50 subtype

ON BYL719

Pt1* ILC E545K 400 No Bone HER2 enriched Luminal A

Pt2* IDC H1047R 450 No Liver Luminal A Luminal A

Pt3† IDC E545K 300 Exemestane Liver HER2 enriched HER2 enriched

Pt4† IDC H1047R 300 Exemestane Breast HER2 enriched Luminal A

Pt5† IDC H1047R 300 Exemestane Liver Luminal B Luminal B

Pt6† IDC WT 250 Letrozole Breast Luminal B Luminal A

Pt7† IDC E545K 300 Letrozole Liver Luminal B Luminal A

Pt8† ILC H1047L 300 Exemestane Liver Luminal B Luminal B

Pt9† IDC H1047R 300 Exemestane Liver Basal-like Luminal B

Pt10† IDC C420R 300 Exemestane Lung HER2 enriched HER2 enriched

Table S3. Clinical and pathologic features corresponding to paired pretreatment and BYL719-treated tumor samples. Breast

cancer patients (Pt) enrolled in BYL719 phase I trial* or a trial of BYL719 in combination with AI†. The table specifies the site of the

metastatic disease that was biopsied. ILC: invasive lobular carcinoma; IDC: invasive ductal carcinoma; WT: wild-type.