Embed Size (px)
Citation preview
Supplementary Materials for
Therapeutic targeting of the MYC signal by inhibition of histone
chaperone FACT in neuroblastoma
Daniel R. Carter, Jayne Murray, Belamy B. Cheung, Laura Gamble, Jessica Koach,
Joanna Tsang, Selina Sutton, Heyam Kalla, Sarah Syed, Andrew J. Gifford,
Natalia Issaeva, Asel Biktasova, Bernard Atmadibrata, Yuting Sun, Nicolas Sokolowski,
Dora Ling, Patrick Y. Kim, Hannah Webber, Ashleigh Clark, Michelle Ruhle, Bing Liu,
André Oberthuer, Matthias Fischer, Jennifer Byrne, Federica Saletta, Le Myo Thwe,
Andrei Purmal, Gary Haderski, Catherine Burkhart, Frank Speleman, Katleen De Preter,
Anneleen Beckers, David S. Ziegler, Tao Liu, Katerina V. Gurova, Andrei V. Gudkov,
Murray D. Norris, Michelle Haber,* Glenn M. Marshall*
*Corresponding author. E-mail: [email protected] (G.M.M.); [email protected] (M.H.)
Published 4 November 2015, Sci. Transl. Med. 7, 312ra176 (2015)
DOI: 10.1126/scitranslmed.aab1803
The PDF file includes:
Materials and Methods
Fig. S1. Data supporting Fig. 1.
Fig. S2. Data supporting Fig. 2.
Fig. S3. Data supporting Fig. 3.
Fig. S4. Data supporting Fig. 4.
Fig. S5. Data supporting Fig. 5.
Fig. S6. Data supporting Fig. 6.
Fig. S7. Data supporting Fig. 7.
Fig. S8. Fluorescence in situ hybridization for MYCN amplification in tissue
microarray.
Table S1. Cox proportional hazards modeling of MYC target signature members
in 649 neuroblastoma patients.
Table S2. Literature analysis of lead candidates that favor poor outcome in
neuroblastoma.
Table S3. Cox proportional hazards modeling of SSRP1 and SPT16 in 649
neuroblastoma patients.
www.sciencetranslationalmedicine.org/cgi/content/full/7/312/312ra176/DC1
Table S4. Gene set enrichment analysis of 2-week-old TH-MYCN+/+ ganglia
compared with age-matched wild-type mice.
Table S5. Histology of TH-MYCN+/+ mice treated with oral or intravenous
CBL0137.
Table S6. Histology of TH-MYCN+/+ mice treated with a dose-escalating regimen
of intravenous CBL0137.
Table S7. P values not shown in figures.
References (44–59)
Supplementary Materials and Methods
Study design
This study was designed to identify therapeutically targetable mechanisms of MYCN signaling in
neuroblastoma. In the first part of the study, we used a Cox regression modeling strategy on a previously
published MYC core target gene signature (7) to identify FACT as a prognostically relevant target of
MYCN in a large cohort of neuroblastoma patients. In the second stage of the project, we determined the
biological relationship between MYCN and FACT and linked their function to regulation of tumor
initiation using a well-established transgenic mouse model of neuroblastoma. Thirdly, we provided in
vitro and in vivo evidence that FACT inhibitor CBL0137 is a potential indirect MYC inhibitor using a
series of forced genetics and animal modeling approaches, which suggest that CBL1037 shows target
specificity. Finally, we conducted pre-clinical testing for FACT inhibitor CBL0137 in combination with
currently used chemotherapeutics for the disease, which will continue to support the clinical
development of CBL0137 for treatment of cancer (http://clinicaltrials.gov/show/NCT01905228).
We chose the gene signature in this study for two reasons: i) the signature was defined from multiple
cell systems and therefore is most likely to have a broad relevance to multiple MYC-driven cancers and
ii) our hierarchical clustering results were very similar to a published clustering experiment on a
Burkitt’s lymphoma patient cohort, a well-known MYC-driven cancer (7). The TH-MYCN animal
model used in a number of experiments was chosen because it strongly replicates MYCN-driven
neuroblastoma and has been used by us and others for evaluation of molecular mechanism of MYCN-
driven neuroblastoma as well as for pre-clinical testing of therapies for the disease (44). In vitro studies
used in this manuscript were conducted with multiple technical and biological replicates to ensure
reproducibility of data. Sample sizes for animal models were determined prospectively on the basis of
extensive previous experience with similar experimental types. Data from animal experiments were not
combined between different experiments to avoid masking batch variation caused by possible genetic or
phenotypic drift within the breeding colony (notably, experimental findings were reproducible
regardless of this concern). Where applicable, treatment groups were blinded and multiple researchers
were involved in data collection to overcome unintentional bias (for example in animal studies,
histological analysis, and ganglia viability counts). Information on specimen collection, procedures in
mice, molecular and bioinformatics analyses, cell-based experimentation, immunohistochemistry, and
histopathological analysis, as well as details regarding sample number and replication in assays, is given
in figure legends and detailed below.
Expression analysis on neuroblastoma tumor cohorts
Gene expression analysis of 649 neuroblastoma tumors was conducted as previously detailed (4).
Hierarchical clustering of a previously published 51 gene signature (7) was conducted on a 649 patient
cohort (listed as Kocak dataset) using the R2 microarray analysis and visualization platform
(http://r2.amc.nl) based on the Euclidean distance measure. Kaplan-Meier analysis and log-rank tests
were used to determine statistical significance between expression quartiles for the average of all 51
MYC target genes, SSRP1, and SPT16 based on overall patient survival and event-free survival using
SPSS software (IBM). Boxplots and Pearson correlations for SSRP1 and SPT16 expression in 649
neuroblastoma tumors were generated with R software (http://www.r-project.org/). Cox regression was
performed using SPSS software (IBM) for both univariate and multivariate models as indicated. A
validation cohort of 88 patients (Versteeg dataset) (14) was analyzed for SSRP1 and SPT16 expression
relative to patient outcome using the R2 microarray analysis and visualization platform
(http://r2.amc.nl). 12 primary neuroblastoma tumors, which were used for protein expression analysis,
were sourced from the Children’s Oncology Group. The tissue microarray of 47 neuroblastoma tumors
was sourced from the Westmead Children’s Hospital, Sydney, Australia.
Neuroblastoma cell line tissue culture
All cell lines were purchased from the ATCC. The human neuroblastoma cell lines SK-N-BE(2)-C
(referred to as BE(2)C), SKN-DZ, SKN-FI, SH-SY5Y, and SH-EP were maintained in Dulbecco’s
Modified Eagle’s Medium (DMEM) (Life Technologies) with 10% heat-inactivated fetal calf serum
(FCS) (Life Technologies) and L-glutamine (Life Technologies). KELLY cells were maintained in
RPMI medium (Life Technologies) with 10% heat-inactivated FCS and supplemented with L-glutamine
(Life Technologies). Fibroblast cell lines MRC5 and WI38 were maintained in Minimum Essential
Medium (MEM) (Life Technologies) and Alpha-MEM (Life Technologies), respectively, with 10%
heat-inactivated FCS. All cells were maintained at 37°C with 5% CO2. Cells were maintained in
exponential growth phase by trypsin passaging every 3 days.
Western blotting
Protein extracted from whole cell lysates was prepared in radioimmunoprecipitation assay buffer (150
mM NaCl, 1.0% IGEPAL CA-630, 0.5% sodium deoxycholate, 0.1% SDS, 50 mM Tris, pH 8.0; Sigma-
Aldrich) containing 1% Triton X-100 detergent (Sigma-Aldrich) with 10% protease inhibitor (Sigma-
Aldrich), vortexed 3 times and incubated on ice for 30-60 minutes. Protein concentration was
determined using the Pierce BCA (bicinchoninic acid) Protein Analysis Kit (Pierce) as per
manufacturer's instructions. Before electrophoresis, 20-40 µg of harvested protein was boiled for 5-10
minutes in 4x loading buffer and reducing agent (Bio-Rad). Samples were then loaded into precast
Criterion Gels (Bio-Rad 12-well 10.5-14% Tris-HCl). Precision Blue Dual Colour Protein Ladder (Bio-
Rad) was used for molecular weight determination. Electrophoresis was conducted at 150 volts for 1.5
hours, then protein was transferred to nitrocellulose membranes (GE Healthcare) at 250 amperes for 2
hours. To confirm protein transfer, Ponceau S (Sigma-Aldrich) staining was conducted, and then
membranes were blocked in 10% skim milk in Tris-buffered saline + Tween 20 (100 ml of 1M Tris pH
8, 87.7 g NaCl, and 1% Tween 20) for 1-2 hours at room temperature. Membranes were incubated with
primary antibodies: goat SPT16 (BioLegend, 1:6000), goat SSRP1 (BioLegend, 1:500), goat MYCN
(Santa Cruz Biotechnology, 1:1000), goat c-MYC (Santa Cruz Biotechnology, 1:200), and goat GAPDH
(Sapphire Bioscience, 1:10000) overnight at 4˚C on a rocking incubator. Membranes were washed at
least three times and incubated with secondary mouse anti-goat horseradish peroxidase antibody
(Thermo Scientific, 1:2000) for 2 hours at room temperature. Immunocomplexes were visualized by
chemo-luminescence (Super Signal, Pierce) and photosensitive film (GE Healthcare). GAPDH or -
actin were used as loading controls as indicated. Densitometry was conducted using Image J software
(NIH), and all samples were normalized to loading control and then the control condition. Densitometry
results are the combined data from at least 3 independent biological replicates.
Immunohistochemistry
Slides were dried in a 60°C oven for 1 hour. The tissue slides were immersed in xylene for 20
minutes to deparaffinize the sections. Slides were then re-hydrated with 100%, 90%, 70% ethanol, and
MilliQ water sequentially. Antigen retrieval was performed by immersing the slides in 100 mM tri-
sodium citrate buffer at pH 6 and microwaving at 800 W for 20 minutes. Cooling intervals of 10 minutes
after each 5 minutes of heating were used during the process. The endogenous peroxidases were
inactivated by immersing slides in 3% hydrogen peroxide. To block non-specific binding of
immunoglobulin, tissues were treated with 2.5% bovine serum albumin, 2.5% fetal calf serum, and 0.2%
Triton-X for 1 hour at room temperature.
For all mouse immunohistochemistry (IHC), slides were incubated with the following primary
antibodies at 4°C overnight: anti-tyrosine hydroxylase rabbit polyclonal antibody (Millipore, 1:300);
MYCN rabbit monoclonal antibody (SDIX, 1:500), SSRP1 rabbit monoclonal antibody (Proteintech
Group, 1:200), or rabbit IgG (Vector Laboratories) at concentrations corresponding to the MYCN and
SSRP1 antibody concentrations. Slides were then incubated with secondary goat anti-rabbit
immunoglobulin/biotinylated antibody (Dako, E0432, 1:500) for 1 hour at room temperature. The
biotinylated antibody was labeled with streptavidin-HRP (Dako, K1016) for 45 minutes at room
temperature. The sections were developed with 3, 3'-diaminobenzidine tetrahydrochloride (Dako,
K3468) at room temperature for 1.5 minutes for TH and SSRP1 slides, and for 5 minutes for MYCN
slides. Slides were then washed in MilliQ water and dehydrated with 70%, 90%, and 100% ethanol
sequentially.
IHC for SSRP1 expression in the tissue microarray of primary tumor samples was conducted under a
similar protocol, except that SSRP1 goat antibody (Biolegend) was used as the primary antibody and
anti-goat immunoglobulin/biotinylated antibody (Dako, E0466) was used as a secondary antibody.
Tissue microarray for human neuroblastoma tumors
Human neuroblastoma tissue microarray (TMA) sections were obtained as part of the Children’s
Hospital Westmead tumor bank. A total of 47 patients are represented on the TMA. Each core was
scored according to the method of American Society of Clinical Oncology Guideline Recommendations
(10, 45) for SSRP1. Scores for each core were calculated by researchers blinded to clinical parameters
for each patient. The results for all cores for one patient were averaged for a final score (the number of
cores per patient ranged from 1-2 cores). Cores were omitted from analysis if (i) an insufficient amount
of the core was present, (ii) staining was difficult to interpret because of folding of the core, or (iii)
suboptimal staining was present as seen particularly in cores at the edge of the slide. Fluorescence in situ
hybridization for MYCN was performed on the TMA, to determine which cores were MYCN-amplified
by standard clinical grading (refer to representative images in fig. S8, white arrowheads indicate MYCN
amplifications). Scoring of immunohistochemical staining was correlated with MYCN status, and the
outcome for each patient represented in the TMA was analyzed by Kaplan-Meier analysis.
Representative photos were taken using an Olympus BX53 light microscope and DP-73 camera with
cellSens software.
siRNA/plasmid transfection
Cells were seeded on 96-well plates for cell viability assays, 6-well plates for colony assays, or T25
flasks for protein lysates. Cell density was adjusted so that for all assays, 80-90% confluency would be
achieved by the endpoint of the assay in the control condition. siRNAs used were SPT16 (#J00951706,
Dharmacon), SSRP1 (#J01178306, Dharmacon), MYCN-1 (#SI03087518, Qiagen), MYCN-2
(#SI03113670, Qiagen), c-MYC-1 (#SI02662611, Qiagen), c-MYC2 (#SI00300902, Qiagen), or non-
targeting control siRNAs (ONTARGETplus siRNA, #D-001810-0X, Dharmacon). Expression plasmids
for empty vector pLV-neo, pLV-neo-SSRP1, or pLV-neo-SPT16 were previously described (10, 12). All
siRNA or plasmid transfections were conducted with Lipofectamine 2000 according to manufacturer’s
instructions (Life Technologies) at 20-40 nM for siRNA or 1-2 μg for plasmid DNA. On occasions of
double siRNA or plasmid transfections, total nucleic acid was equalized to the total amount transfected
in comparative control samples. After transfection, cells were harvested for total RNA or protein at 48-
72 hours after transfection and analyzed by quantitative PCR or western blot, respectively. For cell
viability assays, resazurin (75 mg resazurin, 12.5 mg methylene blue, 164.5 mg potassium
hexacyanoferrate (III), 211 mg potassium hexacyanoferrate (II) trihydrate in 500 ml of phosphate
buffered saline) was added to measure cell viability at 72, 96, and 120 hours after transfection. Data
displayed are the mean ± standard error of the combined data from three independent biological
replicates.
Quantitative polymerase chain reaction
RNA was isolated using PureLink RNA kits (Life Technologies). 1 μg of RNA was converted to
cDNA using Superscript III Reverse Transcriptase (Life Technologies). Real-time PCR was conducted
on the ABI-7500 Real Time PCR System (Life Technologies) using the following conditions: 25 µl
reaction, 50˚C for 2 min, 95˚C for 10 min, 95˚C for 15 sec, 60˚C for 1 min x 40 cycles with a
dissociation step. Melt curve analysis was used to assess product specificity, and non-template control
samples were run for all primer pairs to evaluate non-specific amplification. Relative abundance of
mRNA transcript for MYCN (F: CGACCACAAGGCCCTCAGTA, R:
CAGCCTTGGTGTTGGAGGAG), SSRP1 (F: TTGAGAGGGAGGAGTACGGG, R:
GTAGCTTGGGTTCATGCCCT), and SPT16 (F: GTCAATGGCTTCCGCTTCAC, R:
ACAGGGCTGGAACAAAGCAT) was calculated using the ∆∆Ct approximation relative to
housekeeping gene β2M (F: ACTGGTCTTTCTATCTCTTGTACTACACTGA, R:
TGATGCTGCTTACATGTCTCGAT).
SSRP1 and MYCN siRNA microarray
RNA was isolated from MYCN and SSRP1 siRNA-treated samples as well as controls in BE(2)C
cells at 36 and 72 hours, respectively. At these time points, MYCN is downregulated at the protein level.
RNA quality was assessed using the Agilent Bioanalyser. Affymetrix Genechip Human Gene 2.0 ST
arrays were run at the Ramaciotti Centre for Genomics (University of New South Wales). Arrays were
normalized using GenePattern software (version 3.2.3 Broad Institute) with the NormaliseAffymetrixST
(version 2.2) and LimmaGP modules (version 19.3) available at https://pwbc.garvan.unsw.edu.au/gp.
SSRP1 siRNA samples were run in duplicate and compared to duplicate control siRNA samples.
MYCN-1 and MYCN-2 siRNA samples were compared to a single control siRNA sample.
Gene set enrichment analysis (http://www.broadinstitute.org/gsea/index.jsp) (46, 47) was conducted
on a pre-ranked list of differentially expressed genes in SSRP1 siRNA-treated cells compared to control
siRNA-treated cells. Gene sets for MYCN target genes were created from the 50 most differentially
upregulated and downregulated genes for MYCN siRNAs compared to control siRNAs.
TH-MYCN+/+ganglia microarray
Celiac and Superior Cervical ganglia were isolated from two-week old TH-MYCN+/+ mice and wild-
type littermates as previously described (15, 19). RNA was isolated and hybridized to Agilent SurePrint
G3 Mouse GE 8x60K Microarrays. Arrays were normalized using GenePattern software (version 3.2.3
Broad Institute) with the AgilentToGCT and LimmaGP modules (version 19.3) available at
https://pwbc.garvan.unsw.edu.au/gp.
Gene set enrichment analysis (http://www.broadinstitute.org/gsea/index.jsp) (46, 47) was conducted
on a pre-ranked list of differentially expressed genes in TH-MYCN+/+ ganglia compared to wild-type
ganglia. Gene sets for p53 target genes are available in the Molecular Signature Database
(http://www.broadinstitute.org/gsea/msigdb/index.jsp).
Protein stability assay
siRNAs directed against SSRP1 and SPT16 or plasmids that overexpress SSRP1 and SPT16 were
transfected into BE(2)C cells, and protein synthesis was blocked 48 hours after transfection with 100
µg/ml cycloheximide (CHX - Sigma) for the indicated duration of time. Cells were then lysed for
western blotting, and MYCN protein expression was evaluated. Densitometry results from replicate
experiments were combined to evaluate relative MYCN expression compared to cells untreated with
CHX. Half-life is expressed as the time at which MYCN expression is reduced to half that of untreated
cells. GAPDH was used as a loading control. Data are expressed as the average relative MYCN
expression, combined from three independent biological replicates +/- standard error of the mean.
Immunofluorescence
Cell cultures in 8-well chamber slides were fixed in 3-4% paraformaldehyde for 15 minutes at room
temperature followed by 30 minutes of 0.4-0.5% Triton-X to permeabilize cells. After washing with
PBS, cells were then blocked with 10% FCS for 1 hour, followed by overnight incubation with rabbit
anti-III-tubulin (Covance 1:1000), monoclonal anti-γH2AX (Abcam 1:5000), or rabbit polyclonal anti-
53BP1 (Cell Signaling, 1:1000) at 4˚C in a humid environment. Secondary anti-rabbit-Alexa-Fluor 488
(Life Technologies 1:2000) or anti-mouse-Alexa-Fluor 555 (Life Technologies 1:1000) was then
incubated for 45 minutes hidden from light at room temperature, and slides were mounted with
coverslips using DAPI mounting solution (Southern Biotech). DAPI was used as a nuclear stain. For
primary ganglia cultures, βIII-tubulin was used to determine the number of neural lineage cells. Cells
were counted on the Zeiss Axioplan II microscope. Counts reflect all cells in a particular well
normalized to control for three independent experiments. For marker analysis with CBL0137/etoposide
treated cultures, cells were visualized using the Zeiss 710 confocal microscope. The number of cells
containing >10 γH2AX and 53BP1 foci was determined in two independent experiments; 100 cells were
counted in each experiment.
Cell viability assays
For the neuroblastoma cell lines used, cells were seeded into 96-well plates (200 µL per well) at a
predetermined density to achieve 90% confluency by the endpoint of the assay. After 24 hours of
incubation, CBL0137 concentrations ranging from 4.8e-5 µM to 32 µM or SSRP1 or SPT16 siRNA
complexes were added to cells. Cells were incubated at 37°C, 5% CO2 for 24-120 hours as indicated.
Resazurin reduction was then used to measure cell viability. To evaluate efficacy of CBL0137 in high
MYC-expressing cell lines, protein expression analysis was used to determine relative MYC expression
(Figure S1N). Among the cell lines analyzed, “high MYC” cells were identified as follows: i) among
MYCN non-amplified cell lines, SH-SY5Y was considered to have high c-MYC expression, and ii) all
MYCN-amplified cell lines were considered to high MYCN expression. Combination
CBL0137/mafosfamide experiments were conducted at the indicated doses for 48 hours. Synergistic
drug combinations were determined using CalcuSyn software (Biosoft) developed by Chou and Talalay
(43) at a Fa level of 0.8. Quantitative data displayed are the mean ± standard error of the combined data
from three independent biological replicates.
All cell viability assays were conducted in 96-well plates. 22 µL of 10X resazurin (75 mg resazurin,
12.5 mg methylene blue, 164.5 mg potassium hexacyanoferrate (III), 211 mg potassium
hexacyanoferrate (II) trihydrate in 500 ml of phosphate-buffered saline) was added into each well and
fluorescent readings were taken at 570 nm using Victor plate fluorescent reader (BioRad). An initial
background reading was taken, followed by 4-8 hour incubation at 37oC before a final reading was
taken. Background fluorescence was subtracted from all data, which were then normalized to percent
viability and compared to untreated cells. IC50 values were calculated by non-linear regression analysis
calculated with Graphpad Prism 6 software (Applied BioSystems). Data are displayed as the mean ±
standard error of the combined data from three independent biological replicates.
Chromatin immunoprecipitation (ChIP)
ChIP assays were performed using a ChIP assay kit (Merck Millipore), with a mouse anti-MYCN
antibody (Calbiochem) or a control mouse IgG antibody (Santa Cruz Biotechnology). Real-time PCR
analyses of ChIP assay products were performed using primers targeting a negative control region (2210
bp upstream of SSRP1 gene transcription start site), and the SSRP1 or SPT16 gene promoter regions.
Sequences of primers used for real-time PCR were: 5’ GCCTGAGCTAAGGACCCTCT-3’ (forward)
and 5’ AAGAGACCTTTTCCCCCTGA-3’ (reverse) for the negative control region, 5’-
GCACGCATCATTCCAATACA-3’ (forward) and 5’- CCGGCCTAGAAAATGTGTGT-3’ (reverse)
for the SSRP1 promoter region, and 5’- TCGGCAAAAAGTCTGAGGTC-3’ (forward) and 5’-
ACAAAATGTGCGATGCAAAG-3’ (reverse) for the SPT16 gene promoter region. Fold enrichment of
the SSRP1 or SPT16 promoter regions by anti-MYCN antibody treatment was calculated by dividing
cycle threshold values of the SSRP1 or SPT16 promoter regions by cycle threshold values of the
negative control region, relative to input.
In vivo models of neuroblastoma
All experimental procedures involving mice were approved by the University of New South Wales
Animal Care and Ethics Committee according to the Animal Research Act, 1985 (New South Wales,
Australia) and the Australian Code of Practice for Care and Use of Animals for Scientific Purposes
(2013). The TH-MYCN transgenic mouse model of neuroblastoma has been previously described (5, 48,
49). Male and female TH-MYCN mice were used in all experiments. For chemotherapy studies, ten
mice were used, 5 males and 5 females. Female BALB/c nude mice (nu/nu) were obtained from
Australian BioResources (Moss Vale). All mice were maintained in a temperature-controlled
environment with a 12 hour light/dark cycle in Tecniplast individually vented cages with enviro-dri and
igloos for nesting. Mice were given irradiated mouse and rat feeder pellets (Gordon’s Specialty
Stockfeeds) and acidified water ad libitum. Mice were euthanized at the completion of the protocol by
carbon dioxide overdose, or for pups aged less than 2 weeks of age, by halothane overdose.
Ganglia histology in TH-MYCN mice
Wildtype and TH-MYCN+/+ mice were bred on-site and time mated for a range of time points (1 day
old, 7 days old, 14 days old, and 6 weeks old). Euthanized mice were fixed in 10% neutral buffered
formalin for 24 hours followed by 80% ethanol for 5 days. Skin, teeth, and limbs were removed, and
mice were bisected longitudinally. Fixed tissues were paraffin-embedded and then serial sections were
cut to identify the location of any ganglia by H&E staining. Once ganglia were identified, several
directly adjacent sections were cut for IHC. At least 3 independent mice had one or more ganglia present
for analysis for each time point/genotype. Representative photos were taken using an Olympus BX53
light microscope and DP-73 camera with cellSens software.
Tissues were examined based on an estimate of average whole cell staining intensity for sympathetic
neuroblasts, ganglion cells, or a combination of the two sympathetic cell types where indicated. A
reference range for staining intensity of both MYCN and SSRP1 was based on upper extremes of
staining intensity compared to rabbit IgG as a negative non-staining control. Samples were scored by
two independent observers blinded to mouse genotype and age according to the American Society of
Clinical Oncology Guideline Recommendations (10, 45). Briefly, a score was assigned to each ganglion
on the basis of staining intensity: 0 for negative staining, 1 for weak staining, 2 for moderate staining,
and 3 for strong staining. Samples were then also scored on the percentage of cells staining: 0 (0% cells
staining), 1 (1%-9% cells staining), 2 (10%-49% cells staining), 3 (50%-100% cells staining). The final
expression score was a product of the two scores, with a maximum possible score of 9. Data displayed
are reflective of the average score of multiple fields per mouse sample +/- standard error of the mean.
Primary TH-MYCN+/+ ganglia cultures
Superior cervical ganglia and celiac ganglia were dissected from normal and TH-MYCN+/+ mice at 2
weeks of age as described previously (15,19). Ganglia were placed in Hanks' balanced salt solution (Life
Technologies) containing 1 mg/ml collagenase (Sigma) at 4°C for 30 min and then dissociated by
adding 0.05% trypsin at 37°C for 8-11 minutes. Samples were then washed twice, resuspended, and
mechaninicaly dissociated with a pipette in Neurobasal-A medium (Life Technologies) supplemented
with 0.5 mM L-glutamine, 25 μM glutamic acid, penicillin streptomycin (1% vol/vol), and B27 (Life
Technologies; 2% vol/vol; complete media).
Ganglia cells were cultured in complete Neurobasal-A medium on poly-d-lysine and laminin-coated
coverslips in 8-well chamber slides (Lab-Tek II - Thermo Scientific) in the presence of NGF (50 ng/ml;
Biosensis) and aphidicolin (3.3 µg/ml; Sigma). 48 hours after seeding, ganglia cultures were then
washed gently by dilution with PBS to avoid cell contact with air, and medium was replaced with B27-
rich medium or a 1/30 dilution of B27. When B27 is diluted, this is considered serum withdrawal and
referred to as such in the manuscript. Cultures were then incubated for 48 hours, and neural lineage cells
were quantified by immunofluorescent staining for βIII-tubulin. Data are expressed as the percentage of
βIII-tubulin-positive cells compared with untreated/B27-rich cells. Ganglia cultures were treated with
CBL0137, nutlin-3a (Sigma), pifithrin-α (Sigma), or pan-caspase OPH Inhibitor Q-VD, Non-
omethylated (RnD Systems) 24 hours after serum withdrawal for a total of 24 hours.
CBL0137 prophylaxis in TH-MYCN mice with neuroblast hyperplasia
For CBL0137 prophylaxis studies, 10 mg/kg CBL0137 or 0.2% methylcellulose was administered
intraperitoneally to TH-MYCN mice at 6 days of age. For examination of sympathetic ganglia histology,
treatment proceeded once a day for a total of 5 days. Mice were then culled and fixed for H&E staining
and histological analysis. All mice were examined for the proportion of ganglia which exhibited
neuroblast hyperplasia. >30 neuroblasts/focal region in each ganglion were considered to be
hyperplastic. Data are presented as the average proportion of ganglia which were hyperplastic +/-
standard error for each mouse. For examination of tumor incidence and growth, prophylactic CBL0137
treatment proceeded for 3 cycles of 5 days on/ 2 days off, at 10 mg/kg per treatment. Treatment ceased
at 4 weeks of age, a time at which small tumors are normally detected by palpation. Palpation then
proceeded until tumors were 10 mm in diameter, at which time the mice were culled and tumors
removed, fixed for histology, and stained by H&E. Data presented reflect the number of ganglion cells
counted in 50 fields/tumor +/- standard deviation.
In vivo chemotherapeutic treatment in TH-MYCN+/+ mice
Upon the development of 5 mm tumors, TH-MYCN+/+ transgenic mice were randomized into
treatment groups to receive treatments. After this, mice were monitored until the development of a
medium (~1 cm) palpable abdominal tumor or signs of thoracic tumor development (labored breathing
or hind limb paralysis), or in the event of not relapsing with a tumor, until 20 weeks of age, as
previously described (49). For Kaplan-Meier analysis, a 10 mm palpable tumor is considered the
survival endpoint. Survival % (y axis) refers to the proportion of mice which have not reached the
endpoint at any given time (x axis). Kaplan-Meier graphs were generated with GraphPad Prism 6, and
two-sided log-rank tests were used to compare groups.
Mice on all treatments were given soggy food to supplement their food intake and reduce dehydration
from diarrhea. If weight loss of >10% occurred in any protocol with CBL0137, the treatment was ceased
and the mice given palliative care of 5% dextrose injections until their weight recovered. Once they had
recovered, the treatment protocol continued. If weight loss of ≥20% occurred, the mice were euthanized
and excluded from the analysis for toxicity.
Most mice showed minimal toxicity and were monitored until they reached one of the endpoints for
the study, as described above. Some occasions of weight loss were observed and mice were removed
from study as follows: cisplatin (2/10 mice), cisplatin/CBL0137 (2/10 mice), vincristine/CBL0137 (5/10
mice), and CBL0137/irinotecan/temozolomide (2/10 mice).
For single agent studies, mice received CBL0137 either orally, prepared in 0.5% methylcellulose, at
20 mg/kg/day in a 5 day on, 2 day off schedule for 4 weeks or intravenously (i.v.) at 20, 40, or 60
mg/kg/day prepared in 50 mg/mL Captisol (Ligand Technologies), every four days for 8 doses.
For combination therapy, CBL0137 was prepared in 50 mg/mL Captisol (Ligand Technologies) and
given i.v, every four days for 8 doses at 40 mg/kg/day. This was combined with chemotherapeutic
agents, which were administered for 5 consecutive days i.p, at the following doses: vincristine (Tocris),
0.2 mg/kg/day; etoposide (Sigma), 6 mg/kg/day; cisplatin (Hospira), 2 mg/kg/day; cyclophosphamide
(Baxter), 15 mg/kg/day. Doses were lowered for the relapse backbone regimens as follows: i)
cyclophosphamide, 10 mg/kg / topotecan, 0.5 mg/kg (Baxter and GlaxoSmithKline), or ii) irinotecan, 2
mg/kg (Hospira) / temozolomide, 5 mg/kg (Sigma). All chemotherapy drugs were diluted from their
stock solution to 5% dextrose for injection.
Short-term CBL0137 effects on TH-MYCN+/+mice
Five TH-MYCN+/+ mice were treated with vehicle (50 mg/kg Captisol), oral CBL0137 (20
mg/kg/day for 5 doses), or i.v CBL0137 (20, 40, and 60 mg/kg for a single dose). Twenty four hours
after the fifth dose for oral or the single dose of i.v. CBL0137, mice were euthanized and the tumors or
other organs were snap frozen for assessment of CBL0137 concentration or fixed in 10% neutral
buffered formalin for paraffin embedding to examine histology and antibody staining (described in
respective sections below).
Histological analysis of CBL0137-treated TH-MYCN+/+mice
Tumors were assessed for relevant morphological features and classified according to the INPC
Classification (50, 51) by a trained pathologist. Features assessed included the degree of differentiation,
presence of ganglionic cells, Schwannian stroma, calcification, hemorrhage, necrosis, estimated mitotic
karyorrhexis index (MKI), and associated inflammatory cells. Percentage of viable tumor was
calculated as 100 minus percentage of hemorrhage and necrosis. Graphs of results and statistical
analyses (Mann-Whitney Test) used to compare treatment groups were performed with GraphPad Prism
6. Alveolar capillaries of lung parenchyma were examined for pulmonary metastases and reported for
each treatment group (5 mice for each of vehicle or i.v. CBL0137 at 20, 40, and 60 mg/kg for a single
dose). Representative photos were taken using an Olympus BX53 light microscope and DP-73 camera
with cellSens software. Magnification: 400X.
LC-MS/MS determination of CBL0137 concentration in TH-MYCN+/+ mouse neuroblastoma tissue
samples
Sample preparation: The samples were prepared for analysis using a methanol extraction procedure. 50-
80 mg sections of tumor tissue were supplemented with methanol 1:10 (wt:vol) containing 0.1% formic
acid and homogenized using a Bullet Blender (model BBX24B). To complete the compound extraction,
the sample solutions were rocked overnight at 2-8°C and then centrifuged for 10 minutes at 14000 rpm
and 2-8°C to precipitate the homogenized tissue pellet. The supernatant was then separated and diluted
1:4 (vol/vol) with mobile phase A (MPA), then analyzed by LC-MS/MS vs. a reagent-matched
calibration curve.
LC-MS/MS analysis, HPLC conditions: analytical column: Zorbax 300Extend-C18; C18, 3.5 µm, 300
Å, 4.6x100 mm; flow rate: 1.0 mL/min; column temperature: 25ºC; auto-sampler cooling block
temperature: 4ºC; injection volume: 4 µL.
Gradient conditions:
Minutes % MPA* % MPB*
0.0 90 10
1.0 90 10
2.0 10 90
5.0 10 90
6.0 90 10
8.0 90 10
*MPA - 0.1% formic acid in water; MPB - 0.1% formic acid in acetonitrile.
LC-MS/MS analysis, MS/MS conditions: positive polarity; scan mode - multiple reaction monitoring
(MRM); ionization mode - turbo ion spray; precursor ion → product ion: m/z: 337.1→194.1
(CBL0137); curtain gas CUR: 35; gas 1 GS1: 60; gas 2 GS2: 60; collision gas CAD: 6; temperature
TEM: 650; ion spray voltage IS: 5500; declustering potential DP: 108; entrance potential EP: 10;
collision cell entrance potential CE: 39; collision cell exit potential CXP: 26
LC-MS/MS instrument: AB Sciex 5500 triple quadrupole mass spectrometer; Shimadzu UFLC
Prominence HPLC system
LC-MS/MS data analysis: integration of calibration standard and sample peak area was accomplished
using ABSciex Analyst 1.5.2 instrument operating software. Calibration was performed by least squares
analysis using a (1/y2) weighting. The calculation used the peak area of the calibration standards vs. the
concentration of the calibration standards. The concentration of CBL0137 in the study samples was
calculated using the calibration curve established by the calibration standards. CBL0137 concentration
was expressed in g/mL, assuming 1 mg/mL density of tumor tissue.
Neuroblastoma xenografts
BALB/c nude mice (nu/nu) were inoculated with 5 x 106 BE(2)C cells in the dorsal flank at 5-6
weeks of age. Mice were monitored for tumor growth every second day using vernier calipers. Tumor
mass was calculated as previously described (52). Once a 50 mm3 tumor had developed, mice were
randomized to the treatment groups. Mice were treated with 60 mg/kg/day CBL0137 dissolved in 50
mg/mL Captisol, i.v. every four days for 8 doses either alone or in combination with the two relapse
chemotherapy backbones of cyclophosphamide/topotecan or irinotecan/temozolomide at the same doses,
schedule, and route as in TH-MYCN mice above, and compared to vehicle-treated controls. Mice on all
treatments were given soggy food to supplement their food intake and reduce dehydration from diarrhea.
If weight loss of >10% occurred in any protocol with CBL0137, the treatment was ceased and the mice
given palliative care of 5% dextrose injections until their weight recovered. Once they had recovered,
the treatment protocol continued. Mice were monitored until they developed a 1000 mm3 tumor, or in
the event of not relapsing with a tumor, until 120 days after the start of treatment. The time to develop a
1000 mm3 tumor (considered the survival endpoint) was calculated, and Kaplan-Meier graphs were
generated with GraphPad Prism 6. Two-sided log-rank tests were used to compare groups, and P values
<0.05 were considered statistically significant.
Colony formation assays
Colony assays were used to assess the effects of FACT siRNA and CBL0137 in SHEP.MYCN3 cells,
a MYCN non-amplified neuroblastoma cell model with stably incorporated MYCN which can be
controlled by doxycycline administration in the medium as previously described (42). Synergy between
combinations of CBL0137 with mafosfamide (the active metabolite of cyclophosphamide), topotecan,
SN38 (the active metabolite of irinotecan), cisplatin, etoposide, vincristine, and temozolomide were
conducted in KELLY and BE(2)C neuroblastoma cell lines.
For drug administration experiments, SHEP.MYCN3 (maintained in doxycycline-rich or deficient
medium), KELLY, or BE(2)C cells were plated at 400, 500, and 250 cells/well, respectively. After 5
hours of seeding, cells were treated with drugs for a total of 72 hours. Once colonies had formed (7 days
for SHEP.MYCN3, 14 days for KELLY, and 10 days for BE(2)C), cells were fixed and stained with
0.5% crystal violet/50% methanol. Colonies were counted using Quantity One 1-D Analysis software
(Bio-Rad). Each experiment was performed in triplicate. Synergistic drug combinations were
determined using CalcuSyn software (Biosoft) developed by Chou and Talalay (43). CalcuSyn generates
a combination index (CI) as a measure of the combined drug interaction. Each dose-response curve was
fitted to a linear model using the median effect equation allowing calculation of a CI value from the
median effect value and the slope. CI values were generated over a range of fractional cell kill (Fa)
levels from 0.05 – 0.90 (5% – 90% growth inhibition). All CI values in presented data are at a Fa level
of 0.80 as per the recommendation of Chou for anti-cancer agents (53). CI<0.9 was considered
synergistic, CI between 0.9 and 1.1 was considered additive, and a CI>1.1 was considered antagonistic.
For FACT siRNA experiments, MYCN overexpression was induced by doxycycline in
SHEP.MYCN3 cells and after 72 hours, siRNAs for SPT16 and SSRP1 were transfected as described in
the “siRNA/plasmid transfection” section above. After 48 hours, cells were trypsinized and a fraction
was used to calculate MYCN, SSRP1, and SPT16 protein expression by western blot, while another
fraction was plated at a density of 400 cells/well for colony assays. After 7 days (SHEP.MYCN3), 10
days (KELLY), or 14 days (BE2C), colonies were counted for each condition as described above. Data
are displayed as the combination of at least three independent experiments.
Pulsed-field gel electrophoresis
Cells were treated as indicated, collected by trypsinization, resuspended in 1% InCert-agarose in PBS
(Bio-Rad) to a final concentration of 1.5 million cells/100μL, and agarose plugs were separated by
pulsed-field gel electrophoresis (CHEF-DR II System, Bio-Rad) as previously described (54). After
electrophoresis, gels were stained with ethidium bromide and quantified for the amount of double
stranded breaks (DSBs) normalized to intact DNA using ImageJ; data from two independent
experiments are presented.
Statistical analysis
Unless otherwise stated, all statistical analysis was conducted in Graphpad Prism 6 software, and p-
values were determined using unpaired two-sided t-tests. When exact p-values are not provided on
graphs, refer to table S7 for more details.
Supplementary Figure S1 – Data supporting Fig. 1. (A) Kaplan-Meier plots for event-free survival of
649 neuroblastoma patients stratified by expression quartiles of the MYC target signature. MYC target
signature expression quartiles were generated by averaging the expression of all 51 gene members of the
MYC signature for each patient. Patients were ranked from lowest to highest, and quartiles were
generated: Q1, 0-25th patient percentile, Q2, 25th-50th patient percentile, Q3, 50th-75th patient
percentile, Q4, 75th-100th patient percentile. P-value applies to pairwise log-rank tests on Q1vsQ4,
Q2vsQ4, or Q3vsQ4. See table S7 for individual p-values. (B) Kaplan-Meier plots for event-free
survival of 649 neuroblastoma patients stratified by expression quartiles of SPT16 (left) and SSRP1
(right). Patients were ranked lowest to highest according to SPT16 or SSRP1 expression, and expression
quartiles were generated: Q1, 0-25th patient percentile, Q2, 25th-50th patient percentile, Q3, 50th-75th
patient percentile, Q4, 75th-100th patient percentile. P-value applies to pairwise log-rank tests on
Q1vsQ4, Q2vsQ4, or Q3vsQ4. See table S7 for individual p-values. (C) Kaplan-Meier plots for outcome
of 88 neuroblastoma patients dichotomized by median expression of SPT16 (left) and SSRP1 (right).
Data displayed is from Versteeg dataset (14), courtesy of the R2 microarray analysis and visualization
platform (http://r2.amc.nl). P-value determined using log-rank test. See table S7 for individual p-values.
(D) Expression of SSRP1 (left) and SPT16 (right) was evaluated in tumors from 649 neuroblastoma
patients and dichotomized by known clinical indicators: MYCN amplification status [non-amplified
(NA) vs. amplified (Amp)], stage [INSS 1, 2, or 4S (low) vs. Stage 3 or 4 (high)], and age (<18 months
vs. >18 months). Box-plots for the middle 50% of observations (box) and the 95% confidence interval
(whiskers) are shown. ***, p<0.001. See table S7 for individual p-values. (E) Correlation of mRNA
expression for SSRP1 and SPT16 in tumors from 649 neuroblastoma patients as indicated. MYCN-
amplified patients are indicated in red and MYCN non-amplified patients are in green. P-value and R-
value were determined using Pearson correlation coefficient test. See table S7 for individual p-values.
(F-G) Correlation of mRNA expression for SSRP1 or SPT16 with MYCN or a published 51 gene MYC
target gene signature (7) in tumors from 649 neuroblastoma patients as indicated. MYC target signature
represents the average expression of all 51 gene members per patient. P-value and R-value were
determined using Pearson correlation coefficient test. See table S7 for individual p-values. (H) Kaplan-
Meier plots based on a 47 neuroblastoma patient tissue microarray. Overall survival of patients
dichotomized by known prognostic indicators: MYCN status (non-amplified vs. amplified), INSS (Stage
1, 2, or 4S vs. 3 or 4), and age (<18 months vs. > 18 months). P-values were determined using log-rank
tests. (I) Kaplan-Meier plots for overall survival of 47 patients included in a neuroblastoma tissue
microarray, according to low or high immunohistochemical staining for SSRP1. P-value determined
using log-rank tests based on immunohistochemical expression score. (J) SSRP1 protein expression in
neuroblastoma tumor tissue. Serial sections for SSRP1 immunohistochemical staining and hematoxylin
and eosin (H&E) are shown for representative MYCN non-amplified and MYCN-amplified samples
from a 47 patient neuroblastoma tissue microarray. High magnification (400x) representative images
displayed in the main image, low magnification (40X) of tumor core is presented in the inset. Scale bar
= 200 µm. (K) SSRP1 expression score in a tissue microarray of neuroblastoma patients, calculated for
MYCN non-amplified (n=35) and MYCN-amplified patients (n=9). Data displayed represent mean
immunohistochemical expression score ± standard deviation. P-value determined using Mann Whitney
test. (L) Whole cell protein extracts from 12 primary neuroblastoma tumors immunoblotted for SSRP1
and MYCN expression. GAPDH was used as a loading control. (M) Densitometry from (L), showing
average SSRP1 expression ± standard deviation. (N) Protein lysates isolated from a panel of
neuroblastoma cell lines and normal lung fibroblasts for immunoblotting of SPT16, SSRP1, MYCN, and
c-MYC expression. β-actin was used as a loading control. * non-specific band. (O) Densitometry results
from 3 replicate experiments as shown in (N) were combined to evaluate the correlation between MYC
proteins (MYCN in MYCN-amplified cells and c-MYC in MYCN non-amplified cells) with both
SSRP1 (left) and SPT16 (right) in neuroblastoma cells (n=11). P-value and R-value were calculated
using Pearson correlation coefficient test. (P) Densitometry results from 3 replicate experiments as
shown in (N) were combined to evaluate the correlation between SSRP1 and SPT16 in neuroblastoma
cells (n=11). P-value and R-value were calculated using Pearson correlation coefficient test. (Q)
Densitometry results from 3 replicate experiments as shown in (N) were combined to evaluate the
expression of SSRP1 (left) and SPT16 (right) in neuroblastoma cell lines compared with normal lung
fibroblasts (MRC5, WI-38 cells). Amp, amplified; NA, non-amplified. Data displayed represent mean ±
standard deviation. P-value calculated with unpaired two-sided t-test.
Supplementary Figure S2 – Data supporting Fig. 2. (A) Schematic of the promoter regions used in
chromatin immunoprecipitation (ChIP) assays. E-box refers to consensus MYC binding motif
corresponding to CANNTG sequence. TSS=transcriptional start site. (B) ChIP assay in BE(2)C cells for
MYCN enrichment at either SPT16 or SSRP1 promoter regions as denoted in (A). Relative MYCN
enrichment was calculated for SPT16 and SSRP1 promoters by dividing PCR products from target
primers by PCR products from primers targeting the negative control region. Data displayed represent
the average MYCN enrichment at target regions ± standard error from 3 biological replicates. For
MYCN siRNA-treated samples, siRNAs were added to cells 48 hours before harvest. (C) As for B),
except for KELLY cells. (D) Western blots for SPT16, SSRP1, and c-MYC protein expression in
MYCN non-amplified SH-SY5Y (left) and SK-N-AS cells (right) treated with control or c-MYC
siRNAs. Data displayed are from lysates collected 48 hours after transfection. GAPDH was used as a
loading control. (E) Western blots for SPT16, SSRP1, and MYCN protein expression in BE(2)C cells
(left) and KELLY cells (right) treated with control, SPT16, or SSRP1 siRNA. Data displayed are 72
hours after transfection. GAPDH was used as a loading control. (F) MYCN mRNA expression in
MYCN-amplified BE(2)C and MYCN non-amplified SKN-FI cells treated with control (empty) or co-
transfected with SPT16 + SSRP1 expression plasmids. Data calculated 48 hours after treatment. Data
displayed are the mean of 3 replicate experiments ± standard error. β2-Microglobulin (β2M) was used as
a reference gene. (G) Western blots for SPT16, SSRP1, and MYCN protein expression in BE(2)C cells
(left), KELLY cells (middle), and SKN-FI cells (right) treated with control (empty), SPT16, SSRP1, or
co-transfected SPT16 + SSRP1 expression plasmids. Data displayed are 24-48 hours after transfection
for co-transfection experiments and 72 hours after transfection for single transfection experiments.
GAPDH was used as a loading control. (H) Western blots for MYCN expression in BE(2)C cells treated
with control, SPT16, or SSRP1 siRNA and pre-incubated with cycloheximide (CHX) for the amounts of
time indicated. Data displayed are from 48 hours after transfection, and GAPDH was used as a loading
control (left). MYCN protein expression normalized to loading control was combined from the data of 3
independent biological replicates, and MYCN half-life was determined for all samples. Line charts
reflect average MYCN expression relative to the 0 time CHX value ± standard error (right). P-value
reflects the difference of MYCN half-life between control siRNA samples and both SSRP1 and SPT16
siRNA treated samples, comparing dissociation constants for each group based on one-phase
exponential decay regression. (I) Western blots for MYCN expression in BE(2)C cells treated with
control (empty) or cotransfected with SPT16 or SSRP1 expression plasmids and pre-incubated with
cycloheximide (CHX) for the amounts of time indicated. Data displayed are from 48 hours after
transfection, and GAPDH was used as a loading control (left). MYCN protein expression was
normalized to loading control and represents the data from 3 independent biological replicates. MYCN
half-life was determined for all samples. Line charts reflect average percentage MYCN expression
relative to the 0 time CHX value ± standard error (right). P-value reflects the difference of MYCN half-
life between empty-vector treated cells and co-transfected SSRP1/SPT16 plasmid-treated cells,
comparing dissociation constants for each group based on one-phase exponential decay regression. (J)
Gene set enrichment analysis (GSEA) on a global ranked list of differentially expressed genes in BE(2)C
cells treated with control or SSRP1 siRNA. Gene sets analyzed included the 50 most differentially
upregulated (UP_50) or downregulated (DN_50) genes after MYCN siRNA-1 (top) or MYCN siRNA-2
(bottom) in BE(2)C cells. FDR, false discovery rate. FDR and p-value were calculated using the GSEA
platform (http://www.broadinstitute.org/gsea/index.jsp).
Supplementary Figure S3 – Data supporting Fig. 3. (A) Representative immunohistochemistry
images comparing serial ganglion sections of postnatal wildtype and TH-MYCN+/+ mice. H&E staining
and immunoblotting for MYCN, SSRP1, and sympathetic neuron marker tyrosine hydroxylase (TH) are
displayed. Arrowheads indicate areas of neuroblast hyperplasia. Scale bar = 100 µm. (B) Semi-
quantitative histology scoring was used to determine the relative expression of MYCN in wildtype and
TH-MYCN+/+ mice through perinatal time points as indicated. P-value was calculated using ANOVA,
testing the significance of genotype as the source of variation. At least 3 independent mice had one or
more ganglia present for analysis for each time point/genotype. (C-F) Analysis of
immunohistochemistry from (A). C) Histology scoring was used to evaluate the correlation between
SSRP1 and MYCN expression score in ganglia. P-value and R-value calculated using Spearman's rank
correlation coefficient test. D) Mean histology expression score in ganglia was determined for MYCN
and SSRP1, and was compared for overall (Ov) score or by cell type within each ganglion section: Nb,
neuroblasts, Ga, ganglion cells. ns, non-significant (p>0.05). P-value calculated using Mann Whitney
test. E) Histology scoring was used to determine the relative expression of SSRP1 and correlated with
the total percentage area of cells that are neuroblasts in each ganglion section. P-value and R-value
calculated using Spearman's rank correlation coefficient test. F) Histology scoring was used to determine
the relative expression of MYCN and its correlation with the total percentage area of cells that are
neuroblasts in each ganglion section. P-value and R-value calculated using Spearman's rank correlation
coefficient test. (G) Representative images of tumor histology from mice after treatment as in Fig. 3E
(left) and quantitation of the average number of ganglion-like cells identified per tumor, 50 fields/tumor
analyzed (vehicle, n=9; CBL0137, n=10) (right). Arrowheads indicate examples of ganglion-type cells.
P-value determined using Mann Whitney test. (H) SSRP1 and SPT16 mRNA expression in SH-SY5Y
cells treated with pro-differentiation agent all-trans retinoic acid (αRA) for incubation times as indicated.
Each timepoint is the mean of two independent experiments ± standard error. Data from Takeda dataset
(16), courtesy of the R2 microarray analysis and visualization platform (http://r2.amc.nl). (I) Primary
sympathetic ganglia from 2 week old TH-MYCN+/+ or wildtype age-matched controls were isolated and
cultured as in Figure 3F. Ganglia cultures were treated with serum-rich or serum-deprived medium (1/30
normal concentration of serum) for 48 hours, as well as CBL0137 at various concentrations for 24 hours,
and viability was calculated by counting βIII-tubulin positive cells for each of the TH-MYCN+/+ or
wildtype cultures. CBL0137 inhibitory concentration 50 (IC50) was normalized to untreated samples for
each condition. Data displayed are from the average of 3 independent biological replicates. ns= non-
significant (p>0.05). (J) 6-day-old wildtype or TH-MYCN+/+ mice were treated with intraperitoneal
vehicle control (0.2% methylcellulose) or CBL0137 for 5 days (10 mg/kg/day), and primary sympathetic
ganglia were isolated and cultured. Cultures were treated with serum-rich or serum-deprived medium
(1/30 normal concentration) for 48 hours, and mean cell number per microscopic field was determined
by counts for βIII-tubulin positive immunofluorescence for each of the TH-MYCN+/+ or wildtype
cultures as indicated. Data represent mean cells per microscopic field ± standard error from 3
independent biological replicates. ns= non-significant (p>0.05), w/d = withdrawal. (K-L) Primary
sympathetic ganglia from 2 week old TH-MYCN+/+ mice were isolated and cultured and treated with
CBL0137 and varying concentrations of p53 inhibitor, pifithrin α (PFTα) (K) or pan-caspase inhibitor
OPH-Q-VD (L). Graphs display percentage cell viability as determined by counts for βIII-tubulin
positive immunofluorescence normalized to untreated/serum-rich samples for TH-MYCN+/+ mice. Data
are displayed as average cell viability ± standard error from 3 independent biological replicates. (M)
Primary sympathetic ganglia from 2 week old TH-MYCN+/+ or wildtype aged matched controls were
isolated and cultured. Ganglia cultures were treated with serum-rich or serum-deprived medium (1/30
normal concentration) for 48 hours, as well as nutlin-3a at various concentrations for 24 hours, and
viability was calculated by cell counts on βIII-tubulin positive cells for each of the TH-MYCN+/+ or
wildtype cultures. Nutlin-3a inhibitory concentration 50 (IC50) was normalized to untreated samples for
each condition. Data displayed are from the average of 3 independent biological replicates. ns= non-
significant (p>0.05). (N) From (M), plot shows the non-linear regression line of percentage cell viability
as determined by counts for βIII-tubulin positive immunofluorescence normalized to untreated/serum-
rich samples for each of the TH-MYCN+/+ or wildtype cultures. Data displayed as average cell viability
± standard error from the combination of 3 independent biological replicates. Red circle indicates the
concentration of Nutlin3a that is required in serum-deprived TH-MYCN+/+ cultures to cause equal cell
viability to serum-deprived wildtype cultures. (O-P) Primary sympathetic ganglia from 2 week old TH-
MYCN+/+ mice were isolated and cultured and treated with nutlin-3a, and varying concentrations of p53
inhibitor PFTα (O) or pan-caspase inhibitor OPH-Q-VD (P). Graph displays percentage cell viability as
determined by counts for βIII-tubulin positive immunofluorescence normalized to untreated/serum-rich
samples for TH-MYCN+/+ mice. Data displayed as average cell viability ± standard error from 3
independent biological replicates.
Supplementary Figure S4 – Data supporting Fig. 4. (A-B) Resazurin reduction assays were
conducted on A) MYCN-amplified BE(2)C cells or B) c-MYC-overexpressing SH-SY5Y cells treated
with control siRNA or siRNAs directed against SPT16 or SSRP1 for 72, 96, and 120 hours as indicated.
Plots display mean relative cell viability compared to control siRNA-treated samples ± standard error
from 3 independent biological replicates. **, p<0.01. See table S7 for individual p-values. (C)
SHEP.MYCN3 cells were treated with doxycycline (dox) to induce MYCN overexpression or without
doxycycline to keep MYCN at low endogenous levels. Combined siRNAs directed toward SSRP1 and
SPT16 were then used to knockdown FACT subunits, and protein expression of SPT16, SSRP1, and
MYCN was determined by western blot. GAPDH was used as a loading control. (D) Cells treated as in
(C) were plated for colony formation assays. Colony number was counted and normalized to dox-
negative and siControl-treated cells (-). Data displayed are the mean normalized proportion of colonines
from 3 replicate experiments ± standard error. Images in insets are displayed to show examples of
colony formation plates. (E) CBL0137 dose response curves from Fig. 4A using resazurin reduction
assays. Non-linear regression curves were calculated in Graphpad Prism using non-linear regression
analysis on log10 adjusted X values (CBL0137 concentration). (F) ChIP assay in BE(2)C cells (left) and
KELLY cells (right) for MYCN enrichment at either SPT16 or SSRP1 promoter regions as denoted in
fig. S2A. Relative MYCN enrichment was calculated for SPT16 and SSRP1 promoters by dividing PCR
products from target primers by PCR products from primers targeting the negative control region. Data
displayed represent the average MYCN enrichment at target regions ± standard error from 3 biological
replicates. For CBL0137-treated samples, 0.25 µM was added to cells 48 hours before harvest.
Supplementary Figure S5 – Data supporting Fig. 5. (A) Kaplan-Meier plot for survival of 6-week-old
tumor-bearing TH-MYCN+/+ mice treated with vehicle (5% dextrose) or intravenous CBL0137 (20, 40,
or 60 mg/kg, once every 4 days for 4 weeks). Log-rank test was used to determine statistical significance
between CBL0137-treated groups, compared to vehicle. Mice began treatment when medium-sized (~5
mm) palpable tumors were detected. Endpoint was when tumors reached 10 mm by palpation. ℞ indicates treatment period. (B) Representative H&E images for TH-MYCN+/+ tumors treated with
vehicle or i.v. CBL0137 (1 day x 20, 40, or 60 mg/kg/day). Data represent mean ± standard error. 5
mice per treatment group. (C) Representative images of H&E stained lungs from TH-MYCN+/+ mice
treated with vehicle or i.v. CBL0137 (1 day x 20, 40, or 60 mg/kg/day). Arrowheads indicate
neuroblastoma metastases. 5 mice per treatment group. (D) CBL0137 was quantified in tissues from TH-
MYCN+/+ mice treated with i.v. CBL0137 (1 day x 20, 40, or 60 mg/kg/day). Data displayed as the mean
CBL0137 concentration from 5 mice per treatment group ± standard deviation. (E) Correlation of
CBL0137 tissue concentration and tumor viability from TH-MYCN+/+ mice treated with i.v. CBL0137
(1 day x 20, 40, or 60 mg/kg/day). P-value and R-value determined using Spearman's rank correlation
coefficient. (F) Kaplan-Meier plots of BALB/c nude mice bearing subcutaneous BE(2)C xenograft
tumors treated with vehicle (5% dextrose) or i.v. CBL0137 (60 mg/kg, once every 4 days for 4 weeks).
P-value determined using log-rank test. Mice began treatment when medium-sized (~5 mm diameter)
palpable tumors were detected. ℞ indicates treatment period. (G) MYCN protein expression in
subcutaneous BE(2)C xenograft tumors (ID 1-17 are tumor identifiers) from BALB/c nude mice treated
with vehicle (5% dextrose) or intravenous CBL0137 (60 mg/kg once every 4 days for 4 weeks). Western
blot (left) and densitometry ± standard deviation (right) are shown. Tumors were harvested for protein
when they reached 1000 mm3 in size.
Supplementary Figure S6 – Data supporting Fig. 6. (A) Resazurin reduction assays were conducted
on MYCN-amplified neuroblastoma cells (BE(2)C, KELLY) and normal fibroblast controls (WI38,
MRC5) treated with CBL0137 or mafosfamide alone or in combination. Plots display mean relative cell
viability compared to untreated samples ± standard error from 3 independent biological replicates.
Combination index (CI) at a fractional cell kill of 0.80 is shown using the Chou and Talalay method (43,
53). CI<0.9, synergistic; 0.9<CI<1.1, additive; CI>1.1, antagonistic. (B) From A), cell viability for the
CBL0137/mafosfamide combination is shown relative to the product of their respective individual doses
for neuroblastoma and normal fibroblast cell lines. Non-linear regression was used on log-transformed
CBL0137/mafosfamide doses (the product of the two individual doses for CBL0137 and mafosfamide).
P-value was determined using extra sum of squares F-test and reflects multiple comparisons for
neuroblastoma and normal fibroblast cell lines as follows: BE(2)C vs. Wi38, BE(2)C vs. MRC5,
KELLY vs. Wi38, KELLY vs. MRC5. (C-D) Colony-forming assays for BE(2)C cells (C) and KELLY
cells (D) treated with CBL0137 (CBL) in combination with topotecan (TOPO), cisplatin (CIS),
etoposide (VP16), irinotecan (SN38), vincristine (VCR), or temozolomide (TEMOZ). Combination
index (CI) at a fractional cell kill of 0.80 is shown using the Chou and Talalay method (43, 53). CI<0.9,
synergistic; 0.9<CI<1.1, additive; CI>1.1, antagonistic. (E) Kaplan-Meier plots for survival of BALB/c
nude mice with subcutaneously xenografted BE(2)C cells treated with vehicle (5% dextrose), or
intravenous 60 mg/kg CBL0137 (once every 4 days for 4 weeks) combined with i) 10 mg/kg/day
cyclophosphamide and 0.5 mg/kg/day topotecan (left) or ii) 2 mg/kg/day irinotecan (irino) and
5mg/kg/day temolozomide (temoz) (right). Mice were treated when tumors reached 50 mm3 and
endpoint was 1000 mm3. CPM, topo, irino, and temoz were all administered for 5 consecutive days
intraperitoneally. P-value was determined using pairwise log-rank test for CBL0137/chemotherapy
combinations vs. their respective treatment controls. ℞ indicates treatment period.
Supplementary Figure S7 – Data supporting Fig. 7. (A) BE(2)C cells were treated for 24 hours with
or without the following agents: 0.5 μM vincristine (VCR) or 2 mM hydroxyurea (HU). These agents
were subsequently removed, and medium was supplemented with or without CBL0137 for 22 hours
(refer to the schematic above the gel for the administration schedule). The repair of DNA double
stranded breaks (DSBs) caused by these agents in the presence or absence of CBL0137 was determined
using pulsed-field gel electrophoresis. Data displayed are representative of 2 independent biological
replicates. Dashed white lines indicate areas where the gel was cropped for presentation. (B) The
experiment was performed as in A), except that treated cells were examined by western blot for DNA-
damage marker H2AX. β-actin was used as a loading control.
Supplementary Figure S8 – Fluorescence in situ hybridization for MYCN amplification in
tissue microarray. White arrowheads indicate MYCN amplifications.
MYCN non-amplified
MYCN-amplified
Supplementary Table S1: Cox proportional hazards modeling of MYC target signature members in 649
neuroblastoma patients.
Variables Univariate1
1. Gene expression (continuous) Multivariate 11
1. Gene expression (continuous) Multivariate 21
1. Gene expression (continuous)
2. MYCN status (amp vs. non-amp) 2. MYCN status (amp vs. non-amp)
3. INSS (3 or 4 vs. 1, 2, or 4S)
4. Age (>18 m vs. <18 m)
ID p HR p HR p HR
MYC SIG (Average) 2.7E-35 47.6 3.2E-12 19.7 2.7E-04 4.9
GAR1 5.5E-37 17.7 1.7E-19 11.1 1.4E-06 4.2
DKC1 1.4E-30 12.1 2.2E-09 6.3 9.6E-02 1.6
FBL 1.1E-26 10.1 2.1E-07 4.4 1.3E-02 2.1
SDAD1 2.3E-18 9.0 2.9E-09 5.1 1.5E-03 2.4
NOLC1 1.3E-23 8.9 6.9E-08 4.1 1.8E-03 2.2
CCT3 9.5E-16 8.2 4.6E-07 4.2 3.7E-03 2.3
NOP16 2.1E-30 8.1 2.4E-14 5.2 2.9E-04 2.4
ILF3 2.8E-23 7.9 4.7E-07 3.7 3.8E-03 2.3
WDR74 4.1E-35 7.6 1.4E-18 5.5 1.0E-04 2.4
SPT16 2.7E-17 7.2 5.1E-08 4.1 8.2E-03 2.0
GART 1.4E-20 7.1 2.6E-06 3.3 9.6E-03 1.9
POLE3 2.2E-22 6.9 1.2E-06 3.2 2.6E-02 1.8
SLIRP 2.7E-17 6.4 8.2E-06 3.2 2.7E-01 1.3
DHX9 1.4E-09 5.5 1.3E-02 2.1 1.2E-01 1.5
C10ORF2 2.2E-25 5.4 5.8E-11 3.5 4.5E-04 2.0
CCDC47 4.2E-10 5.3 4.3E-05 3.2 2.1E-01 1.4
PINX1 1.0E-23 4.8 1.2E-10 3.3 9.6E-06 2.3
WDR3 1.3E-14 4.7 1.5E-02 1.8 7.0E-01 1.1
G3BP1 9.9E-11 4.6 2.2E-03 2.2 1.4E-01 1.5
ABCE1 2.2E-14 4.5 2.8E-01 1.3 7.5E-01 1.1
GPATCH4 1.7E-17 4.5 1.7E-07 2.8 7.9E-02 1.4
APEX1 5.4E-21 4.4 2.7E-05 2.4 5.9E-02 1.5
PAICS 7.8E-25 4.4 1.0E-04 2.3 7.9E-02 1.5
NOP58 6.9E-07 4.3 3.1E-01 1.3 4.0E-01 1.2
GNL3 1.3E-11 3.8 7.0E-01 0.9 8.0E-01 0.9
PES1 1.4E-15 3.8 2.2E-05 2.3 8.2E-03 1.7
DDX21 1.2E-10 3.7 1.5E-02 1.8 2.4E-01 1.3
TRA2B 4.0E-08 3.6 1.1E-02 2.0 2.2E-02 1.6
POLR1B 6.5E-15 3.6 5.0E-05 2.2 2.6E-01 1.3
HNRPDL 1.2E-04 3.3 6.1E-01 1.2 5.6E-01 1.2
SMARCC1 7.2E-09 3.2 7.2E-01 1.1 8.6E-01 1.0
SURF6 1.2E-05 2.9 7.4E-05 2.9 1.2E-03 1.5
DTL 3.3E-17 2.9 8.0E-09 2.1 3.8E-02 1.7
FAM216A 7.7E-07 2.6 6.7E-01 0.9 5.9E-01 0.9
CYP27B1 1.6E-23 2.5 2.9E-08 1.9 4.8E-04 1.5
HSP90AB1 3.3E-04 2.5 2.3E-01 1.4 3.4E-01 1.3
SRM 1.1E-06 2.5 9.8E-03 1.8 3.4E-01 1.2
NOL6 2.6E-10 2.4 1.7E-05 2.1 2.1E-01 1.3
METTL1 2.3E-21 2.2 9.7E-07 1.7 4.3E-02 1.3
DDX39B 1.0E-03 2.1 6.6E-02 1.5 2.2E-01 1.3
NOL11 1.8E-03 2.1 4.2E-01 1.2 8.8E-01 1.0
ZWILCH 8.7E-07 2.1 2.8E-03 1.6 5.8E-02 1.4
SERBP1 6.8E-09 1.9 3.0E-01 0.9 9.0E-02 1.2
TSR1 2.3E-02 1.8 9.1E-01 1.0 3.2E-01 1.3
DCAF13 2.6E-03 1.7 5.0E-01 1.1 4.5E-01 1.1
CISD1 1.6E-02 1.5 3.4E-03 2.0 1.9E-01 1.2
PELP1 1.4E-01 1.4 8.7E-01 1.0 2.6E-01 1.3
RIOK2 2.6E-01 1.2 7.4E-04 1.5 6.3E-01 0.9
ANAPC1 2.3E-01 1.2 3.5E-01 1.3 4.1E-01 1.2
WDR75 5.7E-01 1.1 3.7E-02 0.7 4.1E-01 0.9
YWHAG 1.1E-03 0.5 9.8E-01 1.0 7.7E-01 1.1 1 Cox regression analysis of individual gene members of 51-gene MYC signature considering factors prognostic for overall survival in neuroblastoma (n=649). Hazard ratios were calculated on the regression coefficients in the proportional hazards model. Multivariate analysis was performed after inclusion of prognostic factors into the Cox regression model as indicated. HR=Hazard ratio. Red cells indicate p<0.05 or HR>=2.0. Green cells indicate HR<=0.5.
Supplementary Table S2: Literature analysis of lead candidates that favor poor outcome in
neuroblastoma.
Gene HR Function Evidence in
cancer Chemical Inhibitor
Cancer References
GAR1 17.7 Ribonuclear protein NA
FBL 10.1 Ribonuclear protein (Oncogene) (55)
SDAD1 9.0 Ribosomal biogenesis NA
NOLC1 8.9 Nucleolar antigen (Oncogene) (56)
CCT3 8.2 Protein folding NA
NOP16 8.1 Ribosomal biogenesis (Oncogene) (57)
ILF3 7.9 RNA binding (Oncogene) (58)
WDR74 7.6 unknown NA
SPT16 7.2 Histone chaperone (Oncogene) (10,12)
C10ORF2 5.4 Mitochondrial DNA
metabolism NA
PINX1 4.8 Telomerase inhibitor (TS) (59)
Literature review strategy included keywords for the standard gene name or alternate gene names for the gene, as well
as the term “cancer” to identify gene function, evidence in cancer, and reports for chemical inhibitors against the
target. All literature searches were undertaken in the PubMed database (http://www.ncbi.nlm.nih.gov/pubmed).
“Evidence in cancer” was considered positive if forced genetic upregulation or downregulation was associated with a
malignant phenotypical outcome in vitro or in vivo. Altered expression levels in cancer were not considered sufficient
evidence. Red cells indicate that SPT16 is the only candidate with evidence for a role in cancer that has a chemical
inhibitor available. HR, hazard ratio from univariate analysis, NA, not applicable, TS, tumor suppressor gene.
Supplementary Table S3. Cox proportional hazards modeling of SSRP1 and SPT16 in 649
neuroblastoma patients.
A) SSRP1
Marker Patients
(n) Available
(n) Hazard Ratio 95% CI
p-value
Model considering SSRP1 expression based on OS 649 645 SSRP1 expression (continuous) 12.5 7.8-20.0 <0.001
Model considering MYCN status and SSRP1 expression based on OS 649 645 MYCN status (amp vs. non-amp) 4.5 3.2-6.4 <0.001 SSRP1 expression (continuous) 9.5 5.5-16.5 <0.001
Model considering individual prognostic markers and SSRP1 expression based on OS 649 645 MYCN status (amp vs. non-amp) 2.9 2.0-4.1 <0.001 INSS (Stage 3 or 4 vs. Stage 1,2, or 4S) 3.6 1.9-6.6 <0.001 Age (>18 months vs. <18 months) 3.6 2.3-5.8 <0.001 SSRP1 expression (continuous) 4.1 2.3-7.4 <0.001
Model considering SSRP1 expression based on EFS 649 624
SSRP1 expression (continuous) 7.7 5.2-11.3 <0.001 Model considering MYCN status and SSRP1 expression based on EFS 649 624
MYCN status(amp vs. non-amp) 2.1 1.6-2.9 <0.001 SSRP1 expression (continuous) 6.2 4.1-9.5 <0.001
Model considering individual prognostic markers and SSRP1 expression based on EFS 649 624 MYCN status (amp vs. non-amp) 1.6 1.2-2.2 0.003 INSS (Stage 3 or 4 vs. Stage 1,2, or 4S) 1.9 1.3-2.7 0.001 Age (>18 months vs. <18 months) 1.8 1.3-2.5 <0.001 SSRP1 expression (continuous) 3.6 2.2-5.7 <0.001
Cox proportional hazards model for the relative hazard of SSRP1 expression (continuous) to overall survival (OS) and event-free
survival (EFS). Univariate and multivariate analysis considering MYCN amplification status (non-amplified vs. amplified) alone or
in combination with INSS grading (Stage 1, 2, or 4S vs. Stage 3 or 4) and age (<18 months vs. >18 months) are detailed as
indicated.
B) SPT16
Marker Patients
(n) Available
(n) Hazard Ratio 95% CI p-value
Model considering SPT16 expression based on OS 649 645 SPT16 expression (continuous) 7.2 4.6-11.4 <0.001
Model considering MYCN status and SPT16 expression based on OS 649 645 MYCN status(amp vs. non-amp) 4.9 3.4-7.1 <0.001 SPT16 expression (continuous) 4.1 2.5-6.8 <0.001
Model considering individual prognostic markers and SPT16 expression based on OS 649 645 MYCN status (amp vs. non-amp) 2.8 1.9-3.9 <0.001 INSS (Stage 3 or 4 vs. Stage 1,2, or 4S) 4.4 2.4-8.1 <0.001 Age (>18 months vs. <18 months) 3.8 2.4-6.1 <0.001 SPT16 expression (continuous) 2.0 1.2-3.4 0.008
Model considering SPT16 expression based on EFS 649 624
SPT16 expression (continuous) 4.0 2.7-5.8 <0.001 Model considering MYCN status and SPT16 expression based on EFS 649 624
MYCN status(amp vs. non-amp) 2.4 1.7-3.3 <0.001 SPT16 expression (continuous) 2.9 1.9-4.3 <0.001
Model considering individual prognostic markers and SPT16 expression based on EFS 649 624 MYCN status (amp vs. non-amp) 1.6 1.2-2.3 0.003 INSS (Stage 3 or 4 vs. Stage 1,2, or 4S) 2.3 1.6-3.3 <0.001 Age (>18 months vs. <18 months) 1.9 1.4-2.6 <0.001 SPT16 expression (continuous) 1.7 1.1-2.6 0.014
Cox proportional hazards model for the relative hazard of SPT16 expression (continuous) to overall survival (OS) and event free survival (EFS). Univariate and multivariate analysis considering MYCN-amplification status (non-amplified vs. amplified) alone or in combination with INSS grading (Stage 1, 2, or 4S vs. Stage 3 or 4) and age (<18 months vs. >18 months) are detailed as indicated.
Supplementary Table S4: Gene set enrichment analysis of 2-week-old TH-MYCN+/+ ganglia
compared with age-matched wild-type mice.
Supplementary Table S5: Histology of TH-MYCN+/+ mice treated with oral or intravenous CBL0137.
Supplementary Table S6: Histology of TH-MYCN+/+ mice treated with a dose-escalating regimen of
intravenous CBL0137.
Mouse ID Treatment Tumor Type Viable Tumor (%)
Pulmonary Metastases Lymphocytic Infiltrate
D14748 Vehicle PD 80 Present Extratumoral D14812 Vehicle PD 95 Present Extratumoral D14816 Vehicle PD 80 Present Absent D14896 Vehicle PD 95 Present Absent D15056 Vehicle PD 87.5 Present Absent
D14728 1x20 mg/kg CBL0137 UD 87.5 Present Absent D14817 1x20 mg/kg CBL0137 UD 82.5 Present Absent D14843 1x20 mg/kg CBL0137 PD 90 Present Intratumoral D14910 1x20 mg/kg CBL0137 UD 92.5 Absent Intra & extra D15059 1x20 mg/kg CBL0137 PD 85 Present Intratumoral
D14743 1x40 mg/kg CBL0137 PD 45 Absent Extratumoral D14815 1x40 mg/kg CBL0137 PD 57.5 Present Intratumoral D14840 1x40 mg/kg CBL0137 PD 72.5 Present Absent D14863 1x40 mg/kg CBL0137 UD 52.5 Present Extratumoral D15058 1x40 mg/kg CBL0137 PD 82.5 Present Intratumoral
D14747 1x60 mg/kg CBL0137 UD 17.5 Absent Intratumoral D14766 1x60 mg/kg CBL0137 UD 7.5 Absent Absent D14830 1x60 mg/kg CBL0137 UD 1.5 Absent Absent D14882 1x60 mg/kg CBL0137 PD 7.5 Absent Absent D14937 1x60 mg/kg CBL0137 UD 12.5 Absent Absent
UD-undifferentiated; PD-poorly differentiated
Gene set Normalized
enrichment score
p-value False discovery
rate ONGUSAHA_TP53_TARGETS -1.85 0.000 0.002
PEREZ_TP53_AND_TP63_TARGETS -1.74 0.000 0.006
TANG_SENESCENCE_TP53_TARGETS_UP -1.58 0.022 0.025
Mouse ID Treatment
Morphology
Tumor Type
Ganglion Cells
Stroma H&N (%)
Viable Tumor
(%)
cPARP (%)
MKI Calcification
Inflammatory cells
D6172 Vehicle UD Absent Focal (<50%) 15 85 3 High Absent MФ, lymphocytes D7605 Vehicle PD <5% Patchy (<50%) 5 95 5 High Absent MФ, lymphocytes D7622 Vehicle UD <5% Patchy (<50%) 10 90 2 High Absent MФ, lymphocytes D7623 Vehicle UD Absent Focal (<50%) 15 85 3 High Absent MФ D7745 Vehicle PD <5% Patchy (<50%) 10 90 5 High Absent MФ, lymphocytes
D6107 CBL0137 Oral PD <5% Inconspicuous 15 85 5 High Focal MФ, lymphocytes D6158 CBL0137 Oral UD Absent Patchy (<50%) 20 80 2 High Absent MФ, lymphocytes D6191 CBL0137 Oral PD <5% Inconspicuous 20 80 5 High Absent MФ D6241 CBL0137 Oral PD <5% Inconspicuous 25 75 5 High Patchy MФ D7636 CBL0137 Oral PD <5% Patchy (<50%) 60 40 2 High Patch MФ
D7490 CBL0137 i.v. PD <5% Conspicuous (<50%) 80 15 10 Int-High Absent MФ, lymphocytes D7540 CBL0137 i.v. PD <5% Patchy-consp (<50%) 70 30 10 Int-High Absent MФ, lymphocytes D7552 CBL0137 i.v. PD <5% Patchy-consp (<50%) 85 15 15 Int-High Absent MФ, lymphocytes D7555 CBL0137 i.v. PD Absent Patchy (<50%) 85 15 15 Low-Int Absent MФ D7739 CBL0137 i.v. PD <5% Patchy (<50%) 90 10 70 High Focal absent
UD-undifferentiated; PD-poorly differentiated; H&N-hemorrhage and necrosis; cPARP-cleaved PARP; int-intermediate; MФ-macrophage
Supplementary Table S7: P values not shown in figures.
Figure Comparison Test Software p-value
1B MYC signature - Q4 vs Q1 log-rank SPSS 1.7214E-18
1B MYC signature - Q4 vs Q2 log-rank SPSS 5.4779E-14
1B MYC signature - Q4 vs Q3 log-rank SPSS 0.00002
1C SPT16 - Q4 vs Q1 log-rank SPSS 2.1596E-14
1C SPT16 - Q4 vs Q2 log-rank SPSS 2.1808E-11
1C SPT16 - Q4 vs Q3 log-rank SPSS 0.000007
1C SSRP1 - Q4 vs Q1 log-rank SPSS 1.87322E-19
1C SSRP1 - Q4 vs Q2 log-rank SPSS 1.80549E-13
1C SSRP1 - Q4 vs Q3 log-rank SPSS 4.0702E-05
S1A MYC signature - Q4 vs Q1 log-rank SPSS 5.8678E-17
S1A MYC signature - Q4 vs Q2 log-rank SPSS 7.2255E-12
S1A MYC signature - Q4 vs Q3 log-rank SPSS 0.000816
S1B SPT16 - Q4 vs Q1 log-rank SPSS 8.8535E-11
S1B SPT16 - Q4 vs Q2 log-rank SPSS 0.000001
S1B SPT16 - Q4 vs Q3 log-rank SPSS 0.000193
S1B SSRP1 - Q4 vs Q1 log-rank SPSS 8.0575E-18
S1B SSRP1 - Q4 vs Q2 log-rank SPSS 4.9124E-12
S1B SSRP1 - Q4 vs Q3 log-rank SPSS 0.000589
S1C SPT16 - OS- High vs Low log-rank R2 Microarray platform 0.00039
S1C SPT16 - EFS- High vs Low log-rank R2 Microarray platform 0.0043
S1C SSRP1 - OS- High vs Low log-rank R2 Microarray platform 0.000000031
S1C SSRP1 - EFS- High vs Low log-rank R2 Microarray platform 0.0000021
S1D SSRP1 - MYCN amp vs MYCN non-amp t-test SPSS 1.42099E-17
S1D SSRP1- >18 m vs <18 m t-test SPSS 8.8947E-17
S1D SSRP1 - INSS high vs INSS low t-test SPSS 3.8886E-26
S1D SPT16 - MYCN Amp vs MYCN non AMP t-test SPSS 1.7417E-16
S1D SPT16- >18 m vs <18 m t-test SPSS 6.3887E-16
S1D SPT16 - INSS high vs INSS low t-test SPSS 1.2591E-14
S1E correlation SSRP1/SPT16 Pearson correlation SPSS 2.08E-46
S1F correlation SSRP1/MYCN Pearson correlation R2 Microarray platform 1.6E-16
S1F correlation SPT16/MYCN Pearson correlation R2 Microarray platform 4.7E-16
S1G correlation SSRP1/MYC signature Pearson correlation SPSS 2.9518E-85
S1G correlation SPT16/MYC signature Pearson correlation SPSS 1.1976E-93
2A BE2C - SPT16: siCNT vs siMYCN-1 t-test Prism < 0.0001
2A BE2C - SPT16: siCNT vs siMYCN-2 t-test Prism 0.0019
2A BE2C - SSRP1: siCNT vs siMYCN-1 t-test Prism < 0.0001
2A BE2C - SSRP1: siCNT vs siMYCN-2 t-test Prism 0.0002
2A BE2C - MYCN: siCNT vs siMYCN-1 t-test Prism < 0.0001
2A BE2C - MYCN: siCNT vs siMYCN-2 t-test Prism < 0.0001
2A KELLY - SPT16: siCNT vs siMYCN-2 t-test Prism 0.0009
2A KELLY - SPT16: siCNT vs siMYCN-2 t-test Prism 0.0011
2A KELLY - SSRP1: siCNT vs siMYCN-1 t-test Prism 0.0226
2A KELLY - SSRP1: siCNT vs siMYCN-2 t-test Prism 0.0008
2A KELLY - MYCN: siCNT vs siMYCN-1 t-test Prism < 0.0001
2A KELLY - MYCN: siCNT vs siMYCN-2 t-test Prism 0.0003
2C BE2C - SPT16: siCNT vs siSSRP1+siSPT16 t-test Prism 0.0006
2C BE2C - SSRP1: siCNT vs siSSRP1+siSPT16 t-test Prism < 0.0001
2C BE2C - MYCN: siCNT vs siSSRP1+siSPT16 t-test Prism 0.0001
2C KELLY - SPT16: siCNT vs siSSRP1+siSPT16 t-test Prism < 0.0001
2C KELLY - SSRP1: siCNT vs siSSRP1+siSPT16 t-test Prism < 0.0001
2C KELLY - MYCN: siCNT vs siSSRP1+siSPT16 t-test Prism 0.0004
S4A BE2C - siCNT vs siSPT16 72 hrs t-test Prism 0.0131
S4A BE2C - siCNT vs siSPT16 96 hrs t-test Prism 0.0006
S4A BE2C - siCNT vs siSPT16 120 hrs t-test Prism <0.0001
S4A BE2C - siCNT vs siSSRP1 72 hrs t-test Prism 0.029
S4A BE2C - siCNT vs siSSRP1 96 hrs t-test Prism <0.0001
S4A BE2C - siCNT vs siSSRP1 120 hrs t-test Prism 0.001
S4B SH-SY5Y - siCNT vs siSPT16 72 hrs t-test Prism 0.0091
S4B SH-SY5Y - siCNT vs siSPT16 96 hrs t-test Prism 0.0001
S4B SH-SY5Y - siCNT vs siSPT16 120 hrs t-test Prism 0.0054
S4B SH-SY5Y - siCNT vs siSSRP1 72 hrs t-test Prism 0.001
S4B SH-SY5Y - siCNT vs siSSRP1 96 hrs t-test Prism 0.0072
S4B SH-SY5Y - siCNT vs siSSRP1 120 hrs t-test Prism 0.0143
5B Viability % - CBL0137 i.v. vs Vehicle Mann Whitney U Prism 0.0079
5B Apoptosis % - CBL0137 i.v. vs Vehicle Mann Whitney U Prism 0.0079
