Supplementary Materials for · 2013-05-20 · Supplementary Materials and Methods Analysis of the epigenetic characteristics of the promoter regions of testis and placenta restricted

www.sciencetranslationalmedicine.org/cgi/content/full/5/186/186ra66/DC1

Supplementary Materials for

Ectopic Activation of Germline and Placental Genes Identifies Aggressive Metastasis-Prone Lung Cancers

Sophie Rousseaux,* Alexandra Debernardi, Baptiste Jacquiau, Anne-Laure Vitte,

Aurélien Vesin, Hélène Nagy-Mignotte, Denis Moro-Sibilot, Pierre-Yves Brichon, Sylvie Lantuejoul, Pierre Hainaut, Julien Laffaire, Aurélien de Reyniès, David G. Beer, Jean-François Timsit, Christian Brambilla, Elisabeth Brambilla, Saadi Khochbin*

*Corresponding author. E-mail: [email protected] (S.R.); [email protected] (S.K.)

Published 22 May 2013, Sci. Transl. Med. 5, 186ra66 (2013)

DOI: 10.1126/scitranslmed.3005723

The PDF file includes:

Materials and Methods Fig. S1. Epigenetic “locking” of genes restricted to germline or placental expression. Fig. S2. CpG methylation in the TSS regions of TS/PS genes. Fig. S3. Prognostic value of ectopic expression of the 26 genes in lung cancer of specific histological subgroups. Fig. S4. Prognostic value of ectopic expression of a subset of the 26 prognostic genes in an independent study of 443 lung ADCs. Table S1. List of the normal tissue samples from GEO studies used for our analyses of gene expression profiles in normal tissues. Table S2. List of genes with an expression restricted to male germ cells or placenta (TS/PS genes). Table S3. Description and list of the 1776 cancer samples analyzed from the Exp0 cancer study (GSE2129). Table S4. Percentage of positive expressions of TS/PS genes in the 14 different types of cancer analyzed from the Exp0 cancer study (GSE2129). Table S5. List of tissue samples and cell lines analyzed on the dedicated microarray. Table S6. List of primers used for qRT-PCR experiments. Table S7. Key clinical and biological data for the 293 lung cancer patients in our study. Table S8. Percentage of positive expressions of TS/PS genes in the different histological subtypes of our series of lung tumors. Table S9. Methylation levels (β values) of the selected 347 CpG sites associated with 88 TS/PS genes in the 55 lung tumors in our series.

Table S10. List of 26 genes associated with poor survival in lung cancer and results of univariate analysis of association with prognosis in our lung cancer patients. Table S11. HRs from the Cox regression model testing the association with prognosis in our set of 26 genes in a multivariate analysis, along with pathological data and TNM stages. Table S12. List of the 3272 genes that are differentially expressed between patients classified by our 26 TS/PS genes in the good prognostic group (P1) and patients in the poor prognostic group (P3). Table S13. List of relevant gene sets identified by GSEA from the Broad Institute Database corresponding to various GO terms (C5) and curated signatures (C2), including resistance to drugs or response to drugs, overlapping with our list of up- and down-regulated genes in P3 aggressive lung tumors.

1

Supplementary Materials and Methods

Analysis of the epigenetic characteristics of the promoter regions of testis and placenta

restricted genes (TS/PS) in somatic cells

An analysis of publicly available pangenomic data was used to determine the epigenetic status

of the promoter regions of the TS/PS. Three genome-wide studies of the human epigenome

were considered: 1) Data on the methylation status of promoters (by MeDIP) in human

fibroblasts and sperm, and their enrichment in RNA polymerase II and histone H3K4me2 (by

ChIP-chip) in fibroblasts (9) 2) Data on the enrichment in polymerase, and various histone

modifications by ChIP-chip on human ES cells, reticulocytes and liver cells (10) 3) Chip-seq

data (11) in human lymphocytes, analyzing the enrichment in histone methylations at various

sites.

For the MeDIP and ChIP-chip experiments published by (9), we used the values published by

the authors (corresponding to the scaled log2 of the ratio of enrichment with MeDIP or ChIP-

chip). For the ChIP-chip experiments published by (10), the values were arbitrarily coded as -

1 or +1 corresponding to "not enriched" or "enriched", respectively, as defined by the authors.

Unavailable values were encoded “0”. For the ChIPSeq experiments published by (11), the

tag counts were individually recovered from the raw files available online, then normalized

and changed into logged relative enrichment values as follows. Considering each of the genes

of interest and each epigenetic mark, the numbers of tags assigned to the chromosome region

covering the 3Kb region upstream of the TSS were added together. Then, considering each

epigenetic mark, the values (sum of the tags counted in the 3Kb region upstream of the TSS)

were normalized using the mean value of all the analyzed genes and log2 transformed. The

heatmaps were obtained using the PermutMatrix software, after sorting the promoters

according to their CpG enrichment and methylation in fibroblasts to define three classes as

shown in the histograms, including hypermethylated CpG-rich, hypomethylated CpG-rich and

CpG-poor, and increasing enrichment in marks associated with poised (P) or active (A) genes

according to (10) and to (11).

Transcriptomic data analysis and statistics

Normal tissue samples

Transcriptomic data from 431 samples of normal human tissues available online from

publicly accessible databases (see GEO reference numbers and lists of samples in Supp. Table

S1) were included in our analysis. All these data were obtained with the Affymetrix

2

technology “Affymetrix.GeneChip.HG-U133_Plus_2” and are available on the GEO website

(http://www.ncbi.nlm.nih.gov/geo/). The .CEL files were downloaded and data were

normalized using the GeneSpring GX software (version 11, Agilent Technologies) and the

Robust Multi-array Average (RMA) algorithm for summarization (which uses Perfect

Match (PM)-only based measures) and quantile normalization, and then exported. These data

were then used to establish a list of genes with a predominant expression in one tissue and,

for each of these genes, to identify the group of tissues in which the maximum expression

was found. For this purpose, tissues were pooled into five defined groups, which are germline

tissues (including male and female germline), neurological tissues (neuro), embryonic stem

cells (hES), placenta, and adult somatic tissues (soma). For each gene, the values

corresponding to the mean expression in all tissues and the standard deviation were

calculated, as well as the maximum of the expression values. The group of tissues where this

maximum expression was found was also recorded. The gene was defined as predominantly

expressed in a tissue group if the maximum of expression was above a threshold defined as

the mean value of expression in all tissues + 3*standard deviation. Otherwise the gene was

considered to have no particular specificity of expression. In addition, a subset of 112

samples representative of adult somatic tissues (also listed in Supp. Table S1) was used to

establish threshold values to discriminate between expression and non-expression of germline

and placenta restricted genes (see below). These data were included in the workflows of

cancer data, and were therefore treated simultaneously for summarization, normalization and

analysis.

Cancer samples

Affymetrix .CEL files in the same format as above (“Human Genome U133 Plus 2.0 Array”)

were obtained for

- Our current series of 293 lung cancer patients (clinical data summarized in Table S7;

available online from GEO GSE30219)

- 1776 cancer samples representing 14 different types of solid tumors (listed in Table

S3) available online from GEO GSE2129 (Expression Project for Oncology named “expO”,

from the International Genomics Consortium: https://expo.intgen.org/geo/home.do)

The .CEL files were downloaded into the GeneSpring GX software (version 11, Agilent

Technologies) using the RMA algorithm for summarization (PM-based only measures) and

quantile normalization. The probes available with this technology enabled the detection of all

3

506 TS/PS genes on our list. For these studies, the normal adult somatic tissues of reference

were a subset of 112 samples from normal adult somatic tissues (GSE3526; Supp. Table S1).

Analysis of the expression of TS/PS genes on a dedicated microarray

Approximately 400 ng of total RNA of each of the various control, cancer and cell line

samples, extracted or purchased from Cytomix (OriGene) (see Supp. Table S5 for

information on the origin of the RNA samples), were labeled with cyanine 3 by linear

amplification using the Quick Amp labeling kit (Agilent Technology) and, after quality

control by spectrometry (NanoDrop ND-1000), were hybridized (at 65° C for 17 hours) in a

single color experiment on custom 8x15K chips (CTChip_V2, Agilent Technologies). The

slides were scanned and the fluorescence intensities acquired using the Feature Extraction

10.1 software. The raw data corresponding to the mean values of the processed green signals

(after background substraction) were filtered (according to quality criteria including

uniformity of the spots, signals completely above background levels and a median intensity

above 100), normalized (using the mean of the raw values of the control somatic samples),

and log2 transformed. The heatmap shown here was obtained by using the Permutmatrix

software (free online, http://www.lirmm.fr/~caraux/PermutMatrix/).

Establishment of thresholds of expression for germline and placenta restricted genes

Because the 506 germline and placenta restricted genes (TS/PS) were selected for not being

expressed in normal adult somatic tissues, we used the 112 samples of normal adult somatic

tissues to establish a value corresponding to the threshold between expression or non-

expression for each of these genes. For each probe, this threshold of expression was

calculated using the signal values observed in the adult somatic tissues, where these genes are

normally silent. The signal values in the control tissues were almost normally distributed but

their intensity and variations depended on the nature of the probe. Depending on the

distribution of the signal values in the 112 adult somatic tissues, a threshold corresponding to

the mean of the signal values in the 112 control samples + 2 or +3 standard deviations

(respectively designed as “mean+2sd” and “mean+3sd”) was chosen. The TS/PS probes

giving a signal above the threshold of “mean + 3sd” in more than 5% of the control samples

were considered non-specific and were therefore removed from the study. The use of these

thresholds allowed us to detect the expression of TS/PS genes in cancer samples, and

differentiate real expression from background signals. This was a key feature of our approach

4

enabling the detection of expression on an ON/OFF basis, which greatly simplified the

analysis.

A similar threshold-based approach to that described above for Affymetrix data was also used

in our dedicated chip to determine the “ON/OFF” status of TS/PS genes in somatic tissues

that were analyzed at the same time as the cancer samples (see below).

RT-qPCR analyses

One µg of total RNA, either extracted with the TRI Reagent kit (from Sigma-Aldrich,

ref93289) or commercially available as Cytomix (OriGene), was reverse transcribed in a final

volume of 20 µl using the “AffinityScript Multiple Temperature cDNA Synthesis

Kit”(Stratagene, Agilent Technologies). For “no RT” controls, the same mix was added to

the RNA without the reverse transcriptase enzyme. In each reaction, 5 µl of a 1/50 dilution of

the RT product were mixed with 12.5 µl of Brilliant SYBR Green qPCR master mix

(Stratagene, Agilent Technologies) and 150 nM of each primer (the primer sequences are

listed in Supp. Table S6) in a 20 µl final volume. For qPCR on “Tissue Scan Tissue qPCR

Arrays” (purchased from OriGene), 30 µl of qPCR mix (containing 15 µl of Brilliant

SYBR Green qPCR master mix and 150 nM of each primer) were added in each of the 96

wells. Quantitative polymerase chain reactions (Q-PCR) were carried out on a Stratagene

Mx3000P system in 96-well plates as follows: denaturation for 10 min at 95°C, followed

by 40 cycles of 30 s at 95°C, 1 min at 60°C and 1 min at 72°C, and followed by a last

cycle of 1 min at 95°C, 30 s at 55°C and 30 s at 95°C. Each experiment was performed in

duplicate and included RT and “no RT” samples. For each pair of primers the efficiency

coefficient was calculated based on the Ct obtained at different concentrations of RNA from

Placenta or Testis (for placenta and testis expressed genes, respectively) and the dissociation

curves were checked. When “no RT” experiments were satisfactory (Ct >=36), for each RT

experiment, using the mean Ct value of the duplicates, an expression value was calculated

(2^(Ct of gene of interest in reference tissues – Ct of gene of interest in sample))/ (2^(mean

Ct of the 4 control genes in reference tissues – mean Ct of the 4 control genes in sample)), and

expressed as the ratio of expression relative to the reference tissues. The four control genes

were Actin, U6, RELA, AUP1. In the qPCR on cancer samples (OriGene Tissue Scan Tissue

qPCR Arrays) the corresponding normal control tissues were used as reference tissues; for the

KO cells derived from the HCT116 cell line, the wild type cell line was the reference tissue.

TS/PS genes DNA methylation analysis

5

Whole-genome DNA methylation was analyzed in 55 patients from our cohort using the

Illumina Infinium HumanMethylation450 assay (32) that examines the DNA methylation

status of 485 000 CpG sites (covering 99% of RefSeq genes and 96% of CpG islands).

Detailed information about this technology can be obtained at http://www.illumina.com.

In brief, genomic DNA was extracted using either the Manual-MagNa Pure LC DNA II kit

(Roche) or the Manual-Gentra Puregene kit (Qiagen) and bisulfite-converted using the EZ-96

DNA Methylation Kit (Zymo Research). DNA was then whole-genome amplified,

enzymatically fragmented and hybridized (500 ng) to the BeadChip arrays according to the

manufacturer’s instructions. Bisulfite conversion and microarray experiments were performed

by Integragen SA (http://www.integragen.com). The BeadChips were scanned using the

Illumina HiScan SQ scanner and raw image data were imported into the GenomeStudio

(v2011.1) methylation module (v1.9.2.), which was used to extract and transform the

fluorescent signal intensities into beta-values (range: 0 for unmethylated site to 1 for a fully

methylated site). Data were exported as standard report files and normalised using the R lumi

package (v2.15).

The data obtained in our lung tumors were compared with methylation data obtained in a

large series of normal tissues, including lung, with the same technology and available on the

GEO website under the reference GSE31848. We focused our attention on the methylation

levels of the CpG found upstream of or around the TSS (-1500 to + 1500 bp relative to the

TSS) of TS/PS genes associated with CpG-rich promoters, which were found

hypermethylated in normal somatic tissues, including lung (meaning that the mean beta

values in all somatic tissues were >= 0.8). Of these TS/PS CpGs hypermethylated in normal

somatic tissues, we then selected those corresponding to genes ectopically activated in at least

one of the 55 studied lung tumors. A total of 347 CpGs, corresponding to 88 TS/PS genes,

met these two criteria. The methylation beta values of these CpGs in the 55 lung cancer

patients are presented in Supp. Table S9 and as a heatmap (Fig. 3D). The methylation beta

values were also plotted against expression values obtained with the Affymetrix technology in

the same patients: Fig. 3E shows the plots corresponding to the individual CpGs of two genes,

BRDT and MAGEB6, as examples, and Supp. Fig S2 shows 88 plots, each corresponding to

all CpGs of one gene, labeled in different colors.

Assessment of prognostic value of the “off context” expression of TS/PS genes in lung cancer

patients

6

Each of the TS/PS genes found expressed in at least 1% of our series of lung cancer patients

was tested for its prognostic potential in a univariate analysis, using R software (version

2.10.0). Survival probabilities were compared between the patients whose tumor expressed

the gene (signal over the threshold established as described above) and those whose tumor did

not. A logrank Mantel-Cox test allowed comparison of the two survival curves. A total of

26 genes were found significantly associated with prognosis with a p-value <0.05 and a

Hazard Ratio (HR)>1.5; these were selected to be tested in combination.

The patients were then assigned into three main groups according to the number of positive

expressions, using the 26 genes in combination. Patients with none of the 26 genes expressed

were assigned to the P1 group, those with one or two expressed genes to the P2 group and

those with three or more expressed genes to the P3 group. Survival probabilities of the

patients in these three groups were compared using a logrank Mantel-Cox test.

In order to examine the discriminating power of the 26 genes in combination in the context of

other parameters influencing lung cancer prognosis, we also performed sensitivity analyses

considering each of the main four histological subtypes and subgroups of patients at specific

TNM stages, using the same test. The global survival over 5 years was additionally modeled

using a multivariate proportional hazard (Cox) model. Statistical analysis was performed

using R version 2.10.0 software. The explanatory variables considered included tumor

histological subtypes (ADC, BAS, LCNE, SQC or other), T stages (T1, T2, T3/T4), N

stages (N0 or N+), as well as the prognostic classes defined by our combination of 26

TS/PS genes (P1, P2 or P3). The proportional hazard assumption for the exposure variable

was assessed using Schoenfeld’s test statistics. A cutoff of 5 % was used f o r statistical

significance.

Supervised transcriptomic analyses

The genes showing significant differences of expression between patients with best prognosis

(P1) and those with poorest prognosis (P3) were identified using a Mann Withney unpaired

test (threshold p<0.01) and a fold change at 1.5. The heatmaps were obtained by

representating the RMA normalized values of expression of these genes in the indicated

color scale (green: low expression; red: high expression) using the permutMatrix software

(version 1.9.3). The sub cellular localization of the up-regulated and down-regulated genes in

aggressive tumors was analyzed using the Ingenuity Pathway Analysis software.Functions

enriched in each of the lists of up-and down regulated genes in aggressive (P3) tumors

were identified using GO terms.

7

Comparison of the prognostic value of the 26 TS/PS genes with the expression profile of

aggressive tumors

In order to assess whether the transcriptomic profile associated with aggressive P3 tumors

was directly associated with prognosis, patients were classified on the basis of the respective

mean values of expression of the up- and down- regulated genes in P3 versus P1 tumors, and

the prognosis was compared between patients with P3 profiles (high expression values for

the “up-regulated in P3” genes, and low expression values for the “down-regulated in P3”

genes) versus patients with P1 profiles (low expression values for the “up-regulated in P3”

genes, and high expression values for the “down-regulated in P3” genes).

Gene Sets Enrichment Analysis (GSEA)

The whole list of gene probes represented on the technology “Affymetrix.GeneChip.HG-

U133_Plus_2”, associated with the fold changes corresponding to their differential expression

between P3 and P1 tumors was entered as a pre-ranked file for GSEA analysis, to

systematically look for significant overlaps within the gene sets database made available by

the Broad Institute (http://www.broadinstitute.org/gsea/).

8

Supplementary Figures

9

Fig. S1. Epigenetic “locking” of genes restricted to germline or placental expression. A.

Overall strategy for the systematic detection of ectopic gene expressions in cancer leading to

the identification of aggressive lung tumors. B. Number of unique gene identifiers

corresponding to “restricted” ESTs (ESTs found only in one tissue) (x axis) for each human

body site (y axis); C. Histogram representing the number of genes (y axis) predominantly

expressed in each group of normal adult tissues (x axis, tissue groups defined in Supp. Table

S1) according to transcriptomic data; D. Histograms showing the respective proportions of

TS/PS genes (left) or all human genes (right) with hypomethylated or hypermethylated

CpG-rich promoters, or CpG-poor promoters, according to MeDIP experiments performed in

human fibroblasts (WI38) as published in (9). E. Heatmaps reporting the main results of our

analysis of the epigenetic status of TS/PS genes in somatic cells based on the data from three

published pangenomic epigenetic studies, including MeDIP (9), Chip-chip (9, 10), and Chip-

seq (11); the genes (y axis) are grouped according to their promoter class and methylation (as

in Fig S1D), and the columns represent the relative enrichments in DNA methylation,

polymerase (pol II, and Pol IIi corresponding to the hypophosphorylated form of PolII), as

well as in various histone modifications (as indicated) in several human somatic cell types,

including fibroblasts (WI38), embryonic stem cells (hES), hepatocytes (liver), reticulocytes

(REH) and lymphocytes. The epigenetic marks are represented on the x-axis: open circles

correspond to transcription permissive marks and black circles to repressive marks.

10

11

12

13

14

15

Fig S2. CpG methylation in the TSS regions of TS/PS genes. Scatter plots showing the

methylation (beta-values on the y axis) of CpG sites localized near the TSS of the TS/PS

genes (n=88), correlated with their respective expression levels (ratios of RMA normalized

values on the x axis) in the 55 lung cancer patients. Each plot corresponds to all CpGs of one

gene, labeled in different colors. For clarification purposes, the plots corresponding to the

two genes shown in Fig. 3E are magnified and annotated.

16

Fig. S3. Prognostic value of ectopic expression of the 26 genes in lung cancer of specific

histological subgroups. Cumulative global Kaplan Meier survival estimates (y axis) as a

function of time over five years (in months, x axis) of lung cancer patients in our series (A)

comparing the four main histological subtypes of non-small cell lung cancer (ADC

(adenocarcinoma, n=85), SQC (squamous cell carcinoma, n=61), BAS (basaloid tumors,

n=39), LCNE (large cell neuroendocrine tumors, n=56) and (B) comparing the patients

classified into groups P1, P2 and P3 according to the expression of our 26 genes, within

each of the histological groups defined as above; Logrank test p-values are p=0.0075 for

ADC, p=0.0158 for BAS, p<0.0001 for SQC and LCNE.

17

Fig. S4. Prognostic value of ectopic expression of a subset of the 26 prognostic genes in

an independent study of 443 lung ADCs. Cumulative global Kaplan Meier survival

estimates (y axis) as a function of time over five years (in months, x axis) of lung

adenocarcinoma (ADC) patients from the Beer and collaborators study (19); (A) All 443 ADC

patients; (B) ADC patients grouped according to the expression of the 11 TS/PS genes

(corresponding the subset of the 26 prognostic genes which were represented on the array

used for this study).

18

Supplementary Tables

Supp Table S1: List of the normal tissue samples from GEO studies

used for our analyses of gene expression profiles in normal tissues.

GEO Studies

Tissue groups

Number of samples GSE11350 GSE15431 GSE18809 GSE3526 GSE6872 GSE7434 GSE9994

Male Germline

41 9 17

2 13

Female Germline

17

17

ES cells

3 3

Placenta

32

10

10 12

Adult Somatic tissues 144

144 Adult ovary (somatic and

germline) 4

4

Neuronal tissues

190

190

Total

431 12 34 10 340 13 10 12

Samples Dataset (GEO)

Sample_Name Tissue Groups 112 control used for threshold

GSM282014.CEL GSE11350 Gonia_haGSC4

Male Germline


Male Germline


Male Germline


Male Germline


Male Germline


Male Germline

GSM282009.CEL GSE11350 ES1

ES cells


ES cells


ES cells

GSM282008.CEL GSE11350 Gonia_hGS1

Male Germline


Male Germline


Male Germline

GSM387005.CEL GSE15431 Ovary 9.1 Weeks Gestation Female Germline

GSM387006.CEL GSE15431 Ovary 9.6 Weeks Gestation rep1 Female Germline



GSM387009.CEL GSE15431 Ovary 11 Weeks Gestation Female Germline

GSM387010.CEL GSE15431 Ovary 12 Weeks Gestation Female Germline









19




GSM387022.CEL GSE15431 Testis 9 Weeks Gestation

Male Germline

GSM387023.CEL GSE15431 Testis 9.1 Weeks Gestation Male Germline


GSM387025.CEL GSE15431 Testis 11 Weeks Gestation rep1 Male Germline

GSM387026.CEL GSE15431 Testis 11 Weeks Gestation rep2 Male Germline


GSM387028.CEL GSE15431 Testis 12 Weeks Gestation Male Germline



GSM387031.CEL GSE15431 Testis 13.9 Weeks Gestation rep1 Male Germline








GSM466504.CEL GSE18809 Placenta, Preterm spontaneous delivery, #1 Placenta





GSM466509.CEL GSE18809 Placenta, Term spontaneous delivery, #1 Placenta





GSM80757.CEL GSE3526 ovary_8

Adult ovary (somatic and germline) yes







GSM80562.CEL GSE3526 adipose_tissue_omental_2 Somatic adult tissue (not neuro) yes

GSM80576.CEL GSE3526 bone_Marrow_1

Somatic adult tissue (not neuro) yes



GSM80578.CEL GSE3526 bronchus_2




GSM80580.CEL GSE3526 adipose_tissue_3






20

GSM80584.CEL GSE3526 adipose_tissue_subcutaneous_4 Somatic adult tissue (not neuro) yes







GSM80605.CEL GSE3526 adrenal_gland_cortex_1








GSM80609.CEL GSE3526 coronary_artery_1


GSM80615.CEL GSE3526 Cervix_3


GSM80624.CEL GSE3526 Colon_cecum_1














GSM80656.CEL GSE3526 heart_atrium_4


GSM80658.CEL GSE3526 heart_ventricle_2




GSM80672.CEL GSE3526 Endometrium_8








GSM80686.CEL GSE3526 kidney_cortex_1


GSM80694.CEL GSE3526 Esophagus_1








GSM80707.CEL GSE3526 Lung_3






GSM80716.CEL GSE3526 mammary_gland_10


GSM80717.CEL GSE3526 Myometrium_7














GSM80728.CEL GSE3526 liver_1




21



GSM80731.CEL GSE3526 kidney_medulla_1






GSM80735.CEL GSE3526 lymph_Nodes_1










GSM80749.CEL GSE3526 pharyngeal_mucosa_3






GSM80781.CEL GSE3526 Stomach_cardiac_1






GSM80790.CEL GSE3526 skeletal_muscle_2






GSM80793.CEL GSE3526 saphenous_vein_1






GSM80801.CEL GSE3526 Pituitary_gland_6


GSM80805.CEL GSE3526 prostate_gland_1




GSM80807.CEL GSE3526 spleen_1




GSM80810.CEL GSE3526 Stomach_fundus_2


GSM80811.CEL GSE3526 Stomach_fundus_3


GSM80813.CEL GSE3526 Stomach_pyloric_1


GSM80816.CEL GSE3526 Stomach_pyloric_4






GSM80821.CEL GSE3526 salivary_gland_2










GSM80844.CEL GSE3526 tongue_main_corpus_2




GSM80864.CEL GSE3526 Thyroid_gland_1






22



GSM80870.CEL GSE3526 ventral_tegmental_area_1 Somatic adult tissue (not neuro) yes


GSM80883.CEL GSE3526 tongue_superior_part_w/_papillae_2 Somatic adult tissue (not neuro) yes

GSM80884.CEL GSE3526 tongue_superior_part_w/_papillae_3 Somatic adult tissue (not neuro) yes

GSM80887.CEL GSE3526 trachea_2




GSM80889.CEL GSE3526 Tonsil_2









GSM80911.CEL GSE3526 Urethra_1






GSM80561.CEL GSE3526 adipose_tissue_omental_1 Somatic adult tissue (not neuro)




Somatic adult tissue (not neuro)

GSM80589.CEL GSE3526 adipose_tissue_subcutaneous_5 Somatic adult tissue (not neuro)

GSM80590.CEL GSE3526 adipose_tissue_subcutaneous_6 Somatic adult tissue (not neuro)

















GSM80776.CEL GSE3526 oral_mucosa_1
















GSM80882.CEL GSE3526 tongue_superior_part_w/_papillae_1 Somatic adult tissue (not neuro)

GSM80885.CEL GSE3526 tongue_superior_part_w/_papillae_4 Somatic adult tissue (not neuro)




Neuro

23


Neuro


Neuro


Neuro


Neuro

GSM80871.CEL GSE3526 ventral_tegmental_area_2 Somatic adult tissue (not neuro)



GSM80868.CEL GSE3526 testes_1

Male Germline

GSM80869.CEL GSE3526 testes_2

Male Germline

GSM80565.CEL GSE3526 amygdala_1

Neuro


Neuro


Neuro


Neuro

GSM80569.CEL GSE3526 putamen_1

Neuro


Neuro


Neuro

GSM80572.CEL GSE3526 accumbens_1

Neuro


Neuro


Neuro


Neuro


Neuro


Neuro


Neuro


Neuro


Neuro


Neuro


Neuro


Neuro


Neuro


Neuro


Neuro


Neuro


Neuro


Neuro


Neuro

GSM80611.CEL GSE3526 dorsal_root_ganglia_1

Neuro


Neuro


Neuro


Neuro

GSM80616.CEL GSE3526 cerebellum_1

Neuro


Neuro


Neuro

24


Neuro

GSM80620.CEL GSE3526 corpus_callosum_1

Neuro


Neuro


Neuro


Neuro


Neuro

GSM80627.CEL GSE3526 cerebral_cortex_5

Neuro


Neuro


Neuro


Neuro


Neuro


Neuro


Neuro


Neuro


Neuro


Neuro


Neuro


Neuro


Neuro


Neuro


Neuro


Neuro


Neuro


Neuro


Neuro


Neuro


Neuro


Neuro

GSM80660.CEL GSE3526 frontal_lobe_1

Neuro


Neuro

GSM80662.CEL GSE3526 hippocampus_3

Neuro


Neuro


Neuro


Neuro


Neuro


Neuro


Neuro

GSM80669.CEL GSE3526 hypothalamus_8

Neuro


Neuro


Neuro


Neuro


Neuro

25


Neuro


Neuro


Neuro


Neuro


Neuro


Neuro


Neuro


Neuro


Neuro


Neuro


Neuro


Neuro

GSM80699.CEL GSE3526 midbrain_1

Neuro


Neuro


Neuro


Neuro


Neuro


Neuro


Neuro


Neuro

GSM80708.CEL GSE3526 medulla_1

Neuro


Neuro


Neuro


Neuro


Neuro


Neuro


Neuro


Neuro


Neuro


Neuro

GSM80744.CEL GSE3526 parietal_lobe_1

Neuro


Neuro


Neuro


Neuro


Neuro

GSM80753.CEL GSE3526 nodose_nucleus_5

Neuro

GSM80754.CEL GSE3526 occipital_lobe_5

Neuro


Neuro


Neuro


Neuro


Neuro


Neuro

26


Neuro


Neuro


Neuro


Neuro


Neuro


Neuro


Neuro


Neuro


Neuro


Neuro


Neuro


Neuro


Neuro

GSM80784.CEL GSE3526 spinal_cord_1

Neuro


Neuro


Neuro


Neuro


Neuro


Neuro


Neuro


Neuro

GSM80827.CEL GSE3526 subthalamic_nucleus_2

Neuro


Neuro


Neuro

GSM80830.CEL GSE3526 substantia_nigra_1

Neuro


Neuro


Neuro


Neuro

GSM80834.CEL GSE3526 temporal_lobe_1

Neuro


Neuro


Neuro


Neuro

GSM80838.CEL GSE3526 thalamus_1

Neuro


Neuro


Neuro


Neuro


Neuro


Neuro


Neuro


Neuro


Neuro


Neuro

27


Neuro


Neuro


Neuro


Neuro


Neuro


Neuro


Neuro


Neuro


Neuro


Neuro


Neuro

GSM80875.CEL GSE3526 trigeminal_ganglia_1

Neuro


Neuro


Neuro


Neuro

GSM80879.CEL GSE3526 vestibular_nuclei_superior_2 Neuro




Neuro



Neuro



Neuro


Neuro



GSM158463.CEL GSE6872 Normospermic individual: Sample N1 Male Germline













GSM180067.CEL GSE7434 JR-26 placenta, non-smoking, XY Placenta

GSM180078.CEL GSE7434 JR-14 placenta, smoking, XY Placenta

GSM180432.CEL GSE7434 JR-27 placenta, non-smoking, XX Placenta

28




GSM180446.CEL GSE7434 JR-917 placenta, non-smoking, XX Placenta




GSM252349.CEL GSE9994 First trimester placenta Grp1H17634 Placenta




GSM252353.CEL GSE9994 Second trimester placenta Grp2H17464 Placenta




GSM252357.CEL GSE9994 Term placenta Grp3HT5

Placenta


Placenta


Placenta


Placenta

GSM80809.CEL GSE3526 stomach_fundus_1


GSM80812.CEL GSE3526 stomach_fundus_4


GSM80814.CEL GSE3526 stomach_pyloric_2


GSM80815.CEL GSE3526 stomach_pyloric_3










29

Table S2: List of genes with an expression restricted to male germ cells

or placenta (TS/PS genes). Germline or placenta

restricted expression UniGene ID Entrez gene ID Gene Symbol Germline Hs.192090 164127 C1orf65 Germline Hs.304020 125972 CALR3 Germline Hs.127510 317719 KLHL10 Germline Hs.116303 285126 DNAJC5G Germline Hs.211046 126248 WDR88 Germline Hs.133912 85509 MBD3L1 Germline Hs.591011 196472 FAM71C Germline Hs.374924 259239 WFDC11 Germline Hs.388874 133482 SLCO6A1 Germline Hs.710379 151649 C3orf48 Germline Hs.368364 162517 FBXO39 Germline Hs.128580 158521 FMR1NB Germline Hs.350683 286514 MAGEB18 Germline Hs.348700 148870 CCDC27 Germline Hs.132485 158506 ZNF645 Germline Hs.653180 160140 C11orf65 Germline Hs.407751 143241 DYDC1 Germline Hs.632574 152405 C3orf30 Germline Hs.79363 147746 HIPK4 Germline Hs.351816 136263 C7orf45 Germline Hs.514820 256957 C17orf66 Germline Hs.376505 283847 CCDC79 Germline Hs.514814 146861 AMAC1 Germline Hs.442712 317754 POTED Germline Hs.367879 145858 C15orf32 Germline Hs.350671 254187 TSGA10IP Germline Hs.143519 146279 TEKT5 Germline Hs.666099 153745 FAM71B Germline Hs.179646 145942 TMCO5A Germline Hs.592266 114960 TSGA13 Germline Hs.186363 220082 SPERT Germline Hs.381087 284369 C19orf75 Germline Hs.567674 128209 KLF17 Germline Hs.307999 161829 EXD1 Germline Hs.567778 221241 C18orf20 Germline Hs.368028 149685 ADIG Germline Hs.157231 389874 ZCCHC13 Germline Hs.632691 257169 C9orf43 Germline Hs.564254 26070 DKFZP434K028 Germline Hs.375054 151112 ZSWIM2 Germline Hs.163070 54586 C9orf11 Germline Hs.434416 168400 DDX53

30

Germline Hs.131615 164592 CCDC116 Germline

400692 DKFZp761D1918

Germline Hs.131824 126536 LOC126536 Germline Hs.662570

Germline Hs.220558 Germline Hs.456065 791114 PWRN1

Germline Hs.662373 Germline Hs.644527 440896 LOC440896


Germline Hs.664975 440699 LRRC52 Germline Hs.519941

Germline Hs.522955 283025 C10orf40 Germline Hs.547104

Germline Hs.375441 283796 GOLGA9P Germline Hs.662304

Germline Hs.562766 Germline Hs.146758 Germline Hs.662309 Germline Hs.132310 219990 PLAC1L

Germline Hs.156197 Germline Hs.406964 554236 DPY19L2P4


Germline Hs.591823 340239 LOC340239 Germline Hs.671096 100130548 LOC100130548 Germline Hs.585529

Germline Hs.656810 Germline Hs.210377 120935 CCDC38

Germline Hs.400007 164380 CSTT Germline Hs.120364 285194 LOC285194 Germline Hs.351068 84690 SPATA22 Germline Hs.97541 219938 SPATA19 Germline Hs.130672 286234 C9orf79 Germline Hs.122986 7179 TPTE Germline Hs.660774 399671 HEATR4 Germline

283685 GOLGA6L2

Germline Hs.368451 163742 FLJ40434 Germline Hs.662213

Germline Hs.572187 Germline Hs.569472 100132025 GOLGA6L6

Germline Hs.680123 728099 LOC728099 Germline Hs.408255 100128554 LOC100128554 Germline Hs.434366 728012 LOC100287035 Germline Hs.680114

Germline Hs.388827 5992 RFX4

31

Germline Hs.606987 Germline Hs.568804 Germline Hs.213307 285429 DCAF4L1

Germline Hs.591284 285311 C3orf56 Germline Hs.631621 148231 FLJ25328 Germline Hs.132262 286359 LOC286359 Germline Hs.434113 128954 GAB4 Germline Hs.711809 256006 ANKRD31 Germline Hs.662013 140807 KRT72 Germline Hs.97794 144715 RAD9B Germline Hs.133095 166863 RBM46 Germline Hs.662260

Germline Hs.409982 Germline Hs.604069 730441 LOC730441

Germline Hs.213717 221391 OPN5 Germline Hs.159650 154865 IQUB Germline Hs.371776 203076 C8orf74 Germline Hs.662207

Germline Hs.673877 642280 ZNF876P Germline Hs.352412 136991 ASZ1 Germline Hs.585799 353149 TBC1D26 Germline Hs.189067 152586 LOC152586 Germline Hs.567642 93979 CPA5 Germline Hs.657737 56311 ANKRD7 Germline Hs.2909 5619 PRM1 Germline Hs.111850 4184 SMCP Germline Hs.131179 1618 DAZL Germline Hs.126035 57096 RPGRIP1 Germline Hs.104636 7288 TULP2 Germline Hs.661266 8468 FKBP6 Germline Hs.482520 676 BRDT Germline Hs.97633 8852 AKAP4 Germline Hs.388841 11055 ZPBP Germline Hs.654377 3948 LDHC Germline Hs.109620 167 CRISP1 Germline Hs.601545

Germline Hs.122511 1068 CETN1 Germline Hs.652490 25774 GSTTP1 Germline Hs.97477 57151 LYZL6 Germline Hs.98397 10566 AKAP3 Germline Hs.127689 80316 PPP1R2P9 Germline Hs.177984 8748 ADAM20 Germline Hs.449103 645529 LOC645529 Germline Hs.401982 27296 TP53TG5 Germline Hs.567414 10665 C6orf10 Germline Hs.113290 4114 MAGEB3

32

Germline Hs.251375 9426 CDY2A Germline Hs.177959 2515 ADAM2 Germline Hs.716685 11063 SOX30 Germline Hs.513349 7142 TNP2 Germline Hs.3232 1539 CYLC2 Germline Hs.664724 9083 BPY2 Germline Hs.2324 5620 PRM2 Germline Hs.2042 7180 CRISP2 Germline Hs.115460 881 CCIN Germline Hs.307052 92483 LDHAL6B Germline Hs.121200 353299 RGSL1 Germline Hs.519507 83942 TSSK1B Germline Hs.102866 8277 TKTL1 Germline Hs.694070 23617 TSSK2 Germline Hs.515444 56269 IRGC Germline Hs.274285 10737 RFPL3S Germline Hs.592246 474382 H2AFB1 Germline Hs.159274 4956 ODF1 Germline Hs.131361 5161 PDHA2 Germline Hs.233568 8332 HIST1H2AL Germline Hs.632070 645961 LOC645961 Germline Hs.98008 2712 GK2 Germline Hs.126496 148066 ZNRF4 Germline Hs.169284 221823 PRPS1L1 Germline Hs.370724 10816 SPINT3 Germline Hs.119207 283079 LOC283079 Germline Hs.98848 1587 ADAM3A Germline Hs.367727 5232 PGK2 Germline Hs.320892 55811 ADCY10 Germline Hs.308332 140801 RPL10L Germline Hs.567774 220047 CCDC83 Germline Hs.558533 64663 SPANXC Germline Hs.472491 64064 OXCT2 Germline Hs.97464 56163 RNF17 Germline Hs.515855 27120 DKKL1 Germline Hs.435371 6954 TCP11 Germline Hs.712692 29999 FSCN3 Germline Hs.710629 51314 TXNDC3 Germline Hs.189184 50613 UBQLN3 Germline Hs.534390 10880 ACTL7B Germline Hs.120369 54752 FNDC8 Germline Hs.123530 10881 ACTL7A Germline Hs.128342 150160 CCT8L2 Germline Hs.121602 10047 CST8 Germline Hs.242183 51213 LUZP4 Germline Hs.525202 64184 EDDM3B

33

Germline Hs.178066 64232 MS4A5 Germline Hs.375035 51224 TCEB3B Germline Hs.515632 57663 USP29 Germline Hs.406709 64693 CTAGE1 Germline Hs.146544 81492 RSPH6A Germline Hs.161241 81833 SPACA1 Germline Hs.497034 81626 C1orf14 Germline Hs.632648 11172 INSL6 Germline Hs.124211 81623 DEFB126 Germline Hs.372719 51533 PHF7 Germline Hs.223581 54514 DDX4 Germline Hs.465720 81616 ACSBG2 Germline Hs.400696 148753 FAM163A Germline Hs.648235 100132979 GOLGA8E Germline Hs.398196 84073 MYCBPAP Germline Hs.298312 84072 HORMAD1 Germline Hs.592128 10517 FBXW10 Germline Hs.444236 83893 SPATA16 Germline Hs.309767 56164 STK31 Germline Hs.513635 84229 CCDC135 Germline Hs.708626 84643 KIF2B Germline Hs.534501 84066 C1orf49 Germline Hs.97501 84103 C4orf17 Germline Hs.520554 83887 TTLL2 Germline Hs.524406 84070 FAM186B Germline

84214 DKFZp434F142

Germline Hs.664194 83889 WDR87 Germline Hs.719683 100101118 TTTY8B Germline Hs.97647 83884 SLC25A2 Germline Hs.519403 84654 SPZ1 Germline Hs.667616 83867 TTTY12 Germline Hs.307086 84075 FSCB Germline Hs.257746 317702 VN1R3 Germline Hs.217079

Germline Hs.121283 163255 ZNF540 Germline Hs.651245 84944 MAEL Germline Hs.709736 84689 MS4A14 Germline Hs.115429 440804 RIMBP3B Germline Hs.666896

Germline Hs.568628 127540 HMGB4 Germline Hs.380061 124535 HSF5 Germline Hs.665663 162333 MARCH10 Germline Hs.121438 146849 CCDC42 Germline Hs.443299 374973 C1orf223 Germline Hs.326528 145946 SPATA8 Germline Hs.122599 171169 SPACA4

34


Germline Hs.111591 131540 ZDHHC19 Germline Hs.116287 348120 LOC348120 Germline Hs.112794 140856 C20orf79 Germline Hs.247868 100329135 LOC100329135 Germline Hs.406966 122664 TPPP2 Germline Hs.481235 132851 SPATA4 Germline Hs.531306 646074 POM121L10P Germline Hs.662423

Germline Hs.144491 162540 IMP5 Germline Hs.98660 147719 LYPD4 Germline Hs.411239 221191 PRSS54 Germline Hs.662211 245802 MS4A6E Germline Hs.525769 256646 C15orf55 Germline Hs.620508 388951 TSPYL6 Germline Hs.587755 780529 LOC780529 Germline Hs.125785 149018 LELP1 Germline Hs.127882 284257 BOD1P Germline Hs.126730 168433 RNF133 Germline Hs.467868 653140 C2orf84 Germline Hs.97592 122258 C13orf28 Germline Hs.498620 254312 LOC254312 Germline Hs.97542 89869 PLCZ1 Germline Hs.127963 728460 LOC728460 Germline Hs.662298 100131928 LOC100131928 Germline Hs.367245 124626 ZPBP2 Germline Hs.518957 132612 ADAD1 Germline Hs.124512 161514 TBC1D21 Germline Hs.636150

Germline Hs.666459 341947 COX8C Germline Hs.666604 389124 IQCF5 Germline Hs.97556 122945 C14orf148 Germline Hs.98843 203562 TMEM31 Germline Hs.99161 285827 LOC285827 Germline Hs.112596

Germline Hs.112761 122651 RNASE11 Germline Hs.517091

Germline Hs.120316 85438 C4orf35 Germline Hs.124502 339669 C22orf33 Germline Hs.535454

Germline Hs.662336 Germline Hs.716731 404220 C6orf201

Germline Hs.98945 Germline Hs.259636 58531 PRM3

Germline Hs.67639 91181 NUP210L

35

Germline Hs.655296 Germline Hs.629246 154150 HDGFL1


Germline Hs.647077 168391 GALNTL5 Germline Hs.112087 140881 DEFB129 Germline Hs.121347 143379 C10orf82 Germline Hs.645542 284861 LOC729461 Germline Hs.552781 100134040 LOC100134040 Germline Hs.632356 645355 LOC645355 Germline Hs.567516 54763 ROPN1 Germline Hs.662663 613126 LOC613126 Germline Hs.126516 149830 PRNT Germline Hs.116324

Germline Hs.591738 64395 GMCL1L Germline Hs.376474 286436 H2BFM Germline Hs.558087 732275 LOC732275 Germline Hs.130722 494558 LOC494558 Germline Hs.666913

Germline Hs.99354 146310 RNF151 Germline Hs.412294 389123 IQCF2 Germline Hs.350507 63946 DMRTC2 Germline Hs.254808 401067 IQCF3 Germline Hs.131288 93661 CAPZA3 Germline Hs.169797 66037 BOLL Germline Hs.10688 143630 UBQLNL Germline Hs.128574 196477 C12orf12 Germline Hs.86761

Germline Hs.446169 Germline Hs.369473 Germline Hs.518241 165721 DNAJB8


Germline Hs.236635 140625 ACTRT2 Germline Hs.209545 389763 FLJ46321 Germline Hs.661446

Germline Hs.662212 283480 LOC283480 Germline Hs.348526 474358 LOC474358 Germline Hs.551951

Germline Hs.657342 222826 C6orf146 Germline Hs.104777 284451 ODF3L2 Germline Hs.585699

Germline Hs.658502 Germline Hs.181895 Germline Hs.97712 100130700 LOC100130700

Germline Hs.149004

36

Germline Hs.507924 Germline Hs.120391 150280 HORMAD2

Germline Hs.129794 353324 SPATA12 Germline Hs.121392


Germline Hs.662288 8755 ADAM6 Germline Hs.97408 338864 LOC338864 Germline Hs.350698


Germline Hs.112930 160419 C12orf50 Germline Hs.647026 135886 WBSCR28 Germline Hs.159043 151658 LOC151658 Germline Hs.98394

Germline Hs.666920 Germline Hs.666899 Germline Hs.155833 341567 H1FNT

Germline Hs.666888 Germline Hs.603767 Germline Hs.624137 Germline Hs.603759 Germline Hs.667736 Germline Hs.591941 414301 DDI1

Germline Hs.420716 151300 LOC151300 Germline Hs.535216 442444 FAM47C Germline Hs.351815 89882 TPD52L3 Germline Hs.380704 201243 C17orf74 Germline Hs.125875 123970 C16orf78 Germline Hs.662302 414157 C10orf62 Germline Hs.131654 63948 DMRTB1 Germline Hs.121021 130560 SPATA3 Germline Hs.98202 121273 C12orf54 Germline Hs.360989 128861 C20orf71 Germline Hs.97714 133558 HEATR7B2 Germline Hs.197801 170062 FAM47B Germline Hs.621235

Germline Hs.414175 126123 C19orf41 Germline Hs.404807 348761 LOC348761 Germline Hs.406982 497634 BEYLA Germline Hs.122199

Germline Hs.112680 Germline Hs.147128 131831 FAM194A

Germline Hs.125998 Germline Hs.447556 146822 CDRT15

Germline Hs.567701 145645 C15orf43

37

Germline Hs.345877 125336 LOXHD1 Germline Hs.116176 645733 LOC645733 Germline Hs.132104 200523 C2orf51 Germline Hs.97726 375686 SPATC1 Germline Hs.591786 255626 HIST1H2BA Germline Hs.666891

Germline Hs.666898 Germline Hs.539723 337977 FLJ25694

Germline Hs.487409 56903 PAPOLB Germline Hs.128069 148109 FAM187B Germline Hs.599397 401351 LOC401351 Germline Hs.369829 118670 FAM24A Germline Hs.209206 284382 ACTL9 Germline Hs.522093 259308 C9orf144B Germline Hs.431161 643406 LOC643406 Germline Hs.652240 387707 CC2D2B Germline Hs.434112 124912 SPACA3 Germline Hs.143268 158724 FAM47A Germline Hs.343631 340178 LOC340178 Germline Hs.299127 146212 KCTD19 Germline Hs.145435 255330 C3orf46 Germline Hs.164799 84692 CCDC54 Germline Hs.437141 160762 CCDC63 Germline Hs.376011 158809 MAGEB6 Germline Hs.350600 439916 C12orf37 Germline Hs.511849 148545 NBPF4 Germline Hs.518247 57501 KIAA1257 Germline Hs.678973 644623 TPTE2P2 Germline Hs.167595 400593 FLJ43944 Germline Hs.632284 9084 VCY Germline Hs.248176 8352 HIST1H3C Germline Hs.349695 7278 TUBA3C Germline Hs.144683 441601 LOC441601 Germline Hs.405659 9271 PIWIL1 Germline Hs.302028 64180 DPEP3 Germline Hs.128180 54766 BTG4 Germline

283491 OR7E156P

Germline Hs.303923 84076 TKTL2 Germline Hs.129293 149647 FAM71A Germline Hs.335788 151254 ALS2CR11 Germline Hs.434715 26716 OR2H1 Germline Hs.131469 133491 C5orf47 Germline

29797 POM121L8P

Germline Hs.404175 728883 LOC728883 Germline Hs.458292 53336 CPXCR1 Germline Hs.126838 11086 ADAM29

38

Germline Hs.372650 283197 C11orf64 Germline Hs.121084 57119 SPINLW1 Germline Hs.279737 51480 VCX2 Germline Hs.113291 4115 MAGEB4 Germline Hs.169222 56 ACRV1 Germline Hs.536001 378951 RBMY1E

Germline Hs.654557 2713 GK3P Germline Hs.444230 1538 CYLC1 Germline Hs.121494 6677 SPAM1 Germline Hs.283011 11085 ADAM30 Germline Hs.123239 84519 ACRBP Germline Hs.98712 84203 TXNDC2 Germline Hs.223806 54457 TAF7L Germline Hs.126780 124404 déc.-99 Germline Hs.151167 5535 PPP3R2 Germline Hs.352187 128653 C20orf141 Germline Hs.131098 84691 FAM71F1 Germline Hs.447626 149699 GTSF1L Germline Hs.558572 119180 LYZL1 Germline Hs.143845 256369 C14orf48 Germline Hs.651593 157381 LOC157381 Germline Hs.375186 140732 SUN5 Germline Hs.662209 415056 LOC415056 Germline Hs.116147 8756 ADAM7 Germline Hs.120319 93034 NT5C1B Germline

259308 C9orf144B

Germline Hs.447948 199720 GGN Germline Hs.253209

Germline Hs.710554 Placenta Hs.509439 135644 TRIM40

Placenta Hs.350750 221301 FAM26D Placenta Hs.661014 203100 HTRA4 Placenta Hs.642938 3484 IGFBP1 Placenta Hs.655287

Placenta Hs.536920 Placenta Hs.666610 100127950 LOC100127950

Placenta Hs.650220 153514 C14orf81 Placenta Hs.654390 1442 CSH1 Placenta Hs.594537 8038 ADAM12 Placenta Hs.364941 3283 HSD3B1 Placenta Hs.654415 5673 PSG5 Placenta Hs.172944 93659 CGB5 Placenta Hs.95008 3814 KISS1 Placenta Hs.709203 5676 PSG7 Placenta Hs.397255 946 SIGLEC6

39

Placenta Hs.418506 3641 INSL4 Placenta Hs.646353 5680 PSG11 Placenta Hs.702084 2792 GNGT1 Placenta Hs.533293 3010 HIST1H1T Placenta Hs.709200 5670 PSG2 Placenta

5672 PSG4

Placenta Hs.709192 5669 PSG1 Placenta Hs.654515 1443 CSH2 Placenta Hs.502092 5678 PSG9 Placenta Hs.654414 5675 PSG6 Placenta Hs.284255 251 ALPPL2 Placenta Hs.512633 5553 PRG2 Placenta Hs.220844 55867 SLC22A11 Placenta Hs.23671 29124 LGALS13 Placenta Hs.472492 191585 PLAC4 Placenta Hs.560509

Placenta Hs.522654 728242 XAGE2B Placenta Hs.654772

Placenta Hs.656025 Placenta

400500 BCAR4

Placenta Hs.529729 Placenta Hs.42265 Placenta

90625 C21orf105

Placenta Hs.656897 Placenta Hs.641200 Placenta Hs.574781 Placenta Hs.641022 Placenta Hs.656801 Placenta Hs.43879 170626 XAGE3

Placenta Hs.112924 Placenta Hs.666901 Placenta Hs.656747 Placenta Hs.671084 Placenta Hs.667725 Placenta Hs.29742 145501 ISM2

Placenta Hs.656795 Placenta Hs.656741 Placenta Hs.656768 Placenta Hs.143856 400926 FLJ90680

Placenta Hs.657599 Placenta Hs.501452 10148 EBI3

Placenta Hs.24236 56891 LGALS14 Placenta Hs.205178 127731 VWA5B1 Placenta Hs.146346 1238 CCBP2 Placenta Hs.606771 79987 SVEP1 Placenta Hs.260074 1588 CYP19A1

40

Placenta Hs.655225 1444 CSHL1 Placenta Hs.654413 5671 PSG3 Placenta Hs.719629 55338 FLJ11292 Placenta Hs.643599 5069 PAPPA Placenta Hs.657576

41

Table S3: Description and list of the 1776 cancer samples analyzed from the Exp0 cancer study (GSE2129).

Cancer Types Number of samples Bladder cancer 30 Breast cancer 353 Cervix cancer 31 Colon cancer 334 Kidney cancer 281 Liver cancer 44 Lung cancer 132 Ovary cancer 199 Pancreas cancer 17 Prostate cancer 83 SmallIntestine cancer 14 Stomach cancer 13 Thyroid cancer 33 Uterus cancer 212 Total 1776

Samples Sample description Sample group GSM117677.CEL Urinary Bladder - 152484 Bladder Cancer

GSM137919.CEL Urinary bladder - 170827 Bladder Cancer

GSM137976.CEL Bladder - 195183 Bladder Cancer



GSM152797.CEL Urinary Bladder - 262809 Bladder Cancer

















42









GSM102440.CEL Breast - 101141 Breast Cancer























GSM301690.CEL breast - 438172 Breast Cancer











43











































44











































45











































46











































47















GSM277691.CEL breast - 383914 Breast Cancer




























48











































49











































50


























GSM102476.CEL Cervix - 118660 Cervix Cancer




GSM152667.CEL Cervix Uteri - 211408 Cervix Cancer













51














GSM53042.CEL Uterine Cervix - 1223 Cervix Cancer

GSM102429.CEL Colon - 101097 Colon Cancer




GSM102462.CEL Rectosigmoid - 104350 Colon Cancer
























52






































GSM137964.CEL Rectosigmoid colon - 191423 Colon Cancer





53











































54











































55











































56

GSM277686.CEL Rectosigmoid Colon - 383898 Colon Cancer








































57











































58











































59















GSM102428.CEL Kidney - 101096 Kidney Cancer




























60











































61














GSM152697.CEL kidney - 228531 Kidney Cancer





























62











































63











































64

GSM301710.CEL KIdney - 458400 Kidney Cancer










































65











































66


GSM102503.CEL Liver - 129708 Liver Cancer













GSM325819.CEL liver - 465685 Liver Cancer




























67




GSM102449.CEL Lung - 101182 Lung Cancer







































68











































69











































70










GSM102483.CEL Ovary - 118671 Ovary Cancer

































71











































72











































73






















GSM277732.CEL ovary - 440433 Ovary Cancer





















74









































GSM117645.CEL Pancreas - 143659 Pancreas Cancer


75
















GSM102498.CEL Prostate - 129691 Prostate Cancer



























76











































77















GSM102474.CEL Small Intestine - 118658 Small Intestine Cancer


GSM102511.CEL Small intestine - 136917 Small Intestine Cancer












GSM102495.CEL Stomach - 129661 Stomach Cancer






GSM325824.CEL stomach - 465760 Stomach Cancer







GSM117646.CEL Thyroid - 143660 Thyroid Cancer

78















GSM277704.CEL thyroid - 421735 Thyroid Cancer


















GSM102425.CEL Endometrium - 101093 Uterus Cancer

GSM102430.CEL Uterus - 101099 Uterus Cancer









79






































GSM152598.CEL Uterus and cervix - 161533 Uterus Cancer





80




















GSM152773.CEL Corpus Uteri - 254398 Uterus Cancer























81











































82























GSM38069.CEL Myometrium - 8184 Uterus Cancer







GSM46923.CEL Uterine Corpus - 29259 Uterus Cancer

GSM46926.CEL Corpus uteri - 29269 Uterus Cancer


GSM46937.CEL Uterine Corpus - 31814 Uterus Cancer










83



































84

Table S4: Percentage of positive expressions of TS/PS genes in the 14 different types of cancer analyzed from the Exp0 cancer study (GSE2129).

Gene id (gene symbol or Unigene)

All (n=1776)

Bladder (n=30)

Breast (n=353)

Cervix (n=31)

Colon (n=334)

Kidney (n=281)

Liver (n=44)

Lung (n=132)

Ovary (n=199)

Pancreas (n=17)

Prostate (n=83)

S.Intest. (n=14)

Stomach (n=13)

Thyroid (n=33)

Uterus (n=212)

Hs.562766 79.0 90.0 72.5 83.9 78.1 88.6 86.4 78.8 75.4 94.1 78.3 92.9 69.2 97.0 74.1

Hs.507924 68.9 73.3 66.0 80.6 61.1 80.4 63.6 69.7 65.3 70.6 81.9 92.9 69.2 81.8 63.2

GNGT1 50.2 63.3 37.1 67.7 38.6 67.6 47.7 50.8 69.8 35.3 26.5 57.1 15.4 48.5 57.1

IQUB 50.1 50.0 41.1 54.8 33.8 81.1 27.3 38.6 48.2 35.3 50.6 57.1 46.2 84.8 58.0

FLJ25694 49.6 53.3 43.1 45.2 53.0 54.8 50.0 54.5 46.2 35.3 55.4 85.7 61.5 48.5 44.3

Hs.133294 49.2 80.0 55.8 80.6 76.3 8.5 61.4 49.2 62.3 47.1 0.0 21.4 69.2 18.2 50.0

TPTE 49.2 50.0 44.8 54.8 46.1 59.1 59.1 49.2 48.7 58.8 61.4 85.7 38.5 63.6 35.8

C17orf104 45.4 40.0 42.8 64.5 34.1 48.4 45.5 50.8 60.3 52.9 41.0 64.3 30.8 36.4 46.7

LOC100287035 45.4 46.7 45.6 58.1 39.5 50.2 34.1 41.7 44.7 52.9 49.4 71.4 61.5 57.6 44.3

SOX30 42.8 33.3 36.5 64.5 46.4 50.2 45.5 40.9 37.2 41.2 45.8 71.4 53.8 54.5 36.8

Hs.655296 42.7 36.7 53.0 25.8 24.9 65.5 25.0 43.2 42.7 47.1 44.6 28.6 38.5 51.5 28.8

STK31 42.6 60.0 34.8 38.7 53.3 33.1 47.7 68.2 52.8 52.9 13.3 35.7 61.5 21.2 35.8

Hs.666891 41.7 43.3 45.3 32.3 31.4 64.4 27.3 37.1 35.2 52.9 45.8 50.0 38.5 42.4 32.1

SPINLW1 41.7 33.3 43.6 35.5 34.1 61.2 43.2 34.1 41.2 58.8 42.2 42.9 38.5 30.3 32.1

MAGEB18 41.2 50.0 46.5 41.9 35.3 42.7 29.5 40.9 40.7 41.2 27.7 57.1 53.8 54.5 42.9

TPTE2P2 37.4 36.7 45.6 45.2 36.8 44.5 34.1 28.0 26.6 41.2 55.4 57.1 30.8 39.4 22.6

ADAM12 33.3 46.7 75.1 41.9 36.2 9.3 15.9 36.4 19.6 64.7 1.2 21.4 7.7 18.2 17.5

ASZ1 29.9 40.0 32.9 22.6 32.0 28.5 22.7 26.5 27.6 23.5 34.9 57.1 30.8 27.3 25.9

GMCL1L 29.1 36.7 24.1 38.7 31.4 21.0 29.5 32.6 38.7 17.6 36.1 7.1 38.5 24.2 30.2

ACE2 28.3 3.3 6.5 12.9 60.5 63.0 47.7 15.9 12.6 35.3 1.2 28.6 30.8 3.0 5.7

Hs.666898 25.2 40.0 10.5 45.2 13.8 18.1 11.4 30.3 55.8 11.8 8.4 14.3 23.1 9.1 53.8

FMR1NB 25.1 36.7 29.5 29.0 20.1 28.1 29.5 20.5 27.1 23.5 12.0 42.9 30.8 30.3 22.6

Hs.710554 22.4 33.3 22.7 25.8 17.1 34.9 13.6 19.7 26.6 35.3 21.7 35.7 15.4 12.1 11.8

MAGEA5 22.1 46.7 26.6 41.9 15.3 14.9 27.3 32.6 29.6 29.4 2.4 42.9 15.4 18.2 20.3

NT5C1B 20.9 23.3 19.8 25.8 20.7 30.2 15.9 22.0 17.6 17.6 15.7 28.6 23.1 18.2 15.1

DPY19L2P4 20.8 20.0 20.7 22.6 13.2 37.7 9.1 19.7 19.6 11.8 20.5 57.1 15.4 15.2 14.6

ZPBP 20.8 20.0 19.8 25.8 18.0 28.8 18.2 25.8 17.6 29.4 18.1 50.0 23.1 21.2 14.6

LOC613126 20.5 26.7 21.8 25.8 15.6 29.9 20.5 22.0 22.6 29.4 10.8 42.9 15.4 24.2 10.4

Hs.116324 19.1 26.7 22.9 19.4 18.3 22.4 22.7 23.5 15.1 23.5 12.0 35.7 7.7 12.1 12.3

C3orf48 17.5 36.7 19.8 9.7 12.6 21.4 27.3 14.4 17.1 0.0 20.5 42.9 7.7 24.2 12.7

MAGEB6 17.3 20.0 21.0 22.6 16.2 17.8 13.6 14.4 15.1 17.6 10.8 28.6 0.0 12.1 19.3

HTRA4 17.1 16.7 17.6 16.1 10.5 28.1 25.0 37.1 12.6 17.6 7.2 42.9 0.0 18.2 5.7

Hs.603759 17.1 10.0 13.9 3.2 7.5 37.4 20.5 11.4 19.1 11.8 0.0 7.1 23.1 15.2 22.2

Hs.666899 17.0 20.0 22.4 9.7 15.0 18.5 25.0 15.2 19.1 5.9 10.8 21.4 30.8 9.1 10.8

MAGEB3 16.3 16.7 16.7 25.8 17.7 17.8 9.1 18.2 18.1 17.6 2.4 28.6 15.4 18.2 12.7

Hs.181895 16.1 23.3 7.1 3.2 27.5 22.8 15.9 7.6 15.6 29.4 2.4 14.3 7.7 3.0 17.9

GK3P 16.0 26.7 7.6 19.4 35.9 13.5 45.5 26.5 5.0 29.4 0.0 0.0 7.7 9.1 5.7

PIWIL1 15.4 16.7 7.6 16.1 30.8 8.9 20.5 10.6 23.6 11.8 1.2 21.4 23.1 51.5 6.1

Hs.432394 14.2 26.7 12.7 12.9 10.8 17.1 29.5 15.9 20.6 5.9 6.0 7.1 7.7 6.1 12.3

C9orf11 14.0 16.7 12.2 12.9 13.8 19.6 13.6 9.8 17.6 11.8 8.4 14.3 15.4 12.1 11.8

85

COX8C 14.0 3.3 11.0 3.2 8.4 17.1 13.6 19.7 22.1 11.8 10.8 28.6 7.7 0.0 18.9

DYDC1 14.0 16.7 11.0 22.6 7.8 13.2 11.4 15.2 17.6 11.8 13.3 0.0 0.0 9.1 27.8

LOC151658 13.9 26.7 10.5 3.2 17.1 18.9 25.0 9.8 12.1 11.8 18.1 7.1 15.4 12.1 9.0

Hs.667725 13.6 23.3 16.7 16.1 12.0 16.4 9.1 9.8 16.1 11.8 12.0 28.6 30.8 6.1 6.1

Hs.606987 13.0 13.3 15.0 22.6 10.5 16.4 11.4 19.7 12.1 11.8 6.0 21.4 0.0 15.2 7.5

Hs.656897 13.0 23.3 30.3 19.4 9.3 4.3 6.8 12.9 8.0 35.3 1.2 7.1 0.0 6.1 10.4

Hs.177930 12.8 16.7 13.6 12.9 11.1 16.4 6.8 14.4 12.6 5.9 13.3 21.4 0.0 12.1 9.9

CYLC1 12.8 13.3 17.6 25.8 9.6 18.1 6.8 6.1 11.1 5.9 1.2 28.6 0.0 21.2 11.3

ZNF876P 12.7 13.3 13.6 12.9 9.0 20.6 9.1 12.1 15.1 5.9 4.8 28.6 7.7 18.2 7.1

HORMAD1 12.6 23.3 17.6 35.5 6.9 1.1 2.3 42.4 12.6 0.0 0.0 7.1 0.0 6.1 15.1

RBM46 12.3 20.0 13.3 22.6 10.2 14.2 13.6 12.1 15.1 11.8 10.8 0.0 15.4 6.1 8.5

Hs.656747 12.1 16.7 13.0 9.7 8.1 19.9 9.1 9.8 17.1 5.9 14.5 7.1 7.7 3.0 5.2

VN1R3 11.9 13.3 13.9 9.7 9.6 19.9 11.4 9.1 13.1 5.9 6.0 28.6 0.0 6.1 5.7

Hs.666888 11.7 10.0 14.2 6.5 6.6 16.7 13.6 14.4 12.1 0.0 13.3 14.3 15.4 15.2 6.6

Hs.666896 11.6 16.7 13.6 6.5 11.7 15.3 11.4 10.6 9.0 5.9 7.2 7.1 0.0 3.0 10.8

MAGEB4 11.5 6.7 16.7 29.0 9.0 15.7 13.6 6.8 11.1 5.9 0.0 28.6 0.0 15.2 6.6

POTED 11.5 10.0 17.3 3.2 7.8 7.8 11.4 10.6 12.1 11.8 32.5 28.6 7.7 0.0 6.6

SLCO6A1 11.5 23.3 8.2 22.6 7.5 16.0 9.1 7.6 22.1 0.0 6.0 14.3 7.7 3.0 11.3

SPZ1 11.4 3.3 9.1 9.7 12.0 18.1 9.1 11.4 10.6 11.8 9.6 14.3 7.7 9.1 9.0

LOC729461 11.3 20.0 10.2 16.1 7.8 18.9 9.1 12.9 7.0 0.0 9.6 21.4 7.7 39.4 7.1

PLCZ1 11.1 20.0 9.9 16.1 9.9 13.2 9.1 14.4 12.1 5.9 8.4 28.6 15.4 12.1 8.0

NBPF4 11.0 6.7 30.3 6.5 13.8 3.9 6.8 4.5 4.5 11.8 0.0 0.0 7.7 6.1 2.4

LOC728099 10.9 6.7 9.6 6.5 9.6 26.3 9.1 9.1 5.5 5.9 2.4 14.3 7.7 15.2 5.7

C9orf43 10.9 10.0 9.6 6.5 10.8 12.1 13.6 14.4 13.6 23.5 12.0 0.0 7.7 15.2 5.7

DMRTC2 10.0 13.3 14.7 9.7 6.6 14.2 9.1 12.9 7.5 5.9 1.2 14.3 0.0 15.2 5.7

LOC440896 9.7 13.3 9.1 16.1 11.1 11.7 6.8 16.7 5.5 5.9 10.8 21.4 7.7 9.1 4.2

ADAM2 9.7 10.0 13.0 3.2 8.7 10.7 4.5 6.1 9.0 0.0 18.1 7.1 0.0 6.1 8.0

ALPPL2 9.7 6.7 4.0 16.1 4.8 3.6 2.3 5.3 20.6 5.9 6.0 7.1 0.0 0.0 32.5

Hs.659210 9.6 6.7 11.9 6.5 9.3 8.5 6.8 9.1 10.6 11.8 8.4 21.4 7.7 6.1 8.5

Hs.572187 9.0 6.7 7.4 6.5 7.8 14.2 6.8 9.8 9.5 5.9 3.6 7.1 7.7 15.2 8.5

FLJ11292 9.0 6.7 16.1 3.2 5.4 16.0 11.4 4.5 6.5 5.9 4.8 7.1 0.0 6.1 2.4

Hs.446169 9.0 16.7 10.5 3.2 4.2 17.1 9.1 7.6 10.1 0.0 4.8 7.1 7.7 12.1 4.7

BOLL 8.8 10.0 8.5 9.7 6.3 21.4 6.8 6.8 4.0 11.8 3.6 14.3 7.7 6.1 4.7

VWA5B1 8.8 13.3 5.7 9.7 6.6 14.6 18.2 9.8 7.5 29.4 8.4 7.1 0.0 9.1 7.1

AMAC1 8.8 13.3 9.3 16.1 6.9 16.7 6.8 9.8 7.0 0.0 3.6 14.3 0.0 3.0 3.8

C10orf82 8.7 6.7 18.7 3.2 4.2 3.2 4.5 5.3 10.1 0.0 6.0 7.1 0.0 3.0 12.7

PRM2 8.7 10.0 9.9 9.7 7.5 11.4 6.8 12.1 7.0 11.8 13.3 0.0 7.7 6.1 3.8

RBMY1E 8.7 13.3 2.3 0.0 10.8 20.3 9.1 11.4 1.5 11.8 19.3 14.3 15.4 12.1 0.5

C15orf43 8.3 16.7 9.1 6.5 8.1 8.5 9.1 10.6 8.5 5.9 3.6 14.3 7.7 9.1 6.1

SLC22A11 8.3 0.0 1.1 6.5 0.9 46.3 4.5 1.5 0.5 0.0 2.4 0.0 0.0 0.0 0.9

SPATA22 8.3 10.0 13.3 6.5 7.2 7.8 4.5 9.8 7.5 0.0 6.0 14.3 0.0 3.0 5.2

C18orf20 8.1 10.0 7.4 19.4 6.3 10.7 11.4 9.8 5.5 5.9 8.4 21.4 7.7 15.2 5.2

PHF7 7.9 3.3 12.2 12.9 9.3 10.3 2.3 8.3 4.5 0.0 4.8 7.1 0.0 3.0 2.4

FAM24A 7.8 3.3 7.6 9.7 7.8 12.5 4.5 4.5 7.5 0.0 7.2 7.1 7.7 9.1 5.7

TSPYL6 7.8 13.3 10.2 9.7 5.7 11.4 9.1 3.0 9.5 5.9 3.6 28.6 7.7 3.0 3.3

ADAM3A 7.5 16.7 9.1 6.5 6.9 8.2 6.8 6.1 8.5 5.9 8.4 7.1 0.0 6.1 4.2

86

TKTL1 7.5 10.0 2.3 9.7 5.7 6.8 11.4 6.1 20.6 0.0 2.4 14.3 7.7 3.0 9.9

Hs.624137 7.4 6.7 4.8 9.7 5.7 12.8 6.8 11.4 6.0 0.0 3.6 14.3 0.0 9.1 7.5

Hs.662570 7.4 13.3 6.2 9.7 8.7 13.9 9.1 3.8 3.5 0.0 2.4 14.3 0.0 12.1 4.7

CCDC83 7.4 6.7 10.8 6.5 6.3 8.2 2.3 9.1 6.0 5.9 12.0 14.3 0.0 6.1 2.4

SPATA16 7.4 3.3 5.4 12.9 6.6 14.6 13.6 6.8 8.5 0.0 6.0 7.1 0.0 3.0 2.4

Hs.253209 7.3 3.3 10.8 0.0 4.8 13.5 9.1 6.8 7.0 5.9 1.2 7.1 7.7 9.1 1.4

LOC100128554 7.2 16.7 4.8 9.7 7.2 11.4 6.8 9.1 7.0 5.9 4.8 7.1 0.0 9.1 4.2

FAM186B 7.1 10.0 6.5 12.9 6.0 11.7 4.5 8.3 6.0 0.0 6.0 14.3 0.0 3.0 4.7

MARCH10 7.1 3.3 5.7 6.5 3.6 12.8 2.3 5.3 10.1 5.9 6.0 7.1 7.7 3.0 8.5

KRT72 6.9 16.7 6.2 12.9 3.6 12.1 9.1 6.1 4.0 17.6 7.2 14.3 0.0 9.1 5.7

Hs.662207 6.9 13.3 7.4 3.2 5.7 7.5 6.8 9.8 7.0 0.0 6.0 0.0 0.0 6.1 6.6

CC2D2B 6.7 10.0 7.6 9.7 5.1 8.5 4.5 6.8 4.5 0.0 4.8 28.6 0.0 15.2 5.7

MAEL 6.7 13.3 5.7 3.2 4.5 16.0 9.1 3.8 4.0 0.0 4.8 7.1 0.0 6.1 4.7

PAPOLB 6.5 6.7 5.9 3.2 7.8 7.5 6.8 7.6 5.5 0.0 4.8 21.4 7.7 6.1 4.7

LOC152586 6.4 3.3 6.5 6.5 7.2 10.3 2.3 5.3 5.0 0.0 7.2 7.1 0.0 6.1 3.8

PLAC4 6.4 10.0 6.2 9.7 5.4 8.2 2.3 5.3 5.0 11.8 7.2 7.1 7.7 6.1 6.6

C10orf40 6.1 3.3 6.5 0.0 6.6 11.0 4.5 6.8 3.5 5.9 0.0 7.1 7.7 6.1 4.2

TCEB3B 6.1 3.3 9.1 12.9 6.0 6.8 6.8 5.3 5.0 0.0 6.0 14.3 7.7 3.0 1.4

LDHAL6B 6.0 3.3 5.4 12.9 5.7 8.9 9.1 8.3 3.0 5.9 3.6 7.1 15.4 9.1 3.8

LOC283079 6.0 10.0 5.7 6.5 4.8 9.3 4.5 8.3 6.5 5.9 1.2 14.3 15.4 3.0 3.3

Hs.217079 6.0 3.3 2.8 9.7 4.5 7.5 2.3 8.3 9.5 0.0 6.0 14.3 15.4 9.1 6.1

C4orf35 6.0 6.7 6.2 9.7 4.8 7.1 9.1 8.3 5.5 0.0 3.6 14.3 7.7 9.1 3.8

Hs.659928 5.9 6.7 4.8 12.9 2.1 15.3 4.5 7.6 2.5 5.9 4.8 7.1 7.7 3.0 3.3

DCAF4L1 5.8 13.3 5.7 6.5 3.9 7.8 11.4 6.1 6.0 0.0 3.6 0.0 7.7 6.1 5.2

RFPL3S 5.7 0.0 9.1 3.2 2.1 2.8 6.8 9.1 8.5 0.0 3.6 7.1 7.7 3.0 7.1

Hs.529729 5.5 30.0 5.7 9.7 4.2 8.9 4.5 2.3 6.0 0.0 0.0 14.3 0.0 3.0 2.8

Hs.86761 5.5 3.3 9.9 3.2 5.1 6.8 6.8 1.5 3.5 5.9 1.2 0.0 15.4 3.0 3.3

AKAP4 5.4 6.7 4.2 3.2 6.9 9.6 2.3 5.3 5.5 0.0 0.0 0.0 7.7 0.0 3.8

LOC157381 5.4 3.3 4.2 0.0 0.0 0.4 2.3 3.0 3.0 0.0 67.5 0.0 0.0 0.0 5.7

LOC338864 5.4 0.0 3.1 9.7 6.0 8.9 2.3 6.1 6.5 5.9 2.4 7.1 7.7 3.0 4.2

TNP2 5.4 3.3 4.0 6.5 4.2 10.3 4.5 8.3 3.5 0.0 6.0 7.1 0.0 3.0 4.2

LOC283688 5.3 6.7 4.2 12.9 4.5 10.0 6.8 5.3 5.0 0.0 3.6 14.3 0.0 3.0 2.4

CALR3 5.3 10.0 4.2 6.5 3.3 8.9 2.3 7.6 5.0 17.6 7.2 0.0 0.0 6.1 2.8

Hs.122199 5.2 6.7 5.4 0.0 3.9 10.7 2.3 5.3 5.5 0.0 3.6 7.1 0.0 0.0 2.8

C20orf79 5.2 6.7 4.5 3.2 5.4 9.6 0.0 5.3 6.0 5.9 3.6 7.1 0.0 0.0 2.4

Hs.574781 5.2 3.3 4.2 3.2 2.7 4.6 2.3 6.8 10.1 0.0 3.6 7.1 7.7 6.1 7.5

C13orf28 5.2 10.0 4.5 9.7 4.8 8.9 2.3 3.8 5.0 0.0 3.6 0.0 0.0 9.1 3.3

LOC441009 5.2 6.7 5.9 9.7 3.6 10.0 4.5 3.0 5.5 11.8 2.4 7.1 0.0 0.0 1.9

FSCB 5.1 10.0 6.8 6.5 4.5 7.1 2.3 3.8 5.0 0.0 3.6 7.1 7.7 6.1 1.4

Hs.641200 5.0 13.3 4.8 6.5 5.7 7.8 2.3 4.5 4.0 0.0 6.0 0.0 0.0 0.0 2.4

87

Table S5: List of tissue samples and cell lines analyzed on the dedicated microarray.

Normal samples Origin (CM: RNA bought from Cytomix)

Placenta Ambion refAM6000

Testis Ambion refAM7972

Testis CM3

Spleen resting B cells gift by Dr M. Callanan*

Resting B cells replicate 1 gift by Dr M. Callanan*

Resting B cells replicate 2 gift by Dr M. Callanan*

Bladder CM42

Breast CM46

Breast CM47

Colon CM15

Colon CM17

Liver CM26

Lung CM27

Lymph node CM4

Lymph node CM5

Ovary CM50

Pancreas CM40

Prostate CM34

Tumor samples

Lung adenocarcinoma CM29

Small cell carcinoma CM28

Sqamous cell carcinoma CM30

Leukemia CM11

Leukemia CM12

Leukemia CM13

Lymphoma CM10

Lymphoma CM8

Lymphoma CM9

Bladder cancer CM41

Breast cancer CM43

Breast cancer CM45

Colon cancer CM14

Colon cancer CM15

Liver cancer CM20

Ovary cancer CM48

Ovary cancer CM49

Pancreas cancer CM38

Pancreas cancer CM39

Prostate cancer CM35

88

Prostate cancer CM36

Cell Lines

non small lung cancer cell line H1299

colon cancer cell line (wild type) HCT116++

colon cancer cell line (with double inactivation of DNA methyl transferases DNMT1 and DNMT3b) HCT116 DKO

* Dr M Callanan, INSERM-UJF U823, Grenoble, France

89

Table S6: List of primers used for qRT-PCR experiments. Name Forward primer Reverse primer

U6 ctcgcttcggcagcaca aacgcttcacgaatttgcgt

Beta ACTIN catgtacgttgctatccaggc ctccttaatgtcacgcacgat

RELA cgggatggcttctatgagg ctccaggtcccgcttctt

AUP1 tgcactccgtgtacaacagc tttgtcgcttcatgtgctct

ASZ1 cccaggatgagaatggttaca ccaagttcaagcaacttcaaaac

FMR1NB ggatgctcatgctctccatt tgcaagcacaaaatatgaggac

SOX30 gtgaggggaaaggggaaata atcacccaggtgccattaaa

SPANXC aatccacgaggtgaatgagac ttcctcctgtagcgaaccact

TCP11 tttccaacagctatgaacctgag cagggggagttgctgatagtt

H2BFWT ggacagcttcgccacctatt ttctgaggacagccttcgtg

GMCL1L cttatacttgaaaaggatcaggaaca gggaaggtcagaaacctgct

C1orf14 gaaccagtaacagttcaaaaagca caatttgggtgctggaaga

C6orf146 gctaacagcctacgtgtgtca ttctgaatccaaattccagtga

CETN1 ctccaccggccaaaagagaaa gatggtcccacttccgtcc

DDI1 ccaacccccacgatctgtc cctctcttgctctctcaaggc

FTMT aattgcacgctctagcctcag acgtggtcacctagttctttga

SPATA22 ttggctcctgtaatgaaaacagt ccatctctgtagctccaacca

PDHA2 tggaatgggaacatctactgaga gggataaaattgcccctctt

RPL10L ggcagagatggctttcacat cccagcacaggacaacatc

ZPBP2 tgcaatggatctgttgactgt atatgcttggctccgaaaaa

BRDT aagaagagcaagttgtgggtg tgtaccacgttcaagggagaa

NYD-SP25 atgccacatgccaggacag agttcagaagtcgagtgggatt

PRM2 gcagacactgctctcgaagg gtttcgggcgactttttctt

TAF7L ctccatcccaggatttttga tgaacatctcccgaagcata

TKTL1 cactgtggggtatctgttggt aatggttcggaacatggcta

LDHAL6B gttggactgtgcctgttgtg cccaggcataggaaattcg

LDHC gctctgaagactctggacccta tcagcttgataatttcataggcact

TUBA2 cggaggagctcaacatgc agttcccagcaggcattg

CCDC79 aattgcacgacacctgagataat gctgcatgagaacttgagacaa

C11orf64 tgtacccagtaacagagggag gcagtttctctatggaaccacca

CCDC42 ctgaaggactactacatcttcaacaag cctcatggatctcctcgaac

MGC42718 ccgacgtgacctctagctg cacctgtctctgggtcactg

ADAM30 aacaaagcaattgtctgcctct tgcggatgttcacatggat

DDX53 tgccgatactcccactatcc attagcctccgccctcttc

DMRTB1 ccgtcctgtttgatactgacaa cggactgctcctgagacg

DMRTC2 ctttgggcgtcttcttgact caggcatgtcactgggttc

HIST1H2BA atgccggaggtgtcatctaaa agaataactctccttacgggtcc

INSL6 acccctttctcacggttgatt caagaagtagacactgggtttgt

MGC33951 gtggctttgggtcatttca aatgttggtcttgttcccaaa

RSHL1 ggcactgaaggcgaacag gatgttgggcactggtgtct

DNAJC5G cttaagaagggcgcctcac cccaggtgatactcaaaaggag

RBMXL2 agtacacccaccgcgattac gtcgctgtagcctctcaagg

PAPOLB tgcatcaacagaaaaacaacatt caagctcccaaccaggatt

PWWP1 caggtcgctcaacaactcc cggaagtagacgccgaagt

RNF17 aggtcttcctaccagcgaatg gaccggatgatctggataccc

PIWIL2 ttatgtcagaaccattcaatccac ccatgatgatgcaaacaacc

COX8C gatcagcagaggggaatgg ttctcctttggtgctcctct

DEFB126 ggttgaacattccagcctct gcctctttgctttaatgagtcg

FLJ35848 aaaacattccctttatctggatctt caccctcataaaaggcagca

MAGEA5 caccaggtcctctcaagagtc tggattgcctccatagagtgaa

MAGEB18 attgcacctgtttcatgcagt ccagcgacactactttcttgt

MAGEB3 tctcagggtctatcctccact agggaagcaattcttatggcttt

90

NT5C1B aagcaggaacaccagtgctaa ggagtcatgcaggcttgg

TTLL2 tgtgttcctccacacaaagc ggatggaatgttaagggtaaagg

WBSCR28 acgaggctctcagtgctgtt acacccagtggttgaagagg

ZPBP ccaaaatgtcctgagtgctgt ttataagcacgtttttgctcca

BTG4 gcctcatcagacgtttcctc aagggctgtttcaagttttcaa

C10orf82 ctgccaaggaatgtccaagga tgacaggtttcagtttcgggg

C12orf37 atgggatgctttgattgctc agagatgtgaggctggcagt

CCDC83 aatcctcgtcatctgctgct tccagcagcttgggtaagata

CPA5 cagcaccaacagcttcagtt cattacaaagttgtcaatccagcta

DPEP3 cctggacaggcttagagacg tcctgggactggcatgag

EBI3 cctgcagtggaaggaaagg agggtccaggagcaatcc

HIST1H3C gtctagtaatgaaccaatcagtctgg agtcccgcgcgataaaat

ISM2 actcggccctgtggctat ggtgtccttgtcctcagtgc

KIAA1257 gacgattcttggacgattcaa aattccttgatctccatcatgc

LGALS14 tcacttttgtcaaggacccac ttgtgacgcacatagatgcac

LOC441601 gccaaagcagacacactcac acaatgttcaccattttcaactgt

MAGEB6 tgagcctgaaaagtgctgtc tgtgggtaggaagactaggaagg

NBPF4 catgctgagagcgcagag tttcatcctgccatcctttg

PIWIL1 agaggttaccagaccagaatgg gtgtgggagaaacactaccactt

RBM46 ggaaatttggcggtcctc cctacaaaaacttcacagcctct

RFX4 catcaccaagcaaacccttt gactcgatgggagactgctc

ROPN1 ccaaagtggatggggagat gattataccatcagggccaatta

TKTL2 acgaccggttcatcctctc tccacccaagcagcataga

TPTE aggcacctgcgaaagaaag cgtgctaacacactttcactgat

TPTE2P2 cagaagcagtctggctttca tgtcatcggtgtctctatcaatg

TUBA3C cggaggagctcaacatgc agttcccagcaggcattg

VCY ggccaaggagacaggaaag cggccaccttggtagtctt

91

Table S7. Key clinical and biological data for the 293 lung cancer patients in our study.

Our cohort (GSE30219)

Histological subtypes

T1N0

Non T1N0

Total

Adenocarcinoma

ADC

71 14 85 Squamous Cell Tumors SQC

47 14 61 Large Cell Neuroendocrine LCNE 6 50 56 Basaloid Tumors

BAS

7 32 39 Carcinoid Tumors

CARCI 11 13 24 Small Cell Carcinoma

SCC

3 18 21 Other histology

Other 7

7 All tumors

Total 152 141 293 Non tumoral lung

NTL

37

Tumor_ID

SEX (M=male; F=female)

HISTOLOGY

M

N

T

TNM

AGE at surgery

Adj. CHEMOTHERAPY (N=no; Y=yes; ND: not known)

Adj. RADIOTHERAPY (N=no; Y=yes; ND: not known)

TOBACCO (ND: not known)

TP53::Gene mutation::Status (WT=not mutated; M=mutated; ND: not known)

Prognostic group (26 genes)

Follow-up Time (months)

Event (Dead=1; Alive=0)

EBA_007b M ADC M0 N1 T3 T3N1M0 61 N N Active Smoker ND P1 175 0

EBA_009 M ADC M0 N0 T2 T2N0M0 57 N N Former Smoker ND P2 22 1

EBA_012 M ADC M0 N0 T2 T2N0M0 71 N N Active Smoker ND P1 107 1


92

EBA_014 F ADC M0 N0 T1 T1N0M0 60 N N Never Smoker WT P1 221 0

EBA_015b F ADC M0 N0 T3 T3N0M0 73 N N Former Smoker ND P3 21 1

EBA_17 F ADC M0 N1 T2 T2N1M0 64 N N Never Smoker ND P1 17 1



EBA_24 F ADC M0 N0 T2 T2N0M0 69 N N Active Smoker ND P2 23 1


EBA_27 M ADC M0 N0 T2 T2N0M0 70 N Y Former Smoker ND P2 193 1



EBA_32 M SQC M0 N1 T1 T1N1M0 57 N Y Active Smoker ND P1 23 1

EBA_33 M SQC M0 N0 T3 T3N0M0 80 N N Former Smoker ND P2 4 1


EBA_36 M SQC M0 N0 T1 T1N0M0 48 N N Active Smoker M P1 200 0

EBA_37 M SQC M0 N1 T1 T1N1M0 50 Y Y Active Smoker ND P1 67 1



EBA_40 M SQC M0 N1 T3 T3N1M0 70 N N Active Smoker ND P3 22 1

EBA_41 M SQC M0 N1 T2 T2N1M0 48 Y N Active Smoker ND P1 204 0


EBA_51 F SQC M0 N1 T3 T3N1M0 58 N N Active Smoker ND P1 26 1

EBA_53 F SQC M0 N1 T2 T2N1M0 66 N Y Never Smoker ND P2 13 1

EBA_054b M SQC M0 N1 T4 T4N1M0 57 N Y Active Smoker ND P2 17 1

EBA_055 M BAS M0 N1 T4 T4N1M0 60 N Y Former Smoker ND P2 60 1

EBA_62 M BAS M0 N0 T1 T1N0M0 65 N N Active Smoker M P2 42 1

EBA_64 M BAS M0 N0 T1 T1N0M0 64 N N Active Smoker M P2 179 1

EBA_68 M BAS M0 N1 T2 T2N1M0 66 N N Former Smoker M P1 48 1

EBA_69 M BAS M0 N1 T1 T1N1M0 70 N Y Active Smoker ND P2 50 1

EBA_70 M BAS M0 N0 T2 T2N0M0 72 N N Former Smoker M P1 80 1

EBA_73 M LCNE M0 N0 T3 T3N0M0 50 N Y Active Smoker ND P2 3 0

EBA_75 M LCNE M0 N1 T2 T2N1M0 75 ND N Former Smoker ND P3 8 1

EBA_80 F LCNE M0 N1 T1 T1N1M0 65 N Y Active Smoker ND P2 188 0

EBA_81 M LCNE M0 N2 T2 T2N2M0 79 N Y Active Smoker M P3 2 1

EBA_82 M LCNE M0 N0 T2 T2N0M0 80 N N Former Smoker M P2 9 1

EBA_084 M LCNE M0 N2 T4 T4N2M0 77 N Y Former Smoker M P1 28 1

EBA_086 M LCNE M0 N0 T2 T2N0M0 66 N N Active Smoker M P1 57 1

EBA_092b M SCC M0 N2 T4 T4N2M0 68 N N Active Smoker ND P3 13 1

EBA_096b M SCC M1 N2 T2 T2N2M1 67 Y N Active Smoker ND P3 14 1

EBA_098 M SCC M0 N3 T4 T4N3M0 54 Y Y Former Smoker ND P3 14 1

EBA_109b M CARCI M1 N0 T2 T2N0M1 58 N N Never Smoker ND P1 85 1

EBA_111b F CARCI M0 N3 T4 T4N3M0 70 N N ND ND P1 43 1

EBA_112b M CARCI M0 N1 T2 T2N1M0 57 N N Former Smoker ND P2 184 0

93

EBA_113 F CARCI M0 N1 T2 T2N1M0 52 N N Never Smoker ND P1 155 0

EBA_116 M CARCI M0 N0 T1 T1N0M0 29 N N Active Smoker ND P1 123 0


EBA_121 M CARCI M0 N1 T1 T1N1M0 15 N N Never Smoker ND P1 119 0

EBA_141b M ADC M0 N0 T2 T2N0M0 65 N N Former Smoker ND P2 4 1

EBA_143b M SQC M0 N0 T2 T2N0M0 82 N N Former Smoker ND P2 95 1


EBA_151 M SQC M0 N1 T2 T2N1M0 63 N N Active Smoker ND P1 34 1

LBA_001 M BAS M0 N1 T1 T1N1M0 44 N Y Former Smoker ND P1 29 1

LBA_003 M BAS M0 N0 T1 T1N0M0 68 N N ND WT P2 91 0

LBA_004 M BAS M0 N1 T2 T2N1M0 55 N N Active Smoker M P2 83 0

LBA_005 M BAS M0 N0 T3 T3N0M0 67 N N Former Smoker M P2 13 1

LBA_006 M BAS M0 N1 T3 T3N1M0 56 N Y Former Smoker M P1 10 1






LBA_012 M BAS M1 N1 T2 T2N1M1 50 Y Y Former Smoker M P2 54 1

LBA_013 M SQC M0 N0 T1 T1N0M0 60 N N Active Smoker M P3 14 1

LBA_014 M BAS M0 N2 T3 T3N2M0 57 N Y Active Smoker M P2 11 1



LBA_018 F BAS M0 N2 T3 T3N2M0 65 N Y Active Smoker M P2 21 1







LBA_028 M BAS M0 N0 T1 T1N0M0 73 N N Former Smoker WT P2 52 1



LBA_031 F BAS M0 N1 T2 T2N1M0 53 N N Active Smoker M P3 34 1









94

EBA_043b M SQC M0 N0 T1 T1N0M0 58 N N Active Smoker M P2 63 0

LBA_044 F LCNE M0 N2 T3 T3N2M0 67 Y Y Active Smoker M P2 7 1

LBA_046 M LCNE M1 N2 T2 T2N2M1 74 N N Active Smoker WT P2 3 1

LBA_047 M LCNE M0 N0 T2 T2N0M0 61 N N Active Smoker M P2 1 1


LBA_053 M LCNE M0 N2 T1 T1N2M0 46 Y Y Active Smoker M P2 206 0


LBA_055 M LCNE M0 N3 T4 T4N3M0 69 N Y Active Smoker WT P3 7 1

LBA_056 M LCNE M0 N2 T4 T4N2M0 54 Y Y Former Smoker M P2 140 1

LBA_058 M LCNE M0 N2 T4 T4N2M0 45 Y N Former Smoker M P3 9 1


LBA_060 M LCNE M0 N3 T3 T3N3M0 55 N Y Former Smoker M P3 11 1

LBA_063 M LCNE M0 N3 T3 T3N3M0 54 Y Y Active Smoker WT P2 11 1

LBA_064 M LCNE M0 N0 T2 T2N0M0 72 N N Former Smoker WT P2 174 1


LBA_066 F LCNE M0 N1 T3 T3N1M0 59 N Y Former Smoker M P2 105 1

LBA_067 M LCNE M0 N2 T4 T4N2M0 39 N Y Active Smoker M P3 29 1

EBA_068b M LCNE M0 N0 T2 T2N0M0 64 N N Former Smoker ND P3 14 1

LBA_069 M LCNE M0 N2 T4 T4N2M0 65 Y Y Active Smoker M P2 118 1

LBA_070 M LCNE M0 N1 T4 T4N1M0 62 N N Active Smoker ND P3 7 1

LBA_071 M LCNE M0 N0 T2 T2N0M0 77 N N Former Smoker ND P2 81 1


EBA_074b M LCNE M0 N2 T3 T3N2M0 52 N Y Active Smoker M P3 11 1

EBA_076b M LCNE M0 N0 T2 T2N0M0 74 N N Active Smoker WT P3 14 1


EBA_078b F LCNE M0 N0 T1 T1N0M0 52 N N Active Smoker M P2 11 1

EBA_081b M LCNE M0 N0 T2 T2N0M0 68 N N Former Smoker M P1 107 1


EBA_084b M LCNE M1 NX TX TXNXM1 49 N N Former Smoker WT P3 20 1

LBA_085 F LCNE M0 N2 T2 T2N2M0 66 N Y Active Smoker M P2 118 1


EBA_087b M LCNE M0 N0 T1 T1N0M0 71 N N Former Smoker WT P1 91 1

LBA_088 M LCNE M0 N1 T2 T2N1M0 49 N N Former Smoker M P1 111 0

EBA_089b M LCNE M0 N1 T3 T3N1M0 46 N N Active Smoker M P3 13 1


LBA_091 F LCNE M0 N0 T3 T3N0M0 67 N Y Former Smoker M P2 116 0


EBA_093b M LCNE M0 N1 T3 T3N1M0 55 N Y Former Smoker M P2 25 1



LBA_096 M LCNE M0 N0 T3 T3N0M0 51 N Y Active Smoker M P3 20 1

EBA_097b M LCNE M0 N1 T2 T2N1M0 70 N N Never Smoker M P3 3 1

95


EBA_099b M LCNE M0 N0 T3 T3N0M0 41 Y N Former Smoker M P2 56 0


EBA_101b M LCNE M0 N0 T1 T1N0M0 51 N N Active Smoker M P3 32 1

EBA_105b M SCC M0 N2 T3 T3N2M0 68 Y Y Former Smoker ND P2 31 1

EBA_107b M SCC M1 N1 T4 T4N1M1 71 N N Former Smoker ND P3 6 1

EBA_108b F CARCI M0 N0 T2 T2N0M0 58 N N Never Smoker ND P1 85 0

EBA_110b M CARCI M0 NX TX TXNXM0 ND Y N Active Smoker ND P1 11 1

EBA_122b F CARCI M0 N0 T1 T1N0M0 24 N N Never Smoker ND P1 204 0

EBA_123 M LCNE M0 N1 T1 T1N1M0 48 Y Y Active Smoker ND P2 53 0

EBA_200 M SCC M0 N3 T3 T3N3M0 56 Y Y Active Smoker ND P2 28 1


EBA_204 M SCC M1 N3 TX TXN3M1 62 Y N Former Smoker ND P1 11 1

EBA_205 M SCC M0 N2 T4 T4N2M0 47 Y N Former Smoker ND P3 19 1

EBA_208 M SCC M0 N2 TX TXN2M0 83 Y N Never Smoker ND P3 14 1

EBA_209 M SCC M0 N0 T1 T1N0M0 71 Y N Former Smoker ND P3 30 1

EBA_210 M SCC M0 N0 T1 T1N0M0 51 Y N Active Smoker ND P1 77 0

EBA_212 F SCC M1 N2 TX TXN2M1 69 Y N Active Smoker ND P2 2 1




EBA_219 M SCC M0 N2 T3 T3N2M0 68 N N Active Smoker ND P2 7 1


EBA_221 M SCC M0 N3 T2 T2N3M0 67 N N Active Smoker ND P2 8 1

EBA_222 M SCC M0 N2 TX TXN2M0 40 N Y Active Smoker ND P2 10 1



EBA_227 M CARCI M0 N0 T1 T1N0M0 71 N N Former Smoker ND P1 105 0

EBA_228 F CARCI M0 N0 T1 T1N0M0 57 N N Former Smoker ND P2 115 0








EBA_240 F CARCI M0 N0 T1 T1N0M0 35 N N Active Smoker ND P2 78 0

EBA_242 M CARCI M0 N0 T2 T2N0M0 80 N N Former Smoker ND P2 67 0



EBA_304 M LCNE MX N1 T2 T2N1MX 76 ND ND ND ND P1 12 0


96


CBA_001 F ADC M0 N0 T1 T1N0M0 62 N N Former Smoker M P1 121 0

CBA_002 M ADC M0 N0 T1 T1N0M0 50 N N Former Smoker WT P1 21 1

CBA_003 F ADC M0 N0 T1 T1N0M0 62 N N Active Smoker WT P1 86 1

CBA_004 M SQC M0 N0 T1 T1N0M0 71 N N Former Smoker WT P3 12 1

CBA_005 M ADC M0 N0 T1 T1N0M0 62 N N Active Smoker WT P1 195 1

CBA_006 F ADC M0 N0 T1 T1N0M0 53 N N Former Smoker WT P1 68 0

CBA_007 M SQC M0 N0 T1 T1N0M0 67 N N Active Smoker M P2 52 1


CBA_011 M SQC M0 N0 T1 T1N0M0 78 N N Former Smoker M P2 115 0







CBA_020 M LCC M0 N0 T1 T1N0M0 62 N N Active Smoker WT P2 85 0

CBA_022 M ADC M0 N0 T1 T1N0M0 60 ND ND Never Smoker WT P1 51 0


CBA_024 M Other M0 N0 T1 T1N0M0 72 N N Active Smoker M P2 36 1


CBA_026 M ADC M0 N0 T1 T1N0M0 65 N N Former Smoker M P1 34 1

CBA_027 M SQC M0 N0 T1 T1N0M0 67 N N Former Smoker ND P2 228 1


CBA_029 M ADC M0 N0 T1 T1N0M0 77 ND N Never Smoker WT P1 58 0



CBA_032 M ADC M0 N0 T1 T1N0M0 58 N N Active Smoker M P2 102 0











CBA_046 M SQC M0 N0 T1 T1N0M0 62 N N Active Smoker WT P1 44 1



CBA_049 M Other M0 N0 T1 T1N0M0 78 N N Former Smoker M P1 2 1

97

CBA_050 F SQC M0 N0 T1 T1N0M0 74 N N Former Smoker M P1 55 0


CBA_052 F SQC M0 N0 T1 T1N0M0 70 N N Active Smoker WT P2 76 1


CBA_055 F ADC M0 N0 T1 T1N0M0 70 N N Never Smoker WT P1 175 1


CBA_057 F ADC M0 N0 T1 T1N0M0 84 N N Former Smoker WT P1 59 0














CBA_074 M SQC M0 N0 T1 T1N0M0 67 N N Never Smoker M P2 45 1





CBA_080 M ADC M0 N0 T1 T1N0M0 65 N Y Former Smoker WT P2 56 0

















98


CBA_102 M Other M0 N0 T1 T1N0M0 82 N N Active Smoker WT P1 53 1





CBA_107 M LCC M0 N0 T1 T1N0M0 56 N N Former Smoker WT P1 122 0





CBA_114 F SQC M0 N0 T1 T1N0M0 56 N N Active Smoker M P3 12 1



CBA_119 M SQC M0 N0 T1 T1N0M0 46 Y N Never Smoker M P1 59 0

CBA_120 M LCC M0 N0 T1 T1N0M0 63 N N Former Smoker M P1 216 0


CBA_122 M ADC M0 N0 T1 T1N0M0 57 N N Former Smoker ND P1 89 0











CBA_136 M Other M0 N0 T1 T1N0M0 81 N N Former Smoker M P1 14 1



CBA_140 M ADC M0 N0 T1 T1N0M0 74 N N ND M P1 0 1

CBA_141 F ADC M0 N0 T1 T1N0M0 47 N N Active Smoker M P2 11 1





99

Table S8: Percentage of positive expressions of TS/PS genes in the different histological subtypes of our series of lung tumors.

Gene id (Gene Symbol or unigene) A

ll Lung cancer

ADC

BAS

CARCI

LCNE

SCC

SQC

Hs.562766 65.4% 61.2% 87.2% 45.8% 53.6% 38.1% 85.2%

HORMAD1 49.7% 44.7% 48.7% 0.0% 60.7% 23.8% 75.4%

GNGT1 37.4% 22.4% 53.8% 16.7% 48.2% 52.4% 41.0%

ADAM12 18.5% 10.6% 30.8% 0.0% 8.9% 4.8% 42.6%

BRDT 17.1% 27.1% 12.8% 0.0% 21.4% 0.0% 14.8%

C9orf43 15.7% 7.1% 23.1% 37.5% 14.3% 14.3% 16.4%

SOX30 14.7% 14.1% 17.9% 4.2% 19.6% 23.8% 9.8%

MAGEB6 14.3% 3.5% 23.1% 8.3% 19.6% 4.8% 24.6%

LOC100287035 14.3% 10.6% 17.9% 29.2% 16.1% 23.8% 6.6%

C12orf54 14.0% 0.0% 41.0% 0.0% 0.0% 0.0% 39.3%

TKTL1 13.6% 8.2% 12.8% 20.8% 23.2% 4.8% 13.1%

TPTE 13.3% 10.6% 7.7% 0.0% 25.0% 28.6% 9.8%

RFPL3S 12.6% 3.5% 15.4% 8.3% 14.3% 33.3% 16.4%

Hs.606987 12.6% 0.0% 25.6% 4.2% 3.6% 4.8% 36.1%

ANKRD7 12.6% 3.5% 10.3% 33.3% 25.0% 19.0% 4.9%

C11orf65 12.2% 8.2% 12.8% 29.2% 10.7% 14.3% 11.5%

MAGEB18 11.9% 14.1% 12.8% 4.2% 8.9% 4.8% 16.4%

Hs.507924 10.8% 2.4% 0.0% 29.2% 17.9% 28.6% 9.8%

ADCY10 10.1% 0.0% 30.8% 0.0% 5.4% 0.0% 23.0%

MAEL 8.7% 7.1% 5.1% 4.2% 17.9% 0.0% 9.8%

COX8C 8.4% 7.1% 7.7% 4.2% 16.1% 9.5% 4.9%

TAF7L 8.0% 8.2% 7.7% 4.2% 10.7% 28.6% 0.0%

Hs.636150 8.0% 0.0% 23.1% 0.0% 3.6% 0.0% 19.7%

Hs.659210 8.0% 7.1% 5.1% 4.2% 17.9% 9.5% 3.3%

LDHC 7.7% 10.6% 10.3% 0.0% 10.7% 0.0% 4.9%

SPINLW1 7.3% 3.5% 2.6% 25.0% 3.6% 33.3% 3.3%

DKFZp761D1918 7.3% 7.1% 5.1% 25.0% 5.4% 9.5% 3.3%

INSL4 7.3% 20.0% 0.0% 0.0% 7.1% 0.0% 0.0%

DEFB126 6.6% 2.4% 5.1% 4.2% 1.8% 0.0% 21.3%

ASZ1 5.9% 8.2% 2.6% 4.2% 5.4% 14.3% 3.3%

Hs.181895 5.9% 5.9% 2.6% 16.7% 8.9% 9.5% 0.0%

FLJ25694 5.2% 1.2% 2.6% 12.5% 8.9% 19.0% 1.6%

WBSCR28 4.9% 1.2% 2.6% 4.2% 3.6% 23.8% 6.6%

C21orf105 4.9% 7.1% 2.6% 0.0% 10.7% 0.0% 1.6%

RBMY1E 4.5% 2.4% 7.7% 0.0% 7.1% 14.3% 1.6%

100

SPATA22 4.5% 1.2% 10.3% 0.0% 5.4% 14.3% 3.3%

PLCZ1 4.2% 3.5% 5.1% 0.0% 3.6% 9.5% 4.9%

HIST1H3C 4.2% 0.0% 2.6% 0.0% 10.7% 23.8% 0.0%

CPA5 4.2% 0.0% 2.6% 4.2% 12.5% 9.5% 1.6%

LOC613126 4.2% 0.0% 2.6% 41.7% 0.0% 4.8% 0.0%

FAM163A 3.8% 0.0% 0.0% 45.8% 0.0% 0.0% 0.0%

Hs.654772 3.8% 0.0% 10.3% 8.3% 0.0% 0.0% 8.2%

LOC100130548 3.8% 0.0% 2.6% 20.8% 0.0% 4.8% 6.6%

FMR1NB 3.5% 3.5% 0.0% 0.0% 12.5% 0.0% 0.0%

RBM46 3.5% 2.4% 5.1% 0.0% 5.4% 4.8% 3.3%

RFX4 3.5% 1.2% 2.6% 0.0% 14.3% 0.0% 0.0%

RAD9B 3.1% 1.2% 10.3% 0.0% 3.6% 4.8% 1.6%

RPL10L 2.8% 1.2% 2.6% 0.0% 7.1% 4.8% 1.6%

POTED 2.8% 1.2% 5.1% 12.5% 3.6% 0.0% 0.0%

Hs.156197 2.8% 0.0% 0.0% 0.0% 12.5% 4.8% 0.0%

LOC157381 2.4% 3.5% 0.0% 4.2% 0.0% 9.5% 1.6%

CPXCR1 2.4% 0.0% 2.6% 12.5% 1.8% 0.0% 3.3%

DPEP3 2.4% 2.4% 2.6% 0.0% 7.1% 0.0% 0.0%

TKTL2 2.4% 3.5% 0.0% 0.0% 3.6% 4.8% 1.6%

NBPF4 2.4% 3.5% 0.0% 0.0% 7.1% 0.0% 0.0%

KIAA1257 2.4% 0.0% 7.7% 0.0% 5.4% 0.0% 1.6%

Hs.574781 2.4% 4.7% 2.6% 0.0% 3.6% 0.0% 0.0%

Hs.666899 2.4% 1.2% 2.6% 4.2% 3.6% 9.5% 0.0%

C10orf82 2.1% 0.0% 2.6% 0.0% 1.8% 19.0% 0.0%

PAPPA 2.1% 3.5% 0.0% 0.0% 5.4% 0.0% 0.0%

PLAC4 2.1% 4.7% 0.0% 0.0% 3.6% 0.0% 0.0%

BCAR4 2.1% 5.9% 0.0% 0.0% 0.0% 0.0% 1.6%

CAPZA3 2.1% 4.7% 0.0% 0.0% 3.6% 0.0% 0.0%

RNF17 1.7% 0.0% 0.0% 0.0% 7.1% 0.0% 1.6%

PIWIL1 1.7% 0.0% 0.0% 0.0% 8.9% 0.0% 0.0%

ISM2 1.7% 0.0% 0.0% 0.0% 5.4% 9.5% 0.0%

DAZL 1.7% 1.2% 2.6% 0.0% 1.8% 0.0% 3.3%

VCX2 1.7% 1.2% 0.0% 0.0% 7.1% 0.0% 0.0%

C6orf10 1.7% 0.0% 2.6% 0.0% 0.0% 0.0% 6.6%

HIST1H2AL 1.7% 0.0% 2.6% 0.0% 7.1% 0.0% 0.0%

INSL6 1.7% 2.4% 0.0% 0.0% 5.4% 0.0% 0.0%

FAM71F1 1.7% 0.0% 7.7% 0.0% 0.0% 0.0% 3.3%

IQCF3 1.7% 0.0% 0.0% 16.7% 1.8% 0.0% 0.0%

C19orf41 1.7% 1.2% 0.0% 0.0% 7.1% 0.0% 0.0%

AMAC1 1.7% 0.0% 0.0% 0.0% 1.8% 4.8% 4.9%

SPANXC 1.4% 3.5% 0.0% 0.0% 0.0% 0.0% 1.6%

LOC387895 1.4% 1.2% 2.6% 0.0% 0.0% 9.5% 0.0%

101

ROPN1 1.4% 0.0% 5.1% 0.0% 0.0% 4.8% 1.6%

ALPPL2 1.4% 4.7% 0.0% 0.0% 0.0% 0.0% 0.0%

H2AFB1 1.4% 0.0% 2.6% 0.0% 1.8% 0.0% 3.3%

LOC441601 1.4% 1.2% 0.0% 0.0% 3.6% 4.8% 0.0%

LGALS14 1.4% 0.0% 2.6% 0.0% 5.4% 0.0% 0.0%

SPZ1 1.4% 1.2% 2.6% 0.0% 1.8% 0.0% 1.6%

C2orf84 1.4% 3.5% 0.0% 0.0% 0.0% 0.0% 1.6%

PSG3 1.0% 2.4% 0.0% 0.0% 1.8% 0.0% 0.0%

TUBA3C 1.0% 0.0% 0.0% 0.0% 5.4% 0.0% 0.0%

TCP11 1.0% 2.4% 0.0% 0.0% 1.8% 0.0% 0.0%

IGFBP1 1.0% 1.2% 0.0% 4.2% 1.8% 0.0% 0.0%

VCY 1.0% 0.0% 0.0% 0.0% 5.4% 0.0% 0.0%

C12orf37 1.0% 0.0% 5.1% 0.0% 0.0% 0.0% 1.6%

TPTE2P2 1.0% 1.2% 0.0% 0.0% 3.6% 0.0% 0.0%

TXNDC3 1.0% 0.0% 0.0% 0.0% 3.6% 0.0% 1.6%

ZNF540 1.0% 0.0% 5.1% 0.0% 0.0% 4.8% 0.0%

ZDHHC19 1.0% 0.0% 0.0% 0.0% 1.8% 0.0% 3.3%

DMRTC2 1.0% 0.0% 0.0% 0.0% 5.4% 0.0% 0.0%

C15orf43 1.0% 1.2% 5.1% 0.0% 0.0% 0.0% 0.0%

LOC645733 1.0% 1.2% 0.0% 0.0% 1.8% 0.0% 1.6%

ALS2CR11 1.0% 2.4% 0.0% 0.0% 1.8% 0.0% 0.0%

TEKT5 1.0% 2.4% 0.0% 0.0% 1.8% 0.0% 0.0%

LOC440896 1.0% 0.0% 2.6% 0.0% 1.8% 4.8% 0.0%

102

Table S9: Methylation levels (ββββ values) of the selected 347 CpG sites associated with 88 TS/PS genes in the 55 lung tumors in our series.

103

Distance CpG-TSS

GeneSym

b_RangPlot_CpG-TSS

Index_Beta

TargetID

TSS1500

TSS200

5'UTR

1stExon

Body

3'UTR

RELATION_TO_UCSC_CPG_ISLAND

value_100%

Non Methyle

value_100%

Methylation

LUTN_CBR_HS_020_M

ethylation(beta-value)

LUTN_CBR_HS_050_M


LUTN_CBR_HS_060_M


LUTN_CBR_HS_067_M


LUTN_CBR_HS_114_M


LUTN_CBR_HS_119_M


LUTN_CBR_HS_120_M


LUTN_CBR_HS_133_M


BRON_EB_HS_084_M


BRON_EB_HS_086_M


BRON_EB_HS_092_M


BRON_EB_HS_024_M


BRON_EB_HS_041_M


BRON_EB_HS_068_M


BRON_EB_HS_070_M


LBAN_EBR_HS_003_M


LBAN_EBR_HS_010_M


LBAN_EBR_HS_013_M


LBAN_EBR_HS_015_M


LBAN_EBR_HS_018_M


LBAN_EBR_HS_026_M


-1151 ADAD1_1 (-1151) 64108 cg03155733 x

N_Shore 0.26 0.92 0.85 0.67 0.54 0.76 0.82 0.88 0.86 0.61 0.66 0.56 0.86 0.50 0.55 0.59 0.89 0.87 0.80 0.82 0.80 0.73 0.81

-219 ADAD1_2 (-219) 323819 cg17756365 x x

N_Shore 0.25 0.85 0.82 0.73 0.73 0.82 0.82 0.86 0.74 0.49 0.40 0.53 0.85 0.59 0.47 0.84 0.79 0.86 0.81 0.81 0.85 0.88 0.80

-182 ADAD1_3 (-182) 127246 cg06523752 x x

N_Shore 0.16 0.90 0.79 0.68 0.74 0.81 0.83 0.74 0.76 0.35 0.29 0.61 0.89 0.65 0.61 0.63 0.81 0.89 0.77 0.80 0.74 0.65 0.72

57 ADAD1_4 (57) 328658 cg18053768 x

x x

N_Shore 0.21 0.95 0.90 0.91 0.85 0.94 0.91 0.92 0.92 0.94 0.92 0.95 0.86 0.75 0.81 0.85 0.89 0.92 0.94 0.93 0.92 0.91 0.91

127 ADAD1_5 (127) 5519 cg00257303 x

x

N_Shore 0.14 0.87 0.89 0.87 0.86 0.87 0.87 0.92 0.89 0.92 0.59 0.41 0.90 0.77 0.83 0.60 0.84 0.91 0.88 0.88 0.88 0.91 0.88

213 ADAD1_6 (213) 3419 cg00152611 x

x

N_Shore 0.09 0.89 0.82 0.62 0.68 0.83 0.81 0.86 0.79 0.34 0.51 0.40 0.84 0.51 0.53 0.64 0.82 0.67 0.60 0.83 0.50 0.54 0.58

241 ADAD1_7 (241) 202454 cg10668096

x x

Island 0.06 0.96 0.89 0.87 0.86 0.77 0.92 0.96 0.94 0.96 0.86 0.95 0.77 0.63 0.94 0.83 0.92 0.96 0.91 0.94 0.96 0.81 0.96

243 ADAD1_8 (243) 367008 cg20456564

x x

Island 0.22 0.91 0.84 0.82 0.88 0.88 0.92 0.91 0.93 0.93 0.84 0.94 0.82 0.67 0.85 0.83 0.84 0.90 0.90 0.90 0.89 0.87 0.91

289 ADAD1_9 (289) 60822 cg02985694

x x

Island 0.05 0.93 0.90 0.92 0.90 0.94 0.88 0.92 0.90 0.94 0.62 0.87 0.86 0.83 0.77 0.80 0.87 0.79 0.90 0.87 0.90 0.73 0.92

302 ADAD1_10 (302) 332751 cg18286862

x x

Island 0.05 0.96 0.97 0.95 0.97 0.96 0.97 0.97 0.97 0.97 0.86 0.94 0.96 0.90 0.96 0.91 0.94 0.95 0.96 0.96 0.96 0.96 0.93

326 ADAD1_11 (326) 12134 cg00571090

x x

Island 0.07 0.89 0.87 0.83 0.89 0.84 0.87 0.87 0.86 0.89 0.64 0.84 0.89 0.82 0.86 0.78 0.86 0.90 0.90 0.87 0.89 0.87 0.88

343 ADAD1_12 (343) 236932 cg12765972

x x

Island 0.05 0.98 0.96 0.96 0.98 0.96 0.99 0.99 0.98 0.98 0.96 0.96 0.98 0.97 0.98 0.96 0.97 0.98 0.99 0.98 0.99 0.98 0.97

473 ADAD1_13 (473) 189197 cg09912005

x x

Island 0.08 0.91 0.83 0.88 0.88 0.81 0.83 0.86 0.84 0.85 0.78 0.80 0.86 0.83 0.85 0.83 0.82 0.88 0.81 0.89 0.84 0.87 0.87

491 ADAD1_14 (491) 162380 cg08374687

x x

Island 0.16 0.94 0.91 0.92 0.92 0.91 0.97 0.95 0.94 0.97 0.91 0.92 0.92 0.89 0.91 0.90 0.91 0.96 0.93 0.91 0.95 0.86 0.92

621 ADAD1_15 (621) 185248 cg09682129

x x

Island 0.29 0.89 0.84 0.81 0.81 0.85 0.89 0.89 0.86 0.91 0.70 0.92 0.84 0.71 0.74 0.66 0.82 0.87 0.89 0.84 0.86 0.85 0.83

897 ADAD1_16 (897) 36604 cg01788029

x

S_Shore 0.13 0.91 0.88 0.83 0.74 0.86 0.90 0.90 0.93 0.93 0.80 0.78 0.89 0.65 0.54 0.64 0.78 0.87 0.66 0.92 0.87 0.81 0.76

1089 ADAD1_17 (1089) 392866 cg22162821

x

x

S_Shore 0.19 0.86 0.86 0.83 0.87 0.81 0.88 0.90 0.87 0.85 0.79 0.67 0.92 0.66 0.84 0.82 0.88 0.93 0.85 0.88 0.87 0.90 0.88

-884 ADAM12_1 (-884) 79397 cg03948236 x

S_Shore 0.12 0.91 0.90 0.85 0.80 0.87 0.88 0.90 0.87 0.91 0.85 0.70 0.87 0.49 0.84 0.50 0.86 0.91 0.88 0.88 0.86 0.88 0.78

-1143 ADCY10_1 (-1143) 316663 cg17296053 x

0.16 0.92 0.92 0.91 0.94 0.92 0.93 0.92 0.96 0.94 0.92 0.75 0.95 0.44 0.89 0.86 0.86 0.90 0.93 0.93 0.93 0.92 0.93

154 ADCY10_2 (154) 468650 cg26859666

x x

0.17 0.91 0.94 0.89 0.90 0.92 0.78 0.91 0.93 0.93 0.88 0.87 0.89 0.44 0.85 0.83 0.83 0.64 0.92 0.94 0.91 0.89 0.92

104

1012 ADCY10_3 (1012) 429344 cg24461337

x

0.22 0.93 0.91 0.90 0.92 0.94 0.96 0.93 0.93 0.95 0.92 0.92 0.96 0.51 0.88 0.90 0.89 0.95 0.92 0.94 0.94 0.93 0.95

-42 ANKRD7_1 (-42) 297857 cg16192029

x

0.03 0.97 0.91 0.92 0.93 0.96 0.93 0.93 0.92 0.90 0.44 0.87 0.97 0.31 0.30 0.44 0.94 0.96 0.79 0.91 0.94 0.69 0.91

-18 ANKRD7_2 (-18) 479334 cg27488279

x

0.22 0.92 0.79 0.62 0.73 0.77 0.82 0.78 0.81 0.37 0.48 0.82 0.86 0.51 0.47 0.49 0.71 0.76 0.65 0.85 0.85 0.59 0.70

4 ANKRD7_3 (4) 258428 cg13955432

x x

0.02 0.97 0.95 0.96 0.98 0.95 0.95 0.99 0.95 0.98 0.89 0.78 0.98 0.44 0.42 0.75 0.97 0.99 0.96 0.93 0.97 0.94 0.96

211 ANKRD7_4 (211) 340320 cg18760317

x

0.16 0.87 0.88 0.88 0.87 0.87 0.87 0.93 0.89 0.93 0.77 0.82 0.88 0.54 0.40 0.77 0.88 0.90 0.90 0.90 0.92 0.88 0.85

-343 ASZ1_1 (-343) 189184 cg09911342 x

S_Shore 0.27 0.89 0.87 0.88 0.89 0.86 0.88 0.91 0.88 0.90 0.56 0.56 0.88 0.50 0.83 0.81 0.84 0.92 0.87 0.89 0.91 0.91 0.86

-169 ASZ1_2 (-169) 175325 cg09118552

x

S_Shore 0.15 0.91 0.85 0.85 0.91 0.94 0.89 0.84 0.93 0.94 0.55 0.63 0.82 0.42 0.87 0.85 0.73 0.89 0.89 0.88 0.91 0.86 0.70

-151 ASZ1_3 (-151) 396514 cg22424532

x

S_Shore 0.16 0.89 0.88 0.82 0.88 0.87 0.80 0.85 0.89 0.91 0.55 0.51 0.83 0.43 0.65 0.85 0.68 0.88 0.83 0.85 0.90 0.86 0.78

-48 ASZ1_4 (-48) 267336 cg14382976

x

Island 0.11 0.95 0.80 0.88 0.81 0.86 0.88 0.90 0.86 0.90 0.85 0.84 0.83 0.69 0.86 0.83 0.86 0.90 0.87 0.80 0.89 0.84 0.88

-40 ASZ1_5 (-40) 306738 cg16681268

x

Island 0.13 0.96 0.87 0.93 0.91 0.94 0.92 0.95 0.93 0.97 0.90 0.89 0.87 0.78 0.90 0.91 0.93 0.95 0.95 0.89 0.93 0.91 0.95

160 ASZ1_6 (160) 304079 cg16540704

x x

Island 0.21 0.92 0.81 0.81 0.88 0.91 0.89 0.83 0.89 0.91 0.57 0.69 0.84 0.42 0.83 0.80 0.58 0.83 0.87 0.80 0.85 0.80 0.83

-1351 BCAR4_1 (-1351) 154924 cg07971129 x

0.26 0.85 0.79 0.79 0.69 0.80 0.79 0.77 0.83 0.83 0.80 0.81 0.85 0.75 0.74 0.76 0.75 0.80 0.80 0.81 0.73 0.83 0.82

-1014 BCAR4_2 (-1014) 195210 cg10248617 x

0.30 0.88 0.85 0.75 0.61 0.88 0.85 0.82 0.88 0.87 0.87 0.68 0.88 0.67 0.77 0.74 0.77 0.85 0.75 0.82 0.80 0.88 0.78

-17 BRDT_1 (-17) 6496 cg00308185

x

Island 0.19 0.90 0.84 0.54 0.59 0.72 0.87 0.88 0.88 0.89 0.84 0.88 0.84 0.48 0.70 0.57 0.51 0.78 0.64 0.86 0.60 0.81 0.81

58 BRDT_2 (58) 158641 cg08172037

x x

Island 0.20 0.94 0.94 0.92 0.53 0.92 0.94 0.94 0.93 0.95 0.88 0.93 0.93 0.45 0.88 0.75 0.47 0.89 0.81 0.92 0.80 0.93 0.90

121 BRDT_3 (121) 63721 cg03136151

x x

S_Shore 0.12 0.91 0.91 0.79 0.48 0.84 0.91 0.67 0.88 0.93 0.86 0.87 0.88 0.45 0.64 0.70 0.34 0.68 0.84 0.87 0.65 0.90 0.89

218 BRDT_4 (218) 177666 cg09250199

x x

S_Shore 0.02 0.92 0.75 0.53 0.23 0.73 0.83 0.81 0.69 0.61 0.62 0.89 0.82 0.18 0.22 0.38 0.18 0.55 0.69 0.78 0.30 0.74 0.50

597 BRDT_5 (597) 6488 cg00307685

x

S_Shore 0.17 0.90 0.84 0.88 0.61 0.89 0.88 0.89 0.90 0.88 0.85 0.90 0.89 0.46 0.82 0.57 0.63 0.83 0.86 0.88 0.86 0.90 0.90

1393 BRDT_6 (1393) 459191 cg26315244 x

x

S_Shore 0.29 0.85 0.85 0.77 0.78 0.87 0.90 0.86 0.92 0.90 0.86 0.85 0.91 0.83 0.87 0.78 0.88 0.91 0.88 0.92 0.87 0.88 0.87

148 BTG4_1 (148) 65773 cg03242880 x

x x

N_Shore 0.14 0.89 0.88 0.88 0.86 0.88 0.90 0.90 0.89 0.92 0.85 0.87 0.88 0.82 0.83 0.85 0.82 0.84 0.85 0.91 0.86 0.87 0.86

554 BTG4_2 (554) 136622 cg06995808 x

x

N_Shore 0.13 0.94 0.82 0.90 0.88 0.90 0.90 0.91 0.91 0.92 0.83 0.88 0.91 0.59 0.87 0.80 0.87 0.91 0.90 0.89 0.88 0.91 0.91

2864 BTG4_3 (2864) 36911 cg01802180

x

N_Shelf 0.18 0.88 0.82 0.85 0.85 0.76 0.80 0.85 0.88 0.89 0.73 0.58 0.89 0.39 0.84 0.64 0.89 0.89 0.88 0.82 0.82 0.76 0.83

829 C10orf82_1 (829) 476753 cg27327268

x

N_Shore 0.23 0.96 0.80 0.79 0.77 0.85 0.89 0.73 0.87 0.86 0.81 0.84 0.90 0.73 0.43 0.65 0.81 0.86 0.69 0.71 0.83 0.85 0.72

-1644 C12orf54_1 (-1644) 295161 cg16023065 x

0.16 0.87 0.87 0.85 0.89 0.84 0.78 0.91 0.85 0.90 0.63 0.76 0.84 0.49 0.83 0.69 0.64 0.72 0.75 0.91 0.89 0.85 0.86

-1595 C12orf54_2 (-1595) 463164 cg26543311 x

0.10 0.95 0.84 0.95 0.91 0.96 0.88 0.95 0.85 0.96 0.64 0.85 0.91 0.38 0.89 0.81 0.89 0.44 0.82 0.92 0.92 0.95 0.90

-1449 C12orf54_3 (-1449) 199544 cg10505355 x

0.13 0.90 0.79 0.85 0.87 0.90 0.87 0.89 0.85 0.93 0.56 0.90 0.86 0.41 0.82 0.66 0.71 0.63 0.84 0.86 0.89 0.90 0.73

-862 C12orf54_4 (-862) 226918 cg12133004

x

0.18 0.89 0.88 0.88 0.89 0.92 0.75 0.92 0.89 0.94 0.57 0.70 0.83 0.46 0.82 0.82 0.85 0.43 0.76 0.91 0.92 0.89 0.89

-24 C12orf54_5 (-24) 187940 cg09843829

x

0.21 0.89 0.86 0.88 0.86 0.90 0.89 0.89 0.89 0.93 0.80 0.92 0.83 0.54 0.86 0.83 0.85 0.78 0.84 0.88 0.91 0.91 0.87

-436 C15orf43_1 (-436) 228494 cg12227757 x

0.13 0.85 0.76 0.83 0.75 0.66 0.78 0.88 0.73 0.91 0.76 0.50 0.85 0.71 0.70 0.70 0.79 0.91 0.80 0.81 0.83 0.79 0.73

-93 C15orf43_2 (-93) 226632 cg12115928

x

0.16 0.90 0.82 0.82 0.85 0.91 0.87 0.87 0.89 0.91 0.85 0.72 0.84 0.72 0.69 0.78 0.79 0.86 0.86 0.86 0.86 0.88 0.70

105

-21 C15orf43_3 (-21) 368291 cg20543571

x

0.21 0.91 0.84 0.81 0.81 0.91 0.91 0.87 0.90 0.74 0.84 0.85 0.85 0.69 0.83 0.77 0.80 0.86 0.89 0.83 0.86 0.90 0.84

33 C15orf43_4 (33) 426088 cg24252746

x

0.03 0.92 0.91 0.93 0.93 0.92 0.93 0.94 0.91 0.92 0.92 0.72 0.94 0.90 0.88 0.88 0.89 0.92 0.92 0.91 0.91 0.91 0.89

-984 C18orf20_1 (-984) 102627 cg05155520 x

0.10 0.94 0.79 0.80 0.68 0.91 0.86 0.90 0.93 0.91 0.48 0.80 0.88 0.48 0.43 0.49 0.79 0.62 0.89 0.90 0.90 0.53 0.89

-829 C18orf20_2 (-829) 359923 cg19981951 x

0.14 0.96 0.70 0.72 0.80 0.85 0.71 0.88 0.81 0.92 0.41 0.93 0.85 0.40 0.39 0.49 0.43 0.62 0.34 0.87 0.88 0.48 0.71

-377 C18orf20_3 (-377) 35346 cg01722450 x

0.12 0.96 0.84 0.85 0.88 0.91 0.80 0.92 0.86 0.95 0.62 0.87 0.89 0.54 0.51 0.67 0.77 0.73 0.71 0.91 0.92 0.50 0.86

-284 C18orf20_4 (-284) 191540 cg10054857 x

0.13 0.87 0.74 0.76 0.88 0.88 0.66 0.86 0.84 0.89 0.45 0.83 0.87 0.46 0.48 0.63 0.65 0.85 0.43 0.84 0.88 0.58 0.65

-549 C19orf41_1 (-549) 62971 cg03095288 x

S_Shore 0.10 0.83 0.66 0.59 0.46 0.47 0.51 0.30 0.34 0.44 0.70 0.66 0.84 0.37 0.30 0.39 0.79 0.26 0.68 0.53 0.41 0.77 0.74

-1421 C2orf84_1 (-1421) 229664 cg12305798 x

N_Shore 0.12 0.91 0.75 0.48 0.41 0.83 0.60 0.37 0.78 0.75 0.62 0.73 0.87 0.45 0.31 0.44 0.86 0.35 0.55 0.74 0.59 0.75 0.61

-432 C2orf84_2 (-432) 468272 cg26838691 x

N_Shore 0.31 0.92 0.89 0.91 0.89 0.89 0.90 0.93 0.89 0.93 0.89 0.89 0.93 0.79 0.85 0.76 0.90 0.76 0.88 0.87 0.66 0.90 0.87

-322 C2orf84_3 (-322) 457987 cg26250093 x

Island 0.07 0.94 0.93 0.95 0.93 0.93 0.94 0.92 0.93 0.94 0.90 0.92 0.96 0.89 0.88 0.90 0.90 0.96 0.95 0.92 0.93 0.96 0.96

199 C2orf84_4 (199) 336691 cg18527919

x

Island 0.08 0.96 0.92 0.95 0.93 0.91 0.93 0.92 0.94 0.96 0.90 0.96 0.94 0.90 0.85 0.92 0.88 0.92 0.97 0.90 0.92 0.90 0.94

-1300 C6orf10_1 (-1300) 440691 cg25145195 x

0.10 0.90 0.90 0.87 0.64 0.79 0.64 0.79 0.86 0.92 0.48 0.50 0.93 0.76 0.56 0.64 0.84 0.42 0.68 0.87 0.83 0.73 0.81

-699 C6orf10_2 (-699) 15625 cg00738945 x

0.17 0.88 0.82 0.90 0.82 0.74 0.79 0.85 0.84 0.85 0.38 0.64 0.85 0.64 0.62 0.59 0.83 0.90 0.88 0.86 0.84 0.80 0.70

-553 C6orf10_3 (-553) 456610 cg26166145 x

0.17 0.71 0.89 0.78 0.74 0.70 0.77 0.83 0.84 0.85 0.65 0.57 0.86 0.81 0.84 0.84 0.75 0.88 0.88 0.85 0.89 0.84 0.83

144 C6orf10_4 (144) 184626 cg09646336

x x

0.23 0.91 0.90 0.93 0.86 0.97 0.91 0.96 0.94 0.94 0.61 0.74 0.94 0.85 0.90 0.62 0.86 0.93 0.92 0.93 0.90 0.91 0.90

47 C9orf11_1 (47) 121863 cg06206119

x x

0.19 0.85 0.85 0.80 0.79 0.86 0.81 0.74 0.90 0.87 0.70 0.57 0.84 0.51 0.68 0.69 0.68 0.82 0.74 0.86 0.85 0.83 0.69

1288 C9orf43_1 (1288) 30780 cg01481976 x

x

S_Shore 0.25 0.90 0.88 0.82 0.81 0.82 0.90 0.88 0.86 0.89 0.78 0.50 0.85 0.83 0.79 0.84 0.83 0.87 0.84 0.85 0.84 0.87 0.86

1421 C9orf43_2 (1421) 300955 cg16367027 x

x

S_Shore 0.16 0.89 0.89 0.91 0.90 0.93 0.92 0.93 0.92 0.93 0.91 0.75 0.91 0.88 0.88 0.89 0.87 0.93 0.91 0.94 0.93 0.95 0.94

3749 CCDC38_1 (3749) 477350 cg27366263

x

N_Shelf 0.28 0.92 0.86 0.77 0.61 0.80 0.47 0.52 0.83 0.86 0.84 0.64 0.86 0.72 0.49 0.49 0.61 0.52 0.38 0.87 0.76 0.78 0.46

-409 CCDC42_1 (-409) 474817 cg27217253 x

N_Shore 0.08 0.97 0.81 0.32 0.29 0.13 0.40 0.37 0.23 0.21 0.23 0.34 0.81 0.34 0.28 0.51 0.33 0.37 0.18 0.57 0.35 0.43 0.31

-40 CCDC42_2 (-40) 345516 cg19093680

x

N_Shore 0.15 0.90 0.91 0.85 0.79 0.31 0.89 0.90 0.78 0.93 0.63 0.70 0.92 0.49 0.43 0.67 0.82 0.91 0.79 0.89 0.67 0.92 0.55

-22 CCDC42_3 (-22) 479779 cg27513572

x

N_Shore 0.18 0.91 0.85 0.77 0.65 0.22 0.80 0.81 0.56 0.87 0.52 0.41 0.86 0.44 0.40 0.60 0.72 0.83 0.64 0.87 0.53 0.88 0.47

118 CCDC42_4 (118) 191594 cg10057436

x x

N_Shore 0.18 0.91 0.83 0.82 0.69 0.39 0.84 0.88 0.70 0.91 0.67 0.61 0.87 0.55 0.34 0.68 0.83 0.83 0.69 0.85 0.61 0.88 0.54

-1485 COX8C_1 (-1485) 374253 cg20938103 x

x

N_Shore 0.23 0.89 0.87 0.87 0.85 0.77 0.83 0.89 0.84 0.91 0.90 0.48 0.94 0.65 0.86 0.86 0.85 0.95 0.87 0.90 0.92 0.92 0.88

-600 COX8C_2 (-600) 35410 cg01726287 x

x

N_Shore 0.24 0.88 0.78 0.69 0.52 0.64 0.58 0.59 0.70 0.81 0.69 0.25 0.85 0.51 0.43 0.75 0.80 0.59 0.74 0.80 0.74 0.65 0.75

241 COX8C_3 (241) 195 cg00008493

x

x

Island 0.33 0.90 0.87 0.85 0.91 0.94 0.93 0.90 0.94 0.93 0.85 0.90 0.88 0.86 0.88 0.88 0.89 0.90 0.91 0.88 0.90 0.89 0.86

501 COX8C_4 (501) 99620 cg04994970

x

x

Island 0.11 0.95 0.89 0.93 0.95 0.89 0.94 0.97 0.90 0.96 0.91 0.86 0.97 0.73 0.95 0.90 0.89 0.92 0.95 0.91 0.95 0.93 0.94

568 COX8C_5 (568) 114359 cg05794411

x

x

Island 0.12 0.93 0.89 0.92 0.95 0.96 0.94 0.95 0.93 0.93 0.89 0.93 0.91 0.79 0.90 0.84 0.88 0.91 0.93 0.91 0.94 0.94 0.90

-578 CPA5_1 (-578) 318038 cg17376631 x

0.15 0.90 0.80 0.88 0.89 0.84 0.91 0.93 0.86 0.88 0.88 0.60 0.86 0.49 0.85 0.82 0.88 0.92 0.90 0.90 0.92 0.93 0.72

-1289 DAZL_1 (-1289) 78742 cg03911306 x

S_Shore 0.13 0.92 0.74 0.85 0.67 0.83 0.78 0.55 0.85 0.86 0.70 0.72 0.74 0.56 0.43 0.32 0.79 0.50 0.65 0.68 0.77 0.87 0.55

106

-706 DAZL_2 (-706) 404398 cg22929549 x

S_Shore 0.17 0.89 0.87 0.86 0.69 0.90 0.88 0.83 0.89 0.90 0.92 0.86 0.88 0.47 0.51 0.78 0.84 0.75 0.74 0.83 0.82 0.81 0.76

-603 DAZL_3 (-603) 400728 cg22703164 x

S_Shore 0.15 0.93 0.88 0.79 0.87 0.82 0.89 0.90 0.88 0.93 0.92 0.79 0.91 0.72 0.56 0.82 0.87 0.92 0.81 0.88 0.89 0.91 0.84

-338 DAZL_4 (-338) 149023 cg07643314 x

S_Shore 0.21 0.94 0.89 0.87 0.89 0.83 0.89 0.90 0.91 0.92 0.89 0.73 0.91 0.56 0.63 0.85 0.87 0.90 0.93 0.90 0.91 0.88 0.87

-98 DAZL_5 (-98) 312937 cg17070539

x

Island 0.27 0.89 0.89 0.82 0.87 0.87 0.88 0.89 0.89 0.88 0.90 0.68 0.92 0.83 0.81 0.91 0.87 0.93 0.90 0.93 0.90 0.94 0.88

-90 DAZL_6 (-90) 294966 cg16011604

x

Island 0.06 0.96 0.97 0.94 0.93 0.91 0.95 0.96 0.89 0.94 0.96 0.79 0.97 0.94 0.92 0.94 0.93 0.96 0.95 0.95 0.96 0.94 0.94

-11 DAZL_7 (-11) 217776 cg11610140

x

Island 0.04 0.94 0.90 0.87 0.89 0.88 0.95 0.94 0.93 0.94 0.89 0.64 0.93 0.91 0.92 0.84 0.91 0.83 0.90 0.89 0.91 0.92 0.88

22 DAZL_8 (22) 299144 cg16266007

x x

Island 0.12 0.97 0.97 0.96 0.96 0.96 0.97 0.97 0.96 0.97 0.93 0.90 0.97 0.95 0.96 0.94 0.95 0.97 0.96 0.97 0.97 0.96 0.96

101 DAZL_9 (101) 305945 cg16639713

x x

Island 0.26 0.87 0.85 0.82 0.87 0.85 0.88 0.88 0.87 0.87 0.82 0.62 0.86 0.77 0.81 0.81 0.77 0.88 0.84 0.87 0.84 0.88 0.84

-1148 DCAF4L1_1 (-1148) 154149 cg07927617 x

N_Shore 0.23 0.85 0.85 0.80 0.77 0.86 0.81 0.87 0.84 0.86 0.80 0.75 0.86 0.76 0.64 0.58 0.71 0.78 0.85 0.89 0.83 0.91 0.78

-752 DCAF4L1_2 (-752) 299679 cg16296785 x

N_Shore 0.23 0.91 0.88 0.89 0.88 0.92 0.93 0.92 0.93 0.92 0.88 0.89 0.93 0.84 0.87 0.87 0.87 0.94 0.90 0.94 0.92 0.90 0.86

211 DCAF4L1_3 (211) 98605 cg04941033

x

Island 0.13 0.92 0.82 0.78 0.77 0.84 0.86 0.89 0.89 0.92 0.77 0.80 0.80 0.60 0.81 0.76 0.83 0.70 0.82 0.80 0.85 0.88 0.78

373 DCAF4L1_4 (373) 396566 cg22428762

x

Island 0.24 0.91 0.88 0.90 0.92 0.89 0.91 0.93 0.90 0.94 0.88 0.89 0.85 0.74 0.83 0.84 0.85 0.87 0.91 0.91 0.89 0.88 0.93

1256 DCAF4L1_5 (1256) 57974 cg02853107

x

S_Shore 0.07 0.92 0.94 0.92 0.81 0.95 0.90 0.94 0.62 0.96 0.78 0.68 0.94 0.75 0.88 0.67 0.90 0.93 0.89 0.94 0.90 0.88 0.92

-1377 DDX53_1 (-1377) 441998 cg25231425 x

0.29 0.69 0.75 0.81 0.82 0.75 0.85 0.80 0.76 0.81 0.82 0.39 0.86 0.48 0.36 0.76 0.81 0.88 0.78 0.80 0.84 0.84 0.78

-953 DDX53_2 (-953) 208314 cg11025235 x

0.17 0.81 0.72 0.77 0.80 0.77 0.83 0.82 0.78 0.84 0.78 0.42 0.81 0.40 0.58 0.45 0.78 0.83 0.80 0.84 0.85 0.81 0.77

-199 DDX53_3 (-199) 389136 cg21908878

x

0.11 0.93 0.73 0.89 0.84 0.81 0.81 0.90 0.85 0.92 0.87 0.60 0.83 0.27 0.60 0.43 0.87 0.85 0.87 0.92 0.91 0.78 0.85

-106 DDX53_4 (-106) 259822 cg14020146

x

0.04 0.87 0.70 0.90 0.97 0.87 0.80 0.98 0.81 0.92 0.84 0.11 0.91 0.21 0.60 0.35 0.91 0.96 0.93 0.94 0.94 0.82 0.93

-95 DDX53_5 (-95) 453908 cg26009591

x

0.09 0.96 0.72 0.90 0.94 0.88 0.84 0.94 0.88 0.98 0.86 0.33 0.89 0.24 0.68 0.43 0.95 0.93 0.92 0.93 0.94 0.78 0.95

-80 DDX53_6 (-80) 473305 cg27124742

x

0.19 0.94 0.82 0.90 0.94 0.91 0.92 0.96 0.95 0.93 0.91 0.60 0.90 0.42 0.89 0.60 0.90 0.94 0.94 0.95 0.94 0.88 0.95

-50 DDX53_7 (-50) 391225 cg22052586

x

0.26 0.92 0.83 0.91 0.88 0.90 0.88 0.92 0.84 0.96 0.91 0.60 0.88 0.44 0.86 0.69 0.89 0.94 0.92 0.90 0.93 0.88 0.92

-29 DDX53_8 (-29) 262252 cg14138275

x

0.13 0.92 0.77 0.88 0.91 0.90 0.84 0.91 0.76 0.92 0.83 0.65 0.72 0.29 0.45 0.61 0.88 0.91 0.89 0.91 0.91 0.76 0.86

24 DDX53_9 (24) 116010 cg05886698

x x

0.18 0.91 0.81 0.90 0.94 0.90 0.94 0.91 0.93 0.92 0.92 0.91 0.92 0.50 0.86 0.84 0.89 0.93 0.90 0.91 0.93 0.90 0.89

44 DDX53_10 (44) 110062 cg05553756

x x

0.15 0.90 0.82 0.89 0.88 0.87 0.88 0.91 0.90 0.91 0.84 0.87 0.86 0.42 0.88 0.75 0.84 0.89 0.89 0.92 0.91 0.88 0.82

-631 DPEP3_1 (-631) 91258 cg04556612 x

S_Shore 0.20 0.91 0.89 0.89 0.86 0.92 0.89 0.87 0.93 0.92 0.86 0.92 0.89 0.58 0.67 0.72 0.85 0.88 0.92 0.91 0.82 0.90 0.90

-357 DPEP3_2 (-357) 466104 cg26710926 x

S_Shore 0.13 0.89 0.77 0.71 0.75 0.88 0.86 0.89 0.86 0.88 0.82 0.72 0.88 0.45 0.64 0.49 0.81 0.75 0.78 0.87 0.72 0.85 0.52

341 DPEP3_3 (341) 58826 cg02893490

x

Island 0.07 0.94 0.93 0.94 0.92 0.96 0.95 0.95 0.93 0.96 0.91 0.88 0.96 0.60 0.89 0.66 0.92 0.88 0.93 0.94 0.87 0.94 0.94

526 EDDM3B_1 (526) 292168 cg15842430

x

0.19 0.89 0.82 0.78 0.89 0.86 0.85 0.81 0.87 0.86 0.50 0.87 0.82 0.48 0.47 0.55 0.81 0.64 0.35 0.86 0.72 0.87 0.81

1526 EDDM3B_2 (1526) 136922 cg07010207

x

0.16 0.89 0.81 0.55 0.84 0.76 0.89 0.82 0.88 0.50 0.38 0.58 0.87 0.44 0.42 0.48 0.45 0.54 0.35 0.83 0.66 0.84 0.51

1581 EDDM3B_3 (1581) 403901 cg22895202

x

0.16 0.90 0.78 0.71 0.71 0.89 0.80 0.83 0.86 0.90 0.49 0.78 0.84 0.44 0.43 0.45 0.51 0.43 0.37 0.88 0.61 0.56 0.72

3874 FAM163A_1 (3874) 171697 cg08895981

x

S_Shelf 0.12 0.93 0.87 0.71 0.54 0.92 0.83 0.89 0.89 0.75 0.86 0.85 0.92 0.46 0.44 0.46 0.84 0.51 0.39 0.79 0.74 0.90 0.89

107

44768 FAM163A_2 (44768) 334009 cg18369629

x

0.11 0.90 0.74 0.86 0.81 0.86 0.86 0.87 0.87 0.88 0.78 0.77 0.86 0.44 0.39 0.37 0.83 0.72 0.64 0.82 0.86 0.87 0.53

65075 FAM163A_3 (65075) 257930 cg13931250

x

0.17 0.95 0.82 0.89 0.81 0.92 0.88 0.87 0.90 0.93 0.86 0.93 0.92 0.63 0.33 0.46 0.88 0.86 0.82 0.82 0.86 0.85 0.69

-1332 FAM24A_1 (-1332) 473424 cg27131510 x

0.08 0.80 0.88 0.82 0.86 0.85 0.70 0.87 0.83 0.79 0.80 0.61 0.87 0.82 0.53 0.78 0.87 0.78 0.89 0.86 0.76 0.89 0.81

-1322 FAM24A_2 (-1322) 268477 cg14440102 x

0.10 0.96 0.92 0.93 0.96 0.93 0.96 0.98 0.94 0.98 0.95 0.53 0.94 0.88 0.78 0.87 0.94 0.80 0.94 0.92 0.92 0.89 0.87

-57 FAM47B_1 (-57) 334125 cg18377059

x

N_Shore 0.03 0.90 0.74 0.85 0.92 0.89 0.80 0.91 0.87 0.94 0.51 0.79 0.75 0.35 0.89 0.60 0.72 0.94 0.89 0.86 0.91 0.75 0.92

-37 FAM47B_2 (-37) 400855 cg22710391

x

N_Shore 0.01 0.97 0.84 0.92 0.72 0.98 0.89 0.98 0.89 0.95 0.79 0.95 0.83 0.42 0.95 0.71 0.71 0.97 0.96 0.86 0.97 0.84 0.95

43 FAM47B_3 (43) 324896 cg17825231

x

N_Shore 0.12 0.90 0.84 0.86 0.90 0.86 0.88 0.92 0.76 0.91 0.65 0.83 0.90 0.44 0.78 0.74 0.84 0.85 0.91 0.89 0.90 0.85 0.85

537 FAM47B_4 (537) 143109 cg07324045

x

Island 0.04 0.90 0.73 0.89 0.91 0.93 0.86 0.94 0.90 0.91 0.62 0.90 0.83 0.38 0.66 0.71 0.85 0.52 0.88 0.90 0.93 0.78 0.90

649 FAM47B_5 (649) 361256 cg20067941

x

Island 0.08 0.85 0.70 0.86 0.83 0.64 0.83 0.72 0.55 0.77 0.38 0.59 0.85 0.47 0.79 0.50 0.83 0.89 0.74 0.83 0.84 0.81 0.80

728 FAM47B_6 (728) 35076 cg01710449

x

Island 0.09 0.83 0.85 0.85 0.83 0.81 0.82 0.82 0.79 0.81 0.85 0.70 0.81 0.81 0.88 0.86 0.88 0.94 0.73 0.93 0.92 0.89 0.84

-271 FKBP6_1 (-271) 144354 cg07393419 x

x

Island 0.12 0.97 0.95 0.83 0.78 0.90 0.76 0.78 0.75 0.77 0.94 0.91 0.96 0.81 0.77 0.77 0.67 0.79 0.69 0.88 0.72 0.77 0.82

-267 FKBP6_2 (-267) 392174 cg22120509 x

x

Island 0.20 0.94 0.91 0.82 0.72 0.81 0.77 0.77 0.74 0.79 0.93 0.85 0.94 0.75 0.73 0.75 0.65 0.73 0.69 0.85 0.74 0.71 0.79

-261 FKBP6_3 (-261) 286571 cg15505998 x

x

Island 0.33 0.90 0.86 0.84 0.83 0.89 0.90 0.91 0.86 0.92 0.85 0.89 0.88 0.82 0.79 0.79 0.81 0.91 0.88 0.89 0.88 0.88 0.88

555 FKBP6_4 (555) 258805 cg13975641 x

x

Island 0.27 0.87 0.80 0.82 0.73 0.63 0.88 0.85 0.66 0.88 0.75 0.60 0.82 0.55 0.75 0.56 0.77 0.66 0.60 0.82 0.77 0.84 0.82

1046 FKBP6_5 (1046) 267536 cg14393567 x

x

S_Shore 0.17 0.89 0.88 0.80 0.83 0.88 0.90 0.87 0.92 0.91 0.88 0.77 0.89 0.72 0.65 0.56 0.83 0.83 0.81 0.89 0.79 0.89 0.85

1094 FKBP6_6 (1094) 94956 cg04756316 x

x

S_Shore 0.23 0.90 0.83 0.80 0.69 0.80 0.79 0.83 0.79 0.81 0.79 0.58 0.85 0.56 0.55 0.48 0.86 0.69 0.83 0.86 0.86 0.87 0.72

3E+07 FLJ25694_1 (31184524) 404970 cg22961727 x

0.17 0.90 0.83 0.77 0.60 0.87 0.81 0.89 0.92 0.92 0.61 0.49 0.89 0.59 0.54 0.65 0.90 0.59 0.50 0.68 0.88 0.60 0.90

3E+07 FLJ25694_2 (31184536) 213810 cg11354857 x

0.09 0.91 0.81 0.55 0.59 0.84 0.71 0.89 0.89 0.91 0.57 0.41 0.89 0.49 0.50 0.63 0.88 0.47 0.38 0.65 0.86 0.55 0.84

-301 FMR1NB_1 (-301) 236416 cg12732953 x

N_Shore 0.12 0.90 0.81 0.81 0.86 0.84 0.85 0.61 0.81 0.92 0.70 0.45 0.81 0.41 0.43 0.68 0.86 0.80 0.74 0.90 0.81 0.84 0.86

-176 FMR1NB_2 (-176) 180786 cg09425262

x

Island 0.02 0.95 0.85 0.92 0.93 0.92 0.92 0.95 0.92 0.96 0.95 0.91 0.88 0.70 0.89 0.90 0.89 0.97 0.95 0.93 0.94 0.85 0.88

-146 FMR1NB_3 (-146) 17159 cg00812634

x

Island 0.02 0.98 0.96 0.98 0.96 0.97 0.97 0.96 0.97 0.99 0.97 0.93 0.98 0.88 0.97 0.95 0.97 0.98 0.96 0.98 0.99 0.96 0.93

-144 FMR1NB_4 (-144) 57587 cg02834125

x

Island 0.19 0.92 0.90 0.88 0.88 0.92 0.89 0.92 0.92 0.94 0.86 0.89 0.89 0.74 0.90 0.85 0.85 0.91 0.91 0.92 0.93 0.87 0.91

-91 FMR1NB_5 (-91) 387543 cg21807849

x

Island 0.09 0.93 0.91 0.94 0.94 0.95 0.90 0.91 0.93 0.93 0.83 0.79 0.94 0.67 0.91 0.88 0.89 0.94 0.88 0.92 0.95 0.91 0.91

-64 FMR1NB_6 (-64) 307989 cg16746539

x

Island 0.07 0.94 0.83 0.91 0.93 0.90 0.90 0.94 0.91 0.94 0.86 0.81 0.93 0.68 0.92 0.75 0.91 0.84 0.90 0.91 0.92 0.86 0.91

61 FMR1NB_7 (61) 27852 cg01336631

x x

Island 0.21 0.89 0.84 0.84 0.85 0.91 0.88 0.92 0.91 0.91 0.88 0.79 0.90 0.63 0.86 0.78 0.83 0.91 0.89 0.93 0.89 0.89 0.84

246 FMR1NB_8 (246) 397496 cg22495120

x

S_Shore 0.14 0.91 0.72 0.85 0.92 0.85 0.89 0.89 0.88 0.89 0.80 0.92 0.83 0.48 0.82 0.56 0.83 0.76 0.88 0.86 0.89 0.81 0.88

317 FMR1NB_9 (317) 380424 cg21319950

x

S_Shore 0.13 0.96 0.80 0.86 0.86 0.95 0.83 0.93 0.90 0.95 0.86 0.95 0.87 0.40 0.91 0.70 0.84 0.89 0.73 0.89 0.89 0.79 0.90

-360 GALNTL5_1 (-360) 437054 cg24919101 x

0.24 0.90 0.90 0.88 0.90 0.92 0.92 0.91 0.90 0.93 0.89 0.76 0.92 0.74 0.82 0.85 0.85 0.92 0.92 0.92 0.83 0.93 0.92

10531 GALNTL5_2 (10531) 36026 cg01760103

x

x

0.15 0.90 0.76 0.67 0.73 0.80 0.77 0.38 0.84 0.93 0.84 0.60 0.92 0.44 0.46 0.50 0.67 0.62 0.67 0.84 0.72 0.67 0.81

10561 GALNTL5_3 (10561) 383974 cg21565299

x

x

0.28 0.88 0.81 0.65 0.80 0.64 0.74 0.81 0.59 0.81 0.73 0.42 0.90 0.68 0.85 0.73 0.71 0.88 0.70 0.83 0.78 0.83 0.76

108

1E+08 GMCL1L_1 (107558188) 129036 cg06619299 x

S_Shore 0.18 0.91 0.87 0.84 0.89 0.87 0.87 0.90 0.90 0.91 0.87 0.68 0.90 0.86 0.64 0.66 0.83 0.89 0.88 0.85 0.86 0.90 0.87

1E+08 GMCL1L_2 (107558701) 100551 cg05043074 x

S_Shore 0.17 0.89 0.77 0.90 0.83 0.84 0.87 0.85 0.85 0.93 0.86 0.70 0.92 0.83 0.67 0.74 0.88 0.88 0.86 0.84 0.90 0.91 0.79

-899 GNGT1_1 (-899) 238396 cg12863967 x

0.20 0.87 0.82 0.66 0.63 0.85 0.47 0.88 0.89 0.84 0.67 0.53 0.85 0.48 0.58 0.62 0.54 0.49 0.63 0.84 0.77 0.70 0.80

-88 GNGT1_2 (-88) 372850 cg20829211

x

0.38 0.79 0.72 0.61 0.43 0.61 0.50 0.40 0.70 0.79 0.44 0.49 0.72 0.37 0.45 0.56 0.76 0.38 0.42 0.70 0.68 0.66 0.61

-1353 HEATR7B2_1 (-1353) 182764 cg09538031 x

0.23 0.88 0.77 0.76 0.69 0.87 0.69 0.90 0.44 0.43 0.50 0.43 0.78 0.37 0.35 0.43 0.51 0.60 0.70 0.83 0.89 0.56 0.68

-547 HEATR7B2_2 (-547) 38924 cg01900397 x

0.21 0.95 0.75 0.85 0.89 0.78 0.80 0.89 0.45 0.93 0.66 0.44 0.87 0.43 0.34 0.48 0.61 0.89 0.74 0.83 0.93 0.68 0.71

-436 HEATR7B2_3 (-436) 315286 cg17208869 x

0.17 0.87 0.83 0.87 0.91 0.79 0.82 0.90 0.70 0.89 0.44 0.57 0.93 0.39 0.45 0.71 0.87 0.50 0.63 0.85 0.94 0.67 0.88

-131 HORMAD1_1 (-131) 402657 cg22823121

x

0.14 0.93 0.81 0.86 0.86 0.90 0.93 0.92 0.94 0.91 0.83 0.88 0.86 0.78 0.90 0.64 0.83 0.81 0.89 0.86 0.70 0.86 0.91

-113 HORMAD1_2 (-113) 173991 cg09034736

x

0.04 0.93 0.81 0.88 0.83 0.93 0.93 0.92 0.90 0.88 0.86 0.90 0.89 0.83 0.89 0.80 0.90 0.84 0.78 0.91 0.62 0.75 0.93

-32 HORMAD1_3 (-32) 134645 cg06893172

x

0.25 0.93 0.94 0.94 0.94 0.95 0.96 0.97 0.95 0.97 0.94 0.87 0.96 0.93 0.94 0.94 0.94 0.96 0.93 0.95 0.95 0.93 0.95

-24 HORMAD1_4 (-24) 102019 cg05125051

x

0.07 0.91 0.91 0.95 0.87 0.92 0.94 0.94 0.93 0.91 0.92 0.73 0.92 0.90 0.89 0.84 0.88 0.94 0.93 0.91 0.93 0.95 0.90

52 HORMAD1_5 (52) 174399 cg09059988

x x

0.21 0.86 0.87 0.88 0.89 0.91 0.92 0.90 0.89 0.92 0.89 0.90 0.89 0.88 0.84 0.85 0.87 0.88 0.92 0.91 0.89 0.90 0.91

251 HORMAD1_6 (251) 371896 cg20767356

x

0.07 0.96 0.90 0.92 0.89 0.96 0.89 0.96 0.94 0.97 0.89 0.76 0.97 0.89 0.89 0.91 0.92 0.97 0.91 0.96 0.93 0.93 0.91

380 HORMAD1_7 (380) 279862 cg15069995

x

0.07 0.80 0.92 0.87 0.84 0.89 0.82 0.91 0.86 0.83 0.87 0.59 0.93 0.90 0.90 0.87 0.89 0.81 0.89 0.92 0.89 0.93 0.92

-1402 IGFBP1_1 (-1402) 363693 cg20237960 x

N_Shore 0.26 0.84 0.90 0.86 0.86 0.90 0.94 0.86 0.87 0.90 0.88 0.76 0.92 0.80 0.46 0.83 0.88 0.92 0.91 0.93 0.94 0.93 0.86

-1367 IGFBP1_2 (-1367) 196507 cg10326031 x

N_Shore 0.10 0.91 0.82 0.86 0.83 0.91 0.80 0.73 0.76 0.93 0.68 0.75 0.87 0.69 0.31 0.44 0.81 0.68 0.71 0.82 0.83 0.82 0.47

-58 INSL4_1 (-58) 348481 cg19297688

x

0.11 0.93 0.87 0.62 0.46 0.91 0.77 0.69 0.87 0.86 0.58 0.91 0.91 0.57 0.57 0.58 0.44 0.49 0.40 0.76 0.53 0.78 0.46

121 INSL4_2 (121) 225716 cg12067261

x

0.11 0.89 0.89 0.81 0.52 0.87 0.86 0.90 0.88 0.91 0.64 0.85 0.88 0.63 0.55 0.61 0.53 0.73 0.71 0.86 0.77 0.90 0.82

-545 INSL6_1 (-545) 265084 cg14268714 x

S_Shore 0.18 0.85 0.86 0.78 0.83 0.84 0.85 0.85 0.87 0.88 0.81 0.80 0.82 0.73 0.70 0.79 0.78 0.86 0.83 0.87 0.81 0.87 0.78

31 INSL6_2 (31) 249177 cg13504907

x

Island 0.22 0.85 0.84 0.83 0.84 0.86 0.85 0.84 0.82 0.88 0.74 0.82 0.81 0.77 0.74 0.73 0.78 0.83 0.83 0.79 0.84 0.87 0.78

-1367 IQUB_1 (-1367) 469443 cg26903781 x

S_Shore 0.21 0.85 0.91 0.75 0.60 0.64 0.60 0.81 0.83 0.84 0.69 0.59 0.90 0.65 0.62 0.63 0.75 0.81 0.80 0.90 0.77 0.74 0.78

4453 IQUB_2 (4453) 360435 cg20014495

x

N_Shelf 0.10 0.92 0.93 0.87 0.88 0.91 0.85 0.95 0.90 0.93 0.92 0.80 0.92 0.60 0.85 0.84 0.76 0.93 0.81 0.91 0.85 0.83 0.89

6624 IQUB_3 (6624) 454854 cg26070081

x

0.06 0.92 0.85 0.65 0.54 0.74 0.73 0.65 0.72 0.67 0.68 0.58 0.82 0.63 0.58 0.69 0.62 0.63 0.57 0.78 0.72 0.69 0.69

124 IRGC_1 (124) 443661 cg25344367

x

N_Shelf 0.23 0.88 0.88 0.85 0.59 0.88 0.86 0.88 0.88 0.90 0.84 0.85 0.82 0.78 0.83 0.53 0.79 0.85 0.85 0.85 0.79 0.87 0.84

-1321 ISM2_1 (-1321) 205876 cg10878444 x

S_Shore 0.18 0.88 0.77 0.79 0.54 0.86 0.80 0.76 0.74 0.89 0.72 0.82 0.88 0.73 0.39 0.40 0.53 0.75 0.75 0.80 0.56 0.89 0.40

-936 KIAA1257_1 (-936) 67727 cg03344114 x

S_Shore 0.18 0.90 0.83 0.76 0.69 0.86 0.83 0.85 0.83 0.88 0.79 0.88 0.88 0.70 0.34 0.43 0.80 0.79 0.81 0.84 0.78 0.88 0.58

-1282 KISS1_1 (-1282) 320800 cg17539235 x

0.14 0.91 0.85 0.84 0.77 0.94 0.91 0.93 0.91 0.80 0.87 0.95 0.90 0.70 0.74 0.81 0.83 0.78 0.89 0.87 0.86 0.90 0.88

-1128 KISS1_2 (-1128) 32607 cg01574287 x

0.16 0.92 0.88 0.83 0.75 0.89 0.86 0.92 0.89 0.90 0.85 0.90 0.93 0.65 0.52 0.86 0.83 0.72 0.82 0.89 0.89 0.92 0.82

-352 LDHC_1 (-352) 138574 cg07093428 x

0.21 0.86 0.88 0.52 0.62 0.75 0.61 0.50 0.42 0.19 0.32 0.49 0.86 0.36 0.68 0.48 0.84 0.80 0.80 0.88 0.85 0.91 0.79

-298 LDHC_2 (-298) 356255 cg19767548 x

0.24 0.90 0.89 0.54 0.70 0.81 0.65 0.73 0.71 0.45 0.34 0.81 0.92 0.37 0.73 0.53 0.84 0.85 0.75 0.88 0.90 0.94 0.59

109

-288 LDHC_3 (-288) 266395 cg14332815 x

0.18 0.86 0.87 0.56 0.75 0.86 0.61 0.68 0.71 0.32 0.37 0.90 0.91 0.33 0.66 0.54 0.86 0.82 0.84 0.91 0.91 0.93 0.60

-1105 LGALS13_1 (-1105) 391558 cg22076764 x

0.23 0.82 0.80 0.67 0.63 0.84 0.71 0.82 0.83 0.81 0.74 0.52 0.88 0.53 0.50 0.67 0.81 0.38 0.81 0.81 0.74 0.71 0.83

1E+06 LOC100128554_1 (1431046) 392415 cg22135490 x

0.14 0.94 0.82 0.79 0.90 0.27 0.86 0.94 0.62 0.89 0.46 0.19 0.86 0.75 0.47 0.76 0.73 0.37 0.39 0.67 0.90 0.57 0.82

1E+06 LOC100128554_2 (1431403) 24513 cg01164334

x

0.19 0.93 0.80 0.59 0.71 0.48 0.81 0.87 0.54 0.47 0.45 0.24 0.81 0.52 0.49 0.66 0.65 0.39 0.59 0.63 0.74 0.49 0.78

1E+06 LOC100128554_3 (1431447) 467263 cg26787589

x

0.13 0.89 0.75 0.50 0.76 0.49 0.52 0.70 0.65 0.41 0.38 0.20 0.85 0.65 0.48 0.63 0.64 0.27 0.30 0.50 0.62 0.35 0.80

1E+06 LOC100128554_4 (1431461) 343290 cg18942757

x

0.15 0.91 0.77 0.37 0.61 0.75 0.58 0.95 0.72 0.90 0.37 0.28 0.82 0.54 0.39 0.53 0.63 0.26 0.35 0.54 0.45 0.36 0.82

-851 LOC126536_1 (-851) 56740 cg02785793 x

0.25 0.83 0.77 0.69 0.81 0.67 0.80 0.84 0.78 0.87 0.74 0.58 0.87 0.64 0.44 0.78 0.78 0.81 0.83 0.84 0.84 0.85 0.74

-125 LOC126536_2 (-125) 148944 cg07639020

x

0.24 0.85 0.86 0.82 0.86 0.87 0.90 0.90 0.88 0.93 0.88 0.58 0.87 0.78 0.85 0.83 0.86 0.90 0.85 0.86 0.87 0.86 0.82

-97 LOC126536_3 (-97) 47076 cg02305471

x

0.33 0.82 0.89 0.88 0.88 0.84 0.91 0.91 0.89 0.93 0.89 0.57 0.90 0.87 0.73 0.84 0.84 0.92 0.88 0.91 0.90 0.93 0.87

-791 LOC151658_1 (-791) 184683 cg09649523 x

0.17 0.95 0.93 0.90 0.85 0.94 0.89 0.93 0.95 0.93 0.87 0.83 0.92 0.64 0.50 0.66 0.90 0.85 0.95 0.93 0.94 0.93 0.94

-185 LOC151658_2 (-185) 35513 cg01731777

x

0.18 0.91 0.87 0.79 0.69 0.90 0.74 0.83 0.92 0.89 0.78 0.88 0.92 0.41 0.49 0.47 0.80 0.79 0.70 0.87 0.89 0.85 0.71

-1128 LOC441601_1 (-1128) 51781 cg02542440 x

S_Shore 0.27 0.88 0.77 0.85 0.86 0.83 0.86 0.85 0.70 0.90 0.58 0.53 0.85 0.50 0.66 0.62 0.74 0.55 0.79 0.71 0.88 0.78 0.78

-651 LOC441601_2 (-651) 175943 cg09150309 x

S_Shore 0.05 0.91 0.93 0.92 0.88 0.81 0.88 0.88 0.88 0.88 0.90 0.63 0.91 0.85 0.89 0.92 0.91 0.89 0.88 0.95 0.90 0.85 0.92

-297 MAEL_1 (-297) 342634 cg18894878 x

Island 0.19 0.91 0.84 0.38 0.47 0.82 0.67 0.84 0.89 0.70 0.73 0.79 0.83 0.37 0.35 0.49 0.47 0.40 0.38 0.64 0.32 0.52 0.49

-285 MAEL_2 (-285) 472077 cg27053975 x

Island 0.20 0.90 0.84 0.47 0.53 0.85 0.62 0.82 0.85 0.51 0.73 0.87 0.84 0.51 0.47 0.55 0.45 0.49 0.54 0.69 0.45 0.59 0.45

-245 MAEL_3 (-245) 429223 cg24453820 x

Island 0.15 0.91 0.92 0.85 0.78 0.90 0.85 0.93 0.93 0.85 0.90 0.80 0.90 0.60 0.49 0.63 0.69 0.82 0.67 0.82 0.82 0.79 0.79

-196 MAEL_4 (-196) 213488 cg11336590

x

Island 0.21 0.88 0.79 0.65 0.59 0.77 0.69 0.83 0.90 0.71 0.70 0.87 0.86 0.53 0.50 0.59 0.61 0.61 0.55 0.70 0.53 0.64 0.59

-129 MAEL_5 (-129) 347561 cg19241352

x

Island 0.05 0.97 0.94 0.92 0.95 0.97 0.93 0.99 0.98 0.98 0.93 0.93 0.96 0.74 0.51 0.91 0.71 0.94 0.62 0.73 0.94 0.68 0.91

-117 MAEL_6 (-117) 248635 cg13480774

x

Island 0.06 0.92 0.84 0.81 0.86 0.87 0.84 0.93 0.92 0.85 0.77 0.87 0.91 0.64 0.42 0.76 0.61 0.78 0.50 0.65 0.80 0.57 0.76

-112 MAEL_7 (-112) 431389 cg24586196

x

Island 0.05 0.92 0.87 0.88 0.92 0.88 0.85 0.89 0.87 0.92 0.87 0.74 0.92 0.76 0.57 0.87 0.70 0.91 0.69 0.72 0.88 0.72 0.87

63 MAEL_8 (63) 244281 cg13249256

x x

Island 0.15 0.97 0.93 0.96 0.91 0.95 0.96 0.96 0.92 0.95 0.92 0.90 0.95 0.72 0.91 0.81 0.89 0.89 0.85 0.86 0.94 0.83 0.94

65 MAEL_9 (65) 323840 cg17757848

x x

Island 0.12 0.94 0.92 0.94 0.86 0.97 0.95 0.95 0.95 0.97 0.89 0.94 0.95 0.69 0.93 0.79 0.93 0.95 0.92 0.88 0.96 0.89 0.95

60 MAGEB18_1 (60) 393579 cg22215739

x x

0.12 0.90 0.80 0.67 0.69 0.79 0.82 0.52 0.58 0.90 0.49 0.26 0.87 0.45 0.51 0.58 0.43 0.68 0.54 0.76 0.84 0.57 0.79

86 MAGEB18_2 (86) 243933 cg13226591

x x

0.18 0.95 0.82 0.72 0.64 0.87 0.80 0.79 0.66 0.93 0.60 0.22 0.80 0.42 0.43 0.56 0.42 0.74 0.49 0.68 0.84 0.52 0.77

-1451 MAGEB3_1 (-1451) 212513 cg11276914 x

0.21 0.73 0.81 0.67 0.63 0.87 0.59 0.86 0.75 0.84 0.56 0.52 0.81 0.42 0.33 0.50 0.61 0.52 0.41 0.85 0.76 0.68 0.55

-1120 MAGEB6_1 (-1120) 367635 cg20495640 x

0.18 0.83 0.69 0.71 0.76 0.72 0.65 0.79 0.44 0.42 0.42 0.36 0.74 0.37 0.39 0.47 0.74 0.80 0.41 0.63 0.84 0.57 0.67

-148 MAGEB6_2 (-148) 125626 cg06431611

x

0.16 0.90 0.91 0.89 0.91 0.92 0.92 0.93 0.92 0.95 0.81 0.89 0.89 0.79 0.87 0.84 0.86 0.92 0.94 0.93 0.92 0.90 0.90

53 MAGEB6_3 (53) 400756 cg22705131

x x

0.05 0.98 0.95 0.88 0.85 0.94 0.85 0.96 0.94 0.96 0.51 0.71 0.96 0.52 0.86 0.72 0.45 0.90 0.86 0.64 0.95 0.53 0.93

156 MAGEB6_4 (156) 296750 cg16122592

x

0.12 0.92 0.78 0.69 0.65 0.86 0.75 0.79 0.49 0.45 0.37 0.46 0.69 0.40 0.40 0.54 0.42 0.75 0.10 0.63 0.81 0.55 0.83

-170 OR7E156P_1 (-170) 208296 cg11023992

x

0.24 0.87 0.84 0.63 0.42 0.80 0.65 0.87 0.85 0.85 0.56 0.41 0.83 0.45 0.69 0.56 0.59 0.58 0.35 0.74 0.81 0.62 0.77

110

-12 OR7E156P_2 (-12) 191623 cg10059167

x

0.19 0.94 0.91 0.41 0.46 0.72 0.72 0.95 0.63 0.96 0.63 0.20 0.91 0.52 0.45 0.57 0.40 0.49 0.43 0.79 0.48 0.65 0.88

-979 PAPOLB_1 (-979) 152847 cg07856421 x

x

S_Shore 0.23 0.88 0.82 0.74 0.38 0.81 0.86 0.88 0.74 0.90 0.88 0.54 0.87 0.47 0.64 0.62 0.59 0.81 0.83 0.91 0.74 0.91 0.81

-633 PAPOLB_2 (-633) 165390 cg08545365 x

x

S_Shore 0.17 0.87 0.90 0.88 0.79 0.93 0.93 0.90 0.92 0.94 0.91 0.85 0.94 0.83 0.89 0.85 0.88 0.93 0.93 0.90 0.81 0.93 0.91

-426 PAPOLB_3 (-426) 201720 cg10625588 x

x

S_Shore 0.15 0.94 0.89 0.88 0.69 0.92 0.94 0.96 0.88 0.96 0.91 0.81 0.90 0.63 0.91 0.69 0.86 0.92 0.92 0.93 0.90 0.95 0.93

-391 PAPOLB_4 (-391) 123350 cg06295928 x

x

S_Shore 0.15 0.93 0.78 0.70 0.66 0.85 0.90 0.81 0.80 0.94 0.84 0.53 0.86 0.49 0.70 0.53 0.84 0.61 0.82 0.80 0.53 0.87 0.87

-1157 PIWIL1_1 (-1157) 224869 cg12020444 x

N_Shore 0.30 0.91 0.83 0.55 0.38 0.30 0.75 0.49 0.42 0.82 0.42 0.25 0.86 0.45 0.43 0.53 0.73 0.55 0.45 0.57 0.45 0.71 0.58

-1083 PIWIL1_2 (-1083) 298724 cg16244664 x

N_Shore 0.18 0.93 0.82 0.54 0.34 0.35 0.77 0.47 0.39 0.81 0.36 0.47 0.85 0.41 0.43 0.47 0.77 0.50 0.41 0.63 0.31 0.57 0.52

-10 PIWIL1_3 (-10) 435641 cg24838063

x

Island 0.20 0.97 0.76 0.90 0.90 0.92 0.90 0.87 0.96 0.94 0.95 0.91 0.64 0.77 0.91 0.70 0.84 0.95 0.84 0.91 0.92 0.37 0.94

-8 PIWIL1_4 (-8) 465460 cg26677194

x

Island 0.21 0.95 0.89 0.95 0.95 0.93 0.94 0.93 0.96 0.95 0.95 0.92 0.78 0.86 0.91 0.90 0.90 0.97 0.92 0.95 0.94 0.57 0.96

61 PIWIL1_5 (61) 419909 cg23887609

x x

Island 0.20 0.89 0.79 0.71 0.85 0.78 0.78 0.83 0.76 0.86 0.71 0.56 0.71 0.56 0.89 0.80 0.66 0.90 0.72 0.79 0.83 0.49 0.84

205 PIWIL1_6 (205) 473699 cg27147004

x

N_Shore 0.23 0.92 0.85 0.64 0.72 0.74 0.79 0.88 0.82 0.77 0.79 0.43 0.91 0.50 0.79 0.68 0.55 0.73 0.64 0.77 0.72 0.48 0.87

-1075 PLCZ1_1 (-1075) 157342 cg08108029 x

x

0.17 0.88 0.85 0.85 0.79 0.80 0.90 0.90 0.86 0.85 0.81 0.53 0.88 0.75 0.59 0.83 0.87 0.91 0.89 0.87 0.90 0.89 0.70

-297 PLCZ1_2 (-297) 290496 cg15736336 x

x

0.20 0.95 0.80 0.87 0.54 0.94 0.89 0.93 0.69 0.95 0.48 0.92 0.86 0.70 0.48 0.66 0.87 0.90 0.80 0.80 0.93 0.88 0.67

-417 POTED_1 (-417) 185523 cg09698634 x

0.16 0.93 0.81 0.90 0.88 0.90 0.78 0.80 0.95 0.93 0.91 0.95 0.92 0.87 0.86 0.90 0.86 0.93 0.93 0.93 0.78 0.90 0.73

-134 POTED_2 (-134) 428403 cg24403041

x

0.19 0.85 0.80 0.38 0.49 0.40 0.69 0.70 0.64 0.73 0.45 0.45 0.82 0.46 0.54 0.58 0.46 0.47 0.54 0.67 0.42 0.65 0.69

-623 PPP1R2P9_1 (-623) 194203 cg10194937 x

S_Shore 0.12 0.91 0.77 0.86 0.90 0.90 0.86 0.93 0.90 0.94 0.72 0.94 0.88 0.34 0.87 0.69 0.87 0.82 0.90 0.90 0.92 0.79 0.94

-93 PPP1R2P9_2 (-93) 108293 cg05454424

x

S_Shore 0.09 0.93 0.96 0.90 0.95 0.93 0.83 0.96 0.91 0.96 0.94 0.93 0.91 0.80 0.96 0.95 0.91 0.95 0.94 0.97 0.96 0.87 0.97

-21 PPP1R2P9_3 (-21) 459377 cg26327984

x

S_Shore 0.08 0.96 0.96 0.88 0.97 0.96 0.80 0.98 0.96 0.97 0.95 0.92 0.83 0.68 0.95 0.94 0.93 0.96 0.94 0.95 0.96 0.82 0.95

-1139 PRPS1L1_1 (-1139) 348351 cg19286658 x

0.14 0.93 0.91 0.89 0.91 0.92 0.84 0.90 0.92 0.94 0.84 0.57 0.92 0.67 0.62 0.77 0.88 0.82 0.89 0.92 0.93 0.92 0.87

-52 PRPS1L1_2 (-52) 28370 cg01364651

x

0.43 0.85 0.91 0.87 0.76 0.79 0.91 0.83 0.86 0.89 0.74 0.66 0.95 0.78 0.84 0.85 0.85 0.93 0.82 0.92 0.93 0.88 0.86

-50 PRPS1L1_3 (-50) 422085 cg24007612

x

0.26 0.80 0.89 0.86 0.81 0.82 0.86 0.88 0.84 0.88 0.78 0.65 0.90 0.84 0.88 0.90 0.81 0.91 0.84 0.90 0.92 0.87 0.87

-48 PRPS1L1_4 (-48) 386595 cg21746050

x

0.28 0.80 0.90 0.88 0.84 0.85 0.90 0.85 0.87 0.92 0.76 0.60 0.86 0.83 0.90 0.86 0.83 0.91 0.86 0.92 0.89 0.92 0.83

-45 PRPS1L1_5 (-45) 209694 cg11112914

x

0.26 0.95 0.95 0.92 0.91 0.94 0.95 0.94 0.93 0.99 0.63 0.73 0.90 0.79 0.87 0.88 0.88 0.91 0.89 0.93 0.92 0.93 0.84

-23 PRPS1L1_6 (-23) 446537 cg25522484

x

0.11 0.94 0.89 0.73 0.87 0.84 0.71 0.87 0.95 0.92 0.59 0.92 0.89 0.55 0.89 0.54 0.89 0.69 0.75 0.89 0.87 0.78 0.90

22 PRPS1L1_7 (22) 19174 cg00911873

x x

0.17 0.92 0.92 0.91 0.89 0.95 0.92 0.92 0.93 0.93 0.88 0.84 0.94 0.79 0.91 0.80 0.90 0.76 0.93 0.96 0.94 0.95 0.90

48 PRPS1L1_8 (48) 227098 cg12144754

x x

0.22 0.93 0.95 0.93 0.91 0.93 0.91 0.95 0.96 0.96 0.64 0.83 0.93 0.73 0.91 0.73 0.90 0.85 0.91 0.97 0.93 0.90 0.91

82 PRPS1L1_9 (82) 28461 cg01369228

x

0.04 0.97 0.95 0.96 0.94 0.96 0.97 0.96 0.95 0.96 0.61 0.84 0.97 0.72 0.95 0.60 0.93 0.84 0.93 0.96 0.97 0.93 0.94

203 PRPS1L1_10 (203) 67747 cg03344806

x

0.18 0.84 0.81 0.76 0.73 0.74 0.63 0.79 0.78 0.87 0.55 0.66 0.83 0.59 0.47 0.53 0.79 0.44 0.56 0.85 0.78 0.78 0.56

687 RAD9B_1 (687) 51280 cg02517261 x

x

S_Shore 0.18 0.93 0.90 0.90 0.92 0.94 0.90 0.91 0.93 0.95 0.91 0.92 0.92 0.84 0.86 0.88 0.88 0.93 0.93 0.94 0.91 0.92 0.93

1083 RAD9B_2 (1083) 373421 cg20877181 x

x

S_Shore 0.24 0.89 0.88 0.81 0.84 0.92 0.87 0.87 0.90 0.91 0.85 0.91 0.84 0.77 0.84 0.64 0.83 0.77 0.90 0.88 0.60 0.89 0.84

111

-85 RBM46_1 (-85) 123697 cg06318837

x

Island 0.16 0.87 0.88 0.84 0.82 0.93 0.85 0.87 0.88 0.88 0.65 0.91 0.86 0.46 0.83 0.75 0.87 0.84 0.89 0.87 0.83 0.86 0.90

-75 RBM46_2 (-75) 460933 cg26413432

x

Island 0.20 0.91 0.90 0.84 0.79 0.93 0.91 0.91 0.89 0.94 0.86 0.96 0.78 0.46 0.88 0.83 0.88 0.85 0.92 0.85 0.85 0.80 0.88

1003 RBM46_3 (1003) 87485 cg04355617

x

S_Shore 0.19 0.93 0.87 0.61 0.55 0.81 0.68 0.86 0.78 0.88 0.66 0.68 0.87 0.49 0.50 0.62 0.76 0.69 0.68 0.74 0.79 0.87 0.83

-1229 RFPL3S_1 (-1229) 216176 cg11510714 x

0.25 0.83 0.84 0.53 0.58 0.84 0.74 0.74 0.87 0.88 0.74 0.76 0.88 0.50 0.63 0.80 0.79 0.71 0.63 0.79 0.79 0.93 0.84

-1052 RFPL3S_2 (-1052) 361424 cg20078817 x

0.07 0.90 0.83 0.47 0.49 0.89 0.66 0.59 0.88 0.88 0.42 0.88 0.85 0.43 0.46 0.56 0.86 0.59 0.76 0.76 0.60 0.89 0.87

-586 RFPL3S_3 (-586) 197921 cg10413297 x

0.21 0.88 0.86 0.77 0.77 0.81 0.86 0.86 0.86 0.89 0.86 0.54 0.92 0.47 0.50 0.73 0.77 0.41 0.73 0.89 0.68 0.90 0.82

-100 RFPL3S_4 (-100) 306233 cg16655295

x

0.14 0.92 0.89 0.64 0.57 0.92 0.82 0.90 0.88 0.92 0.88 0.72 0.89 0.52 0.46 0.63 0.85 0.47 0.43 0.84 0.73 0.91 0.92

-32 RFPL3S_5 (-32) 109910 cg05544007

x

0.11 0.94 0.95 0.89 0.85 0.90 0.93 0.94 0.93 0.95 0.91 0.57 0.94 0.72 0.40 0.85 0.91 0.57 0.69 0.94 0.90 0.93 0.94

17389 RFX4_1 (17389) 273679 cg14699867 x

x

0.16 0.91 0.90 0.91 0.90 0.88 0.93 0.87 0.91 0.93 0.89 0.91 0.92 0.81 0.88 0.72 0.89 0.91 0.92 0.92 0.93 0.93 0.90

101378 RFX4_2 (101378) 248899 cg13491945

x

x

0.12 0.92 0.82 0.89 0.75 0.88 0.91 0.91 0.78 0.94 0.89 0.80 0.91 0.75 0.72 0.49 0.89 0.88 0.77 0.89 0.91 0.92 0.88

101520 RFX4_3 (101520) 64017 cg03149970

x x x

0.15 0.93 0.90 0.92 0.84 0.93 0.94 0.92 0.86 0.94 0.93 0.77 0.91 0.69 0.78 0.52 0.89 0.86 0.89 0.94 0.93 0.91 0.88

101577 RFX4_4 (101577) 187272 cg09806036

x x

0.16 0.91 0.85 0.88 0.85 0.90 0.90 0.89 0.88 0.90 0.88 0.70 0.90 0.64 0.77 0.51 0.86 0.79 0.80 0.90 0.89 0.92 0.87

101621 RFX4_5 (101621) 13304 cg00625103

x x

0.18 0.93 0.75 0.84 0.76 0.87 0.91 0.70 0.89 0.93 0.87 0.93 0.89 0.55 0.75 0.46 0.85 0.45 0.45 0.88 0.90 0.88 0.74

101648 RFX4_6 (101648) 465490 cg26678516

x x

0.14 0.96 0.77 0.84 0.80 0.78 0.87 0.98 0.88 0.90 0.86 0.76 0.86 0.59 0.54 0.45 0.84 0.56 0.80 0.90 0.86 0.89 0.72

-1045 RNF17_1 (-1045) 29198 cg01405147 x

0.17 0.93 0.81 0.80 0.85 0.87 0.87 0.84 0.89 0.92 0.57 0.88 0.79 0.51 0.73 0.72 0.85 0.76 0.70 0.86 0.66 0.88 0.83

-651 RNF17_2 (-651) 387907 cg21831927 x

0.19 0.84 0.85 0.85 0.88 0.75 0.89 0.88 0.90 0.88 0.84 0.70 0.89 0.65 0.77 0.83 0.87 0.93 0.83 0.94 0.90 0.93 0.86

-610 RNF17_3 (-610) 286792 cg15523998 x

0.24 0.87 0.86 0.81 0.83 0.81 0.80 0.89 0.91 0.81 0.89 0.72 0.87 0.67 0.81 0.73 0.86 0.89 0.86 0.88 0.86 0.85 0.72

-187 RNF17_4 (-187) 139345 cg07131398

x

0.05 0.81 0.65 0.81 0.78 0.56 0.80 0.78 0.82 0.80 0.43 0.74 0.85 0.40 0.53 0.67 0.80 0.85 0.75 0.72 0.81 0.70 0.64

-165 RNF17_5 (-165) 224877 cg12020676

x

0.24 0.84 0.76 0.71 0.82 0.87 0.81 0.81 0.88 0.76 0.54 0.86 0.86 0.63 0.66 0.59 0.81 0.78 0.83 0.81 0.78 0.83 0.74

-66 RNF17_6 (-66) 367348 cg20477497

x

0.15 0.89 0.83 0.81 0.85 0.90 0.90 0.86 0.88 0.74 0.77 0.78 0.88 0.48 0.71 0.77 0.79 0.84 0.90 0.84 0.74 0.89 0.69

-13 RNF17_7 (-13) 324565 cg17806989

x

0.25 0.95 0.97 0.95 0.97 0.96 0.95 0.97 0.95 0.97 0.91 0.96 0.95 0.83 0.94 0.90 0.92 0.94 0.95 0.96 0.95 0.94 0.97

-11 RNF17_8 (-11) 4386 cg00202166

x

0.20 0.93 0.94 0.92 0.95 0.92 0.94 0.95 0.96 0.97 0.92 0.92 0.93 0.73 0.92 0.74 0.92 0.94 0.93 0.94 0.92 0.95 0.92

-131 RPL10L_1 (-131) 276578 cg14871534

x

Island 0.07 0.87 0.75 0.70 0.80 0.85 0.84 0.83 0.84 0.89 0.33 0.42 0.82 0.53 0.63 0.77 0.74 0.82 0.70 0.83 0.82 0.66 0.83

-129 RPL10L_2 (-129) 105077 cg05282641

x

Island 0.04 0.95 0.85 0.78 0.90 0.91 0.89 0.93 0.93 0.94 0.30 0.37 0.91 0.54 0.58 0.82 0.81 0.93 0.76 0.95 0.91 0.64 0.94

-105 RPL10L_3 (-105) 411916 cg23370328

x

Island 0.06 0.97 0.91 0.90 0.95 0.95 0.95 0.91 0.85 0.96 0.47 0.50 0.89 0.52 0.78 0.86 0.91 0.95 0.78 0.92 0.93 0.72 0.95

-90 RPL10L_4 (-90) 128665 cg06599920

x

Island 0.15 0.92 0.88 0.79 0.92 0.93 0.90 0.89 0.87 0.93 0.64 0.70 0.85 0.56 0.88 0.83 0.81 0.89 0.75 0.87 0.91 0.72 0.81

-6 RPL10L_5 (-6) 137958 cg07062130

x

Island 0.21 0.90 0.80 0.88 0.84 0.84 0.89 0.87 0.90 0.92 0.76 0.88 0.83 0.76 0.83 0.74 0.82 0.88 0.89 0.87 0.88 0.70 0.86

25 RPL10L_6 (25) 46096 cg02259232

x x

Island 0.06 0.97 0.92 0.95 0.93 0.98 0.98 0.95 0.97 0.97 0.66 0.94 0.98 0.92 0.97 0.92 0.96 0.98 0.97 0.96 0.97 0.93 0.95

107 RPL10L_7 (107) 447946 cg25610245

x

Island 0.05 0.95 0.90 0.94 0.89 0.90 0.94 0.95 0.91 0.92 0.71 0.62 0.91 0.72 0.79 0.88 0.85 0.89 0.88 0.89 0.87 0.84 0.92

-1473 SOX30_1 (-1473) 77655 cg03853593 x

S_Shore 0.10 0.87 0.82 0.74 0.70 0.88 0.83 0.59 0.74 0.57 0.82 0.57 0.87 0.47 0.62 0.61 0.69 0.88 0.49 0.90 0.88 0.82 0.51

112

-398 SOX30_2 (-398) 438103 cg24986915 x

S_Shore 0.15 0.90 0.92 0.91 0.90 0.94 0.93 0.92 0.94 0.94 0.91 0.92 0.92 0.68 0.86 0.88 0.89 0.94 0.94 0.94 0.93 0.93 0.92

-93 SOX30_3 (-93) 145577 cg07464716

x

Island 0.17 0.91 0.87 0.86 0.83 0.65 0.91 0.90 0.87 0.93 0.85 0.61 0.68 0.49 0.79 0.76 0.83 0.92 0.81 0.90 0.92 0.93 0.87

-41 SOX30_4 (-41) 136623 cg06995810

x

Island 0.14 0.90 0.91 0.92 0.89 0.63 0.92 0.93 0.92 0.94 0.83 0.91 0.83 0.54 0.84 0.87 0.88 0.92 0.91 0.84 0.91 0.95 0.93

-13 SOX30_5 (-13) 446922 cg25551243

x

Island 0.05 0.98 0.90 0.92 0.74 0.53 0.87 0.97 0.92 0.96 0.65 0.97 0.77 0.46 0.96 0.85 0.85 0.89 0.81 0.90 0.86 0.85 0.97

115 SOX30_6 (115) 299974 cg16313910

x x

Island 0.05 0.98 0.89 0.79 0.51 0.43 0.60 0.97 0.79 0.96 0.41 0.92 0.93 0.59 0.93 0.61 0.53 0.61 0.46 0.88 0.47 0.88 0.89

-950 SPATA22_1 (-950) 154042 cg07922387 x

S_Shore 0.15 0.92 0.93 0.91 0.85 0.92 0.93 0.94 0.95 0.96 0.89 0.85 0.94 0.85 0.71 0.67 0.89 0.88 0.94 0.92 0.93 0.94 0.87

-880 SPATA22_2 (-880) 235291 cg12655548 x

S_Shore 0.12 0.89 0.89 0.86 0.77 0.91 0.92 0.89 0.91 0.92 0.89 0.89 0.91 0.85 0.65 0.85 0.85 0.90 0.92 0.88 0.92 0.93 0.91

-562 SPATA22_3 (-562) 367519 cg20488857 x

S_Shore 0.05 0.96 0.87 0.91 0.89 0.88 0.94 0.90 0.89 0.94 0.66 0.64 0.92 0.85 0.90 0.83 0.90 0.62 0.92 0.86 0.91 0.94 0.91

-556 SPATA22_4 (-556) 69201 cg03422252 x

S_Shore 0.02 0.94 0.83 0.84 0.81 0.89 0.83 0.86 0.85 0.92 0.60 0.54 0.85 0.80 0.82 0.58 0.81 0.59 0.84 0.77 0.84 0.88 0.90

-535 SPATA22_5 (-535) 137635 cg07046197 x

S_Shore 0.04 0.90 0.82 0.90 0.83 0.80 0.88 0.89 0.91 0.93 0.59 0.77 0.91 0.87 0.86 0.71 0.85 0.71 0.88 0.86 0.82 0.87 0.91

-430 SPATA22_6 (-430) 133988 cg06862644 x

S_Shore 0.15 0.91 0.75 0.86 0.82 0.89 0.91 0.91 0.89 0.93 0.62 0.50 0.86 0.86 0.42 0.55 0.88 0.42 0.90 0.83 0.83 0.88 0.84

-197 SPATA22_7 (-197) 243755 cg13216327

x

Island 0.16 0.92 0.88 0.88 0.85 0.89 0.92 0.88 0.90 0.94 0.82 0.90 0.84 0.86 0.86 0.81 0.84 0.83 0.92 0.91 0.90 0.90 0.88

-184 SPATA22_8 (-184) 385997 cg21695935

x

Island 0.40 0.75 0.85 0.87 0.86 0.91 0.77 0.83 0.91 0.88 0.82 0.41 0.86 0.80 0.75 0.79 0.59 0.92 0.81 0.80 0.84 0.77 0.87

-172 SPATA22_9 (-172) 50042 cg02458198

x

Island 0.06 0.97 0.97 0.97 0.92 0.96 0.97 0.97 0.97 0.97 0.94 0.84 0.97 0.95 0.94 0.95 0.94 0.98 0.97 0.96 0.95 0.96 0.97

-170 SPATA22_10 (-170) 303367 cg16505927

x

Island 0.06 0.97 0.96 0.96 0.92 0.97 0.98 0.97 0.98 0.98 0.96 0.91 0.98 0.96 0.95 0.97 0.97 0.97 0.97 0.94 0.98 0.97 0.97

-4 SPATA22_11 (-4) 430597 cg24534173

x x x

Island 0.04 0.96 0.96 0.96 0.96 0.97 0.99 0.98 0.96 0.99 0.95 0.90 0.98 0.95 0.95 0.93 0.93 0.95 0.97 0.97 0.98 0.97 0.97

68 SPATA22_12 (68) 232429 cg12485992

x x

N_Shore 0.26 0.90 0.84 0.82 0.86 0.77 0.86 0.87 0.85 0.91 0.70 0.85 0.83 0.83 0.64 0.76 0.49 0.87 0.85 0.85 0.83 0.86 0.86

135 SPATA22_13 (135) 174546 cg09068520

x x

N_Shore 0.04 0.95 0.87 0.85 0.78 0.90 0.89 0.86 0.76 0.92 0.70 0.35 0.90 0.86 0.91 0.82 0.84 0.55 0.93 0.93 0.64 0.92 0.83

-627 SPATC1_1 (-627) 75201 cg03722185 x

0.11 0.93 0.88 0.90 0.85 0.91 0.89 0.91 0.93 0.93 0.85 0.89 0.88 0.62 0.41 0.57 0.86 0.81 0.93 0.90 0.92 0.91 0.93

-348 SPERT_1 (-348) 163159 cg08423667 x

0.21 0.92 0.80 0.88 0.84 0.86 0.83 0.86 0.92 0.94 0.73 0.84 0.89 0.61 0.82 0.58 0.84 0.75 0.85 0.90 0.93 0.91 0.80

-329 SPZ1_1 (-329) 201740 cg10626330 x

0.27 0.83 0.87 0.75 0.87 0.76 0.88 0.62 0.82 0.87 0.86 0.78 0.87 0.59 0.50 0.85 0.80 0.57 0.78 0.89 0.89 0.87 0.82

-304 STK31_1 (-304) 255340 cg13802883 x

0.22 0.92 0.88 0.84 0.85 0.84 0.90 0.92 0.90 0.78 0.85 0.35 0.89 0.37 0.73 0.74 0.89 0.81 0.88 0.91 0.90 0.90 0.80

-230 STK31_2 (-230) 276983 cg14898779 x

0.17 0.88 0.86 0.88 0.87 0.92 0.88 0.91 0.90 0.91 0.88 0.52 0.79 0.56 0.81 0.81 0.79 0.87 0.91 0.92 0.87 0.94 0.94

-198 STK31_3 (-198) 447974 cg25612145 x x

0.17 0.96 0.95 0.93 0.96 0.94 0.95 0.95 0.96 0.96 0.96 0.83 0.94 0.60 0.91 0.90 0.90 0.95 0.95 0.94 0.90 0.97 0.89

-170 STK31_4 (-170) 107586 cg05407490 x x

0.09 0.94 0.91 0.91 0.92 0.83 0.91 0.94 0.84 0.95 0.85 0.90 0.94 0.44 0.89 0.90 0.74 0.86 0.94 0.90 0.93 0.91 0.95

-97 STK31_5 (-97) 99725 cg05000488 x x

0.05 0.94 0.90 0.90 0.91 0.94 0.95 0.94 0.95 0.94 0.86 0.80 0.94 0.42 0.89 0.90 0.88 0.93 0.91 0.92 0.94 0.92 0.92

15 STK31_6 (15) 220314 cg11755819

x x x

0.09 0.98 0.98 0.96 0.97 0.97 0.99 0.99 0.97 0.98 0.95 0.97 0.99 0.51 0.98 0.95 0.95 0.98 0.98 0.98 0.99 0.98 0.98

48 STK31_7 (48) 313485 cg17102984

x x x

0.28 0.84 0.88 0.84 0.86 0.86 0.86 0.85 0.85 0.86 0.83 0.87 0.81 0.58 0.80 0.81 0.80 0.84 0.86 0.85 0.86 0.88 0.86

105 STK31_8 (105) 245296 cg13313214

x x x

0.19 0.90 0.91 0.90 0.90 0.89 0.92 0.91 0.91 0.89 0.88 0.93 0.88 0.53 0.88 0.88 0.86 0.88 0.92 0.91 0.89 0.91 0.91

140 STK31_9 (140) 317306 cg17331904

x x

x

0.06 0.98 0.97 0.97 0.95 0.97 0.96 0.97 0.97 0.97 0.95 0.95 0.97 0.61 0.95 0.96 0.96 0.97 0.96 0.95 0.96 0.96 0.96

113

154 STK31_10 (154) 15958 cg00755064

x x

x

0.11 0.96 0.95 0.95 0.94 0.94 0.97 0.96 0.95 0.96 0.92 0.95 0.96 0.70 0.94 0.96 0.95 0.98 0.97 0.96 0.96 0.97 0.93

244 STK31_11 (244) 447227 cg25570411

x x x

0.22 0.89 0.91 0.90 0.93 0.92 0.91 0.85 0.92 0.91 0.90 0.86 0.86 0.45 0.87 0.85 0.79 0.81 0.90 0.91 0.93 0.92 0.89

248 STK31_12 (248) 383187 cg21519371

x x x

0.12 0.92 0.91 0.91 0.93 0.94 0.96 0.92 0.94 0.94 0.89 0.83 0.91 0.74 0.86 0.90 0.87 0.87 0.91 0.91 0.92 0.93 0.92

-536 TCP11_1 (-536) 296103 cg16083558 x

S_Shore 0.19 0.87 0.85 0.83 0.85 0.92 0.82 0.89 0.73 0.85 0.87 0.75 0.87 0.82 0.36 0.81 0.81 0.59 0.86 0.87 0.67 0.45 0.77

-362 TCP11_2 (-362) 173881 cg09027493 x

S_Shore 0.12 0.93 0.80 0.80 0.85 0.91 0.80 0.91 0.60 0.83 0.87 0.82 0.91 0.74 0.60 0.73 0.79 0.64 0.84 0.85 0.67 0.84 0.67

-299 TCP11_3 (-299) 237978 cg12835524 x

Island 0.11 0.93 0.85 0.82 0.86 0.91 0.71 0.92 0.35 0.89 0.69 0.29 0.91 0.60 0.65 0.75 0.65 0.63 0.74 0.86 0.51 0.76 0.85

-249 TCP11_4 (-249) 226189 cg12090052 x

Island 0.11 0.97 0.97 0.98 0.98 0.96 0.93 0.98 0.37 0.95 0.95 0.61 0.98 0.87 0.95 0.97 0.93 0.86 0.97 0.98 0.77 0.96 0.93

-212 TCP11_5 (-212) 431979 cg24623244 x

Island 0.13 0.96 0.92 0.91 0.94 0.93 0.81 0.93 0.38 0.88 0.89 0.61 0.94 0.67 0.75 0.92 0.70 0.67 0.91 0.92 0.64 0.89 0.80

1072 TCP11_6 (1072) 104159 cg05235151

x

x

N_Shore 0.18 0.95 0.72 0.75 0.84 0.52 0.57 0.77 0.82 0.83 0.81 0.45 0.81 0.56 0.38 0.84 0.54 0.58 0.84 0.84 0.65 0.87 0.42

-710 TKTL1_1 (-710) 84108 cg04186471 x x

N_Shore 0.05 0.82 0.84 0.73 0.49 0.67 0.85 0.51 0.83 0.82 0.60 0.85 0.81 0.23 0.84 0.51 0.58 0.79 0.79 0.88 0.40 0.78 0.86

-683 TKTL1_2 (-683) 5911 cg00279529 x x

N_Shore 0.14 0.91 0.90 0.88 0.70 0.94 0.90 0.93 0.87 0.94 0.90 0.92 0.90 0.40 0.92 0.85 0.73 0.92 0.93 0.93 0.77 0.91 0.92

-652 TKTL1_3 (-652) 467576 cg26803301 x x

N_Shore 0.20 0.92 0.86 0.64 0.43 0.92 0.91 0.93 0.92 0.86 0.80 0.67 0.68 0.28 0.79 0.80 0.29 0.78 0.82 0.85 0.43 0.80 0.92

-553 TKTL1_4 (-553) 396862 cg22451002 x x

N_Shore 0.07 0.82 0.73 0.61 0.41 0.73 0.81 0.84 0.43 0.53 0.87 0.50 0.53 0.18 0.84 0.67 0.24 0.85 0.81 0.83 0.48 0.74 0.75

8204 TKTL1_5 (8204) 339711 cg18721956 x

x

0.17 0.90 0.77 0.80 0.81 0.84 0.87 0.51 0.79 0.89 0.85 0.60 0.82 0.44 0.29 0.56 0.85 0.75 0.62 0.84 0.62 0.83 0.88

8506 TKTL1_6 (8506) 326670 cg17933493 x

x

0.12 0.93 0.90 0.91 0.90 0.95 0.91 0.94 0.91 0.96 0.90 0.93 0.92 0.87 0.87 0.68 0.89 0.93 0.92 0.95 0.94 0.89 0.93

-1337 TKTL2_1 (-1337) 19279 cg00917094 x

S_Shore 0.17 0.87 0.87 0.54 0.46 0.82 0.69 0.83 0.88 0.90 0.57 0.51 0.88 0.49 0.39 0.69 0.54 0.50 0.62 0.83 0.66 0.56 0.79

-1287 TKTL2_2 (-1287) 124596 cg06371723 x

S_Shore 0.24 0.85 0.90 0.80 0.83 0.85 0.87 0.87 0.88 0.88 0.83 0.62 0.91 0.77 0.49 0.83 0.89 0.84 0.92 0.93 0.87 0.78 0.84

-241 TKTL2_3 (-241) 391671 cg22083298 x

S_Shore 0.15 0.87 0.80 0.63 0.47 0.65 0.55 0.80 0.78 0.90 0.85 0.61 0.89 0.45 0.46 0.67 0.64 0.81 0.66 0.91 0.84 0.77 0.72

-47 TKTL2_4 (-47) 229076 cg12267786

x

S_Shore 0.03 0.97 0.93 0.21 0.41 0.92 0.67 0.87 0.73 0.96 0.82 0.75 0.91 0.39 0.35 0.53 0.37 0.66 0.43 0.93 0.50 0.49 0.56

7 TKTL2_5 (7) 409134 cg23210938

x x

Island 0.03 0.98 0.93 0.80 0.45 0.96 0.89 0.89 0.96 0.98 0.77 0.27 0.87 0.49 0.44 0.55 0.44 0.94 0.62 0.94 0.91 0.77 0.93

148 TKTL2_6 (148) 113571 cg05752653

x x

Island 0.07 0.99 0.98 0.98 0.86 0.99 0.98 0.97 0.97 0.99 0.91 0.97 0.99 0.51 0.69 0.93 0.76 0.98 0.89 0.97 0.99 0.98 0.99

224 TKTL2_7 (224) 242258 cg13120726

x

Island 0.24 0.89 0.91 0.90 0.85 0.94 0.93 0.92 0.93 0.93 0.82 0.52 0.88 0.53 0.87 0.78 0.82 0.89 0.86 0.89 0.90 0.88 0.90

230 TKTL2_8 (230) 113468 cg05745457

x

Island 0.19 0.87 0.89 0.84 0.88 0.92 0.90 0.89 0.91 0.91 0.81 0.94 0.89 0.53 0.84 0.80 0.88 0.88 0.91 0.90 0.92 0.90 0.91

360 TKTL2_9 (360) 290372 cg15730068

x

Island 0.21 0.84 0.85 0.84 0.81 0.82 0.84 0.83 0.84 0.86 0.77 0.82 0.86 0.38 0.83 0.79 0.80 0.86 0.81 0.87 0.81 0.73 0.86

1244 TKTL2_10 (1244) 25729 cg01225525

x

N_Shore 0.17 0.93 0.78 0.37 0.63 0.89 0.67 0.60 0.73 0.42 0.48 0.48 0.79 0.45 0.40 0.59 0.75 0.44 0.39 0.85 0.48 0.55 0.72

-563 TPTE_1 (-563) 335452 cg18453969 x

S_Shore 0.06 0.92 0.75 0.85 0.83 0.78 0.87 0.92 0.85 0.93 0.69 0.39 0.82 0.62 0.78 0.74 0.74 0.62 0.82 0.80 0.86 0.75 0.86

-493 TPTE_2 (-493) 449141 cg25691239 x

Island 0.18 0.96 0.88 0.90 0.89 0.93 0.92 0.93 0.90 0.95 0.82 0.86 0.85 0.78 0.90 0.82 0.89 0.86 0.93 0.89 0.85 0.91 0.92

2848 TPTE_3 (2848) 325037 cg17832921

x

N_Shore 0.53 0.90 0.84 0.72 0.73 0.83 0.75 0.78 0.66 0.91 0.69 0.51 0.82 0.74 0.74 0.67 0.60 0.62 0.57 0.75 0.72 0.85 0.89

-1402 TSGA13_1 (-1402) 198057 cg10421595 x

0.17 0.79 0.80 0.76 0.81 0.75 0.85 0.61 0.81 0.88 0.75 0.54 0.88 0.49 0.57 0.69 0.85 0.88 0.75 0.85 0.80 0.84 0.83

109 TSGA13_2 (109) 280081 cg15082843

x x

0.13 0.86 0.72 0.70 0.77 0.72 0.79 0.63 0.77 0.88 0.49 0.55 0.88 0.42 0.33 0.51 0.84 0.53 0.63 0.81 0.71 0.80 0.61

114

-970 TUBA3C_1 (-970) 242867 cg13162960 x

0.19 0.87 0.84 0.86 0.87 0.81 0.91 0.86 0.78 0.89 0.47 0.46 0.91 0.76 0.54 0.84 0.85 0.90 0.90 0.89 0.87 0.89 0.87

-187 TUBA3C_2 (-187) 99857 cg05006718

x

0.13 0.93 0.87 0.93 0.85 0.84 0.92 0.92 0.83 0.94 0.58 0.75 0.85 0.64 0.58 0.83 0.85 0.73 0.87 0.89 0.88 0.91 0.89

-115 TUBA3C_3 (-115) 393877 cg22234479

x

0.05 0.93 0.73 0.95 0.90 0.21 0.85 0.87 0.57 0.90 0.37 0.51 0.89 0.50 0.61 0.78 0.88 0.85 0.92 0.83 0.84 0.90 0.90

-103 TUBA3C_4 (-103) 101606 cg05099240

x

0.11 0.91 0.67 0.92 0.88 0.26 0.88 0.87 0.58 0.93 0.41 0.53 0.90 0.48 0.64 0.72 0.84 0.73 0.86 0.77 0.83 0.88 0.84

-87 TUBA3C_5 (-87) 415097 cg23576999

x

0.07 0.90 0.81 0.84 0.89 0.25 0.88 0.88 0.69 0.92 0.45 0.54 0.91 0.46 0.66 0.71 0.83 0.76 0.89 0.73 0.71 0.88 0.88

-19 TUBA3C_6 (-19) 376168 cg21056036

x

0.09 0.98 0.95 0.97 0.98 0.94 0.98 0.97 0.97 0.98 0.79 0.97 0.97 0.80 0.95 0.96 0.95 0.97 0.97 0.98 0.98 0.98 0.95

19 TUBA3C_7 (19) 82997 cg04131456

x x

0.04 0.97 0.98 0.96 0.97 0.97 0.98 0.98 0.99 0.99 0.95 0.98 0.98 0.93 0.96 0.95 0.95 0.98 0.98 0.95 0.99 0.98 0.98

35 TUBA3C_8 (35) 400183 cg22675150

x x

0.25 0.84 0.77 0.80 0.83 0.83 0.82 0.84 0.82 0.85 0.77 0.82 0.82 0.70 0.80 0.80 0.80 0.84 0.85 0.82 0.82 0.84 0.79

-44 TXNDC3_1 (-44) 51565 cg02531859

x

0.06 0.48 0.80 0.79 0.92 0.94 0.82 0.90 0.82 0.93 0.60 0.84 0.97 0.37 0.46 0.73 0.90 0.62 0.82 0.92 0.94 0.61 0.89

367 TXNDC3_2 (367) 147405 cg07560446

x

0.10 0.96 0.84 0.82 0.86 0.93 0.90 0.96 0.86 0.79 0.46 0.93 0.96 0.44 0.78 0.58 0.88 0.62 0.80 0.94 0.92 0.64 0.93

472 TXNDC3_3 (472) 73992 cg03659153

x

0.14 0.92 0.86 0.78 0.73 0.90 0.81 0.91 0.86 0.89 0.37 0.86 0.92 0.42 0.72 0.68 0.69 0.41 0.48 0.87 0.89 0.67 0.88

547 TXNDC3_4 (547) 226336 cg12099032

x

0.39 0.91 0.88 0.87 0.86 0.91 0.93 0.90 0.87 0.93 0.78 0.87 0.91 0.61 0.89 0.76 0.84 0.71 0.85 0.93 0.92 0.85 0.94

-644 VCX2_1 (-644) 175075 cg09101623 x

0.28 0.90 0.84 0.81 0.71 0.84 0.66 0.66 0.65 0.90 0.78 0.46 0.86 0.43 0.60 0.58 0.57 0.55 0.73 0.88 0.73 0.87 0.66

117 VCX2_2 (117) 144118 cg07380282

x x

0.19 0.94 0.87 0.92 0.90 0.93 0.90 0.94 0.94 0.95 0.91 0.84 0.89 0.46 0.86 0.86 0.81 0.84 0.83 0.91 0.91 0.85 0.92

-971 VWA5B1_1 (-971) 311294 cg16965374 x

0.15 0.91 0.78 0.82 0.63 0.75 0.85 0.86 0.92 0.89 0.88 0.51 0.85 0.45 0.46 0.59 0.48 0.46 0.46 0.62 0.59 0.90 0.83

-915 VWA5B1_2 (-915) 326232 cg17903275 x

0.11 0.91 0.85 0.81 0.51 0.82 0.84 0.86 0.89 0.86 0.86 0.30 0.84 0.52 0.87 0.63 0.83 0.40 0.85 0.73 0.61 0.88 0.83

-172 WBSCR28_1 (-172) 78226 cg03885264

x

0.03 0.93 0.89 0.91 0.74 0.93 0.92 0.92 0.88 0.95 0.87 0.80 0.93 0.84 0.89 0.66 0.88 0.83 0.88 0.84 0.90 0.91 0.88

-140 WBSCR28_2 (-140) 457696 cg26232282

x

0.11 0.91 0.81 0.90 0.68 0.91 0.86 0.89 0.77 0.91 0.82 0.80 0.89 0.77 0.82 0.56 0.84 0.84 0.83 0.81 0.87 0.90 0.85

-431 XAGE3_1 (-431) 162229 cg08366073 x

0.15 0.90 0.74 0.81 0.66 0.75 0.82 0.87 0.79 0.88 0.46 0.48 0.78 0.40 0.69 0.52 0.55 0.84 0.78 0.75 0.78 0.71 0.82

-42 XAGE3_2 (-42) 477722 cg27388297 x x

0.10 0.93 0.78 0.87 0.66 0.89 0.82 0.88 0.85 0.90 0.59 0.50 0.85 0.55 0.85 0.70 0.81 0.84 0.87 0.61 0.88 0.77 0.90

344 XAGE3_3 (344) 247717 cg13440244 x

x

0.03 0.97 0.66 0.84 0.57 0.90 0.85 0.88 0.84 0.96 0.56 0.45 0.88 0.61 0.64 0.70 0.93 0.90 0.88 0.66 0.77 0.66 0.81

-1313 ZDHHC19_1 (-1313) 304484 cg16562763 x

0.26 0.83 0.86 0.82 0.80 0.83 0.83 0.89 0.83 0.92 0.84 0.77 0.90 0.81 0.66 0.59 0.85 0.85 0.88 0.93 0.86 0.88 0.77

98 ZDHHC19_2 (98) 236002 cg12702506

x x

S_Shelf 0.07 0.97 0.79 0.81 0.54 0.74 0.78 0.89 0.63 0.85 0.75 0.84 0.85 0.48 0.44 0.43 0.82 0.80 0.90 0.80 0.69 0.86 0.82

251 ZDHHC19_3 (251) 67380 cg03327494

x

S_Shelf 0.19 0.95 0.86 0.88 0.70 0.94 0.90 0.87 0.88 0.88 0.84 0.87 0.91 0.70 0.41 0.42 0.87 0.87 0.93 0.88 0.85 0.90 0.69

-47824 ZNF540_1 (-47824) 446166 cg25498326 x

S_Shore 0.15 0.86 0.87 0.79 0.85 0.72 0.84 0.86 0.88 0.94 0.65 0.91 0.84 0.56 0.66 0.82 0.66 0.56 0.59 0.87 0.81 0.67 0.86

-168 ZNF540_2 (-168) 339571 cg18713806

x

S_Shelf 0.15 0.94 0.80 0.69 0.79 0.82 0.82 0.90 0.86 0.92 0.75 0.70 0.87 0.69 0.50 0.66 0.34 0.41 0.30 0.66 0.33 0.81 0.52

-275 ZNF876P_1 (-275) 252360 cg13657785 x

N_Shore 0.04 0.90 0.84 0.76 0.86 0.74 0.80 0.89 0.76 0.89 0.89 0.75 0.89 0.55 0.89 0.82 0.91 0.91 0.78 0.85 0.86 0.77 0.68

115

GeneSymb_RangPlot_CpG-TSS

LBAN_EBR_HS_036_M


LBAN_EBR_HS_042_M


LBAN_EBR_HS_054_M


LBAN_EBR_HS_059_M


LBAN_EBR_HS_063_M


LBAN_EBR_HS_072_M


LBAN_EBR_HS_077_M


LBAN_EBR_HS_085_M


LBAN_EBR_HS_088_M


LBAN_EBR_HS_100_M


LBAN_EBR_HS_052_M


LBAN_EBR_HS_073_M


LUTN_CBR_HS_011_M


LUTN_CBR_HS_107_M


LUTN_CBR_HS_145_M


BRON_EB_HS_076_M


BRON_EB_HS_145_M


BRON_EB_HS_040_M


BRON_EB_HS_075_M


BRON_EB_HS_081_M


BRON_EB_HS_082_M


LBAN_EBR_HS_032_M


LBAN_EBR_HS_051_M


LBAN_EBR_HS_055_M


LBAN_EBR_HS_058_M


LBAN_EBR_HS_065_M


LBAN_EBR_HS_067_M


LBAN_EBR_HS_086_M


LBAN_EBR_HS_092_M


LBAN_EBR_HS_096_M


BRON_EB_HS_083_M


BRON_EB_HS_085_M


LBAN_EBR_HS_050_M


LBAN_EBR_HS_061_M


ADAD1_1 (-1151) 0.82 0.53 0.85 0.79 0.40 0.91 0.92 0.83 0.77 0.62 0.88 0.69 0.61 0.78 0.69 0.84 0.87 0.71 0.81 0.34 0.75 0.86 0.84 0.46 0.91 0.87 0.64 0.83 0.89 0.79 0.73 0.31 0.54 0.41

ADAD1_2 (-219) 0.74 0.56 0.85 0.85 0.27 0.82 0.91 0.89 0.85 0.77 0.83 0.45 0.77 0.74 0.83 0.86 0.83 0.75 0.72 0.76 0.75 0.83 0.80 0.59 0.87 0.77 0.58 0.88 0.81 0.70 0.75 0.36 0.44 0.87

ADAD1_3 (-182) 0.83 0.47 0.80 0.68 0.58 0.86 0.81 0.86 0.74 0.65 0.82 0.32 0.77 0.68 0.76 0.83 0.75 0.66 0.70 0.37 0.66 0.84 0.79 0.44 0.86 0.70 0.58 0.88 0.76 0.74 0.67 0.57 0.55 0.36

ADAD1_4 (57) 0.94 0.91 0.90 0.93 0.36 0.93 0.92 0.90 0.92 0.87 0.90 0.92 0.87 0.87 0.95 0.87 0.83 0.86 0.84 0.84 0.84 0.91 0.68 0.89 0.87 0.91 0.91 0.92 0.93 0.88 0.68 0.33 0.48 0.92

ADAD1_5 (127) 0.88 0.79 0.88 0.87 0.56 0.87 0.90 0.89 0.91 0.75 0.88 0.62 0.80 0.87 0.88 0.85 0.79 0.83 0.83 0.80 0.77 0.90 0.78 0.94 0.94 0.87 0.79 0.90 0.92 0.88 0.74 0.44 0.55 0.89

ADAD1_6 (213) 0.69 0.58 0.70 0.62 0.48 0.62 0.85 0.64 0.88 0.61 0.82 0.48 0.40 0.82 0.89 0.81 0.66 0.61 0.55 0.30 0.50 0.84 0.39 0.54 0.52 0.57 0.52 0.62 0.80 0.61 0.47 0.34 0.40 0.25

ADAD1_7 (241) 0.92 0.91 0.89 0.92 0.49 0.89 0.94 0.89 0.95 0.66 0.95 0.86 0.57 0.82 0.96 0.87 0.59 0.84 0.74 0.76 0.73 0.94 0.38 0.93 0.86 0.81 0.71 0.92 0.93 0.88 0.37 0.52 0.46 0.85

ADAD1_8 (243) 0.85 0.88 0.90 0.89 0.66 0.89 0.88 0.83 0.87 0.78 0.89 0.83 0.63 0.84 0.91 0.80 0.66 0.83 0.75 0.81 0.74 0.89 0.48 0.88 0.82 0.82 0.81 0.91 0.90 0.83 0.51 0.43 0.59 0.89

ADAD1_9 (289) 0.72 0.88 0.80 0.74 0.61 0.86 0.92 0.88 0.90 0.79 0.86 0.69 0.72 0.76 0.88 0.87 0.72 0.73 0.77 0.66 0.74 0.91 0.40 0.91 0.83 0.81 0.84 0.87 0.90 0.78 0.45 0.34 0.56 0.70

ADAD1_10 (302) 0.95 0.96 0.97 0.95 0.51 0.97 0.96 0.97 0.96 0.95 0.96 0.90 0.94 0.91 0.96 0.93 0.92 0.93 0.91 0.90 0.92 0.96 0.63 0.96 0.96 0.93 0.94 0.97 0.95 0.95 0.61 0.56 0.46 0.93

ADAD1_11 (326) 0.88 0.88 0.91 0.84 0.42 0.86 0.87 0.86 0.84 0.87 0.87 0.63 0.88 0.79 0.88 0.86 0.76 0.83 0.83 0.80 0.84 0.87 0.58 0.86 0.87 0.83 0.81 0.88 0.88 0.86 0.55 0.50 0.49 0.86

ADAD1_12 (343) 0.97 0.98 0.99 0.98 0.53 0.97 0.98 0.97 0.98 0.97 0.99 0.96 0.98 0.95 0.98 0.97 0.95 0.96 0.96 0.97 0.97 0.98 0.63 0.99 0.99 0.99 0.98 0.97 0.98 0.98 0.61 0.76 0.53 0.99

ADAD1_13 (473) 0.83 0.86 0.86 0.82 0.53 0.90 0.86 0.88 0.81 0.90 0.88 0.80 0.86 0.82 0.79 0.83 0.85 0.84 0.83 0.83 0.82 0.88 0.58 0.89 0.90 0.89 0.86 0.86 0.86 0.83 0.54 0.30 0.43 0.86

ADAD1_14 (491) 0.92 0.93 0.93 0.91 0.40 0.85 0.94 0.93 0.92 0.95 0.94 0.87 0.93 0.90 0.97 0.90 0.75 0.89 0.89 0.91 0.92 0.94 0.39 0.93 0.95 0.93 0.91 0.92 0.94 0.93 0.47 0.54 0.52 0.94

ADAD1_15 (621) 0.81 0.80 0.86 0.83 0.38 0.88 0.91 0.87 0.90 0.73 0.88 0.69 0.74 0.83 0.70 0.79 0.72 0.72 0.70 0.67 0.75 0.91 0.58 0.72 0.83 0.78 0.67 0.88 0.92 0.81 0.55 0.38 0.44 0.67

ADAD1_16 (897) 0.88 0.87 0.78 0.80 0.65 0.73 0.89 0.85 0.86 0.81 0.83 0.80 0.57 0.87 0.85 0.87 0.69 0.71 0.84 0.56 0.71 0.90 0.73 0.34 0.81 0.86 0.59 0.83 0.85 0.70 0.65 0.29 0.27 0.54

ADAD1_17 (1089) 0.85 0.86 0.89 0.89 0.39 0.90 0.87 0.88 0.86 0.85 0.91 0.82 0.87 0.80 0.85 0.84 0.86 0.77 0.86 0.61 0.83 0.89 0.73 0.40 0.91 0.94 0.82 0.89 0.86 0.87 0.70 0.22 0.25 0.66

ADAM12_1 (-884) 0.89 0.89 0.89 0.84 0.33 0.88 0.88 0.90 0.87 0.86 0.86 0.86 0.82 0.83 0.88 0.84 0.85 0.80 0.87 0.86 0.84 0.85 0.88 0.74 0.90 0.91 0.74 0.90 0.67 0.81 0.87 0.42 0.39 0.90

ADCY10_1 (-1143) 0.87 0.73 0.92 0.94 0.39 0.92 0.92 0.90 0.94 0.86 0.93 0.88 0.87 0.87 0.92 0.84 0.95 0.90 0.90 0.88 0.90 0.92 0.89 0.93 0.97 0.91 0.95 0.92 0.90 0.89 0.87 0.44 0.38 0.93

ADCY10_2 (154) 0.90 0.91 0.52 0.88 0.26 0.90 0.93 0.83 0.89 0.73 0.92 0.89 0.84 0.92 0.80 0.85 0.88 0.79 0.85 0.86 0.89 0.93 0.79 0.28 0.88 0.89 0.88 0.93 0.84 0.57 0.81 0.35 0.34 0.92

116

ADCY10_3 (1012) 0.92 0.94 0.88 0.94 0.44 0.94 0.93 0.93 0.95 0.84 0.94 0.93 0.91 0.90 0.94 0.89 0.94 0.90 0.88 0.92 0.91 0.93 0.92 0.34 0.94 0.94 0.89 0.93 0.93 0.92 0.88 0.30 0.36 0.93

ANKRD7_1 (-42) 0.95 0.95 0.58 0.92 0.63 0.58 0.98 0.70 0.27 0.79 0.73 0.41 0.90 0.86 0.98 0.96 0.50 0.79 0.84 0.25 0.82 0.97 0.68 0.42 0.91 0.83 0.88 0.97 0.97 0.75 0.52 0.48 0.58 0.21

ANKRD7_2 (-18) 0.83 0.80 0.63 0.68 0.35 0.61 0.88 0.53 0.49 0.65 0.63 0.39 0.64 0.75 0.87 0.77 0.69 0.64 0.65 0.49 0.72 0.87 0.55 0.47 0.64 0.69 0.71 0.78 0.82 0.58 0.56 0.40 0.39 0.48

ANKRD7_3 (4) 0.97 0.96 0.67 0.96 0.45 0.65 0.98 0.96 0.89 0.96 0.94 0.89 0.98 0.93 0.97 0.97 0.58 0.94 0.95 0.70 0.94 0.98 0.95 0.54 0.98 0.94 0.94 0.97 0.96 0.95 0.73 0.52 0.68 0.62

ANKRD7_4 (211) 0.90 0.89 0.78 0.92 0.57 0.84 0.92 0.88 0.82 0.89 0.88 0.81 0.86 0.83 0.90 0.87 0.72 0.82 0.85 0.81 0.83 0.92 0.90 0.33 0.92 0.89 0.87 0.92 0.95 0.86 0.83 0.34 0.46 0.84

ASZ1_1 (-343) 0.81 0.85 0.89 0.89 0.61 0.88 0.53 0.75 0.74 0.81 0.88 0.55 0.80 0.70 0.92 0.82 0.82 0.77 0.83 0.69 0.75 0.90 0.84 0.65 0.90 0.85 0.87 0.88 0.86 0.84 0.75 0.39 0.41 0.68

ASZ1_2 (-169) 0.75 0.87 0.88 0.90 0.28 0.77 0.56 0.75 0.75 0.80 0.86 0.57 0.80 0.63 0.91 0.84 0.84 0.70 0.77 0.66 0.75 0.85 0.50 0.50 0.92 0.85 0.85 0.90 0.91 0.88 0.67 0.31 0.35 0.64

ASZ1_3 (-151) 0.69 0.82 0.88 0.87 0.36 0.75 0.45 0.75 0.65 0.74 0.82 0.55 0.83 0.60 0.93 0.77 0.79 0.68 0.79 0.54 0.75 0.87 0.61 0.43 0.89 0.81 0.87 0.91 0.87 0.81 0.60 0.28 0.42 0.51

ASZ1_4 (-48) 0.69 0.82 0.82 0.85 0.56 0.78 0.87 0.89 0.85 0.86 0.82 0.85 0.82 0.57 0.90 0.90 0.91 0.83 0.66 0.86 0.83 0.77 0.41 0.89 0.85 0.67 0.85 0.85 0.87 0.86 0.54 0.49 0.38 0.91

ASZ1_5 (-40) 0.82 0.89 0.95 0.92 0.44 0.85 0.93 0.95 0.92 0.90 0.90 0.91 0.91 0.66 0.95 0.92 0.95 0.88 0.75 0.88 0.91 0.84 0.49 0.92 0.93 0.77 0.93 0.90 0.93 0.92 0.53 0.37 0.69 0.94

ASZ1_6 (160) 0.81 0.89 0.80 0.85 0.67 0.81 0.90 0.73 0.68 0.80 0.77 0.51 0.74 0.79 0.90 0.80 0.69 0.68 0.69 0.69 0.71 0.86 0.53 0.54 0.85 0.74 0.78 0.79 0.74 0.76 0.59 0.31 0.48 0.75

BCAR4_1 (-1351) 0.83 0.82 0.86 0.82 0.74 0.84 0.80 0.80 0.80 0.80 0.81 0.80 0.80 0.78 0.81 0.82 0.84 0.73 0.81 0.78 0.82 0.85 0.80 0.74 0.87 0.81 0.82 0.83 0.77 0.79 0.79 0.87 0.72 0.79

BCAR4_2 (-1014) 0.86 0.90 0.87 0.90 0.78 0.85 0.87 0.84 0.80 0.75 0.83 0.88 0.79 0.80 0.83 0.80 0.91 0.74 0.78 0.77 0.79 0.82 0.81 0.64 0.87 0.86 0.79 0.89 0.86 0.68 0.84 0.43 0.66 0.87

BRDT_1 (-17) 0.85 0.60 0.75 0.84 0.44 0.80 0.53 0.63 0.62 0.81 0.86 0.86 0.62 0.72 0.85 0.59 0.70 0.61 0.55 0.72 0.73 0.90 0.47 0.59 0.88 0.57 0.63 0.85 0.71 0.50 0.55 0.48 0.62 0.74

BRDT_2 (58) 0.87 0.65 0.60 0.94 0.42 0.92 0.45 0.67 0.94 0.92 0.92 0.89 0.66 0.75 0.90 0.56 0.61 0.62 0.80 0.91 0.89 0.95 0.61 0.74 0.91 0.84 0.74 0.92 0.80 0.42 0.62 0.37 0.27 0.94

BRDT_3 (121) 0.43 0.86 0.83 0.86 0.31 0.80 0.49 0.53 0.89 0.80 0.89 0.88 0.62 0.85 0.85 0.56 0.64 0.59 0.66 0.84 0.80 0.93 0.51 0.62 0.75 0.70 0.59 0.91 0.68 0.37 0.58 0.38 0.36 0.84

BRDT_4 (218) 0.77 0.39 0.84 0.83 0.59 0.85 0.17 0.27 0.52 0.59 0.77 0.64 0.24 0.44 0.50 0.31 0.33 0.33 0.34 0.34 0.62 0.88 0.10 0.10 0.54 0.27 0.35 0.55 0.22 0.13 0.19 0.44 0.62 0.23

BRDT_5 (597) 0.85 0.84 0.92 0.90 0.44 0.88 0.68 0.88 0.86 0.84 0.86 0.87 0.77 0.75 0.89 0.62 0.63 0.72 0.78 0.80 0.79 0.91 0.54 0.60 0.91 0.83 0.81 0.86 0.68 0.75 0.61 0.35 0.43 0.87

BRDT_6 (1393) 0.83 0.84 0.90 0.93 0.42 0.92 0.86 0.85 0.92 0.88 0.93 0.86 0.90 0.83 0.88 0.81 0.85 0.86 0.89 0.78 0.83 0.93 0.91 0.82 0.91 0.93 0.76 0.87 0.88 0.91 0.87 0.46 0.40 0.82

BTG4_1 (148) 0.85 0.80 0.85 0.89 0.58 0.90 0.88 0.88 0.90 0.90 0.91 0.87 0.87 0.93 0.68 0.76 0.81 0.86 0.85 0.84 0.84 0.90 0.88 0.62 0.92 0.91 0.90 0.89 0.88 0.86 0.85 0.31 0.35 0.88

BTG4_2 (554) 0.89 0.85 0.89 0.73 0.52 0.88 0.84 0.85 0.90 0.84 0.89 0.91 0.81 0.82 0.91 0.85 0.59 0.84 0.84 0.82 0.84 0.92 0.89 0.35 0.84 0.88 0.88 0.90 0.74 0.84 0.83 0.41 0.50 0.89

BTG4_3 (2864) 0.86 0.57 0.83 0.58 0.62 0.82 0.88 0.85 0.72 0.84 0.86 0.76 0.85 0.84 0.92 0.83 0.55 0.88 0.81 0.65 0.85 0.90 0.70 0.36 0.60 0.78 0.83 0.80 0.37 0.64 0.61 0.57 0.58 0.69

C10orf82_1 (829) 0.89 0.76 0.85 0.58 0.41 0.78 0.77 0.84 0.86 0.85 0.80 0.83 0.73 0.76 0.80 0.81 0.83 0.75 0.58 0.74 0.55 0.70 0.77 0.37 0.65 0.57 0.70 0.88 0.47 0.80 0.58 0.44 0.25 0.82

C12orf54_1 (-1644) 0.84 0.90 0.76 0.53 0.69 0.80 0.88 0.79 0.53 0.72 0.82 0.61 0.85 0.83 0.87 0.63 0.48 0.71 0.52 0.51 0.63 0.61 0.47 0.51 0.36 0.56 0.65 0.86 0.23 0.37 0.49 0.38 0.44 0.44

C12orf54_2 (-1595) 0.80 0.92 0.74 0.49 0.37 0.81 0.94 0.74 0.67 0.61 0.81 0.59 0.89 0.82 0.95 0.82 0.64 0.68 0.48 0.42 0.47 0.94 0.44 0.48 0.40 0.45 0.53 0.84 0.20 0.32 0.49 0.40 0.35 0.37

C12orf54_3 (-1449) 0.83 0.88 0.70 0.52 0.53 0.80 0.86 0.83 0.85 0.73 0.86 0.51 0.85 0.79 0.90 0.56 0.56 0.71 0.48 0.50 0.49 0.93 0.37 0.29 0.48 0.51 0.57 0.82 0.18 0.28 0.43 0.45 0.62 0.50

C12orf54_4 (-862) 0.86 0.94 0.76 0.80 0.39 0.83 0.94 0.65 0.45 0.70 0.81 0.54 0.80 0.73 0.73 0.60 0.65 0.59 0.49 0.68 0.55 0.92 0.45 0.44 0.35 0.53 0.65 0.88 0.26 0.32 0.51 0.50 0.34 0.73

C12orf54_5 (-24) 0.87 0.88 0.89 0.88 0.34 0.89 0.89 0.88 0.67 0.80 0.87 0.83 0.89 0.84 0.89 0.72 0.56 0.79 0.62 0.78 0.61 0.89 0.43 0.53 0.84 0.66 0.58 0.88 0.37 0.42 0.51 0.26 0.47 0.82

C15orf43_1 (-436) 0.82 0.78 0.86 0.77 0.33 0.83 0.76 0.84 0.70 0.76 0.79 0.73 0.77 0.64 0.87 0.74 0.77 0.77 0.80 0.83 0.67 0.88 0.79 0.64 0.86 0.83 0.81 0.83 0.80 0.76 0.72 0.26 0.35 0.87

C15orf43_2 (-93) 0.84 0.87 0.81 0.80 0.37 0.82 0.82 0.83 0.89 0.80 0.85 0.87 0.80 0.80 0.89 0.80 0.75 0.74 0.79 0.82 0.81 0.88 0.66 0.68 0.84 0.86 0.82 0.88 0.89 0.73 0.69 0.36 0.29 0.88

117

C15orf43_3 (-21) 0.80 0.86 0.86 0.86 0.57 0.86 0.88 0.82 0.90 0.84 0.87 0.90 0.76 0.86 0.91 0.83 0.76 0.70 0.73 0.84 0.80 0.90 0.67 0.70 0.91 0.79 0.81 0.89 0.86 0.78 0.68 0.40 0.37 0.88

C15orf43_4 (33) 0.93 0.93 0.89 0.90 0.35 0.92 0.93 0.92 0.93 0.92 0.92 0.92 0.92 0.91 0.92 0.89 0.91 0.88 0.91 0.91 0.91 0.92 0.88 0.91 0.92 0.93 0.91 0.92 0.92 0.93 0.87 0.44 0.43 0.92

C18orf20_1 (-984) 0.88 0.86 0.59 0.83 0.38 0.57 0.92 0.53 0.87 0.88 0.88 0.44 0.70 0.86 0.35 0.41 0.59 0.61 0.75 0.35 0.55 0.89 0.51 0.46 0.51 0.79 0.78 0.93 0.42 0.50 0.55 0.38 0.37 0.35

C18orf20_2 (-829) 0.85 0.87 0.47 0.81 0.51 0.38 0.89 0.54 0.85 0.76 0.86 0.40 0.75 0.80 0.34 0.44 0.66 0.62 0.89 0.45 0.85 0.91 0.74 0.35 0.89 0.92 0.90 0.93 0.82 0.78 0.70 0.44 0.54 0.42

C18orf20_3 (-377) 0.89 0.89 0.64 0.87 0.43 0.51 0.91 0.66 0.93 0.86 0.94 0.59 0.86 0.83 0.36 0.51 0.75 0.81 0.88 0.38 0.86 0.91 0.78 0.44 0.93 0.91 0.90 0.92 0.84 0.85 0.70 0.38 0.59 0.33

C18orf20_4 (-284) 0.86 0.89 0.52 0.80 0.27 0.45 0.82 0.60 0.90 0.73 0.86 0.36 0.80 0.73 0.37 0.46 0.69 0.67 0.85 0.22 0.85 0.91 0.79 0.39 0.93 0.90 0.87 0.88 0.88 0.84 0.79 0.83 0.59 0.20

C19orf41_1 (-549) 0.76 0.36 0.58 0.73 0.37 0.34 0.84 0.42 0.52 0.56 0.48 0.69 0.40 0.62 0.64 0.59 0.54 0.46 0.48 0.45 0.67 0.52 0.34 0.21 0.67 0.44 0.46 0.48 0.32 0.42 0.36 0.47 0.42 0.44

C2orf84_1 (-1421) 0.85 0.62 0.71 0.81 0.51 0.73 0.87 0.55 0.59 0.72 0.80 0.69 0.59 0.67 0.34 0.71 0.89 0.45 0.64 0.82 0.82 0.86 0.57 0.32 0.64 0.70 0.64 0.82 0.80 0.72 0.58 0.36 0.23 0.85

C2orf84_2 (-432) 0.88 0.64 0.88 0.89 0.48 0.88 0.92 0.76 0.82 0.88 0.92 0.88 0.89 0.61 0.90 0.87 0.89 0.83 0.75 0.89 0.69 0.89 0.88 0.87 0.87 0.50 0.91 0.90 0.86 0.91 0.86 0.49 0.46 0.90

C2orf84_3 (-322) 0.93 0.96 0.96 0.95 0.62 0.95 0.93 0.95 0.96 0.89 0.97 0.91 0.94 0.85 0.95 0.94 0.95 0.92 0.92 0.91 0.90 0.95 0.92 0.95 0.95 0.95 0.95 0.92 0.95 0.96 0.94 0.53 0.46 0.96

C2orf84_4 (199) 0.92 0.94 0.94 0.92 0.59 0.94 0.91 0.94 0.90 0.65 0.95 0.90 0.91 0.81 0.92 0.92 0.92 0.83 0.88 0.90 0.88 0.85 0.94 0.94 0.91 0.94 0.94 0.90 0.93 0.94 0.88 0.50 0.43 0.95

C6orf10_1 (-1300) 0.81 0.79 0.75 0.80 0.28 0.67 0.91 0.83 0.44 0.91 0.91 0.50 0.68 0.89 0.58 0.83 0.64 0.64 0.83 0.44 0.40 0.71 0.39 0.41 0.69 0.84 0.50 0.74 0.36 0.32 0.38 0.43 0.33 0.49

C6orf10_2 (-699) 0.84 0.86 0.60 0.64 0.25 0.64 0.82 0.87 0.47 0.76 0.85 0.49 0.78 0.85 0.91 0.76 0.61 0.69 0.79 0.47 0.34 0.89 0.38 0.44 0.41 0.85 0.43 0.42 0.29 0.35 0.47 0.42 0.64 0.40

C6orf10_3 (-553) 0.75 0.83 0.85 0.81 0.34 0.80 0.77 0.92 0.87 0.92 0.81 0.60 0.76 0.73 0.80 0.77 0.64 0.77 0.87 0.86 0.73 0.86 0.38 0.76 0.60 0.87 0.65 0.87 0.44 0.30 0.47 0.49 0.33 0.91

C6orf10_4 (144) 0.87 0.90 0.88 0.74 0.40 0.92 0.92 0.90 0.88 0.90 0.92 0.61 0.87 0.91 0.90 0.87 0.57 0.79 0.86 0.72 0.41 0.92 0.26 0.37 0.71 0.88 0.41 0.89 0.30 0.26 0.32 0.46 0.36 0.69

C9orf11_1 (47) 0.81 0.90 0.81 0.83 0.45 0.81 0.82 0.78 0.85 0.74 0.84 0.77 0.70 0.78 0.75 0.83 0.69 0.77 0.85 0.73 0.83 0.91 0.82 0.55 0.90 0.89 0.89 0.85 0.57 0.56 0.83 0.44 0.49 0.79

C9orf43_1 (1288) 0.84 0.75 0.87 0.89 0.58 0.89 0.82 0.85 0.83 0.86 0.87 0.83 0.67 0.82 0.94 0.79 0.87 0.84 0.79 0.82 0.78 0.80 0.79 0.50 0.86 0.82 0.84 0.88 0.84 0.82 0.82 0.27 0.62 0.87

C9orf43_2 (1421) 0.91 0.86 0.93 0.93 0.39 0.91 0.91 0.90 0.91 0.92 0.91 0.90 0.87 0.89 0.91 0.86 0.94 0.92 0.89 0.83 0.89 0.92 0.90 0.57 0.94 0.92 0.91 0.93 0.91 0.91 0.91 0.36 0.43 0.87

CCDC38_1 (3749) 0.62 0.75 0.90 0.85 0.52 0.93 0.85 0.71 0.83 0.83 0.89 0.90 0.61 0.72 0.59 0.78 0.84 0.73 0.81 0.85 0.79 0.88 0.86 0.37 0.89 0.92 0.89 0.90 0.90 0.86 0.86 0.46 0.49 0.81

CCDC42_1 (-409) 0.33 0.19 0.41 0.79 0.46 0.35 0.47 0.55 0.20 0.43 0.43 0.15 0.38 0.59 0.14 0.85 0.52 0.51 0.41 0.19 0.28 0.27 0.19 0.19 0.30 0.35 0.46 0.29 0.43 0.31 0.27 0.47 0.30 0.14

CCDC42_2 (-40) 0.84 0.89 0.49 0.75 0.31 0.54 0.87 0.90 0.65 0.60 0.77 0.59 0.81 0.80 0.78 0.86 0.64 0.87 0.54 0.60 0.46 0.90 0.26 0.30 0.59 0.53 0.67 0.92 0.51 0.41 0.44 0.94 0.46 0.59

CCDC42_3 (-22) 0.73 0.83 0.43 0.55 0.60 0.46 0.75 0.85 0.40 0.57 0.65 0.46 0.66 0.76 0.43 0.88 0.62 0.75 0.49 0.35 0.44 0.78 0.22 0.33 0.46 0.48 0.66 0.84 0.35 0.37 0.38 0.88 0.51 0.34

CCDC42_4 (118) 0.80 0.85 0.46 0.61 0.35 0.53 0.76 0.87 0.68 0.55 0.78 0.64 0.72 0.79 0.74 0.84 0.59 0.75 0.50 0.59 0.47 0.91 0.27 0.29 0.58 0.47 0.62 0.86 0.50 0.35 0.44 0.87 0.30 0.62

COX8C_1 (-1485) 0.86 0.88 0.83 0.90 0.50 0.83 0.88 0.92 0.83 0.84 0.84 0.92 0.85 0.85 0.90 0.86 0.82 0.83 0.66 0.86 0.86 0.89 0.76 0.93 0.91 0.70 0.87 0.93 0.89 0.65 0.79 0.39 0.47 0.91

COX8C_2 (-600) 0.83 0.83 0.65 0.52 0.49 0.57 0.59 0.78 0.56 0.66 0.60 0.74 0.37 0.80 0.73 0.59 0.70 0.57 0.52 0.80 0.67 0.77 0.44 0.85 0.40 0.62 0.69 0.50 0.50 0.46 0.39 0.41 0.40 0.80

COX8C_3 (241) 0.86 0.89 0.92 0.90 0.31 0.90 0.88 0.91 0.89 0.92 0.89 0.87 0.87 0.90 0.92 0.82 0.87 0.81 0.83 0.88 0.80 0.86 0.72 0.91 0.92 0.90 0.87 0.89 0.92 0.88 0.72 0.23 0.39 0.93

COX8C_4 (501) 0.95 0.96 0.92 0.77 0.57 0.88 0.96 0.95 0.94 0.89 0.92 0.96 0.85 0.92 0.95 0.95 0.76 0.90 0.61 0.92 0.86 0.96 0.56 0.96 0.94 0.62 0.91 0.96 0.92 0.75 0.61 0.95 0.40 0.94

COX8C_5 (568) 0.91 0.93 0.93 0.93 0.20 0.94 0.93 0.93 0.94 0.90 0.88 0.90 0.92 0.90 0.94 0.88 0.90 0.85 0.75 0.88 0.87 0.94 0.64 0.91 0.94 0.85 0.90 0.91 0.90 0.90 0.64 0.29 0.33 0.92

CPA5_1 (-578) 0.85 0.83 0.90 0.78 0.54 0.89 0.87 0.92 0.90 0.89 0.88 0.89 0.86 0.84 0.92 0.86 0.87 0.80 0.88 0.84 0.82 0.89 0.85 0.90 0.94 0.89 0.90 0.90 0.92 0.87 0.84 0.53 0.25 0.88

DAZL_1 (-1289) 0.74 0.70 0.74 0.76 0.34 0.65 0.82 0.88 0.65 0.54 0.78 0.76 0.72 0.62 0.41 0.53 0.65 0.61 0.75 0.69 0.51 0.66 0.65 0.53 0.90 0.81 0.75 0.52 0.58 0.65 0.63 0.43 0.38 0.70

118

DAZL_2 (-706) 0.87 0.59 0.90 0.87 0.49 0.87 0.83 0.87 0.67 0.82 0.87 0.90 0.65 0.90 0.69 0.87 0.86 0.76 0.79 0.84 0.85 0.90 0.69 0.65 0.77 0.88 0.88 0.90 0.50 0.79 0.79 0.51 0.36 0.89

DAZL_3 (-603) 0.88 0.86 0.91 0.89 0.52 0.92 0.92 0.93 0.80 0.80 0.85 0.94 0.87 0.87 0.91 0.88 0.82 0.84 0.90 0.85 0.84 0.92 0.82 0.71 0.91 0.88 0.90 0.89 0.75 0.89 0.86 0.39 0.26 0.88

DAZL_4 (-338) 0.88 0.89 0.87 0.89 0.44 0.92 0.92 0.92 0.82 0.91 0.90 0.87 0.80 0.86 0.91 0.87 0.74 0.88 0.82 0.91 0.88 0.94 0.74 0.49 0.74 0.87 0.95 0.93 0.67 0.84 0.88 0.50 0.30 0.90

DAZL_5 (-98) 0.84 0.87 0.92 0.90 0.62 0.90 0.88 0.90 0.88 0.88 0.88 0.88 0.90 0.87 0.92 0.83 0.91 0.88 0.88 0.89 0.84 0.94 0.93 0.77 0.94 0.87 0.90 0.89 0.85 0.90 0.91 0.39 0.70 0.94

DAZL_6 (-90) 0.95 0.96 0.94 0.94 0.50 0.95 0.93 0.95 0.90 0.96 0.92 0.92 0.97 0.94 0.95 0.94 0.96 0.92 0.92 0.94 0.91 0.95 0.93 0.92 0.95 0.95 0.94 0.95 0.90 0.94 0.93 0.49 0.47 0.96

DAZL_7 (-11) 0.89 0.91 0.89 0.88 0.42 0.89 0.93 0.94 0.91 0.93 0.92 0.89 0.91 0.90 0.93 0.91 0.89 0.87 0.91 0.93 0.62 0.90 0.71 0.74 0.90 0.92 0.92 0.88 0.52 0.49 0.73 0.43 0.35 0.94

DAZL_8 (22) 0.95 0.97 0.97 0.95 0.61 0.97 0.97 0.97 0.97 0.96 0.96 0.96 0.98 0.99 0.97 0.97 0.98 0.95 0.96 0.96 0.94 0.96 0.95 0.97 0.97 0.96 0.97 0.95 0.83 0.94 0.94 0.75 0.57 0.97

DAZL_9 (101) 0.82 0.88 0.88 0.89 0.58 0.89 0.87 0.86 0.83 0.85 0.86 0.83 0.85 0.85 0.88 0.77 0.87 0.81 0.81 0.85 0.79 0.88 0.86 0.89 0.90 0.89 0.87 0.89 0.84 0.85 0.86 0.80 0.72 0.89

DCAF4L1_1 (-1148) 0.81 0.82 0.82 0.89 0.36 0.89 0.85 0.87 0.86 0.88 0.85 0.85 0.81 0.84 0.85 0.78 0.89 0.72 0.85 0.78 0.74 0.88 0.64 0.86 0.86 0.93 0.90 0.88 0.84 0.81 0.75 0.30 0.61 0.80

DCAF4L1_2 (-752) 0.86 0.91 0.91 0.94 0.41 0.92 0.90 0.90 0.91 0.88 0.93 0.92 0.89 0.90 0.92 0.82 0.92 0.82 0.88 0.86 0.85 0.89 0.90 0.94 0.94 0.93 0.93 0.90 0.90 0.87 0.84 0.35 0.36 0.92

DCAF4L1_3 (211) 0.84 0.78 0.70 0.76 0.61 0.79 0.87 0.74 0.77 0.75 0.86 0.82 0.63 0.80 0.86 0.80 0.73 0.62 0.68 0.67 0.72 0.87 0.45 0.88 0.83 0.74 0.72 0.83 0.68 0.61 0.55 0.41 0.39 0.71

DCAF4L1_4 (373) 0.84 0.85 0.85 0.87 0.43 0.93 0.90 0.85 0.91 0.90 0.93 0.92 0.81 0.87 0.90 0.83 0.90 0.80 0.72 0.79 0.80 0.91 0.61 0.90 0.93 0.81 0.82 0.90 0.82 0.76 0.70 0.34 0.43 0.85

DCAF4L1_5 (1256) 0.89 0.67 0.65 0.73 0.46 0.88 0.96 0.91 0.93 0.91 0.75 0.81 0.73 0.89 0.79 0.89 0.83 0.88 0.79 0.52 0.86 0.68 0.83 0.39 0.91 0.80 0.90 0.85 0.79 0.75 0.80 0.53 0.58 0.57

DDX53_1 (-1377) 0.77 0.83 0.91 0.51 0.46 0.90 0.84 0.87 0.86 0.76 0.54 0.78 0.77 0.78 0.85 0.75 0.84 0.80 0.52 0.82 0.80 0.83 0.82 0.83 0.79 0.57 0.85 0.83 0.82 0.44 0.72 0.38 0.35 0.85

DDX53_2 (-953) 0.77 0.85 0.85 0.52 0.59 0.88 0.77 0.82 0.80 0.70 0.49 0.74 0.75 0.70 0.84 0.75 0.86 0.76 0.48 0.70 0.76 0.82 0.53 0.54 0.91 0.47 0.83 0.53 0.76 0.43 0.64 0.36 0.51 0.76

DDX53_3 (-199) 0.88 0.90 0.75 0.54 0.60 0.83 0.85 0.69 0.91 0.74 0.37 0.84 0.80 0.74 0.93 0.86 0.84 0.81 0.39 0.38 0.86 0.92 0.51 0.33 0.66 0.29 0.85 0.77 0.80 0.18 0.47 0.38 0.47 0.43

DDX53_4 (-106) 0.91 0.97 0.94 0.31 0.17 0.95 0.89 0.76 0.91 0.74 0.37 0.80 0.92 0.84 0.97 0.92 0.95 0.85 0.35 0.37 0.89 0.95 0.40 0.33 0.77 0.34 0.93 0.34 0.86 0.22 0.34 0.55 0.24 0.33

DDX53_5 (-95) 0.92 0.95 0.95 0.38 0.39 0.94 0.93 0.72 0.92 0.86 0.44 0.87 0.92 0.91 0.93 0.90 0.95 0.89 0.38 0.29 0.93 0.96 0.35 0.59 0.63 0.38 0.92 0.49 0.87 0.26 0.42 0.66 0.54 0.27

DDX53_6 (-80) 0.90 0.94 0.95 0.71 0.47 0.94 0.93 0.84 0.93 0.90 0.73 0.90 0.93 0.95 0.96 0.90 0.94 0.88 0.54 0.73 0.90 0.94 0.77 0.82 0.92 0.60 0.95 0.80 0.93 0.44 0.68 0.29 0.37 0.76

DDX53_7 (-50) 0.92 0.90 0.89 0.72 0.35 0.92 0.92 0.82 0.92 0.83 0.66 0.91 0.87 0.79 0.94 0.89 0.93 0.86 0.57 0.72 0.92 0.94 0.74 0.79 0.87 0.59 0.91 0.77 0.93 0.48 0.63 0.37 0.40 0.76

DDX53_8 (-29) 0.91 0.92 0.81 0.65 0.29 0.86 0.93 0.74 0.91 0.78 0.42 0.87 0.86 0.75 0.80 0.78 0.92 0.79 0.40 0.43 0.88 0.95 0.45 0.55 0.55 0.29 0.85 0.75 0.87 0.28 0.54 0.42 0.35 0.37

DDX53_9 (24) 0.87 0.91 0.93 0.86 0.55 0.94 0.92 0.91 0.92 0.89 0.79 0.88 0.90 0.89 0.93 0.86 0.92 0.88 0.53 0.86 0.87 0.92 0.89 0.75 0.82 0.49 0.90 0.86 0.92 0.32 0.80 0.34 0.33 0.91

DDX53_10 (44) 0.89 0.91 0.91 0.83 0.59 0.89 0.90 0.86 0.88 0.87 0.81 0.87 0.87 0.87 0.89 0.83 0.89 0.80 0.51 0.81 0.84 0.91 0.83 0.70 0.79 0.50 0.91 0.88 0.88 0.36 0.76 0.31 0.47 0.90

DPEP3_1 (-631) 0.87 0.92 0.76 0.74 0.38 0.84 0.92 0.90 0.91 0.75 0.90 0.86 0.86 0.88 0.90 0.86 0.77 0.79 0.58 0.85 0.86 0.89 0.58 0.73 0.87 0.59 0.88 0.91 0.79 0.77 0.65 0.41 0.40 0.90

DPEP3_2 (-357) 0.74 0.85 0.76 0.74 0.30 0.79 0.85 0.78 0.79 0.73 0.86 0.84 0.78 0.86 0.82 0.67 0.70 0.71 0.64 0.71 0.83 0.78 0.70 0.67 0.77 0.67 0.76 0.85 0.77 0.78 0.74 0.45 0.40 0.76

DPEP3_3 (341) 0.94 0.94 0.86 0.80 0.49 0.97 0.92 0.78 0.94 0.87 0.96 0.96 0.95 0.90 0.94 0.91 0.81 0.91 0.72 0.89 0.90 0.96 0.93 0.38 0.90 0.73 0.92 0.93 0.93 0.92 0.90 0.57 0.27 0.95

EDDM3B_1 (526) 0.66 0.87 0.87 0.92 0.38 0.90 0.91 0.90 0.90 0.84 0.91 0.48 0.80 0.82 0.88 0.82 0.91 0.80 0.60 0.33 0.36 0.89 0.43 0.58 0.40 0.62 0.60 0.68 0.38 0.43 0.50 0.35 0.31 0.29

EDDM3B_2 (1526) 0.51 0.88 0.84 0.87 0.23 0.92 0.87 0.83 0.92 0.84 0.90 0.40 0.74 0.77 0.81 0.81 0.87 0.82 0.58 0.29 0.35 0.91 0.58 0.34 0.26 0.62 0.58 0.66 0.34 0.42 0.45 0.37 0.36 0.34

EDDM3B_3 (1581) 0.57 0.72 0.75 0.88 0.73 0.82 0.89 0.75 0.84 0.78 0.88 0.52 0.53 0.79 0.47 0.62 0.83 0.64 0.55 0.45 0.41 0.89 0.48 0.39 0.31 0.59 0.59 0.74 0.32 0.40 0.49 0.86 0.49 0.43

FAM163A_1 (3874) 0.77 0.89 0.66 0.78 0.45 0.87 0.73 0.76 0.83 0.62 0.78 0.86 0.55 0.83 0.68 0.76 0.87 0.60 0.71 0.85 0.76 0.92 0.78 0.35 0.75 0.76 0.89 0.89 0.69 0.75 0.74 0.92 0.40 0.89

119

FAM163A_2 (44768) 0.80 0.87 0.58 0.76 0.36 0.85 0.74 0.83 0.72 0.74 0.76 0.78 0.76 0.80 0.90 0.80 0.90 0.56 0.88 0.82 0.81 0.91 0.79 0.30 0.92 0.85 0.86 0.56 0.86 0.86 0.81 0.37 0.34 0.87

FAM163A_3 (65075) 0.91 0.92 0.81 0.83 0.38 0.88 0.82 0.86 0.90 0.79 0.84 0.90 0.72 0.81 0.89 0.89 0.91 0.74 0.85 0.74 0.79 0.89 0.85 0.42 0.92 0.90 0.90 0.88 0.90 0.86 0.83 0.32 0.55 0.81

FAM24A_1 (-1332) 0.80 0.83 0.89 0.71 0.52 0.86 0.91 0.72 0.83 0.87 0.64 0.85 0.46 0.69 0.43 0.83 0.61 0.78 0.89 0.86 0.78 0.88 0.84 0.76 0.89 0.89 0.96 0.85 0.88 0.87 0.86 0.53 0.49 0.89

FAM24A_2 (-1322) 0.84 0.86 0.95 0.83 0.37 0.93 0.98 0.67 0.91 0.95 0.61 0.91 0.44 0.94 0.47 0.90 0.64 0.90 0.92 0.92 0.88 0.89 0.88 0.71 0.92 0.94 0.94 0.94 0.95 0.95 0.88 0.53 0.46 0.95

FAM47B_1 (-57) 0.90 0.80 0.85 0.44 0.45 0.87 0.91 0.62 0.83 0.79 0.85 0.56 0.86 0.69 0.91 0.78 0.54 0.83 0.73 0.80 0.85 0.92 0.22 0.75 0.90 0.70 0.78 0.89 0.38 0.22 0.30 0.38 0.55 0.82

FAM47B_2 (-37) 0.95 0.84 0.94 0.62 0.38 0.97 0.96 0.73 0.97 0.85 0.96 0.76 0.90 0.86 0.97 0.91 0.68 0.92 0.86 0.79 0.83 0.96 0.35 0.71 0.83 0.85 0.86 0.94 0.57 0.35 0.45 0.24 0.61 0.82

FAM47B_3 (43) 0.87 0.88 0.84 0.59 0.24 0.92 0.90 0.63 0.84 0.78 0.89 0.67 0.86 0.75 0.90 0.71 0.63 0.67 0.79 0.74 0.81 0.90 0.23 0.70 0.93 0.84 0.92 0.77 0.89 0.28 0.35 0.24 0.39 0.86

FAM47B_4 (537) 0.88 0.69 0.77 0.60 0.49 0.83 0.90 0.55 0.60 0.82 0.85 0.64 0.72 0.54 0.91 0.61 0.60 0.81 0.67 0.64 0.78 0.92 0.30 0.22 0.90 0.76 0.89 0.85 0.87 0.26 0.38 0.73 0.60 0.73

FAM47B_5 (649) 0.78 0.84 0.82 0.43 0.48 0.82 0.82 0.67 0.78 0.78 0.76 0.36 0.66 0.61 0.79 0.56 0.56 0.76 0.82 0.37 0.75 0.85 0.36 0.16 0.81 0.81 0.84 0.74 0.83 0.24 0.50 0.22 0.41 0.38

FAM47B_6 (728) 0.80 0.93 0.91 0.88 0.44 0.92 0.87 0.93 0.88 0.91 0.93 0.84 0.89 0.80 0.85 0.58 0.82 0.89 0.84 0.81 0.85 0.92 0.70 0.87 0.89 0.94 0.94 0.88 0.84 0.38 0.74 0.45 0.55 0.87

FKBP6_1 (-271) 0.81 0.79 0.96 0.96 0.65 0.83 0.90 0.76 0.94 0.94 0.85 0.96 0.77 0.90 0.71 0.92 0.93 0.79 0.88 0.69 0.75 0.75 0.81 0.72 0.96 0.89 0.83 0.83 0.90 0.81 0.76 0.75 0.48 0.72

FKBP6_2 (-267) 0.76 0.74 0.94 0.95 0.54 0.79 0.82 0.73 0.90 0.94 0.81 0.96 0.76 0.87 0.71 0.94 0.90 0.77 0.79 0.62 0.73 0.72 0.79 0.72 0.95 0.86 0.83 0.82 0.86 0.77 0.72 0.62 0.45 0.70

FKBP6_3 (-261) 0.86 0.89 0.91 0.89 0.38 0.88 0.88 0.86 0.89 0.90 0.90 0.91 0.86 0.89 0.90 0.83 0.86 0.76 0.72 0.84 0.83 0.88 0.82 0.76 0.82 0.74 0.85 0.89 0.80 0.85 0.79 0.28 0.39 0.89

FKBP6_4 (555) 0.78 0.70 0.82 0.79 0.39 0.66 0.78 0.80 0.59 0.80 0.65 0.77 0.68 0.73 0.67 0.77 0.65 0.71 0.55 0.56 0.65 0.64 0.53 0.43 0.68 0.56 0.67 0.59 0.52 0.57 0.59 0.90 0.52 0.60

FKBP6_5 (1046) 0.88 0.87 0.92 0.90 0.54 0.89 0.88 0.84 0.86 0.86 0.91 0.90 0.81 0.89 0.87 0.84 0.88 0.73 0.68 0.79 0.84 0.89 0.80 0.39 0.88 0.75 0.87 0.87 0.62 0.87 0.76 0.82 0.49 0.89

FKBP6_6 (1094) 0.86 0.82 0.81 0.85 0.55 0.72 0.88 0.82 0.74 0.79 0.77 0.81 0.79 0.76 0.71 0.78 0.73 0.75 0.53 0.58 0.78 0.71 0.47 0.41 0.61 0.56 0.67 0.59 0.41 0.61 0.57 0.76 0.45 0.60

FLJ25694_1 (31184524) 0.88 0.41 0.71 0.70 0.45 0.61 0.79 0.75 0.60 0.75 0.67 0.62 0.82 0.70 0.40 0.60 0.75 0.73 0.68 0.68 0.80 0.93 0.88 0.38 0.89 0.68 0.88 0.87 0.46 0.76 0.80 0.48 0.42 0.68

FLJ25694_2 (31184536) 0.89 0.38 0.73 0.66 0.49 0.53 0.75 0.68 0.47 0.73 0.60 0.56 0.71 0.69 0.37 0.48 0.55 0.63 0.65 0.61 0.77 0.88 0.76 0.44 0.70 0.66 0.92 0.76 0.42 0.67 0.69 0.37 0.37 0.53

FMR1NB_1 (-301) 0.75 0.89 0.68 0.44 0.45 0.73 0.86 0.86 0.74 0.70 0.59 0.76 0.75 0.79 0.89 0.80 0.57 0.72 0.48 0.22 0.35 0.91 0.25 0.24 0.39 0.51 0.46 0.68 0.41 0.32 0.36 0.16 0.41 0.20

FMR1NB_2 (-176) 0.92 0.93 0.83 0.91 0.64 0.95 0.96 0.89 0.91 0.93 0.71 0.95 0.89 0.87 0.94 0.88 0.60 0.77 0.45 0.60 0.43 0.95 0.22 0.43 0.92 0.37 0.36 0.94 0.22 0.18 0.32 0.51 0.41 0.57

FMR1NB_3 (-146) 0.95 0.97 0.98 0.94 0.56 0.97 0.97 0.96 0.98 0.97 0.95 0.97 0.95 0.93 0.97 0.95 0.69 0.94 0.70 0.91 0.68 0.97 0.58 0.69 0.97 0.69 0.50 0.97 0.39 0.43 0.52 0.36 0.54 0.92

FMR1NB_4 (-144) 0.90 0.90 0.93 0.87 0.42 0.90 0.88 0.88 0.92 0.91 0.84 0.88 0.86 0.92 0.94 0.83 0.68 0.79 0.70 0.81 0.66 0.91 0.67 0.71 0.90 0.70 0.54 0.91 0.56 0.53 0.60 0.47 0.50 0.86

FMR1NB_5 (-91) 0.91 0.91 0.87 0.79 0.64 0.95 0.92 0.94 0.90 0.89 0.85 0.88 0.80 0.89 0.92 0.89 0.71 0.91 0.56 0.77 0.72 0.92 0.26 0.60 0.80 0.54 0.61 0.89 0.27 0.31 0.39 0.76 0.39 0.86

FMR1NB_6 (-64) 0.89 0.93 0.77 0.70 0.41 0.86 0.93 0.89 0.90 0.85 0.73 0.89 0.80 0.89 0.95 0.91 0.61 0.84 0.56 0.65 0.68 0.92 0.34 0.54 0.75 0.53 0.66 0.80 0.35 0.41 0.46 0.36 0.50 0.64

FMR1NB_7 (61) 0.89 0.90 0.80 0.60 0.36 0.92 0.86 0.90 0.89 0.84 0.77 0.88 0.70 0.90 0.90 0.85 0.73 0.84 0.58 0.64 0.62 0.86 0.39 0.72 0.60 0.60 0.70 0.84 0.45 0.49 0.53 0.28 0.39 0.65

FMR1NB_8 (246) 0.84 0.88 0.60 0.49 0.38 0.72 0.90 0.84 0.62 0.67 0.72 0.77 0.74 0.77 0.89 0.83 0.62 0.82 0.51 0.48 0.46 0.88 0.29 0.40 0.53 0.52 0.57 0.35 0.34 0.40 0.43 0.26 0.34 0.46

FMR1NB_9 (317) 0.89 0.91 0.69 0.59 0.33 0.86 0.89 0.78 0.78 0.81 0.63 0.87 0.87 0.75 0.83 0.87 0.51 0.71 0.46 0.54 0.57 0.94 0.37 0.67 0.52 0.49 0.55 0.77 0.26 0.30 0.47 0.38 0.48 0.64

GALNTL5_1 (-360) 0.88 0.90 0.92 0.92 0.49 0.92 0.93 0.91 0.88 0.90 0.93 0.92 0.86 0.90 0.91 0.87 0.89 0.87 0.86 0.86 0.89 0.93 0.83 0.81 0.91 0.92 0.86 0.92 0.83 0.57 0.83 0.38 0.45 0.91

GALNTL5_2 (10531) 0.61 0.83 0.82 0.82 0.35 0.79 0.91 0.80 0.66 0.67 0.86 0.80 0.56 0.83 0.39 0.84 0.67 0.60 0.80 0.80 0.85 0.87 0.70 0.34 0.67 0.81 0.66 0.86 0.45 0.47 0.60 0.18 0.43 0.77

GALNTL5_3 (10561) 0.76 0.65 0.85 0.86 0.38 0.75 0.78 0.87 0.72 0.68 0.80 0.78 0.64 0.68 0.80 0.81 0.83 0.83 0.72 0.85 0.73 0.81 0.75 0.57 0.88 0.92 0.77 0.88 0.79 0.55 0.85 0.26 0.44 0.84

120

GMCL1L_1 (107558188) 0.87 0.89 0.69 0.66 0.36 0.85 0.91 0.88 0.89 0.79 0.88 0.89 0.79 0.86 0.88 0.82 0.72 0.80 0.61 0.79 0.49 0.89 0.28 0.39 0.86 0.59 0.82 0.90 0.74 0.68 0.41 0.29 0.31 0.82

GMCL1L_2 (107558701) 0.89 0.89 0.77 0.73 0.42 0.84 0.85 0.88 0.85 0.82 0.85 0.85 0.82 0.80 0.93 0.84 0.71 0.77 0.67 0.66 0.53 0.92 0.40 0.47 0.83 0.70 0.83 0.90 0.77 0.73 0.40 0.39 0.43 0.72

GNGT1_1 (-899) 0.80 0.49 0.82 0.61 0.49 0.86 0.86 0.73 0.60 0.57 0.78 0.69 0.58 0.77 0.57 0.74 0.90 0.54 0.63 0.72 0.80 0.87 0.69 0.35 0.81 0.68 0.86 0.59 0.81 0.67 0.83 0.31 0.58 0.74

GNGT1_2 (-88) 0.69 0.44 0.64 0.64 0.43 0.71 0.69 0.73 0.53 0.62 0.74 0.41 0.50 0.64 0.41 0.62 0.74 0.44 0.70 0.65 0.61 0.78 0.75 0.69 0.79 0.78 0.74 0.66 0.72 0.67 0.68 0.36 0.58 0.75

HEATR7B2_1 (-1353) 0.80 0.89 0.41 0.41 0.34 0.81 0.85 0.58 0.30 0.72 0.35 0.50 0.36 0.66 0.79 0.85 0.85 0.58 0.47 0.23 0.70 0.88 0.30 0.33 0.90 0.53 0.49 0.57 0.66 0.36 0.35 0.29 0.40 0.22

HEATR7B2_2 (-547) 0.89 0.91 0.45 0.48 0.32 0.68 0.62 0.74 0.50 0.77 0.37 0.61 0.56 0.82 0.92 0.87 0.88 0.66 0.52 0.27 0.82 0.91 0.41 0.36 0.94 0.55 0.54 0.31 0.76 0.45 0.42 0.51 0.47 0.27

HEATR7B2_3 (-436) 0.75 0.90 0.51 0.44 0.39 0.54 0.38 0.60 0.66 0.72 0.45 0.44 0.46 0.77 0.89 0.69 0.65 0.66 0.51 0.53 0.77 0.91 0.25 0.75 0.46 0.61 0.58 0.70 0.50 0.34 0.31 0.23 0.32 0.58

HORMAD1_1 (-131) 0.89 0.84 0.81 0.89 0.47 0.90 0.90 0.80 0.74 0.81 0.91 0.83 0.86 0.89 0.93 0.81 0.86 0.77 0.77 0.73 0.84 0.92 0.65 0.71 0.79 0.84 0.79 0.88 0.87 0.70 0.70 0.34 0.58 0.73

HORMAD1_2 (-113) 0.90 0.88 0.79 0.90 0.40 0.91 0.90 0.83 0.81 0.86 0.92 0.84 0.90 0.89 0.90 0.84 0.88 0.81 0.81 0.80 0.83 0.92 0.62 0.64 0.66 0.84 0.74 0.90 0.90 0.66 0.66 0.50 0.45 0.80

HORMAD1_3 (-32) 0.96 0.95 0.95 0.93 0.52 0.96 0.93 0.96 0.95 0.98 0.92 0.89 0.92 0.94 0.96 0.92 0.96 0.96 0.91 0.94 0.93 0.93 0.85 0.83 0.94 0.92 0.91 0.94 0.92 0.94 0.90 0.50 0.64 0.94

HORMAD1_4 (-24) 0.92 0.94 0.95 0.92 0.43 0.95 0.95 0.95 0.91 0.93 0.92 0.84 0.92 0.88 0.92 0.88 0.93 0.90 0.91 0.90 0.85 0.92 0.83 0.84 0.93 0.95 0.88 0.92 0.90 0.91 0.81 0.51 0.38 0.91

HORMAD1_5 (52) 0.86 0.84 0.94 0.93 0.44 0.92 0.91 0.91 0.89 0.90 0.91 0.91 0.91 0.89 0.89 0.86 0.92 0.85 0.87 0.90 0.82 0.93 0.87 0.88 0.94 0.93 0.87 0.90 0.90 0.86 0.86 0.41 0.37 0.94

HORMAD1_6 (251) 0.90 0.93 0.94 0.91 0.53 0.93 0.94 0.93 0.93 0.92 0.94 0.86 0.90 0.89 0.96 0.92 0.95 0.93 0.91 0.91 0.86 0.92 0.92 0.40 0.95 0.94 0.92 0.95 0.89 0.87 0.88 0.52 0.60 0.94

HORMAD1_7 (380) 0.91 0.89 0.94 0.92 0.41 0.95 0.92 0.93 0.92 0.93 0.90 0.86 0.87 0.82 0.88 0.86 0.94 0.85 0.87 0.85 0.91 0.89 0.88 0.49 0.92 0.92 0.89 0.92 0.89 0.90 0.87 0.60 0.35 0.93

IGFBP1_1 (-1402) 0.87 0.88 0.90 0.90 0.42 0.88 0.88 0.92 0.89 0.85 0.90 0.91 0.79 0.83 0.84 0.89 0.86 0.91 0.91 0.87 0.84 0.91 0.88 0.91 0.92 0.93 0.91 0.90 0.91 0.93 0.89 0.49 0.48 0.94

IGFBP1_2 (-1367) 0.84 0.89 0.76 0.74 0.48 0.87 0.86 0.81 0.78 0.64 0.70 0.71 0.77 0.78 0.81 0.82 0.58 0.64 0.73 0.69 0.75 0.92 0.78 0.38 0.89 0.81 0.64 0.49 0.82 0.78 0.77 0.44 0.50 0.73

INSL4_1 (-58) 0.60 0.47 0.83 0.57 0.38 0.87 0.50 0.86 0.79 0.64 0.74 0.63 0.46 0.79 0.60 0.81 0.56 0.55 0.75 0.77 0.63 0.91 0.49 0.65 0.94 0.80 0.70 0.77 0.78 0.48 0.59 0.43 0.48 0.77

INSL4_2 (121) 0.81 0.62 0.87 0.50 0.65 0.76 0.88 0.87 0.74 0.68 0.77 0.61 0.54 0.89 0.93 0.70 0.58 0.65 0.76 0.85 0.63 0.89 0.49 0.70 0.86 0.81 0.78 0.67 0.87 0.45 0.52 0.28 0.48 0.89

INSL6_1 (-545) 0.84 0.88 0.91 0.88 0.33 0.87 0.85 0.87 0.82 0.83 0.87 0.84 0.77 0.87 0.77 0.77 0.87 0.77 0.79 0.80 0.80 0.84 0.86 0.79 0.89 0.86 0.83 0.82 0.86 0.45 0.81 0.31 0.27 0.88

INSL6_2 (31) 0.81 0.84 0.84 0.85 0.37 0.86 0.81 0.84 0.80 0.78 0.82 0.75 0.76 0.81 0.86 0.80 0.82 0.76 0.75 0.76 0.75 0.85 0.80 0.80 0.87 0.80 0.85 0.76 0.85 0.56 0.77 0.86 0.49 0.81

IQUB_1 (-1367) 0.73 0.64 0.72 0.88 0.66 0.86 0.91 0.79 0.80 0.84 0.81 0.76 0.76 0.81 0.40 0.81 0.83 0.65 0.78 0.77 0.84 0.80 0.77 0.42 0.83 0.87 0.88 0.88 0.76 0.70 0.82 0.43 0.44 0.80

IQUB_2 (4453) 0.84 0.90 0.93 0.94 0.56 0.94 0.93 0.94 0.84 0.89 0.91 0.89 0.87 0.90 0.96 0.92 0.93 0.85 0.89 0.90 0.87 0.94 0.94 0.80 0.92 0.98 0.93 0.95 0.70 0.96 0.85 0.73 0.56 0.95

IQUB_3 (6624) 0.66 0.70 0.76 0.75 0.64 0.74 0.72 0.71 0.68 0.70 0.71 0.68 0.65 0.74 0.59 0.67 0.72 0.60 0.69 0.64 0.70 0.69 0.66 0.63 0.68 0.71 0.72 0.65 0.64 0.61 0.64 0.46 0.41 0.65

IRGC_1 (124) 0.82 0.75 0.83 0.85 0.44 0.88 0.85 0.85 0.89 0.81 0.84 0.88 0.81 0.86 0.83 0.81 0.88 0.81 0.64 0.82 0.78 0.87 0.50 0.75 0.59 0.67 0.88 0.82 0.67 0.71 0.63 0.29 0.99 0.83

ISM2_1 (-1321) 0.81 0.80 0.80 0.79 0.50 0.82 0.85 0.85 0.83 0.59 0.75 0.72 0.52 0.78 0.76 0.80 0.80 0.72 0.65 0.81 0.81 0.87 0.82 0.28 0.89 0.68 0.84 0.74 0.88 0.80 0.83 0.47 0.49 0.84

KIAA1257_1 (-936) 0.84 0.72 0.60 0.80 0.57 0.85 0.83 0.84 0.88 0.81 0.83 0.80 0.72 0.83 0.74 0.77 0.73 0.77 0.58 0.73 0.77 0.83 0.65 0.36 0.72 0.62 0.75 0.87 0.81 0.70 0.69 0.41 0.51 0.74

KISS1_1 (-1282) 0.86 0.90 0.73 0.91 0.56 0.88 0.88 0.85 0.88 0.85 0.86 0.91 0.87 0.83 0.85 0.78 0.87 0.76 0.80 0.69 0.82 0.89 0.79 0.62 0.90 0.86 0.89 0.88 0.80 0.83 0.75 0.77 0.37 0.71

KISS1_2 (-1128) 0.87 0.89 0.59 0.86 0.60 0.81 0.91 0.85 0.73 0.86 0.88 0.87 0.82 0.86 0.89 0.75 0.74 0.71 0.80 0.42 0.70 0.92 0.62 0.41 0.88 0.84 0.89 0.89 0.60 0.74 0.67 0.38 0.43 0.49

LDHC_1 (-352) 0.64 0.45 0.97 0.69 0.25 0.80 0.68 0.34 0.83 0.58 0.87 0.31 0.56 0.73 0.62 0.31 0.89 0.80 0.73 0.85 0.81 0.35 0.30 0.34 0.78 0.80 0.58 0.22 0.76 0.32 0.48 0.18 0.22 0.89

LDHC_2 (-298) 0.78 0.39 0.91 0.78 0.48 0.88 0.64 0.43 0.92 0.59 0.91 0.32 0.54 0.79 0.80 0.36 0.84 0.72 0.78 0.90 0.84 0.32 0.31 0.21 0.94 0.81 0.68 0.19 0.91 0.32 0.53 0.51 0.44 0.93

121

LDHC_3 (-288) 0.75 0.43 0.91 0.71 0.68 0.87 0.61 0.38 0.89 0.61 0.89 0.34 0.57 0.74 0.69 0.33 0.82 0.75 0.74 0.86 0.86 0.30 0.31 0.26 0.89 0.79 0.71 0.15 0.90 0.30 0.52 0.39 0.53 0.90

LGALS13_1 (-1105) 0.71 0.62 0.80 0.68 0.51 0.66 0.88 0.61 0.77 0.78 0.79 0.72 0.50 0.77 0.72 0.84 0.78 0.59 0.70 0.83 0.71 0.92 0.67 0.43 0.90 0.77 0.83 0.82 0.51 0.36 0.57 0.51 0.40 0.91

LOC100128554_1 (1431046) 0.54 0.89 0.59 0.42 0.54 0.84 0.90 0.89 0.63 0.61 0.46 0.41 0.49 0.83 0.68 0.86 0.71 0.59 0.66 0.89 0.86 0.74 0.87 0.30 0.94 0.69 0.53 0.26 0.82 0.35 0.82 0.32 0.30 0.92

LOC100128554_2 (1431403) 0.51 0.85 0.59 0.44 0.44 0.65 0.92 0.83 0.48 0.64 0.44 0.47 0.49 0.83 0.25 0.81 0.66 0.53 0.64 0.38 0.67 0.69 0.79 0.40 0.77 0.64 0.54 0.44 0.74 0.29 0.73 0.38 0.39 0.40

LOC100128554_3 (1431447) 0.40 0.81 0.45 0.42 0.56 0.75 0.91 0.78 0.26 0.61 0.34 0.34 0.34 0.82 0.16 0.83 0.65 0.43 0.58 0.36 0.68 0.70 0.80 0.21 0.88 0.58 0.36 0.67 0.76 0.19 0.74 0.33 0.35 0.40

LOC100128554_4 (1431461) 0.40 0.76 0.42 0.48 0.45 0.77 0.86 0.71 0.29 0.61 0.31 0.34 0.38 0.79 0.21 0.81 0.60 0.42 0.53 0.25 0.56 0.66 0.74 0.22 0.86 0.59 0.42 0.68 0.75 0.17 0.73 0.51 0.33 0.21

LOC126536_1 (-851) 0.77 0.77 0.72 0.78 0.41 0.62 0.64 0.87 0.77 0.73 0.89 0.76 0.67 0.78 0.87 0.84 0.72 0.71 0.75 0.77 0.56 0.83 0.76 0.43 0.78 0.81 0.72 0.85 0.75 0.58 0.68 0.29 0.33 0.81

LOC126536_2 (-125) 0.81 0.83 0.86 0.90 0.48 0.88 0.86 0.87 0.86 0.86 0.90 0.85 0.86 0.86 0.89 0.84 0.82 0.86 0.82 0.85 0.82 0.89 0.83 0.88 0.92 0.90 0.83 0.91 0.84 0.82 0.84 0.33 0.37 0.93

LOC126536_3 (-97) 0.88 0.88 0.87 0.92 0.69 0.89 0.90 0.92 0.91 0.91 0.85 0.90 0.89 0.86 0.91 0.89 0.77 0.88 0.93 0.90 0.75 0.94 0.85 0.79 0.91 0.89 0.77 0.92 0.91 0.57 0.84 0.45 0.39 0.92

LOC151658_1 (-791) 0.92 0.94 0.93 0.97 0.38 0.93 0.94 0.91 0.91 0.93 0.94 0.93 0.89 0.91 0.93 0.89 0.94 0.87 0.92 0.90 0.87 0.94 0.93 0.82 0.94 0.94 0.91 0.95 0.94 0.89 0.91 0.34 0.26 0.94

LOC151658_2 (-185) 0.82 0.89 0.87 0.87 0.50 0.91 0.90 0.85 0.92 0.83 0.88 0.80 0.47 0.90 0.57 0.87 0.92 0.76 0.85 0.90 0.85 0.89 0.86 0.36 0.90 0.92 0.87 0.90 0.90 0.88 0.82 0.38 0.52 0.94

LOC441601_1 (-1128) 0.66 0.78 0.74 0.65 0.45 0.67 0.89 0.85 0.45 0.61 0.52 0.59 0.60 0.83 0.91 0.85 0.87 0.81 0.55 0.36 0.43 0.90 0.48 0.50 0.44 0.55 0.66 0.43 0.46 0.76 0.49 0.34 0.27 0.35

LOC441601_2 (-651) 0.93 0.87 0.84 0.90 0.59 0.92 0.91 0.91 0.95 0.88 0.50 0.88 0.76 0.83 0.84 0.82 0.82 0.90 0.53 0.84 0.50 0.91 0.19 0.87 0.89 0.44 0.86 0.92 0.23 0.73 0.31 0.83 0.27 0.88

MAEL_1 (-297) 0.43 0.89 0.87 0.67 0.36 0.79 0.85 0.69 0.32 0.56 0.83 0.68 0.51 0.85 0.43 0.85 0.37 0.45 0.76 0.87 0.89 0.90 0.20 0.31 0.56 0.80 0.60 0.85 0.23 0.59 0.37 0.35 0.35 0.90

MAEL_2 (-285) 0.52 0.86 0.79 0.63 0.42 0.77 0.81 0.69 0.40 0.60 0.80 0.76 0.61 0.75 0.46 0.84 0.63 0.55 0.74 0.86 0.84 0.90 0.35 0.47 0.59 0.77 0.62 0.86 0.34 0.60 0.47 0.39 0.43 0.88

MAEL_3 (-245) 0.81 0.91 0.94 0.91 0.29 0.92 0.93 0.81 0.67 0.64 0.89 0.91 0.88 0.92 0.86 0.88 0.61 0.75 0.87 0.91 0.91 0.94 0.25 0.42 0.89 0.91 0.79 0.92 0.34 0.76 0.44 0.28 0.44 0.94

MAEL_4 (-196) 0.63 0.88 0.85 0.66 0.47 0.85 0.82 0.72 0.47 0.56 0.84 0.72 0.61 0.82 0.72 0.80 0.61 0.60 0.74 0.85 0.85 0.89 0.36 0.53 0.66 0.79 0.67 0.89 0.35 0.64 0.49 0.31 0.34 0.90

MAEL_5 (-129) 0.78 0.96 0.79 0.93 0.48 0.95 0.96 0.75 0.75 0.71 0.98 0.95 0.96 0.94 0.97 0.96 0.56 0.73 0.95 0.95 0.95 0.97 0.37 0.51 0.81 0.95 0.78 0.97 0.31 0.67 0.45 0.52 0.38 0.97

MAEL_6 (-117) 0.70 0.91 0.86 0.80 0.58 0.85 0.86 0.69 0.69 0.57 0.86 0.78 0.88 0.85 0.86 0.89 0.55 0.65 0.79 0.87 0.87 0.92 0.32 0.45 0.66 0.79 0.64 0.87 0.26 0.58 0.37 0.39 0.32 0.90

MAEL_7 (-112) 0.80 0.91 0.96 0.87 0.48 0.92 0.91 0.76 0.80 0.74 0.91 0.87 0.91 0.86 0.87 0.90 0.64 0.72 0.82 0.90 0.88 0.91 0.36 0.52 0.86 0.89 0.78 0.90 0.27 0.71 0.42 0.70 0.69 0.89

MAEL_8 (63) 0.92 0.96 0.92 0.85 0.54 0.92 0.92 0.60 0.93 0.91 0.92 0.91 0.89 0.92 0.94 0.95 0.47 0.90 0.85 0.93 0.95 0.96 0.19 0.73 0.91 0.89 0.66 0.95 0.18 0.53 0.32 0.62 0.47 0.94

MAEL_9 (65) 0.93 0.97 0.93 0.87 0.71 0.91 0.93 0.56 0.93 0.90 0.93 0.93 0.93 0.90 0.92 0.95 0.44 0.93 0.85 0.96 0.97 0.95 0.17 0.68 0.94 0.89 0.54 0.93 0.14 0.48 0.29 0.76 0.60 0.97

MAGEB18_1 (60) 0.84 0.90 0.55 0.54 0.29 0.89 0.91 0.72 0.42 0.76 0.52 0.44 0.54 0.67 0.41 0.82 0.68 0.69 0.78 0.41 0.67 0.90 0.84 0.41 0.91 0.82 0.81 0.40 0.72 0.45 0.80 0.34 0.32 0.33

MAGEB18_2 (86) 0.88 0.86 0.54 0.51 0.36 0.91 0.91 0.84 0.36 0.69 0.48 0.57 0.52 0.73 0.34 0.87 0.74 0.64 0.72 0.53 0.67 0.91 0.72 0.40 0.87 0.77 0.77 0.72 0.72 0.39 0.73 0.35 0.37 0.51

MAGEB3_1 (-1451) 0.85 0.79 0.57 0.50 0.22 0.63 0.87 0.83 0.76 0.64 0.66 0.53 0.60 0.59 0.27 0.79 0.63 0.62 0.54 0.81 0.65 0.88 0.58 0.38 0.82 0.55 0.78 0.74 0.64 0.26 0.52 0.39 0.54 0.83

MAGEB6_1 (-1120) 0.78 0.86 0.50 0.50 0.43 0.83 0.89 0.69 0.33 0.56 0.45 0.35 0.53 0.58 0.72 0.80 0.63 0.72 0.76 0.31 0.63 0.87 0.84 0.33 0.87 0.84 0.83 0.44 0.85 0.45 0.80 0.35 0.41 0.24

MAGEB6_2 (-148) 0.90 0.91 0.81 0.80 0.29 0.86 0.92 0.89 0.90 0.91 0.86 0.80 0.89 0.94 0.93 0.85 0.64 0.86 0.83 0.89 0.83 0.94 0.91 0.93 0.92 0.87 0.91 0.92 0.93 0.50 0.89 0.39 0.43 0.90

MAGEB6_3 (53) 0.95 0.95 0.54 0.49 0.46 0.82 0.98 0.91 0.93 0.76 0.46 0.57 0.82 0.87 0.62 0.95 0.55 0.81 0.82 0.78 0.81 0.97 0.81 0.51 0.97 0.82 0.81 0.94 0.98 0.40 0.77 0.52 0.61 0.81

MAGEB6_4 (156) 0.84 0.74 0.50 0.43 0.43 0.62 0.88 0.62 0.42 0.61 0.47 0.36 0.48 0.68 0.68 0.85 0.60 0.70 0.67 0.35 0.63 0.89 0.43 0.40 0.79 0.69 0.74 0.25 0.90 0.36 0.53 0.29 0.52 0.29

OR7E156P_1 (-170) 0.54 0.45 0.75 0.71 0.39 0.69 0.87 0.73 0.41 0.69 0.31 0.53 0.61 0.76 0.27 0.53 0.45 0.67 0.83 0.72 0.72 0.51 0.71 0.45 0.89 0.86 0.85 0.85 0.64 0.73 0.75 0.30 0.33 0.71

122

OR7E156P_2 (-12) 0.46 0.45 0.78 0.55 0.48 0.59 0.89 0.71 0.42 0.69 0.34 0.63 0.64 0.88 0.38 0.53 0.70 0.60 0.74 0.43 0.89 0.65 0.64 0.52 0.92 0.79 0.87 0.74 0.54 0.70 0.61 0.52 0.46 0.42

PAPOLB_1 (-979) 0.80 0.61 0.69 0.51 0.39 0.81 0.92 0.88 0.85 0.57 0.69 0.90 0.77 0.82 0.86 0.86 0.66 0.73 0.60 0.90 0.81 0.93 0.42 0.94 0.42 0.66 0.52 0.94 0.37 0.35 0.46 0.24 0.42 0.92

PAPOLB_2 (-633) 0.90 0.94 0.92 0.89 0.46 0.93 0.90 0.93 0.92 0.81 0.92 0.93 0.90 0.90 0.94 0.87 0.69 0.88 0.69 0.89 0.86 0.94 0.44 0.94 0.91 0.71 0.90 0.93 0.80 0.52 0.48 0.53 0.49 0.92

PAPOLB_3 (-426) 0.91 0.90 0.82 0.66 0.33 0.75 0.93 0.90 0.95 0.85 0.81 0.95 0.89 0.94 0.96 0.90 0.65 0.77 0.63 0.92 0.82 0.96 0.37 0.95 0.54 0.64 0.71 0.93 0.52 0.43 0.52 0.29 0.31 0.95

PAPOLB_4 (-391) 0.75 0.90 0.78 0.59 0.31 0.62 0.86 0.75 0.84 0.60 0.71 0.89 0.56 0.79 0.93 0.82 0.64 0.57 0.51 0.77 0.72 0.91 0.35 0.88 0.63 0.49 0.55 0.81 0.42 0.40 0.53 0.37 0.38 0.84

PIWIL1_1 (-1157) 0.63 0.49 0.59 0.47 0.40 0.56 0.86 0.80 0.57 0.58 0.40 0.36 0.51 0.79 0.30 0.84 0.63 0.61 0.49 0.36 0.34 0.82 0.40 0.33 0.48 0.50 0.57 0.26 0.24 0.46 0.52 0.34 0.37 0.34

PIWIL1_2 (-1083) 0.58 0.34 0.62 0.39 0.40 0.67 0.91 0.77 0.47 0.51 0.40 0.26 0.45 0.77 0.30 0.84 0.65 0.58 0.44 0.42 0.30 0.89 0.35 0.28 0.54 0.41 0.65 0.17 0.30 0.53 0.52 0.32 0.54 0.44

PIWIL1_3 (-10) 0.96 0.91 0.87 0.81 0.44 0.94 0.86 0.49 0.90 0.88 0.89 0.94 0.35 0.87 0.94 0.23 0.93 0.88 0.95 0.93 0.82 0.91 0.26 0.36 0.67 0.96 0.94 0.92 0.60 0.97 0.38 0.95 0.42 0.94

PIWIL1_4 (-8) 0.95 0.93 0.94 0.89 0.67 0.96 0.92 0.64 0.91 0.93 0.95 0.94 0.51 0.92 0.95 0.32 0.96 0.92 0.95 0.93 0.89 0.94 0.39 0.45 0.86 0.97 0.97 0.92 0.74 0.96 0.51 0.62 0.49 0.97

PIWIL1_5 (61) 0.90 0.86 0.92 0.90 0.45 0.80 0.83 0.53 0.72 0.85 0.62 0.79 0.43 0.80 0.84 0.29 0.83 0.78 0.86 0.79 0.80 0.85 0.30 0.29 0.57 0.94 0.84 0.85 0.40 0.85 0.45 0.45 0.42 0.90

PIWIL1_6 (205) 0.77 0.65 0.91 0.84 0.71 0.85 0.91 0.60 0.80 0.79 0.54 0.80 0.50 0.82 0.51 0.38 0.77 0.73 0.77 0.65 0.72 0.79 0.32 0.55 0.53 0.81 0.84 0.60 0.22 0.64 0.42 0.36 0.46 0.61

PLCZ1_1 (-1075) 0.82 0.89 0.88 0.89 0.43 0.90 0.88 0.92 0.86 0.86 0.87 0.79 0.77 0.76 0.88 0.86 0.93 0.78 0.84 0.80 0.69 0.86 0.85 0.88 0.85 0.90 0.89 0.96 0.92 0.58 0.81 0.33 0.39 0.85

PLCZ1_2 (-297) 0.89 0.31 0.87 0.88 0.38 0.89 0.92 0.85 0.87 0.76 0.89 0.46 0.67 0.84 0.80 0.82 0.85 0.75 0.82 0.70 0.71 0.91 0.83 0.47 0.93 0.88 0.86 0.62 0.90 0.54 0.82 0.32 0.82 0.71

POTED_1 (-417) 0.94 0.82 0.96 0.87 0.28 0.86 0.94 0.87 0.73 0.86 0.92 0.93 0.90 0.81 0.87 0.94 0.42 0.90 0.64 0.79 0.85 0.93 0.55 0.89 0.95 0.64 0.94 0.94 0.42 0.38 0.70 0.35 0.35 0.81

POTED_2 (-134) 0.49 0.56 0.64 0.50 0.53 0.49 0.86 0.59 0.70 0.63 0.67 0.43 0.47 0.83 0.24 0.59 0.64 0.57 0.57 0.41 0.47 0.78 0.39 0.52 0.39 0.57 0.68 0.63 0.26 0.34 0.45 0.38 0.45 0.39

PPP1R2P9_1 (-623) 0.89 0.90 0.61 0.48 0.52 0.67 0.83 0.56 0.92 0.74 0.90 0.73 0.86 0.69 0.93 0.79 0.51 0.53 0.49 0.47 0.62 0.92 0.34 0.37 0.47 0.53 0.54 0.87 0.50 0.39 0.45 0.33 0.52 0.48

PPP1R2P9_2 (-93) 0.94 0.96 0.97 0.97 0.71 0.99 0.95 0.82 0.95 0.96 0.97 0.96 0.95 0.97 0.93 0.92 0.96 0.97 0.92 0.94 0.94 0.96 0.85 0.96 0.95 0.95 0.94 0.97 0.42 0.50 0.80 0.54 0.29 0.97

PPP1R2P9_3 (-21) 0.96 0.96 0.96 0.97 0.63 0.97 0.95 0.77 0.96 0.97 0.96 0.95 0.95 0.96 0.98 0.95 0.76 0.96 0.92 0.95 0.94 0.94 0.73 0.96 0.94 0.91 0.97 0.95 0.31 0.37 0.62 0.69 0.48 0.96

PRPS1L1_1 (-1139) 0.89 0.93 0.92 0.55 0.45 0.92 0.92 0.90 0.90 0.89 0.91 0.88 0.88 0.92 0.93 0.86 0.75 0.79 0.82 0.74 0.87 0.92 0.85 0.74 0.91 0.87 0.76 0.91 0.92 0.53 0.77 0.33 0.43 0.79

PRPS1L1_2 (-52) 0.85 0.88 0.85 0.78 0.42 0.90 0.90 0.94 0.76 0.87 0.82 0.74 0.81 0.79 0.84 0.87 0.71 0.80 0.89 0.77 0.75 0.90 0.72 0.92 0.72 0.92 0.87 0.88 0.86 0.40 0.69 0.31 0.40 0.82

PRPS1L1_3 (-50) 0.83 0.89 0.92 0.76 0.48 0.86 0.89 0.91 0.78 0.85 0.83 0.76 0.88 0.86 0.87 0.84 0.68 0.89 0.86 0.88 0.86 0.90 0.78 0.92 0.89 0.87 0.84 0.91 0.88 0.49 0.75 0.39 0.27 0.90

PRPS1L1_4 (-48) 0.87 0.87 0.85 0.75 0.31 0.94 0.91 0.89 0.91 0.88 0.85 0.81 0.87 0.86 0.86 0.88 0.71 0.89 0.83 0.85 0.83 0.89 0.88 0.91 0.83 0.89 0.92 0.89 0.91 0.45 0.86 0.35 0.45 0.89

PRPS1L1_5 (-45) 0.89 0.95 0.88 0.78 0.54 0.94 0.91 0.93 0.80 0.88 0.85 0.66 0.84 0.92 0.89 0.88 0.69 0.88 0.87 0.75 0.89 0.92 0.72 0.88 0.88 0.89 0.83 0.94 0.88 0.47 0.73 0.48 0.52 0.80

PRPS1L1_6 (-23) 0.77 0.92 0.85 0.58 0.33 0.84 0.93 0.87 0.62 0.76 0.89 0.57 0.84 0.87 0.94 0.87 0.64 0.69 0.73 0.43 0.78 0.94 0.59 0.75 0.65 0.76 0.58 0.91 0.88 0.39 0.57 0.11 0.27 0.41

PRPS1L1_7 (22) 0.90 0.92 0.93 0.71 0.45 0.93 0.92 0.93 0.90 0.87 0.93 0.84 0.92 0.94 0.93 0.89 0.75 0.82 0.77 0.67 0.83 0.94 0.78 0.73 0.91 0.86 0.81 0.79 0.89 0.46 0.68 0.53 0.37 0.70

PRPS1L1_8 (48) 0.92 0.91 0.92 0.61 0.21 0.94 0.93 0.93 0.87 0.86 0.93 0.64 0.90 0.91 0.94 0.89 0.59 0.80 0.59 0.77 0.80 0.92 0.63 0.74 0.91 0.61 0.79 0.92 0.93 0.33 0.61 0.26 0.55 0.82

PRPS1L1_9 (82) 0.93 0.96 0.89 0.39 0.54 0.94 0.95 0.95 0.92 0.92 0.91 0.56 0.94 0.93 0.96 0.94 0.48 0.81 0.73 0.70 0.77 0.96 0.42 0.46 0.90 0.70 0.66 0.92 0.92 0.21 0.37 0.55 0.50 0.70

PRPS1L1_10 (203) 0.77 0.79 0.74 0.40 0.61 0.63 0.55 0.80 0.51 0.66 0.79 0.46 0.64 0.69 0.84 0.77 0.58 0.52 0.59 0.27 0.60 0.84 0.48 0.31 0.65 0.67 0.60 0.61 0.83 0.27 0.49 0.38 0.48 0.28

RAD9B_1 (687) 0.93 0.91 0.92 0.92 0.42 0.92 0.92 0.93 0.93 0.91 0.94 0.94 0.90 0.90 0.91 0.88 0.92 0.88 0.88 0.82 0.89 0.92 0.93 0.92 0.91 0.93 0.91 0.92 0.92 0.92 0.89 0.29 0.37 0.85

RAD9B_2 (1083) 0.87 0.69 0.90 0.87 0.31 0.86 0.88 0.83 0.91 0.85 0.89 0.88 0.73 0.90 0.85 0.79 0.85 0.81 0.82 0.75 0.86 0.89 0.86 0.81 0.88 0.90 0.87 0.89 0.88 0.88 0.84 0.16 0.37 0.83

123

RBM46_1 (-85) 0.85 0.85 0.88 0.85 0.34 0.88 0.89 0.85 0.90 0.81 0.89 0.70 0.85 0.80 0.87 0.71 0.79 0.82 0.79 0.72 0.76 0.90 0.86 0.87 0.85 0.87 0.83 0.89 0.61 0.58 0.79 0.36 0.41 0.79

RBM46_2 (-75) 0.89 0.90 0.89 0.82 0.50 0.91 0.94 0.90 0.95 0.92 0.89 0.85 0.88 0.89 0.92 0.66 0.74 0.84 0.88 0.69 0.76 0.91 0.86 0.81 0.94 0.92 0.82 0.85 0.57 0.49 0.74 0.36 0.34 0.78

RBM46_3 (1003) 0.86 0.75 0.82 0.68 0.54 0.87 0.90 0.77 0.65 0.78 0.86 0.69 0.57 0.80 0.85 0.43 0.75 0.72 0.73 0.69 0.68 0.88 0.88 0.82 0.84 0.81 0.57 0.78 0.50 0.50 0.74 0.32 0.41 0.74

RFPL3S_1 (-1229) 0.75 0.77 0.79 0.83 0.43 0.84 0.80 0.80 0.83 0.78 0.82 0.78 0.68 0.80 0.83 0.80 0.72 0.69 0.74 0.70 0.79 0.89 0.80 0.50 0.73 0.79 0.85 0.86 0.69 0.85 0.73 0.31 0.48 0.79

RFPL3S_2 (-1052) 0.65 0.79 0.73 0.70 0.43 0.78 0.87 0.61 0.58 0.76 0.87 0.39 0.51 0.82 0.40 0.64 0.73 0.65 0.63 0.40 0.85 0.91 0.54 0.43 0.42 0.68 0.79 0.92 0.49 0.90 0.63 0.36 0.30 0.36

RFPL3S_3 (-586) 0.87 0.72 0.85 0.87 0.31 0.89 0.89 0.89 0.83 0.83 0.84 0.86 0.62 0.90 0.95 0.81 0.69 0.86 0.82 0.89 0.81 0.91 0.68 0.82 0.66 0.83 0.90 0.90 0.57 0.43 0.70 0.31 0.53 0.94

RFPL3S_4 (-100) 0.80 0.63 0.81 0.78 0.45 0.80 0.91 0.70 0.91 0.75 0.89 0.87 0.79 0.88 0.84 0.82 0.69 0.69 0.76 0.59 0.86 0.93 0.72 0.38 0.62 0.82 0.74 0.91 0.51 0.41 0.80 0.27 0.27 0.58

RFPL3S_5 (-32) 0.92 0.72 0.91 0.92 0.39 0.94 0.93 0.93 0.90 0.93 0.93 0.93 0.90 0.91 0.91 0.91 0.74 0.84 0.91 0.89 0.91 0.95 0.92 0.46 0.93 0.94 0.88 0.94 0.77 0.46 0.92 0.29 0.74 0.91

RFX4_1 (17389) 0.91 0.91 0.89 0.74 0.43 0.86 0.92 0.92 0.93 0.88 0.93 0.90 0.91 0.90 0.93 0.88 0.76 0.86 0.88 0.89 0.90 0.92 0.64 0.60 0.93 0.94 0.91 0.92 0.93 0.93 0.79 0.36 0.46 0.94

RFX4_2 (101378) 0.87 0.86 0.86 0.72 0.27 0.88 0.89 0.91 0.87 0.80 0.91 0.91 0.76 0.83 0.89 0.89 0.70 0.75 0.89 0.90 0.88 0.90 0.89 0.36 0.88 0.94 0.84 0.90 0.92 0.84 0.85 0.31 0.40 0.93

RFX4_3 (101520) 0.90 0.92 0.91 0.88 0.43 0.89 0.94 0.92 0.93 0.86 0.92 0.91 0.91 0.87 0.92 0.87 0.80 0.76 0.90 0.89 0.88 0.93 0.91 0.47 0.93 0.93 0.91 0.93 0.96 0.92 0.92 0.37 0.48 0.94

RFX4_4 (101577) 0.89 0.89 0.85 0.72 0.42 0.85 0.91 0.91 0.87 0.86 0.89 0.90 0.83 0.87 0.90 0.87 0.64 0.77 0.86 0.89 0.87 0.91 0.84 0.45 0.87 0.90 0.87 0.93 0.88 0.78 0.85 0.42 0.25 0.93

RFX4_5 (101621) 0.74 0.88 0.70 0.45 0.37 0.68 0.87 0.86 0.91 0.82 0.88 0.90 0.65 0.80 0.93 0.88 0.63 0.54 0.78 0.84 0.84 0.92 0.79 0.33 0.87 0.85 0.83 0.92 0.86 0.55 0.73 0.34 0.53 0.90

RFX4_6 (101648) 0.76 0.91 0.72 0.50 0.48 0.79 0.89 0.87 0.89 0.80 0.90 0.88 0.72 0.79 0.84 0.84 0.65 0.65 0.85 0.89 0.84 0.92 0.87 0.32 0.92 0.88 0.85 0.90 0.92 0.77 0.81 0.41 0.56 0.92

RNF17_1 (-1045) 0.89 0.77 0.90 0.64 0.43 0.81 0.93 0.84 0.89 0.75 0.89 0.61 0.60 0.87 0.92 0.86 0.71 0.71 0.64 0.76 0.81 0.90 0.38 0.82 0.37 0.68 0.69 0.94 0.39 0.55 0.48 0.53 0.43 0.86

RNF17_2 (-651) 0.80 0.82 0.88 0.91 0.20 0.92 0.86 0.91 0.86 0.91 0.86 0.82 0.78 0.85 0.88 0.82 0.76 0.81 0.79 0.82 0.82 0.89 0.38 0.78 0.90 0.80 0.77 0.88 0.36 0.50 0.42 0.18 0.46 0.85

RNF17_3 (-610) 0.91 0.84 0.89 0.91 0.40 0.91 0.86 0.90 0.77 0.85 0.87 0.86 0.76 0.81 0.82 0.80 0.76 0.81 0.73 0.83 0.81 0.82 0.47 0.87 0.88 0.82 0.86 0.85 0.47 0.53 0.48 0.38 0.45 0.88

RNF17_4 (-187) 0.83 0.70 0.69 0.79 0.54 0.85 0.75 0.80 0.71 0.68 0.75 0.41 0.65 0.62 0.82 0.75 0.41 0.87 0.56 0.76 0.65 0.68 0.18 0.20 0.53 0.57 0.48 0.81 0.13 0.21 0.20 0.46 0.55 0.94

RNF17_5 (-165) 0.83 0.81 0.79 0.84 0.77 0.83 0.88 0.75 0.84 0.72 0.84 0.53 0.60 0.72 0.83 0.83 0.66 0.71 0.64 0.67 0.74 0.86 0.33 0.47 0.50 0.73 0.65 0.86 0.36 0.46 0.42 0.80 0.77 0.79

RNF17_6 (-66) 0.74 0.89 0.77 0.88 0.35 0.84 0.88 0.81 0.90 0.82 0.90 0.78 0.65 0.86 0.86 0.82 0.68 0.76 0.62 0.67 0.76 0.90 0.39 0.40 0.48 0.64 0.71 0.86 0.36 0.53 0.51 0.52 0.29 0.68

RNF17_7 (-13) 0.91 0.94 0.97 0.96 0.37 0.97 0.95 0.95 0.93 0.94 0.96 0.94 0.93 0.94 0.94 0.89 0.90 0.93 0.92 0.92 0.92 0.96 0.79 0.95 0.94 0.95 0.95 0.94 0.32 0.55 0.81 0.48 0.27 0.95

RNF17_8 (-11) 0.90 0.94 0.96 0.95 0.54 0.95 0.94 0.94 0.94 0.93 0.95 0.92 0.92 0.94 0.95 0.90 0.80 0.90 0.88 0.91 0.92 0.94 0.70 0.95 0.95 0.93 0.93 0.94 0.31 0.54 0.68 0.28 0.30 0.96

RPL10L_1 (-131) 0.81 0.67 0.65 0.38 0.37 0.82 0.83 0.79 0.84 0.57 0.46 0.30 0.71 0.81 0.82 0.60 0.57 0.77 0.67 0.72 0.71 0.84 0.38 0.82 0.82 0.68 0.65 0.84 0.42 0.31 0.49 0.62 0.49 0.68

RPL10L_2 (-129) 0.94 0.66 0.65 0.37 0.33 0.90 0.94 0.86 0.91 0.58 0.44 0.21 0.73 0.86 0.85 0.58 0.54 0.87 0.71 0.79 0.71 0.95 0.39 0.88 0.87 0.76 0.61 0.95 0.40 0.33 0.52 0.42 0.30 0.67

RPL10L_3 (-105) 0.94 0.76 0.62 0.37 0.38 0.90 0.95 0.87 0.81 0.80 0.41 0.46 0.75 0.84 0.94 0.59 0.58 0.93 0.58 0.75 0.68 0.94 0.45 0.75 0.89 0.56 0.82 0.91 0.44 0.36 0.50 0.46 0.36 0.78

RPL10L_4 (-90) 0.87 0.80 0.71 0.55 0.43 0.85 0.86 0.83 0.90 0.87 0.50 0.66 0.81 0.85 0.93 0.60 0.62 0.81 0.63 0.74 0.63 0.91 0.55 0.72 0.85 0.61 0.86 0.87 0.49 0.39 0.66 0.28 0.45 0.79

RPL10L_5 (-6) 0.86 0.82 0.72 0.74 0.37 0.84 0.86 0.87 0.87 0.87 0.68 0.75 0.71 0.85 0.92 0.65 0.73 0.82 0.59 0.84 0.71 0.86 0.86 0.87 0.77 0.60 0.87 0.90 0.48 0.43 0.81 0.31 0.35 0.88

RPL10L_6 (25) 0.97 0.96 0.84 0.79 0.56 0.96 0.97 0.97 0.94 0.96 0.78 0.69 0.96 0.96 0.97 0.96 0.71 0.96 0.86 0.95 0.88 0.96 0.97 0.89 0.97 0.88 0.95 0.97 0.45 0.44 0.88 0.68 0.60 0.94

RPL10L_7 (107) 0.92 0.80 0.80 0.62 0.37 0.87 0.93 0.92 0.85 0.81 0.64 0.72 0.84 0.87 0.89 0.78 0.77 0.85 0.81 0.78 0.73 0.92 0.83 0.71 0.84 0.83 0.79 0.90 0.58 0.55 0.73 0.49 0.58 0.82

SOX30_1 (-1473) 0.74 0.45 0.75 0.75 0.21 0.54 0.82 0.84 0.79 0.70 0.90 0.82 0.74 0.77 0.51 0.83 0.73 0.71 0.59 0.53 0.76 0.86 0.46 0.50 0.31 0.61 0.64 0.87 0.30 0.35 0.51 0.34 0.39 0.62

124

SOX30_2 (-398) 0.96 0.92 0.93 0.94 0.39 0.88 0.92 0.93 0.93 0.91 0.93 0.95 0.91 0.94 0.93 0.87 0.75 0.87 0.84 0.85 0.89 0.92 0.87 0.67 0.91 0.88 0.91 0.93 0.71 0.63 0.80 0.23 0.38 0.93

SOX30_3 (-93) 0.86 0.90 0.89 0.90 0.40 0.91 0.90 0.90 0.79 0.83 0.90 0.86 0.45 0.83 0.91 0.85 0.72 0.87 0.66 0.84 0.82 0.90 0.34 0.69 0.53 0.70 0.78 0.85 0.57 0.35 0.56 0.37 0.47 0.87

SOX30_4 (-41) 0.88 0.90 0.94 0.93 0.33 0.89 0.91 0.93 0.88 0.88 0.93 0.88 0.46 0.85 0.96 0.88 0.76 0.88 0.72 0.84 0.88 0.92 0.41 0.77 0.59 0.74 0.88 0.90 0.62 0.47 0.57 0.30 0.49 0.90

SOX30_5 (-13) 0.93 0.96 0.96 0.95 0.43 0.96 0.97 0.79 0.85 0.95 0.93 0.68 0.40 0.80 0.95 0.97 0.69 0.91 0.56 0.83 0.95 0.95 0.35 0.52 0.32 0.54 0.77 0.93 0.41 0.36 0.44 0.51 0.48 0.91

SOX30_6 (115) 0.85 0.94 0.91 0.87 0.30 0.84 0.94 0.53 0.86 0.90 0.88 0.38 0.47 0.80 0.71 0.76 0.67 0.77 0.52 0.54 0.79 0.62 0.33 0.43 0.24 0.54 0.63 0.90 0.21 0.31 0.39 0.61 0.45 0.51

SPATA22_1 (-950) 0.79 0.94 0.89 0.95 0.48 0.91 0.92 0.86 0.91 0.89 0.88 0.91 0.92 0.90 0.93 0.87 0.72 0.85 0.82 0.87 0.71 0.93 0.76 0.32 0.94 0.88 0.90 0.92 0.83 0.92 0.76 0.36 0.36 0.92

SPATA22_2 (-880) 0.81 0.88 0.91 0.93 0.50 0.92 0.89 0.89 0.90 0.89 0.90 0.92 0.89 0.88 0.90 0.88 0.59 0.82 0.76 0.85 0.85 0.89 0.84 0.42 0.94 0.83 0.91 0.94 0.84 0.79 0.82 0.38 0.47 0.91

SPATA22_3 (-562) 0.80 0.93 0.90 0.87 0.57 0.95 0.92 0.81 0.91 0.91 0.81 0.72 0.84 0.89 0.94 0.88 0.53 0.83 0.59 0.69 0.64 0.93 0.35 0.53 0.87 0.59 0.88 0.80 0.74 0.51 0.49 0.54 0.58 0.77

SPATA22_4 (-556) 0.69 0.88 0.82 0.84 0.48 0.83 0.83 0.73 0.82 0.82 0.61 0.60 0.75 0.83 0.89 0.83 0.53 0.75 0.51 0.41 0.58 0.81 0.36 0.43 0.77 0.55 0.79 0.51 0.70 0.52 0.48 0.52 0.40 0.45

SPATA22_5 (-535) 0.74 0.87 0.69 0.84 0.45 0.87 0.88 0.79 0.87 0.88 0.64 0.63 0.84 0.85 0.88 0.87 0.57 0.80 0.61 0.67 0.57 0.73 0.59 0.53 0.88 0.58 0.67 0.84 0.76 0.59 0.55 0.47 0.59 0.73

SPATA22_6 (-430) 0.50 0.87 0.52 0.77 0.37 0.74 0.88 0.73 0.88 0.86 0.67 0.63 0.81 0.84 0.90 0.88 0.51 0.66 0.49 0.59 0.50 0.86 0.53 0.54 0.89 0.53 0.77 0.84 0.58 0.50 0.56 0.23 0.23 0.56

SPATA22_7 (-197) 0.84 0.91 0.77 0.88 0.27 0.89 0.91 0.89 0.90 0.88 0.84 0.87 0.90 0.92 0.91 0.84 0.54 0.81 0.66 0.80 0.81 0.88 0.61 0.61 0.91 0.70 0.82 0.88 0.71 0.56 0.61 0.43 0.35 0.84

SPATA22_8 (-184) 0.73 0.90 0.77 0.90 0.36 0.82 0.87 0.88 0.89 0.87 0.86 0.86 0.86 0.89 0.92 0.81 0.57 0.85 0.82 0.84 0.62 0.90 0.72 0.89 0.86 0.88 0.86 0.72 0.79 0.70 0.77 0.32 0.48 0.91

SPATA22_9 (-172) 0.96 0.96 0.97 0.95 0.61 0.94 0.95 0.96 0.95 0.96 0.96 0.94 0.95 0.94 0.98 0.95 0.51 0.93 0.79 0.95 0.90 0.96 0.58 0.95 0.95 0.83 0.94 0.97 0.85 0.61 0.61 0.59 0.44 0.96

SPATA22_10 (-170) 0.96 0.97 0.96 0.97 0.59 0.96 0.97 0.95 0.96 0.97 0.96 0.95 0.96 0.97 0.97 0.94 0.50 0.95 0.77 0.97 0.92 0.98 0.59 0.96 0.97 0.80 0.91 0.97 0.87 0.57 0.58 0.48 0.52 0.97

SPATA22_11 (-4) 0.94 0.97 0.98 0.98 0.57 0.97 0.97 0.97 0.96 0.97 0.98 0.95 0.97 0.98 0.97 0.94 0.51 0.94 0.68 0.95 0.90 0.98 0.60 0.95 0.98 0.73 0.97 0.97 0.88 0.54 0.64 0.70 0.71 0.98

SPATA22_12 (68) 0.62 0.84 0.71 0.83 0.38 0.81 0.83 0.69 0.84 0.85 0.76 0.68 0.80 0.82 0.85 0.80 0.66 0.75 0.58 0.74 0.61 0.85 0.46 0.76 0.84 0.63 0.83 0.79 0.82 0.60 0.60 0.63 0.44 0.85

SPATA22_13 (135) 0.57 0.93 0.66 0.86 0.46 0.79 0.86 0.89 0.80 0.77 0.52 0.69 0.88 0.84 0.79 0.90 0.50 0.86 0.48 0.36 0.60 0.80 0.32 0.51 0.89 0.52 0.78 0.85 0.72 0.45 0.47 0.57 0.39 0.45

SPATC1_1 (-627) 0.90 0.92 0.66 0.63 0.45 0.71 0.91 0.85 0.94 0.86 0.90 0.87 0.81 0.90 0.81 0.86 0.62 0.84 0.49 0.83 0.71 0.94 0.44 0.38 0.69 0.55 0.83 0.90 0.69 0.61 0.50 0.32 0.26 0.89

SPERT_1 (-348) 0.86 0.83 0.83 0.56 0.30 0.87 0.87 0.90 0.81 0.81 0.87 0.75 0.86 0.77 0.86 0.86 0.72 0.63 0.85 0.87 0.86 0.91 0.82 0.58 0.78 0.91 0.85 0.89 0.90 0.83 0.79 0.29 0.50 0.89

SPZ1_1 (-329) 0.72 0.89 0.74 0.89 0.30 0.91 0.88 0.90 0.86 0.85 0.88 0.87 0.82 0.82 0.88 0.85 0.74 0.68 0.76 0.76 0.78 0.90 0.50 0.87 0.63 0.80 0.73 0.89 0.76 0.57 0.56 0.24 0.51 0.84

STK31_1 (-304) 0.85 0.85 0.91 0.86 0.30 0.88 0.91 0.87 0.88 0.79 0.89 0.82 0.70 0.84 0.87 0.86 0.91 0.71 0.81 0.87 0.86 0.91 0.83 0.51 0.80 0.85 0.85 0.92 0.82 0.84 0.72 0.92 0.22 0.92

STK31_2 (-230) 0.86 0.93 0.86 0.90 0.34 0.89 0.89 0.87 0.86 0.89 0.90 0.89 0.77 0.80 0.87 0.85 0.85 0.84 0.83 0.86 0.87 0.90 0.93 0.89 0.91 0.93 0.92 0.89 0.89 0.91 0.93 0.40 0.51 0.90

STK31_3 (-198) 0.94 0.91 0.95 0.94 0.50 0.95 0.94 0.94 0.95 0.88 0.97 0.95 0.91 0.92 0.96 0.89 0.95 0.88 0.94 0.91 0.93 0.96 0.93 0.90 0.95 0.95 0.94 0.93 0.94 0.94 0.94 0.40 0.26 0.95

STK31_4 (-170) 0.91 0.91 0.94 0.92 0.49 0.92 0.91 0.84 0.85 0.80 0.91 0.91 0.86 0.92 0.89 0.89 0.93 0.80 0.90 0.89 0.88 0.95 0.89 0.90 0.83 0.92 0.89 0.93 0.88 0.88 0.86 0.43 0.69 0.92

STK31_5 (-97) 0.92 0.91 0.94 0.90 0.57 0.94 0.87 0.90 0.87 0.91 0.91 0.91 0.89 0.92 0.90 0.88 0.93 0.85 0.88 0.89 0.88 0.91 0.90 0.74 0.92 0.92 0.93 0.92 0.93 0.89 0.88 0.49 0.39 0.94

STK31_6 (15) 0.97 0.98 0.98 0.98 0.48 0.98 0.99 0.99 0.98 0.98 0.98 0.96 0.98 0.99 0.98 0.96 0.99 0.97 0.98 0.97 0.98 0.98 0.98 0.99 0.99 0.99 0.98 0.99 0.98 0.98 0.97 0.99 0.49 0.99

STK31_7 (48) 0.86 0.85 0.87 0.88 0.37 0.86 0.84 0.85 0.85 0.85 0.87 0.87 0.85 0.84 0.86 0.80 0.86 0.78 0.82 0.81 0.79 0.85 0.87 0.85 0.87 0.86 0.87 0.85 0.86 0.85 0.83 0.45 0.34 0.89

STK31_8 (105) 0.89 0.91 0.94 0.92 0.71 0.93 0.89 0.92 0.91 0.88 0.89 0.90 0.89 0.88 0.93 0.84 0.91 0.84 0.85 0.89 0.84 0.93 0.90 0.81 0.94 0.93 0.92 0.92 0.94 0.88 0.88 0.96 0.58 0.95

STK31_9 (140) 0.96 0.96 0.97 0.98 0.53 0.98 0.97 0.95 0.98 0.96 0.97 0.97 0.96 0.95 0.97 0.96 0.97 0.95 0.96 0.96 0.96 0.98 0.97 0.87 0.97 0.98 0.98 0.97 0.94 0.94 0.93 0.49 0.53 0.98

125

STK31_10 (154) 0.96 0.95 0.98 0.95 0.43 0.97 0.97 0.97 0.96 0.96 0.98 0.94 0.96 0.93 0.93 0.95 0.97 0.95 0.96 0.95 0.96 0.97 0.95 0.94 0.97 0.98 0.96 0.95 0.97 0.95 0.94 0.51 0.38 0.96

STK31_11 (244) 0.85 0.88 0.91 0.92 0.51 0.91 0.91 0.89 0.86 0.87 0.89 0.90 0.85 0.83 0.92 0.86 0.90 0.86 0.84 0.88 0.83 0.91 0.89 0.83 0.93 0.92 0.90 0.88 0.89 0.92 0.86 0.53 0.29 0.92

STK31_12 (248) 0.90 0.93 0.93 0.94 0.46 0.93 0.91 0.90 0.92 0.90 0.91 0.91 0.90 0.91 0.90 0.85 0.93 0.83 0.90 0.87 0.86 0.94 0.92 0.83 0.92 0.92 0.92 0.90 0.93 0.92 0.86 0.43 0.25 0.93

TCP11_1 (-536) 0.73 0.88 0.83 0.85 0.54 0.87 0.86 0.53 0.88 0.87 0.81 0.89 0.86 0.89 0.87 0.79 0.90 0.68 0.84 0.85 0.86 0.89 0.89 0.32 0.85 0.88 0.89 0.89 0.91 0.86 0.83 0.87 0.48 0.89

TCP11_2 (-362) 0.71 0.88 0.64 0.81 0.46 0.75 0.86 0.82 0.86 0.75 0.75 0.89 0.76 0.83 0.88 0.81 0.84 0.66 0.74 0.78 0.85 0.92 0.86 0.37 0.79 0.78 0.84 0.86 0.84 0.77 0.81 0.77 0.36 0.86

TCP11_3 (-299) 0.73 0.91 0.85 0.73 0.43 0.75 0.85 0.74 0.82 0.61 0.54 0.78 0.47 0.88 0.80 0.78 0.79 0.59 0.65 0.50 0.85 0.84 0.72 0.27 0.56 0.69 0.76 0.70 0.71 0.69 0.70 0.61 0.53 0.54

TCP11_4 (-249) 0.96 0.95 0.98 0.98 0.44 0.98 0.97 0.92 0.97 0.74 0.86 0.97 0.63 0.97 0.96 0.96 0.98 0.74 0.94 0.70 0.96 0.97 0.93 0.37 0.96 0.96 0.98 0.98 0.96 0.97 0.91 0.62 0.43 0.77

TCP11_5 (-212) 0.84 0.95 0.91 0.92 0.47 0.92 0.93 0.82 0.90 0.66 0.75 0.92 0.49 0.91 0.91 0.91 0.93 0.62 0.70 0.53 0.88 0.93 0.69 0.31 0.84 0.76 0.92 0.90 0.90 0.90 0.72 0.46 0.49 0.56

TCP11_6 (1072) 0.66 0.89 0.57 0.85 0.35 0.48 0.46 0.75 0.66 0.71 0.76 0.83 0.72 0.71 0.73 0.83 0.57 0.70 0.62 0.70 0.58 0.85 0.55 0.26 0.71 0.64 0.57 0.87 0.54 0.54 0.66 0.40 0.35 0.78

TKTL1_1 (-710) 0.82 0.92 0.67 0.74 0.59 0.70 0.77 0.49 0.82 0.82 0.72 0.62 0.46 0.55 0.84 0.72 0.44 0.65 0.36 0.64 0.73 0.82 0.12 0.16 0.26 0.33 0.57 0.84 0.25 0.35 0.24 0.49 0.60 0.62

TKTL1_2 (-683) 0.77 0.92 0.82 0.89 0.45 0.88 0.95 0.72 0.81 0.84 0.92 0.93 0.90 0.78 0.82 0.85 0.67 0.82 0.56 0.43 0.83 0.93 0.37 0.37 0.82 0.58 0.79 0.91 0.54 0.57 0.46 0.30 0.48 0.36

TKTL1_3 (-652) 0.61 0.91 0.84 0.87 0.26 0.84 0.89 0.56 0.68 0.76 0.82 0.80 0.70 0.71 0.73 0.75 0.52 0.50 0.42 0.49 0.87 0.92 0.29 0.26 0.36 0.46 0.65 0.87 0.37 0.46 0.46 0.30 0.49 0.48

TKTL1_4 (-553) 0.61 0.82 0.62 0.89 0.66 0.72 0.50 0.47 0.49 0.60 0.79 0.84 0.69 0.63 0.29 0.74 0.42 0.45 0.31 0.41 0.81 0.78 0.20 0.16 0.23 0.32 0.56 0.66 0.26 0.28 0.17 0.60 0.61 0.34

TKTL1_5 (8204) 0.68 0.85 0.65 0.55 0.34 0.82 0.80 0.87 0.84 0.52 0.87 0.85 0.81 0.78 0.91 0.78 0.49 0.71 0.43 0.25 0.72 0.80 0.21 0.47 0.29 0.41 0.46 0.88 0.35 0.39 0.29 0.29 0.25 0.20

TKTL1_6 (8506) 0.91 0.94 0.88 0.91 0.31 0.93 0.92 0.90 0.92 0.93 0.92 0.91 0.91 0.91 0.95 0.87 0.62 0.87 0.79 0.84 0.90 0.93 0.51 0.75 0.95 0.85 0.80 0.91 0.85 0.63 0.54 0.47 0.24 0.89

TKTL2_1 (-1337) 0.84 0.64 0.77 0.47 0.37 0.87 0.83 0.79 0.71 0.74 0.56 0.56 0.55 0.72 0.42 0.85 0.73 0.64 0.74 0.55 0.72 0.91 0.67 0.39 0.82 0.81 0.60 0.77 0.78 0.87 0.72 0.36 0.34 0.53

TKTL2_2 (-1287) 0.85 0.87 0.92 0.91 0.45 0.92 0.86 0.90 0.86 0.88 0.77 0.83 0.83 0.91 0.87 0.86 0.74 0.85 0.90 0.85 0.81 0.91 0.75 0.92 0.90 0.94 0.93 0.79 0.90 0.90 0.77 0.34 0.32 0.94

TKTL2_3 (-241) 0.87 0.80 0.83 0.75 0.26 0.88 0.84 0.86 0.88 0.76 0.78 0.74 0.77 0.70 0.74 0.90 0.69 0.69 0.83 0.82 0.88 0.90 0.75 0.35 0.91 0.86 0.64 0.86 0.87 0.88 0.71 0.36 0.51 0.88

TKTL2_4 (-47) 0.68 0.74 0.88 0.54 0.48 0.79 0.92 0.72 0.78 0.59 0.51 0.77 0.44 0.83 0.29 0.68 0.59 0.67 0.72 0.38 0.49 0.96 0.26 0.26 0.69 0.72 0.42 0.88 0.82 0.46 0.34 0.50 0.49 0.34

TKTL2_5 (7) 0.82 0.94 0.94 0.60 0.43 0.92 0.96 0.79 0.81 0.77 0.85 0.77 0.68 0.75 0.88 0.71 0.58 0.72 0.71 0.50 0.75 0.98 0.33 0.36 0.90 0.75 0.62 0.97 0.93 0.51 0.42 0.44 0.43 0.47

TKTL2_6 (148) 0.97 0.99 0.99 0.86 0.46 0.96 0.99 0.84 0.98 0.96 0.96 0.87 0.93 0.98 0.97 0.76 0.66 0.93 0.84 0.87 0.95 0.99 0.41 0.42 0.99 0.83 0.73 0.98 0.98 0.65 0.51 0.51 0.52 0.91

TKTL2_7 (224) 0.89 0.89 0.90 0.81 0.34 0.91 0.89 0.85 0.86 0.88 0.89 0.86 0.92 0.81 0.90 0.81 0.67 0.83 0.81 0.66 0.81 0.93 0.51 0.57 0.91 0.88 0.75 0.86 0.89 0.74 0.60 0.34 0.27 0.67

TKTL2_8 (230) 0.90 0.86 0.87 0.77 0.39 0.90 0.91 0.86 0.91 0.90 0.84 0.85 0.90 0.87 0.92 0.85 0.69 0.85 0.83 0.70 0.84 0.94 0.49 0.55 0.93 0.89 0.80 0.89 0.89 0.72 0.61 0.36 0.37 0.69

TKTL2_9 (360) 0.80 0.82 0.84 0.73 0.49 0.73 0.83 0.82 0.84 0.82 0.81 0.77 0.74 0.75 0.83 0.79 0.57 0.78 0.73 0.77 0.74 0.86 0.36 0.35 0.85 0.82 0.63 0.86 0.78 0.54 0.47 0.33 0.61 0.78

TKTL2_10 (1244) 0.70 0.42 0.59 0.41 0.39 0.76 0.84 0.71 0.81 0.66 0.42 0.41 0.51 0.71 0.48 0.81 0.67 0.53 0.69 0.29 0.54 0.87 0.83 0.45 0.86 0.74 0.57 0.59 0.81 0.64 0.71 0.31 0.29 0.21

TPTE_1 (-563) 0.72 0.78 0.62 0.47 0.47 0.57 0.89 0.65 0.91 0.70 0.43 0.70 0.52 0.76 0.64 0.71 0.63 0.62 0.57 0.47 0.37 0.82 0.53 0.45 0.50 0.54 0.66 0.73 0.35 0.52 0.49 0.73 0.56 0.48

TPTE_2 (-493) 0.90 0.85 0.90 0.81 0.58 0.85 0.89 0.86 0.92 0.90 0.75 0.84 0.80 0.89 0.92 0.87 0.73 0.82 0.69 0.78 0.75 0.93 0.71 0.87 0.91 0.75 0.89 0.93 0.40 0.59 0.65 0.43 0.60 0.82

TPTE_3 (2848) 0.74 0.56 0.70 0.69 0.34 0.62 0.93 0.84 0.55 0.74 0.63 0.68 0.60 0.77 0.52 0.52 0.83 0.60 0.77 0.49 0.58 0.85 0.79 0.61 0.69 0.82 0.77 0.65 0.89 0.89 0.76 0.27 0.48 0.47

TSGA13_1 (-1402) 0.78 0.77 0.69 0.61 0.30 0.72 0.91 0.87 0.87 0.72 0.93 0.73 0.63 0.83 0.90 0.86 0.69 0.69 0.78 0.87 0.82 0.92 0.76 0.39 0.73 0.85 0.83 0.90 0.88 0.56 0.60 0.42 0.42 0.87

TSGA13_2 (109) 0.62 0.78 0.63 0.41 0.37 0.69 0.82 0.75 0.79 0.54 0.82 0.39 0.59 0.71 0.88 0.85 0.64 0.44 0.61 0.69 0.71 0.92 0.40 0.30 0.54 0.66 0.66 0.87 0.75 0.39 0.42 0.26 0.33 0.78

126

TUBA3C_1 (-970) 0.88 0.88 0.84 0.76 0.54 0.72 0.90 0.86 0.81 0.69 0.62 0.50 0.84 0.83 0.83 0.82 0.65 0.80 0.72 0.68 0.56 0.86 0.54 0.73 0.49 0.79 0.78 0.74 0.38 0.57 0.58 0.34 0.54 0.76

TUBA3C_2 (-187) 0.90 0.92 0.70 0.75 0.30 0.81 0.91 0.83 0.73 0.61 0.71 0.55 0.81 0.76 0.92 0.87 0.71 0.82 0.63 0.63 0.47 0.90 0.53 0.68 0.35 0.70 0.71 0.67 0.35 0.51 0.61 0.35 0.37 0.58

TUBA3C_3 (-115) 0.89 0.91 0.68 0.45 0.56 0.50 0.93 0.79 0.82 0.65 0.40 0.32 0.84 0.70 0.93 0.88 0.57 0.82 0.48 0.37 0.53 0.88 0.41 0.48 0.32 0.48 0.54 0.56 0.31 0.46 0.46 0.34 0.44 0.32

TUBA3C_4 (-103) 0.89 0.91 0.61 0.42 0.49 0.49 0.87 0.74 0.81 0.55 0.42 0.33 0.79 0.70 0.93 0.86 0.58 0.81 0.50 0.33 0.42 0.89 0.30 0.43 0.32 0.51 0.52 0.59 0.34 0.46 0.38 0.12 0.30 0.26

TUBA3C_5 (-87) 0.82 0.88 0.60 0.47 0.29 0.55 0.89 0.65 0.77 0.61 0.54 0.47 0.77 0.75 0.90 0.85 0.61 0.82 0.53 0.47 0.47 0.88 0.47 0.46 0.31 0.52 0.54 0.69 0.33 0.42 0.49 0.49 0.28 0.44

TUBA3C_6 (-19) 0.96 0.97 0.85 0.83 0.43 0.96 0.97 0.94 0.97 0.94 0.93 0.81 0.93 0.95 0.98 0.95 0.62 0.96 0.61 0.84 0.60 0.98 0.53 0.87 0.85 0.66 0.74 0.96 0.42 0.52 0.52 0.66 0.67 0.88

TUBA3C_7 (19) 0.96 0.96 0.88 0.98 0.42 0.98 0.98 0.97 0.97 0.98 0.97 0.95 0.98 0.96 0.98 0.96 0.61 0.97 0.67 0.96 0.73 0.97 0.41 0.84 0.98 0.71 0.95 0.97 0.27 0.49 0.51 0.72 0.56 0.98

TUBA3C_8 (35) 0.82 0.86 0.76 0.79 0.47 0.80 0.85 0.83 0.86 0.82 0.67 0.79 0.79 0.73 0.84 0.77 0.69 0.77 0.62 0.65 0.62 0.87 0.49 0.54 0.86 0.66 0.72 0.75 0.42 0.51 0.58 0.31 0.40 0.77

TXNDC3_1 (-44) 0.88 0.75 0.84 0.82 0.30 0.91 0.94 0.93 0.84 0.88 0.92 0.64 0.70 0.89 0.93 0.91 0.60 0.71 0.48 0.54 0.54 0.91 0.52 0.50 0.42 0.47 0.93 0.94 0.41 0.93 0.57 0.48 0.44 0.55

TXNDC3_2 (367) 0.65 0.84 0.79 0.65 0.51 0.93 0.97 0.87 0.79 0.88 0.94 0.40 0.63 0.83 0.74 0.92 0.72 0.74 0.51 0.68 0.88 0.97 0.58 0.56 0.54 0.52 0.92 0.81 0.30 0.86 0.58 0.64 0.51 0.68

TXNDC3_3 (472) 0.58 0.75 0.77 0.79 0.57 0.89 0.91 0.83 0.81 0.73 0.85 0.38 0.66 0.81 0.42 0.84 0.63 0.66 0.64 0.66 0.79 0.94 0.80 0.59 0.75 0.68 0.90 0.72 0.31 0.88 0.76 0.35 0.48 0.68

TXNDC3_4 (547) 0.75 0.90 0.92 0.91 0.39 0.94 0.90 0.91 0.90 0.87 0.85 0.82 0.74 0.89 0.90 0.86 0.91 0.74 0.71 0.81 0.84 0.92 0.88 0.76 0.89 0.75 0.93 0.91 0.43 0.91 0.81 0.46 0.43 0.85

VCX2_1 (-644) 0.71 0.79 0.83 0.93 0.52 0.90 0.91 0.66 0.42 0.75 0.56 0.83 0.71 0.81 0.49 0.80 0.68 0.61 0.60 0.43 0.83 0.88 0.74 0.40 0.86 0.72 0.87 0.31 0.44 0.68 0.63 0.43 0.57 0.42

VCX2_2 (117) 0.87 0.88 0.83 0.72 0.36 0.89 0.94 0.88 0.88 0.88 0.90 0.96 0.81 0.87 0.95 0.83 0.61 0.81 0.57 0.87 0.91 0.94 0.78 0.77 0.90 0.56 0.88 0.88 0.39 0.59 0.70 0.45 0.48 0.92

VWA5B1_1 (-971) 0.57 0.77 0.64 0.48 0.55 0.66 0.90 0.89 0.90 0.75 0.45 0.90 0.71 0.85 0.32 0.78 0.62 0.66 0.51 0.51 0.41 0.78 0.70 0.37 0.32 0.52 0.61 0.87 0.40 0.33 0.61 0.36 0.35 0.51

VWA5B1_2 (-915) 0.52 0.81 0.75 0.60 0.58 0.75 0.86 0.87 0.78 0.77 0.45 0.91 0.71 0.84 0.36 0.83 0.47 0.66 0.69 0.79 0.68 0.76 0.79 0.34 0.40 0.67 0.72 0.88 0.38 0.33 0.68 0.43 0.22 0.83

WBSCR28_1 (-172) 0.89 0.84 0.70 0.73 0.34 0.88 0.89 0.85 0.86 0.85 0.86 0.87 0.89 0.85 0.91 0.88 0.64 0.83 0.78 0.83 0.83 0.89 0.77 0.56 0.92 0.82 0.76 0.91 0.71 0.56 0.75 0.42 0.49 0.87

WBSCR28_2 (-140) 0.84 0.82 0.66 0.79 0.53 0.82 0.85 0.80 0.88 0.79 0.80 0.86 0.86 0.79 0.89 0.79 0.61 0.72 0.73 0.70 0.81 0.88 0.64 0.33 0.86 0.78 0.63 0.84 0.63 0.58 0.70 0.40 0.48 0.71

XAGE3_1 (-431) 0.49 0.74 0.47 0.86 0.58 0.69 0.90 0.65 0.42 0.73 0.47 0.41 0.71 0.65 0.37 0.81 0.58 0.62 0.50 0.29 0.36 0.88 0.22 0.52 0.39 0.45 0.54 0.53 0.26 0.34 0.37 0.43 0.51 0.29

XAGE3_2 (-42) 0.83 0.83 0.60 0.67 0.46 0.69 0.92 0.80 0.78 0.77 0.57 0.58 0.83 0.80 0.69 0.85 0.52 0.73 0.55 0.58 0.59 0.89 0.44 0.57 0.51 0.51 0.61 0.85 0.37 0.38 0.46 0.95 0.36 0.61

XAGE3_3 (344) 0.56 0.83 0.65 0.89 0.58 0.70 0.93 0.87 0.78 0.89 0.53 0.55 0.79 0.75 0.91 0.94 0.58 0.75 0.53 0.41 0.51 0.95 0.49 0.60 0.46 0.54 0.56 0.73 0.46 0.48 0.51 0.42 0.43 0.41

ZDHHC19_1 (-1313) 0.82 0.87 0.86 0.91 0.47 0.88 0.89 0.73 0.87 0.84 0.84 0.88 0.80 0.87 0.85 0.87 0.92 0.86 0.76 0.86 0.83 0.89 0.81 0.31 0.88 0.83 0.86 0.88 0.83 0.80 0.81 0.41 0.61 0.89

ZDHHC19_2 (98) 0.84 0.85 0.60 0.81 0.63 0.59 0.83 0.72 0.70 0.61 0.79 0.77 0.72 0.74 0.81 0.87 0.55 0.75 0.47 0.53 0.63 0.86 0.41 0.33 0.40 0.45 0.59 0.86 0.52 0.53 0.53 0.59 0.66 0.53

ZDHHC19_3 (251) 0.90 0.87 0.72 0.88 0.47 0.79 0.88 0.75 0.84 0.77 0.90 0.90 0.85 0.89 0.89 0.83 0.70 0.79 0.60 0.69 0.75 0.92 0.67 0.34 0.65 0.65 0.87 0.90 0.67 0.77 0.72 0.43 0.29 0.75

ZNF540_1 (-47824) 0.51 0.56 0.51 0.73 0.61 0.69 0.87 0.66 0.88 0.84 0.88 0.63 0.58 0.86 0.90 0.59 0.87 0.62 0.43 0.83 0.56 0.88 0.34 0.72 0.49 0.45 0.84 0.63 0.32 0.40 0.44 0.34 0.42 0.88

ZNF540_2 (-168) 0.43 0.34 0.52 0.68 0.49 0.56 0.86 0.69 0.75 0.66 0.86 0.78 0.54 0.84 0.31 0.86 0.76 0.52 0.46 0.85 0.74 0.67 0.49 0.48 0.77 0.44 0.77 0.49 0.44 0.53 0.51 0.35 0.38 0.90

ZNF876P_1 (-275) 0.82 0.86 0.76 0.81 0.55 0.87 0.87 0.89 0.84 0.85 0.72 0.85 0.52 0.73 0.85 0.88 0.79 0.77 0.42 0.89 0.78 0.88 0.24 0.62 0.79 0.35 0.82 0.85 0.36 0.26 0.30 0.54 0.51 0.84

127

Table S10: List of 26 genes associated with poor survival in lung cancer and results of univariate analysis of association with prognosis in our lung cancer patients.

GeneSymbol p-value HR ISM2 <0.0001 7.21 PIWIL1 <0.0001 5.36 ROPN1 <0.0001 4.67 LGALS14 0.001 4.64 EBI3 0.001 4.23 LOC441601 0.007 3.67 BTG4 0.007 3.64 TUBA3C <0.0001 3.62 C10orf82 0.001 3.46 FLJ43944 0.013 3.29 OR7E156P 0.016 3.18 VCY 0.018 3.13 Hs.601545 0.001 2.85 DPEP3 0.007 2.59 NBPF4 0.02 2.56 TPTE2P2 0.021 2.54 KIAA1257 0.002 2.49 C12orf37 0.017 2.44 TKTL2 0.019 2.19 CCDC83 0.02 2.18 HIST1H3C 0.003 2.14 RFX4 0.017 2.09 CPA5 0.011 2.06 RBM46 0.046 2.04 MAGEB6 <0.0001 1.78 TPTE 0.012 1.65

p-value: significance of difference in cumulative global survival probabilities over 5 years between patients expressing the gene and those not expressing the gene (Logrank test)

HR = hazard ratio (risk of death over 5 years)

128

Table S11. HRs from the Cox regression model testing the association with prognosis in our set of 26 genes in a multivariate analysis,

along with pathological data and TNM stages.

Covariate (reference value)

coef HR (exp(coef)) 95% CI p-value

Histological subtypes (ADC)

BAS 0.18353 1.20 0.72 - 2.01 0.484

LCNE 0.01957 1.02 0.64 - 1.63 0.934

SQC 0.09035 1.09 0.68 - 1.77 0.711

Other -0.18996 0.83 0.35 - 1.94 0.663

T stage (T1)

T+ 0.34831 1.42 0.94 - 2.15 0.100

N stage (N0)

N+ 0.59702 1.82 1.21 - 2.74 0.004 **

Prognostic groups (P1)

P2 0.42159 1.52 1.00 - 2.32 0.049 *

P3 1.73607 5.68 3.47 - 9.28 4.49E-12 ***

number of observations, n= 293

Rsquare = 0.286 (max possible= 0.996 )

Likelihood ratio test = 98.78 on 8 degrees of freedom (df), p=0

Wald test = 107.4 on 8 df, p=0

Score (logrank) test= 133.9 on 8 df, p=0

129

Table S12. List of the 3272 genes that are differentially expressed

between patients classified by our 26 TS/PS genes in the good prognostic group (P1)

and patients in the poor prognostic group (P3).

Affymetrix probe set Gene Symbol UniGene ID

Up or Down in P3 versus P1

Fold change P3

versus P1

209942_x_at MAGEA3 Hs.417816 up 18.07 214612_x_at MAGEA6 Hs.441113 up 17.56 209988_s_at ASCL1 Hs.704281 up 15.74 242601_at HEPACAM2 Hs.443169 up 13.89 206502_s_at INSM1 Hs.89584 up 10.25 210467_x_at MAGEA12 Hs.169246 up 9.02 214603_at MAGEA2B Hs.534597 up 7.79 205347_s_at TMSB15A Hs.56145 up 6.71 206018_at FOXG1 Hs.695962 up 6.59 204086_at PRAME Hs.30743 up 6.02 228245_s_at OVOS Hs.568152 up 5.96 223381_at NUF2 Hs.651950 up 5.41 217561_at CALCA Hs.37058 up 5.28 226446_at HES6 Hs.42949 up 5.27 214642_x_at MAGEA5 Hs.668021 up 5.12 206135_at ST18 Hs.655499 up 4.81 219148_at PBK Hs.104741 up 4.71 211674_x_at CTAG1B Hs.719437 up 4.66 201291_s_at TOP2A Hs.156346 up 4.61 202870_s_at CDC20 Hs.524947 up 4.60 204822_at TTK Hs.169840 up 4.59 211071_s_at MLLT11 Hs.75823 up 4.58 202095_s_at BIRC5 Hs.514527 up 4.52 225834_at FAM72D Hs.535577 up 4.49 230720_at RNF182 Hs.111164 up 4.47 206104_at ISL1 Hs.505 up 4.43 220445_s_at CSAG3 Hs.522810 up 4.43 206102_at GINS1 Hs.658464 up 4.42 203764_at DLGAP5 Hs.77695 up 4.41 236302_at PPM1E Hs.245044 up 4.40 204641_at NEK2 Hs.153704 up 4.39 210052_s_at TPX2 Hs.719145 up 4.38

130

207828_s_at CENPF Hs.497741 up 4.27 235700_at CT45A5 Hs.535081 up 4.20 209891_at SPC25 Hs.421956 up 4.15 1567912_s_at CT45A2 Hs.632281 up 4.14 203130_s_at KIF5C Hs.660699 up 4.14 201387_s_at UCHL1 Hs.518731 up 4.11 207147_at DLX2 Hs.419 up 4.09 228033_at E2F7 Hs.416375 up 4.08 222958_s_at DEPDC1 Hs.445098 up 4.04 205825_at PCSK1 Hs.78977 up 4.03 209642_at BUB1 Hs.469649 up 4.03 210432_s_at SCN3A Hs.435274 up 4.03 205034_at CCNE2 Hs.567387 up 4.03 203999_at SYT1 Hs.310545 up 4.02 226980_at DEPDC1B Hs.677180 up 4.01 242138_at DLX1 Hs.407015 up 3.99 202954_at UBE2C Hs.93002 up 3.96 228273_at Hs.633096 Hs.633096 up 3.94 203820_s_at IGF2BP3 Hs.700696 up 3.90 218663_at NCAPG Hs.567567 up 3.90 206282_at NEUROD1 Hs.709709 up 3.90 204318_s_at GTSE1 Hs.386189 up 3.89 219918_s_at ASPM Hs.121028 up 3.88 202779_s_at UBE2S Hs.396393 up 3.88 242940_x_at DLX6 Hs.249196 up 3.87 204962_s_at CENPA Hs.1594 up 3.86 202705_at CCNB2 Hs.194698 up 3.85 205184_at GNG4 Hs.159711 up 3.82 204146_at RAD51AP1 Hs.719194 up 3.80 221521_s_at GINS2 Hs.433180 up 3.80 204162_at NDC80 Hs.414407 up 3.78 213599_at OIP5 Hs.661645 up 3.76 218332_at BEX1 Hs.334370 up 3.73 203358_s_at EZH2 Hs.444082 up 3.70 203755_at BUB1B Hs.631699 up 3.69 206373_at ZIC1 Hs.647962 up 3.68 228038_at SOX2 Hs.518438 up 3.67 219196_at SCG3 Hs.232618 up 3.67 202580_x_at FOXM1 Hs.239 up 3.63 228335_at CLDN11 Hs.31595 up 3.59 220651_s_at MCM10 Hs.198363 up 3.59 204825_at MELK Hs.184339 up 3.57

131

203362_s_at MAD2L1 Hs.591697 up 3.57 201890_at RRM2 Hs.226390 up 3.57 218355_at KIF4A Hs.648326 up 3.56 218039_at NUSAP1 Hs.615092 up 3.55 206915_at NKX2-2 Hs.516922 up 3.54 214933_at CACNA1A Hs.501632 up 3.54 206023_at NMU Hs.418367 up 3.53 205311_at DDC Hs.359698 up 3.53 219537_x_at DLL3 Hs.127792 up 3.51 236641_at KIF14 Hs.3104 up 3.51 207739_s_at GAGE12J Hs.709908 up 3.50 228656_at PROX1 Hs.585369 up 3.49 209408_at KIF2C Hs.69360 up 3.47 226809_at LOC100216479 Hs.131740 up 3.46 225655_at UHRF1 Hs.108106 up 3.45 226612_at UBE2QL1 Hs.126856 up 3.43 227174_at WDR72 Hs.122125 up 3.43 209859_at TRIM9 Hs.654750 up 3.42 204603_at EXO1 Hs.498248 up 3.40 207325_x_at MAGEA1 Hs.72879 up 3.40 209464_at AURKB Hs.442658 up 3.39 203418_at CCNA2 Hs.58974 up 3.37 204260_at CHGB Hs.516874 up 3.37 227711_at GTSF1 Hs.524476 up 3.36 229288_at EPHA7 Hs.73962 up 3.36 228729_at CCNB1 Hs.23960 up 3.33 228658_at MIAT Hs.517502 up 3.31 242350_s_at LOC100128098 Hs.530588 up 3.31 228323_at CASC5 Hs.181855 up 3.29 218009_s_at PRC1 Hs.567385 up 3.29 203213_at CDK1 Hs.334562 up 3.28 203967_at CDC6 Hs.405958 up 3.28 212843_at NCAM1 Hs.503878 up 3.27 204709_s_at KIF23 Hs.270845 up 3.26 204817_at ESPL1 Hs.153479 up 3.26 205830_at CLGN Hs.86368 up 3.26 218726_at HJURP Hs.532968 up 3.26 202589_at TYMS Hs.592338 up 3.25 218585_s_at DTL Hs.656473 up 3.25 203440_at CDH2 Hs.464829 up 3.24 204444_at KIF11 Hs.8878 up 3.23 219000_s_at DSCC1 Hs.315167 up 3.23

132

223229_at UBE2T Hs.5199 up 3.23 205393_s_at CHEK1 Hs.24529 up 3.20 221591_s_at FAM64A Hs.592116 up 3.20 202016_at MEST Hs.270978 up 3.20 224753_at CDCA5 Hs.434886 up 3.19 223529_at SYT4 Hs.8059 up 3.18 205122_at TMEFF1 Hs.598100 up 3.16 208079_s_at AURKA Hs.250822 up 3.16 204033_at TRIP13 Hs.436187 up 3.16 225687_at FAM83D Hs.472716 up 3.16 1555758_a_at CDKN3 Hs.84113 up 3.15 219306_at KIF15 Hs.646856 up 3.15 227760_at IGFBPL1 Hs.349705 up 3.12 229349_at LIN28B Hs.23616 up 3.12 218755_at KIF20A Hs.718626 up 3.12 202107_s_at MCM2 Hs.477481 up 3.12 228260_at ELAVL2 Hs.166109 up 3.11 222039_at KIF18B Hs.135094 up 3.11 222077_s_at RACGAP1 Hs.505469 up 3.09 205229_s_at COCH Hs.21016 up 3.09 219555_s_at CENPN Hs.55028 up 3.09 203145_at SPAG5 Hs.514033 up 3.08 204798_at MYB Hs.654446 up 3.07 215733_x_at CTAG2 Hs.713312 up 3.07 223307_at CDCA3 Hs.524216 up 3.04 226936_at CENPW Hs.486401 up 3.04 206376_at SLC6A15 Hs.44424 up 3.03 203560_at GGH Hs.78619 up 3.03 226610_at CENPV Hs.433422 up 3.03 204026_s_at ZWINT Hs.591363 up 3.02 213007_at FANCI Hs.513126 up 3.02 229823_at Hs.709812 Hs.709812 up 3.00 205268_s_at ADD2 Hs.188528 up 2.98 205719_s_at PAH Hs.643451 up 2.97 213712_at ELOVL2 Hs.656436 up 2.97 223062_s_at PSAT1 Hs.494261 up 2.97 238756_at GAS2L3 Hs.20575 up 2.97 227928_at C12orf48 Hs.330663 up 2.97 201896_s_at PSRC1 Hs.405925 up 2.95 203022_at RNASEH2A Hs.532851 up 2.94 228988_at ZNF711 Hs.326801 up 2.93 208235_x_at GAGE7 Hs.460641 up 2.92

133

241833_at Hs.235331 Hs.235331 up 2.92 218883_s_at MLF1IP Hs.575032 up 2.91 226473_at CBX2 Hs.368410 up 2.91 217640_x_at SKA1 Hs.134726 up 2.90 236681_at HOXD13 Hs.152414 up 2.90 1556444_a_at Hs.60681 Hs.60681 up 2.90 226661_at CDCA2 Hs.33366 up 2.90 203554_x_at PTTG1 Hs.350966 up 2.89 218875_s_at FBXO5 Hs.520506 up 2.87 201761_at MTHFD2 Hs.469030 up 2.86 213707_s_at DLX5 Hs.99348 up 2.86 242881_x_at Hs.537370 Hs.537370 up 2.85 211341_at POU4F1 Hs.654522 up 2.85 210567_s_at SKP2 Hs.23348 up 2.84 229400_at HOXD10 Hs.123070 up 2.84 204126_s_at CDC45 Hs.474217 up 2.84 213921_at SST Hs.12409 up 2.83 212949_at NCAPH Hs.308045 up 2.83 221258_s_at KIF18A Hs.301052 up 2.83 223642_at ZIC2 Hs.653700 up 2.82 204510_at CDC7 Hs.533573 up 2.82 209692_at EYA2 Hs.472877 up 2.80 204995_at CDK5R1 Hs.500015 up 2.80 223700_at MND1 Hs.294088 up 2.80 201710_at MYBL2 Hs.179718 up 2.79 222848_at CENPK Hs.529778 up 2.78 207267_s_at DSCR6 Hs.254560 up 2.77 230165_at SGOL2 Hs.655182 up 2.76 207165_at HMMR Hs.72550 up 2.76 219532_at ELOVL4 Hs.101915 up 2.76 204913_s_at SOX11 Hs.432638 up 2.75 221520_s_at CDCA8 Hs.524571 up 2.75 228956_at UGT8 Hs.144197 up 2.74 218542_at CEP55 Hs.14559 up 2.74 1562484_at C17orf104 Hs.349758 up 2.73 235904_at UGT3A1 Hs.254699 up 2.73 222608_s_at ANLN Hs.62180 up 2.73 203432_at TMPO Hs.11355 up 2.72 204127_at RFC3 Hs.115474 up 2.72 228069_at FAM54A Hs.121536 up 2.72 205339_at STIL Hs.525198 up 2.72 227952_at Hs.355711 Hs.355711 up 2.72

134

204649_at TROAP Hs.524399 up 2.70 227719_at SMAD9 Hs.123119 up 2.70 213248_at LOC730101 Hs.7921 up 2.70 210587_at INHBE Hs.632713 up 2.69 210437_at MAGEA9B Hs.512582 up 2.69 202503_s_at KIAA0101 Hs.81892 up 2.66 218782_s_at ATAD2 Hs.370834 up 2.66 219105_x_at ORC6L Hs.49760 up 2.66 1552368_at CTCFL Hs.131543 up 2.65 222036_s_at MCM4 Hs.460184 up 2.64 223556_at HELLS Hs.655830 up 2.64 242069_at CBX5 Hs.349283 up 2.64 214651_s_at HOXA9 Hs.659350 up 2.63 203046_s_at TIMELESS Hs.118631 up 2.63 203276_at LMNB1 Hs.89497 up 2.63 1553972_a_at CBS Hs.533013 up 2.62 224997_x_at H19 Hs.533566 up 2.62 205260_s_at ACYP1 Hs.18573 up 2.61 204720_s_at DNAJC6 Hs.647643 up 2.61 213967_at RALYL Hs.121663 up 2.61 200783_s_at STMN1 Hs.209983 up 2.60 218623_at HMP19 Hs.559412 up 2.60 224468_s_at C19orf48 Hs.256301 up 2.60 205625_s_at CALB1 Hs.65425 up 2.60 206533_at CHRNA5 Hs.1614 up 2.59 232760_at TEX15 Hs.458316 up 2.59 204767_s_at FEN1 Hs.409065 up 2.59 205053_at PRIM1 Hs.534339 up 2.59 226287_at CCDC34 Hs.143733 up 2.59 229490_s_at Hs.133294 Hs.133294 up 2.58 206089_at NELL1 Hs.657172 up 2.58 219990_at E2F8 Hs.523526 up 2.58 204558_at RAD54L Hs.642042 up 2.57 205551_at SV2B Hs.21754 up 2.57 201397_at PHGDH Hs.487296 up 2.57 227230_s_at KIAA1211 Hs.596667 up 2.56 204623_at TFF3 Hs.82961 up 2.56 204170_s_at CKS2 Hs.83758 up 2.56 1568604_a_at CADPS Hs.654933 up 2.55 218829_s_at CHD7 Hs.20395 up 2.54 224428_s_at CDCA7 Hs.470654 up 2.54 208808_s_at HMGB2 Hs.434953 up 2.54

135

214254_at MAGEA4 Hs.37107 up 2.54 219787_s_at ECT2 Hs.518299 up 2.53 220205_at TPTE Hs.122986 up 2.53 202718_at IGFBP2 Hs.438102 up 2.53 235609_at Hs.598759 Hs.598759 up 2.53 204521_at C12orf24 Hs.436618 up 2.52 242128_at OTX2 Hs.288655 up 2.52 209372_x_at TUBB2B Hs.654543 up 2.52 212020_s_at MKI67 Hs.80976 up 2.52 219370_at RPRM Hs.100890 up 2.52 211421_s_at RET Hs.350321 up 2.52 219494_at RAD54B Hs.30561 up 2.52 238549_at CBFA2T2 Hs.153934 up 2.52 218625_at NRN1 Hs.103291 up 2.51 235343_at VASH2 Hs.96885 up 2.51 234314_at RALGAPA2 Hs.472285 up 2.49 213150_at HOXA10 Hs.110637 up 2.49 213647_at DNA2 Hs.532446 up 2.48 219882_at TTLL7 Hs.445826 up 2.48 215228_at NHLH2 Hs.46296 up 2.47 205046_at CENPE Hs.75573 up 2.47 228564_at LOC375295 Hs.659070 up 2.46 233586_s_at KLK12 Hs.411572 up 2.46 214097_at RPS21 Hs.190968 up 2.46 229886_at C5orf34 Hs.661641 up 2.46 218350_s_at GMNN Hs.234896 up 2.46 205167_s_at CDC25C Hs.656 up 2.45 241224_x_at DSCR8 Hs.192371 up 2.45 214157_at GNAS Hs.125898 up 2.45 218115_at ASF1B Hs.26516 up 2.45 242283_at DNAH14 Hs.133977 up 2.45 219300_s_at CNTNAP2 Hs.655684 up 2.44 214058_at MYCL1 Hs.437922 up 2.44 204165_at WASF1 Hs.75850 up 2.44 205024_s_at RAD51 Hs.631709 up 2.44 205350_at CRABP1 Hs.346950 up 2.44 205909_at POLE2 Hs.162777 up 2.44 209900_s_at SLC16A1 Hs.75231 up 2.43 210983_s_at MCM7 Hs.438720 up 2.43 211042_x_at MCAM Hs.599039 up 2.43 204465_s_at INA Hs.500916 up 2.42 1569190_at SCLT1 Hs.654690 up 2.42

136

225081_s_at CDCA7L Hs.520245 up 2.42 219926_at POPDC3 Hs.458336 up 2.41 221909_at RNFT2 Hs.437195 up 2.41 204023_at RFC4 Hs.714318 up 2.41 242890_at Hs.658935 Hs.658935 up 2.40 229442_at C18orf54 Hs.208701 up 2.40 231772_x_at CENPH Hs.631967 up 2.39 224320_s_at MCM8 Hs.631506 up 2.39 213484_at Hs.66187 Hs.66187 up 2.38 238605_at NOL4 Hs.514795 up 2.37 201930_at MCM6 Hs.444118 up 2.37 206140_at LHX2 Hs.696425 up 2.37 207030_s_at CSRP2 Hs.530904 up 2.37 236075_s_at LOC100129673 Hs.660048 up 2.37 225482_at KIF1A Hs.516802 up 2.37 225767_at LOC284801 Hs.370699 up 2.36 220668_s_at DNMT3B Hs.643024 up 2.36 212430_at RBM38 Hs.236361 up 2.36 226269_at GDAP1 Hs.168950 up 2.36 224215_s_at DLL1 Hs.379912 up 2.36 230752_at Hs.662155 Hs.662155 up 2.36 213951_s_at PSMC3IP Hs.383019 up 2.35 221933_at NLGN4X Hs.21107 up 2.35 214051_at TMSB15B Hs.709594 up 2.35 209504_s_at PLEKHB1 Hs.445489 up 2.35 223673_at RFX4 Hs.388827 up 2.34 202240_at PLK1 Hs.592049 up 2.34 221677_s_at DONSON Hs.436341 up 2.34 1562473_at Hs.654778 Hs.654778 up 2.34 232010_at FSTL5 Hs.591707 up 2.33 229097_at DIAPH3 Hs.283127 up 2.33 214604_at HOXD11 Hs.421136 up 2.32 213906_at MYBL1 Hs.445898 up 2.32 227764_at LYPD6 Hs.21929 up 2.32 218741_at CENPM Hs.208912 up 2.32 204105_s_at NRCAM Hs.21422 up 2.31 206893_at SALL1 Hs.135787 up 2.30 230496_at FAM123A Hs.528335 up 2.30 227123_at RAB3B Hs.123072 up 2.30 237449_at SP8 Hs.195922 up 2.29 229551_x_at ZNF367 Hs.494557 up 2.29 203209_at RFC5 Hs.506989 up 2.29

137

204695_at CDC25A Hs.437705 up 2.28 213122_at TSPYL5 Hs.173094 up 2.28 203946_s_at ARG2 Hs.708024 up 2.28 201774_s_at NCAPD2 Hs.5719 up 2.28 243918_at Hs.649433 Hs.649433 up 2.28 235638_at RASSF6 Hs.590920 up 2.28 229715_at DKFZp686O24166 Hs.146274 up 2.28 229610_at CKAP2L Hs.434250 up 2.27 210135_s_at SHOX2 Hs.55967 up 2.27 228597_at C21orf45 Hs.190518 up 2.27 206307_s_at FOXD1 Hs.519385 up 2.27 225540_at MAP2 Hs.368281 up 2.26 228377_at KLHL14 Hs.446164 up 2.26 242939_at TFDP1 Hs.79353 up 2.25 1554251_at HP1BP3 Hs.142442 up 2.25 229347_at Hs.42197 Hs.42197 up 2.25 215143_at DPY19L2P2 Hs.148768 up 2.25 228281_at C11orf82 Hs.165607 up 2.24 222910_s_at PEX5L Hs.478393 up 2.24 235153_at RNF183 Hs.211374 up 2.23 219703_at MNS1 Hs.444483 up 2.23 214804_at CENPI Hs.318398 up 2.23 211538_s_at HSPA2 Hs.719230 up 2.23 209825_s_at UCK2 Hs.458360 up 2.23 200875_s_at NOP56 Hs.376064 up 2.23 202946_s_at BTBD3 Hs.709366 up 2.22 220011_at C1orf135 Hs.149305 up 2.22 228868_x_at CDT1 Hs.122908 up 2.22 219588_s_at NCAPG2 Hs.18616 up 2.22 236840_at C12orf56 Hs.535190 up 2.22 229057_at SCN2A Hs.93485 up 2.22 204244_s_at DBF4 Hs.485380 up 2.22 244532_x_at Hs.153272 Hs.153272 up 2.22 205085_at ORC1L Hs.17908 up 2.22 201202_at PCNA Hs.147433 up 2.21 234985_at LDLRAD3 Hs.708347 up 2.21 205733_at BLM Hs.716515 up 2.21 1559111_a_at Hs.639426 Hs.639426 up 2.21 202613_at CTPS Hs.473087 up 2.21 219683_at FZD3 Hs.40735 up 2.21 203069_at SV2A Hs.516153 up 2.21 201897_s_at CKS1B Hs.374378 up 2.21

138

238870_at KCNK9 Hs.493037 up 2.20 228598_at DPP10 Hs.591555 up 2.20 205278_at GAD1 Hs.420036 up 2.20 213378_s_at DDX11 Hs.443960 up 2.19 212686_at PPM1H Hs.435479 up 2.19 204743_at TAGLN3 Hs.169330 up 2.19 223274_at TCF19 Hs.584807 up 2.18 1552521_a_at TMEM74 Hs.99439 up 2.18 225105_at C12orf75 Hs.368938 up 2.18 209680_s_at KIFC1 Hs.436912 up 2.17 231855_at KIAA1524 Hs.591308 up 2.17 204348_s_at AK3L1 Hs.10862 up 2.16 222772_at MYEF2 Hs.6638 up 2.16 229025_s_at IMMP1L Hs.502223 up 2.16 215629_s_at DLEU2L Hs.659291 up 2.16 237116_at LOC646903 Hs.632559 up 2.16 228906_at TET1 Hs.567594 up 2.15 210758_at PSIP1 Hs.658434 up 2.15 205047_s_at ASNS Hs.489207 up 2.15 225667_s_at FAM84A Hs.260855 up 2.14 236312_at Hs.44380 Hs.44380 up 2.14 204471_at GAP43 Hs.134974 up 2.14 1552742_at KCNH8 Hs.475656 up 2.14 206316_s_at KNTC1 Hs.300559 up 2.14 212282_at TMEM97 Hs.199695 up 2.14 220167_s_at TP53TG3 Hs.592038 up 2.14 213346_at C13orf27 Hs.398111 up 2.14 205257_s_at AMPH Hs.592182 up 2.13 229538_s_at IQGAP3 Hs.591495 up 2.13 207663_x_at GAGE3

up 2.13

206196_s_at RUNDC3A Hs.500197 up 2.13 242455_at POU3F2 Hs.182505 up 2.13 1559213_at Hs.399852 Hs.399852 up 2.13 201584_s_at DDX39 Hs.311609 up 2.13 232065_x_at CENPL Hs.531856 up 2.12 204159_at CDKN2C Hs.716664 up 2.12 214096_s_at SHMT2 Hs.719098 up 2.12 201195_s_at SLC7A5 Hs.513797 up 2.12 1557215_at Hs.547419 Hs.547419 up 2.11 204240_s_at SMC2 Hs.119023 up 2.11 220840_s_at C1orf112 Hs.443551 up 2.11 203564_at FANCG Hs.591084 up 2.11

139

227180_at ELOVL7 Hs.274256 up 2.11 205697_at SCGN Hs.116428 up 2.11 205967_at HIST1H4C Hs.46423 up 2.11 208123_at KCNB2 Hs.661102 up 2.10 203423_at RBP1 Hs.529571 up 2.10 225300_at C15orf23 Hs.525796 up 2.10 242560_at FANCD2 Hs.208388 up 2.10 218888_s_at NETO2 Hs.444046 up 2.09 209421_at MSH2 Hs.597656 up 2.09 218899_s_at BAALC Hs.533446 up 2.09 224520_s_at BEST3 Hs.280782 up 2.09 204531_s_at BRCA1 Hs.194143 up 2.09 228107_at LOC100127983 Hs.642655 up 2.09 228654_at SPIN4 Hs.612782 up 2.08 240382_at LOC100131914 Hs.655976 up 2.08 204252_at CDK2 Hs.19192 up 2.08 201555_at MCM3 Hs.179565 up 2.08 229667_s_at HOXB8 Hs.514292 up 2.08 219779_at ZFHX4 Hs.458973 up 2.08 227194_at FAM3B Hs.473877 up 2.08 233149_at Hs.569174 Hs.569174 up 2.08 221539_at EIF4EBP1 Hs.411641 up 2.08 202363_at SPOCK1 Hs.643338 up 2.08 235795_at PAX6 Hs.270303 up 2.07 223542_at ANKRD32 Hs.657315 up 2.07 231898_x_at SOX2OT Hs.654932 up 2.07 243483_at TRPM8 Hs.366053 up 2.07 227578_at LOC100128191 Hs.594042 up 2.07 219502_at NEIL3 Hs.405467 up 2.07 211762_s_at KPNA2 Hs.594238 up 2.07 204492_at ARHGAP11A Hs.591130 up 2.07 222764_at ASRGL1 Hs.535326 up 2.07 221969_at Hs.126365 Hs.126365 up 2.07 229700_at ZNF738 Hs.359535 up 2.07 239657_x_at FOXO6

up 2.06

1552897_a_at KCNG3 Hs.352633 up 2.06 230882_at DLX6AS Hs.34969 up 2.06 203743_s_at TDG Hs.584809 up 2.06 202330_s_at UNG Hs.191334 up 2.05 222781_s_at C9orf40 Hs.532296 up 2.05 203744_at HMGB3 Hs.19114 up 2.05 226943_at C12orf73 Hs.42547 up 2.05

140

205436_s_at H2AFX Hs.477879 up 2.05 224870_at KIAA0114 Hs.17719 up 2.05 209433_s_at PPAT Hs.331420 up 2.05 213609_s_at SEZ6L Hs.194766 up 2.05 203438_at STC2 Hs.233160 up 2.05 212771_at FAM171A1 Hs.66762 up 2.05 1554572_a_at SUV39H2 Hs.554883 up 2.05 230040_at ADAMTS18 Hs.188746 up 2.05 227545_at Hs.54089 Hs.54089 up 2.04 234976_x_at SLC4A5 Hs.594099 up 2.04 242301_at CBLN2 Hs.569851 up 2.04 204728_s_at WDHD1 Hs.385998 up 2.04 228455_at RBM15 Hs.435947 up 2.04 1553984_s_at DTYMK Hs.471873 up 2.04 227211_at PHF19 Hs.460124 up 2.04 220062_s_at MAGEC2 Hs.123536 up 2.03 219523_s_at ODZ3 Hs.130438 up 2.03 206552_s_at TAC1 Hs.2563 up 2.03 228252_at PIF1 Hs.112160 up 2.03 235948_at RIMKLA Hs.420244 up 2.03 229666_s_at CSTF3 Hs.44402 up 2.03 236029_at FAT3 Hs.98523 up 2.03 219736_at TRIM36 Hs.519514 up 2.03 218308_at TACC3 Hs.104019 up 2.03 231265_at COX7B2 Hs.479656 up 2.02 201111_at CSE1L Hs.90073 up 2.02 237302_at Hs.127807 Hs.127807 up 2.02 218617_at TRIT1 Hs.356554 up 2.02 221168_at PRDM13 Hs.287386 up 2.02 238850_at LOC645323 Hs.12827 up 2.02 206858_s_at HOXC6 Hs.549040 up 2.01 228724_at Hs.594267 Hs.594267 up 2.01 207219_at ZNF643 Hs.133034 up 2.01 218073_s_at TMEM48 Hs.476525 up 2.01 220239_at KLHL7 Hs.654817 up 2.01 223618_at FMN2 Hs.24889 up 2.01 201477_s_at RRM1 Hs.445705 up 2.01 201764_at TMEM106C Hs.596726 up 2.01 231906_at HOXD8 Hs.301963 up 2.00 215731_s_at MPHOSPH9 Hs.577404 up 2.00 226350_at CHML Hs.654545 up 2.00 224610_at SNHG1

up 2.00

141

223666_at SNX5 Hs.316890 up 2.00 221582_at HIST3H2A Hs.700190 up 1.99 203016_s_at SSX2IP Hs.22587 up 1.99 223038_s_at FAM60A Hs.505154 up 1.99 235102_x_at Hs.710399 Hs.710399 up 1.99 206218_at MAGEB2 Hs.113824 up 1.99 212563_at BOP1 Hs.535901 up 1.99 238784_at DPY19L2 Hs.533644 up 1.99 222685_at HAUS6 Hs.533468 up 1.99 212850_s_at LRP4 Hs.4930 up 1.98 218252_at CKAP2 Hs.444028 up 1.98 218349_s_at ZWILCH Hs.21331 up 1.98 216870_x_at DLEU2 Hs.547964 up 1.98 229139_at JPH1 Hs.657367 up 1.98 227499_at Hs.642795 Hs.642795 up 1.98 210416_s_at CHEK2 Hs.291363 up 1.98 219512_at DSN1 Hs.632268 up 1.98 205054_at NEB Hs.588655 up 1.98 212621_at TMEM194A Hs.591040 up 1.97 225578_at C13orf37 Hs.28465 up 1.97 204779_s_at HOXB7 Hs.436181 up 1.97 201969_at NASP Hs.319334 up 1.97 238015_at C4orf46 Hs.380920 up 1.97 204173_at MYL6B Hs.632731 up 1.97 219987_at LOC100288413 Hs.363087 up 1.97 225297_at HAUS1 Hs.436617 up 1.97 206772_at PTH2R Hs.570296 up 1.97 204992_s_at PFN2 Hs.91747 up 1.96 228740_at Hs.26766 Hs.26766 up 1.96 223627_at MEX3B Hs.104744 up 1.96 207103_at KCND2 Hs.654739 up 1.96 219170_at FSD1 Hs.28144 up 1.96 214046_at FUT9 Hs.49117 up 1.96 208931_s_at ILF3 Hs.465885 up 1.96 239233_at CCDC88A Hs.292925 up 1.95 219258_at TIPIN Hs.572318 up 1.95 200903_s_at AHCY Hs.388004 up 1.95 235644_at CCDC138 Hs.362702 up 1.95 204886_at PLK4 Hs.172052 up 1.95 235572_at SPC24 Hs.381225 up 1.95 235411_at PGBD1 Hs.144527 up 1.95 204826_at CCNF Hs.1973 up 1.95

142

216548_x_at HMGB3L1 Hs.558624 up 1.95 231882_at FLJ39632 Hs.536395 up 1.94 219877_at ZMAT4 Hs.591850 up 1.94 216952_s_at LMNB2 Hs.538286 up 1.94 208694_at PRKDC Hs.491682 up 1.94 203856_at VRK1 Hs.422662 up 1.94 221685_s_at CCDC99 Hs.368710 up 1.94 239680_at Hs.598880 Hs.598880 up 1.94 205429_s_at MPP6 Hs.533355 up 1.94 225716_at Hs.330495 Hs.330495 up 1.94 207717_s_at PKP2 Hs.164384 up 1.94 214608_s_at EYA1 Hs.491997 up 1.94 242447_at C3orf70 Hs.380048 up 1.94 242787_at Hs.665719 Hs.665719 up 1.93 208962_s_at FADS1 Hs.503546 up 1.93 210683_at NRTN Hs.234775 up 1.93 205888_s_at JAKMIP2 Hs.719177 up 1.93 214451_at TFAP2B Hs.33102 up 1.93 220474_at SLC25A21 Hs.651384 up 1.93 242135_at LOC642236

up 1.93

232282_at WNK3 Hs.92423 up 1.93 226346_at MEX3A Hs.591496 up 1.92 212233_at MAP1B Hs.335079 up 1.92 220234_at CA8 Hs.654388 up 1.92 219511_s_at SNCAIP Hs.426463 up 1.92 225963_at KLHDC5 Hs.505104 up 1.92 210036_s_at KCNH2 Hs.647099 up 1.92 209198_s_at SYT11 Hs.32984 up 1.92 1554020_at BICD1 Hs.505202 up 1.92 238898_at Hs.571099 Hs.571099 up 1.92 227484_at SRGAP1 Hs.210751 up 1.92 219217_at NARS2 Hs.503389 up 1.91 205600_x_at HOXB5 Hs.654456 up 1.91 205519_at WDR76 Hs.250154 up 1.91 231432_at Hs.703788 Hs.703788 up 1.91 229243_at Hs.643687 Hs.643687 up 1.91 236918_s_at LRRC34 Hs.591289 up 1.91 227997_at IL17RD Hs.150725 up 1.91 218894_s_at MAGOHB Hs.104650 up 1.91 207183_at GPR19 Hs.657862 up 1.91 219493_at SHCBP1 Hs.123253 up 1.91 1554452_a_at C7orf68 Hs.710088 up 1.91

143

226623_at PHYHIPL Hs.499704 up 1.91 228144_at ZNF300 Hs.134885 up 1.91 220039_s_at CDKAL1 Hs.657604 up 1.90 201663_s_at SMC4 Hs.58992 up 1.90 206653_at POLR3G Hs.282387 up 1.90 230245_s_at LOC283663 Hs.181297 up 1.90 231967_at PHF20L1 Hs.304362 up 1.90 236391_at Hs.666266 Hs.666266 up 1.90 218903_s_at OBFC2B Hs.240170 up 1.90 205345_at BARD1 Hs.591642 up 1.90 208955_at DUT Hs.527980 up 1.90 203228_at PAFAH1B3 Hs.466831 up 1.90 216026_s_at POLE Hs.524871 up 1.90 243661_at ZNF273 Hs.520889 up 1.90 223823_at KCNMB2 Hs.478368 up 1.90 213668_s_at SOX4 Hs.643910 up 1.90 204766_s_at NUDT1 Hs.534331 up 1.90 224185_at Hs.408312 Hs.408312 up 1.89 239413_at CEP152 Hs.597323 up 1.89 227165_at SKA3 Hs.88523 up 1.89 205348_s_at DYNC1I1 Hs.440364 up 1.89 203685_at BCL2 Hs.150749 up 1.89 213310_at EIF2C2 Hs.449415 up 1.89 207197_at ZIC3 Hs.111227 up 1.89 201853_s_at CDC25B Hs.153752 up 1.89 226925_at ACPL2 Hs.657887 up 1.89 229768_at OR51E1 Hs.470038 up 1.89 1555826_at EPR1 Hs.719661 up 1.89 231341_at SLC35D3 Hs.369703 up 1.89 224523_s_at C3orf26 Hs.655111 up 1.89 223614_at MMP16 Hs.546267 up 1.89 228430_at Hs.503348 Hs.503348 up 1.88 244660_at ELAVL1 Hs.184492 up 1.88 213222_at PLCB1 Hs.431173 up 1.88 220576_at PGAP1 Hs.229988 up 1.88 223234_at MAD2L2 Hs.19400 up 1.88 236937_at VPS8 Hs.269263 up 1.88 214636_at CALCB Hs.534305 up 1.88 201558_at RAE1 Hs.371698 up 1.88 214061_at WDR67 Hs.492716 up 1.88 201430_s_at DPYSL3 Hs.519659 up 1.88 200990_at TRIM28 Hs.467408 up 1.88

144

214463_x_at HIST1H4J

up 1.88 205063_at SIP1 Hs.708127 up 1.88 226118_at CENPO Hs.718431 up 1.88 208107_s_at LOC81691 Hs.177926 up 1.88 241710_at LOC728819 Hs.602756 up 1.88 222752_s_at TMEM206 Hs.445386 up 1.87 230312_at Hs.88045 Hs.88045 up 1.87 241386_at Hs.536336 Hs.536336 up 1.87 219277_s_at OGDHL Hs.17860 up 1.87 224578_at RCC2 Hs.380857 up 1.87 218499_at MST4 Hs.444247 up 1.87 225711_at ARL6IP6 Hs.718420 up 1.87 203976_s_at CHAF1A Hs.79018 up 1.87 201014_s_at PAICS Hs.518774 up 1.87 235736_at LOC100287482 Hs.178144 up 1.86 209426_s_at C1QTNF3 Hs.171929 up 1.86 235134_at Hs.523913 Hs.523913 up 1.86 244455_at KCNT2 Hs.657046 up 1.86 1556344_at LOC150051 Hs.708976 up 1.86 235919_at Hs.187621 Hs.187621 up 1.86 227481_at CNKSR3 Hs.16064 up 1.86 222803_at PRTFDC1 Hs.405619 up 1.86 243161_x_at ZFP42 Hs.335787 up 1.86 230441_at PLEKHG4B Hs.535800 up 1.86 230763_at SPATA17 Hs.171130 up 1.86 243278_at FOXP2 Hs.656280 up 1.86 201479_at DKC1 Hs.4747 up 1.86 235363_at Hs.28360 Hs.28360 up 1.86 227687_at HYLS1 Hs.585071 up 1.85 1567913_at Hs.621508 Hs.621508 up 1.85 1558164_s_at PEX13 Hs.161377 up 1.85 228293_at DEPDC7 Hs.280990 up 1.85 226433_at RNF157 Hs.500643 up 1.85 233970_s_at TRMT6 Hs.128791 up 1.85 1552879_a_at ATOH7 Hs.175396 up 1.85 1556629_a_at SNAP25 Hs.167317 up 1.85 213194_at ROBO1 Hs.13640 up 1.85 228774_at CEP78 Hs.374421 up 1.85 2028_s_at E2F1 Hs.654393 up 1.85 212348_s_at KDM1A Hs.591518 up 1.85 203832_at SNRPF Hs.105465 up 1.85 50314_i_at C20orf27 Hs.274422 up 1.85

145

213234_at KIAA1467 Hs.132660 up 1.85 236337_at SYCP2L

up 1.84

205445_at PRL Hs.1905 up 1.84 223845_at VSIG10 Hs.593950 up 1.84 226456_at C16orf75 Hs.347524 up 1.84 226320_at THOC4 Hs.534385 up 1.84 216237_s_at MCM5 Hs.517582 up 1.84 204999_s_at ATF5 Hs.9754 up 1.84 221703_at BRIP1 Hs.532799 up 1.84 230849_at KCNA1 Hs.416139 up 1.84 205240_at GPSM2 Hs.584901 up 1.84 230361_at HEATR7A Hs.443139 up 1.84 202726_at LIG1 Hs.1770 up 1.84 222843_at FIGNL1 Hs.137516 up 1.84 212789_at NCAPD3 Hs.438550 up 1.83 242584_at FAM161A Hs.440466 up 1.83 229276_at IGSF9 Hs.591472 up 1.83 217946_s_at SAE1 Hs.515500 up 1.83 230403_at Hs.438858 Hs.438858 up 1.83 223575_at KIAA1549 Hs.605380 up 1.83 206550_s_at NUP155 Hs.547696 up 1.83 238847_at Hs.663955 Hs.663955 up 1.83 218757_s_at UPF3B Hs.103832 up 1.83 1554043_a_at Hs.330741 Hs.330741 up 1.83 242828_at FIGN Hs.593650 up 1.83 233243_at Hs.655802 Hs.655802 up 1.83 241682_at KLHL23 Hs.655150 up 1.83 213523_at CCNE1 Hs.244723 up 1.82 234978_at SLC36A4 Hs.148766 up 1.82 244565_at HMX2 Hs.444756 up 1.82 227468_at CPT1C Hs.112195 up 1.82 240236_at STXBP5L Hs.477315 up 1.82 225439_at NUDCD1 Hs.380291 up 1.82 210247_at SYN2 Hs.445503 up 1.82 229778_at C12orf39 Hs.130692 up 1.82 201577_at NME1 Hs.463456 up 1.82 209026_x_at TUBB Hs.636480 up 1.82 215043_s_at SMA5 Hs.529793 up 1.81 223539_s_at SERF1B Hs.658079 up 1.81 243840_at Hs.597302 Hs.597302 up 1.81 1553015_a_at RECQL4 Hs.31442 up 1.81 242002_at NKAIN2 Hs.656604 up 1.81

146

1554408_a_at TK1 Hs.515122 up 1.81 203632_s_at GPRC5B Hs.148685 up 1.81 1558750_a_at Hs.668950 Hs.668950 up 1.81 229622_at FAM132B Hs.24951 up 1.81 233536_at ASXL3 Hs.464876 up 1.81 202483_s_at RANBP1 Hs.24763 up 1.81 1557155_a_at FLJ30375 Hs.535724 up 1.81 238695_s_at RAB39B Hs.632832 up 1.81 230785_at Hs.514980 Hs.514980 up 1.81 230789_at ZNF280B Hs.43834 up 1.81 231307_at PAGE2 Hs.662612 up 1.81 239913_at SLC10A4 Hs.132591 up 1.81 212607_at AKT3 Hs.498292 up 1.80 202690_s_at SNRPD1 Hs.464734 up 1.80 223296_at SLC25A33 Hs.568613 up 1.80 1557598_at Hs.676378 Hs.676378 up 1.80 239911_at ONECUT2 Hs.194725 up 1.80 220459_at MCM3APAS Hs.709346 up 1.80 208580_x_at HIST1H4K Hs.528055 up 1.80 218683_at PTBP2 Hs.718552 up 1.80 219142_at RASL11B Hs.8035 up 1.80 204441_s_at POLA2 Hs.201897 up 1.80 218397_at FANCL Hs.631890 up 1.80 206137_at RIMS2 Hs.655271 up 1.80 204900_x_at SAP30 Hs.591715 up 1.79 1553411_s_at SALL3 Hs.700557 up 1.79 243332_at Hs.670186 Hs.670186 up 1.79 209053_s_at WHSC1 Hs.113876 up 1.79 205628_at PRIM2 Hs.654580 up 1.79 231810_at BRI3BP Hs.596464 up 1.79 220231_at C7orf16 Hs.227011 up 1.79 228776_at GJC1 Hs.532593 up 1.79 225614_at SAAL1 Hs.591998 up 1.78 230988_at Hs.593601 Hs.593601 up 1.78 236420_s_at ANO4 Hs.58785 up 1.78 223275_at PRMT6 Hs.26006 up 1.78 227936_at TMEM68 Hs.420076 up 1.78 201833_at HDAC2 Hs.3352 up 1.78 236565_s_at LARP6 Hs.416755 up 1.78 208821_at SNRPB Hs.83753 up 1.78 231146_at FAM24B Hs.114648 up 1.78 240713_s_at Hs.654853 Hs.654853 up 1.78

147

219650_at ERCC6L Hs.47558 up 1.78 210175_at C2orf3 Hs.303808 up 1.78 204612_at PKIA Hs.433700 up 1.78 230021_at C15orf42 Hs.441708 up 1.78 230874_at Hs.596383 Hs.596383 up 1.78 202666_s_at ACTL6A Hs.435326 up 1.78 1559946_s_at RUVBL2 Hs.515846 up 1.78 236236_at Hs.633123 Hs.633123 up 1.78 204130_at HSD11B2 Hs.1376 up 1.78 203806_s_at FANCA Hs.719210 up 1.78 214431_at GMPS Hs.591314 up 1.78 45633_at GINS3 Hs.47125 up 1.77 228547_at NRXN1 Hs.637685 up 1.77 225485_at TSGA14 Hs.368315 up 1.77 219312_s_at ZBTB10 Hs.591868 up 1.77 204123_at LIG3 Hs.100299 up 1.77 235113_at PPIL5 Hs.710054 up 1.77 202345_s_at FABP5 Hs.408061 up 1.77 213581_at PDCD2 Hs.367900 up 1.77 201518_at CBX1 Hs.77254 up 1.77 209118_s_at TUBA1A Hs.654422 up 1.77 205008_s_at CIB2 Hs.129867 up 1.77 203405_at PSMG1 Hs.473838 up 1.77 235226_at CDK19 Hs.719138 up 1.77 223898_at ZNF670 Hs.710279 up 1.77 232553_at PCYT1B Hs.660708 up 1.77 219544_at C13orf34 Hs.714340 up 1.77 230143_at RNF165 Hs.501114 up 1.77 1553654_at SYT14 Hs.658866 up 1.76 201714_at TUBG1 Hs.279669 up 1.76 208644_at PARP1 Hs.177766 up 1.76 220559_at EN1 Hs.271977 up 1.76 219320_at MYO19 Hs.302051 up 1.76 52285_f_at CEP76 Hs.236940 up 1.76 227916_x_at EXOSC3 Hs.591076 up 1.76 206117_at TPM1 Hs.133892 up 1.76 223538_at SERF1A Hs.559428 up 1.76 224521_s_at CCDC77 Hs.631656 up 1.76 226549_at SBK1 Hs.97837 up 1.76 218399_s_at CDCA4 Hs.715701 up 1.76 203830_at C17orf75 Hs.655257 up 1.76 209617_s_at CTNND2 Hs.314543 up 1.76

148

225676_s_at DCAF13 Hs.532265 up 1.76 1555935_s_at HUNK Hs.109437 up 1.76 227077_at ZNF286B Hs.534279 up 1.76 200790_at ODC1 Hs.467701 up 1.75 218187_s_at C8orf33 Hs.169615 up 1.75 221121_at CXorf48 Hs.272804 up 1.75 241535_at Hs.120377 Hs.120377 up 1.75 201697_s_at DNMT1 Hs.202672 up 1.75 1553292_s_at SGK494 Hs.657973 up 1.75 202412_s_at USP1 Hs.35086 up 1.75 242054_s_at Hs.709953 Hs.709953 up 1.75 206074_s_at HMGA1 Hs.703764 up 1.75 213476_x_at TUBB3 Hs.511743 up 1.75 231468_at LOC100131177 up 1.75 211623_s_at FBL Hs.299002 up 1.75 232034_at LOC203274 Hs.599821 up 1.75 242592_at GPR137C Hs.416214 up 1.75 219510_at POLQ Hs.241517 up 1.75 228642_at HOXA2 Hs.445239 up 1.75 238599_at IRAK1BP1 Hs.656212 up 1.74 205543_at HSPA4L Hs.135554 up 1.74 236121_at OR51E2 Hs.606330 up 1.74 1568597_at LOC646762 Hs.30579 up 1.74 244080_at Hs.527657 Hs.527657 up 1.74 206261_at ZNF239 Hs.25040 up 1.74 228415_at AP1S2 Hs.656471 up 1.74 200644_at MARCKSL1 Hs.75061 up 1.74 244523_at MMD Hs.463483 up 1.74 232291_at MIR17HG Hs.24115 up 1.73 218051_s_at NT5DC2 Hs.84753 up 1.73 219499_at SEC61A2 Hs.112955 up 1.73 200957_s_at SSRP1 Hs.523680 up 1.73 227179_at STAU2 Hs.561815 up 1.73 225723_at C6orf129 Hs.284207 up 1.73 201770_at SNRPA Hs.466775 up 1.73 235207_at Hs.531042 Hs.531042 up 1.73 204228_at PPIH Hs.256639 up 1.73 206526_at RIBC2 Hs.475110 up 1.73 223759_s_at GSG2 Hs.534059 up 1.72 226710_at C8orf82 Hs.105685 up 1.72 1564220_a_at Hs.211461 Hs.211461 up 1.72 200750_s_at RAN Hs.10842 up 1.72

149

1555278_a_at CKAP5 Hs.201253 up 1.72 205449_at SAC3D1 Hs.23642 up 1.72 1556195_a_at Hs.634086 Hs.634086 up 1.72 206565_x_at SMA4

up 1.72

201947_s_at CCT2 Hs.189772 up 1.72 213492_at COL2A1 Hs.408182 up 1.72 225857_s_at LOC388796 Hs.400876 up 1.72 231863_at ING3 Hs.489811 up 1.72 44783_s_at HEY1 Hs.234434 up 1.72 206066_s_at RAD51C Hs.412587 up 1.72 204835_at POLA1 Hs.567319 up 1.72 210691_s_at CACYBP Hs.508524 up 1.72 231145_at Hs.659970 Hs.659970 up 1.72 225075_at PDRG1 Hs.435755 up 1.72 201263_at TARS Hs.481860 up 1.72 208334_at NDST4 Hs.591700 up 1.72 205176_s_at ITGB3BP Hs.166539 up 1.72 205194_at PSPH Hs.512656 up 1.72 226912_at ZDHHC23 Hs.21902 up 1.72 218237_s_at SLC38A1 Hs.694701 up 1.72 236351_at LOC389023 Hs.97540 up 1.72 226747_at TXNDC16 Hs.532609 up 1.71 222640_at DNMT3A Hs.515840 up 1.71 1557684_at ZNF286A Hs.585799 up 1.71 241017_at TBC1D8 Hs.442657 up 1.71 1554101_a_at TMTC4 Hs.713610 up 1.71 225625_at ALKBH2 Hs.374458 up 1.71 1556911_at Hs.668279 Hs.668279 up 1.71 234192_s_at GKAP1 Hs.522255 up 1.71 210221_at CHRNA3 Hs.89605 up 1.71 232790_at Hs.606550 Hs.606550 up 1.71 218561_s_at LYRM4 Hs.387755 up 1.71 231558_at Hs.644967 Hs.644967 up 1.71 203422_at POLD1 Hs.279413 up 1.71 241908_at C1orf58 Hs.552608 up 1.71 223515_s_at COQ3 Hs.713623 up 1.71 229944_at OPRK1 Hs.106795 up 1.71 203693_s_at E2F3 Hs.703174 up 1.70 218434_s_at AACS Hs.656073 up 1.70 206258_at ST8SIA5 Hs.465025 up 1.70 206147_x_at SCML2 Hs.495774 up 1.70 208511_at PTTG3P Hs.647156 up 1.70

150

232195_at GPR158 Hs.499108 up 1.70 235957_at GRIP1 Hs.505946 up 1.70 239202_at Hs.702338 Hs.702338 up 1.70 220354_at LOC100134018 Hs.667436 up 1.70 218788_s_at SMYD3 Hs.567571 up 1.70 219438_at NKAIN1 Hs.470259 up 1.70 219763_at DENND1A Hs.568340 up 1.70 228612_at Hs.503429 Hs.503429 up 1.70 209657_s_at HSF2 Hs.158195 up 1.70 235389_at PHF20 Hs.517044 up 1.70 228600_x_at C7orf46 Hs.592178 up 1.70 218096_at AGPAT5 Hs.624002 up 1.70 230522_s_at C9orf100 Hs.534579 up 1.70 243462_s_at Hs.662467 Hs.662467 up 1.70 228361_at E2F2 Hs.194333 up 1.70 225142_at JHDM1D Hs.308710 up 1.70 227640_s_at RP9 Hs.326805 up 1.70 243010_at MSI2 Hs.658922 up 1.70 204559_s_at LSM7 Hs.512610 up 1.69 216705_s_at ADA Hs.654536 up 1.69 1568873_at ZNF519 Hs.352635 up 1.69 235177_at FAM119A Hs.664764 up 1.69 220160_s_at KPTN Hs.25441 up 1.69 231869_at KIAA1586 Hs.709521 up 1.69 203062_s_at MDC1 Hs.653495 up 1.69 206609_at MAGEC1 Hs.132194 up 1.69 200895_s_at FKBP4 Hs.524183 up 1.69 229116_at CNKSR2 Hs.555917 up 1.69 202532_s_at DHFR Hs.648635 up 1.69 227377_at IGF2BP1 Hs.144936 up 1.69 218768_at NUP107 Hs.524574 up 1.69 213124_at ZNF473 Hs.440553 up 1.69 235693_at Hs.669250 Hs.669250 up 1.69 238541_at C21orf58 Hs.236572 up 1.69 231843_at DDX55 Hs.286173 up 1.69 236798_at Hs.551751 Hs.551751 up 1.69 205747_at CBLN1 Hs.458423 up 1.69 218481_at EXOSC5 Hs.283741 up 1.69 217988_at CCNB1IP1 Hs.107003 up 1.69 229091_s_at CCNJ Hs.596479 up 1.69 223471_at RAB3IP Hs.258209 up 1.69 212916_at PHF8 Hs.133352 up 1.68

151

227892_at PRKAA2 Hs.437039 up 1.68 235781_at CACNA1B Hs.495522 up 1.68 235599_at LOC339535 Hs.532047 up 1.68 220771_at LOC51152 Hs.633593 up 1.68 219715_s_at TDP1 Hs.209945 up 1.68 222011_s_at TCP1 Hs.363137 up 1.68 213742_at SFRS11 Hs.479693 up 1.68 202246_s_at CDK4 Hs.95577 up 1.68 211379_x_at B3GALNT1 Hs.418062 up 1.68 219132_at PELI2 Hs.657926 up 1.67 228116_at Hs.556122 Hs.556122 up 1.67 227370_at FAM171B Hs.28872 up 1.67 239069_s_at Hs.649155 Hs.649155 up 1.67 201516_at SRM Hs.76244 up 1.67 235783_at MRTO4 Hs.463797 up 1.67 212813_at JAM3 Hs.150718 up 1.67 205780_at BIK Hs.475055 up 1.67 225310_at RBMX Hs.380118 up 1.67 206273_at SLMO1 Hs.514718 up 1.67 222857_s_at KCNMB4 Hs.525529 up 1.67 1568627_at SMEK2 Hs.516182 up 1.67 205893_at NLGN1 Hs.478289 up 1.67 202633_at TOPBP1 Hs.53454 up 1.67 206928_at ZNF124 Hs.655205 up 1.67 223654_s_at CELF4 Hs.435976 up 1.67 204525_at PHF14 Hs.655688 up 1.67 1570153_at C13orf38 Hs.124519 up 1.67 239169_at RDM1 Hs.194411 up 1.67 214397_at MBD2 Hs.25674 up 1.67 201090_x_at TUBA1B Hs.719075 up 1.67 204557_s_at DZIP1 Hs.656580 up 1.67 207153_s_at GLMN Hs.49105 up 1.67 218564_at RFWD3 Hs.567525 up 1.67 223257_at G2E3 Hs.509008 up 1.67 219076_s_at PXMP2 Hs.430299 up 1.66 240100_at Hs.436654 Hs.436654 up 1.66 244640_at ZNF850P Hs.406307 up 1.66 1555943_at PGAM5 Hs.102558 up 1.66 241937_s_at WDR4 Hs.248815 up 1.66 223057_s_at XPO5 Hs.203206 up 1.66 221713_s_at MAP6D1 Hs.478465 up 1.66 228049_x_at Hs.369728 Hs.369728 up 1.66

152

224588_at XIST Hs.529901 up 1.66 220865_s_at PDSS1 Hs.558468 up 1.66 213302_at PFAS Hs.573976 up 1.66 209674_at CRY1 Hs.151573 up 1.66 242070_at LOC728485 Hs.157101 up 1.66 206613_s_at TAF1A Hs.153088 up 1.66 218737_at SBNO1 Hs.577403 up 1.66 214349_at Hs.613165 Hs.613165 up 1.66 218622_at NUP37 Hs.444276 up 1.66 238496_at Hs.657481 Hs.657481 up 1.66 225777_at C9orf140 Hs.19322 up 1.66 206445_s_at PRMT1 Hs.20521 up 1.66 221047_s_at MARK1 Hs.497806 up 1.65 219531_at CEP72 Hs.591741 up 1.65 214874_at PKP4 Hs.407580 up 1.65 223461_at TBC1D7 Hs.484678 up 1.65 202179_at BLMH Hs.371914 up 1.65 202911_at MSH6 Hs.445052 up 1.65 204675_at SRD5A1 Hs.552 up 1.65 218188_s_at TIMM13 Hs.75056 up 1.65 211721_s_at ZNF551

up 1.65

205361_s_at PFDN4 Hs.91161 up 1.65 224467_s_at PDCD2L Hs.515344 up 1.65 1557129_a_at FAM111B Hs.186579 up 1.65 204662_at CP110 Hs.279912 up 1.65 218936_s_at CCDC59 Hs.582627 up 1.65 213427_at RPP40 Hs.511756 up 1.65 1553956_at ALS2CR4 Hs.12319 up 1.65 234915_s_at DENR Hs.22393 up 1.65 238704_at Hs.464402 Hs.464402 up 1.65 243018_at Hs.196133 Hs.196133 up 1.65 216860_s_at GDF11 Hs.600883 up 1.65 205296_at RBL1 Hs.207745 up 1.65 225017_at CCDC14 Hs.645028 up 1.64 219177_at BRIX1 Hs.718510 up 1.64 225841_at C1orf59 Hs.7962 up 1.64 202780_at OXCT1 Hs.278277 up 1.64 220520_s_at NUP62CL Hs.163629 up 1.64 226546_at Hs.90286 Hs.90286 up 1.64 218592_s_at CECR5 Hs.26890 up 1.64 231297_at DOT1L Hs.713641 up 1.64 214373_at Hs.679693 Hs.679693 up 1.64

153

210530_s_at NR2C1 Hs.108301 up 1.64 228170_at OLIG1 Hs.56663 up 1.64 234464_s_at EME1 Hs.514330 up 1.64 219522_at FJX1 Hs.39384 up 1.64 212877_at KLC1 Hs.20107 up 1.64 238762_at MTHFD2L Hs.479954 up 1.64 204905_s_at EEF1E1 Hs.719206 up 1.64 207705_s_at NINL Hs.696157 up 1.64 230002_at CLCC1 Hs.658489 up 1.64 217520_x_at LOC731884 Hs.597835 up 1.64 239834_at Hs.657445 Hs.657445 up 1.64 214794_at PA2G4 Hs.524498 up 1.64 218512_at WDR12 Hs.73291 up 1.64 209781_s_at KHDRBS3 Hs.444558 up 1.63 229849_at WIPF3 Hs.709280 up 1.63 242203_at Hs.593315 Hs.593315 up 1.63 200853_at H2AFZ Hs.119192 up 1.63 231895_at SASS6 Hs.591447 up 1.63 226947_at GUSBP1 Hs.621038 up 1.63 225898_at WDR54 Hs.643480 up 1.63 242438_at ASXL1 Hs.374043 up 1.63 201589_at SMC1A Hs.211602 up 1.63 219006_at NDUFAF4 Hs.591333 up 1.63 222044_at PCIF1 Hs.716563 up 1.63 204866_at PHF16 Hs.371977 up 1.63 228972_at Hs.633815 Hs.633815 up 1.63 205284_at URB2 Hs.533628 up 1.63 236026_at GPATCH2 Hs.420757 up 1.63 212719_at PHLPP1 Hs.465337 up 1.63 236774_at Hs.667795 Hs.667795 up 1.63 243707_at Hs.145520 Hs.145520 up 1.63 208398_s_at TBPL1 Hs.486507 up 1.63 230129_at PSTK Hs.281004 up 1.63 218738_s_at RNF138 Hs.302408 up 1.63 223506_at ZC3H8 Hs.418416 up 1.63 211767_at GINS4 Hs.656996 up 1.63 242294_at FBXO45 Hs.169815 up 1.63 210046_s_at IDH2 Hs.596461 up 1.63 230831_at FRMD5 Hs.578544 up 1.62 227164_at SFRS1 Hs.68714 up 1.62 224913_s_at TIMM50 Hs.590956 up 1.62 207501_s_at FGF12 Hs.584758 up 1.62

154

209956_s_at CAMK2B Hs.351887 up 1.62 204483_at ENO3 Hs.224171 up 1.62 201795_at LBR Hs.435166 up 1.62 238156_at Hs.663159 Hs.663159 up 1.62 203448_s_at TERF1 Hs.442707 up 1.62 201066_at CYC1 Hs.289271 up 1.62 212160_at XPOT Hs.85951 up 1.62 227249_at NDE1 Hs.655378 up 1.62 213947_s_at NUP210 Hs.475525 up 1.62 219414_at CLSTN2 Hs.158529 up 1.62 203347_s_at MTF2 Hs.31016 up 1.62 210053_at TAF5 Hs.96103 up 1.62 201310_s_at C5orf13 Hs.36053 up 1.62 243173_at CABP7 Hs.643608 up 1.62 236655_at TPD52 Hs.368433 up 1.62 224448_s_at C6orf125 Hs.93235 up 1.62 218911_at YEATS4 Hs.4029 up 1.62 201313_at ENO2 Hs.511915 up 1.62 218886_at PAK1IP1 Hs.310231 up 1.62 1555997_s_at IGFBP5 Hs.607212 up 1.62 203612_at BYSL Hs.106880 up 1.62 1568612_at GABRG2 Hs.7195 up 1.62 213411_at Hs.592567 Hs.592567 up 1.62 227593_at FLJ37453 Hs.119298 up 1.62 216992_s_at GRM8 Hs.449625 up 1.62 211954_s_at IPO5 Hs.712598 up 1.61 228955_at Hs.280387 Hs.280387 up 1.61 207149_at CDH12 Hs.113684 up 1.61 238807_at GAPDHL7

up 1.61

228073_at NANP Hs.143137 up 1.61 237885_at Hs.649646 Hs.649646 up 1.61 210473_s_at GPR125 Hs.99195 up 1.61 201629_s_at ACP1 Hs.558296 up 1.61 225521_at ANAPC7 Hs.524741 up 1.61 213334_x_at HAUS7 Hs.170835 up 1.61 235694_at TCFL5 Hs.126248 up 1.61 238521_at Hs.595279 Hs.595279 up 1.61 214764_at RRP15 Hs.660109 up 1.61 1553274_a_at SNRNP48 Hs.13366 up 1.61 212709_at NUP160 Hs.643526 up 1.61 213223_at RPL28 Hs.652114 up 1.61 213088_s_at DNAJC9 Hs.654694 up 1.61

155

223225_s_at SEH1L Hs.301048 up 1.61 231517_at ZYG11A Hs.658458 up 1.61 226487_at C12orf34 Hs.661785 up 1.61 233436_at MTBP Hs.657656 up 1.61 235117_at CHAC2 Hs.585944 up 1.61 209153_s_at TCF3 Hs.371282 up 1.61 223557_s_at TMEFF2 Hs.144513 up 1.61 230097_at GART Hs.473648 up 1.60 212556_at SCRIB Hs.436329 up 1.60 210497_x_at SSX2 Hs.661107 up 1.60 216307_at DGKB Hs.567255 up 1.60 229587_at UBA2 Hs.631580 up 1.60 234107_s_at DTD1 Hs.659442 up 1.60 201614_s_at RUVBL1 Hs.272822 up 1.60 208576_s_at HIST1H3B Hs.533292 up 1.60 227526_at CDON Hs.38034 up 1.60 226568_at FAM102B Hs.200230 up 1.60 230696_at Hs.666631 Hs.666631 up 1.60 202715_at CAD Hs.377010 up 1.60 1552417_a_at NEDD1 Hs.270084 up 1.60 218981_at ACN9 Hs.592269 up 1.60 202043_s_at SMS Hs.715555 up 1.60 204566_at PPM1D Hs.591184 up 1.60 212479_s_at RMND5A Hs.75277 up 1.60 215947_s_at FAM136A Hs.516077 up 1.60 227818_at CCDC21 Hs.63795 up 1.60 218772_x_at TMEM38B Hs.411925 up 1.60 226608_at C16orf87 Hs.406551 up 1.60 224839_s_at GPT2 Hs.460693 up 1.60 200826_at SNRPD2 Hs.515472 up 1.60 1553970_s_at CEL Hs.533258 up 1.60 200052_s_at ILF2 Hs.75117 up 1.59 219123_at ZNF232 Hs.279914 up 1.59 225196_s_at MRPS26 Hs.18946 up 1.59 219479_at KDELC1 Hs.408629 up 1.59 213423_x_at TUSC3 Hs.591845 up 1.59 230302_at Hs.264606 Hs.264606 up 1.59 227787_s_at MED30 Hs.492612 up 1.59 209302_at POLR2H Hs.432574 up 1.59 223457_at COPG2 Hs.6421 up 1.59 1558136_s_at TAF11 Hs.112444 up 1.59 227103_s_at ECE2 Hs.146161 up 1.59

156

202903_at LSM5 Hs.424908 up 1.59 219928_s_at CABYR Hs.511983 up 1.59 206837_at ALX1 Hs.41683 up 1.59 225527_at CEBPG Hs.429666 up 1.59 232720_at LINGO2 Hs.715650 up 1.59 223290_at PDXP Hs.632762 up 1.59 208998_at UCP2 Hs.80658 up 1.59 219203_at FAM158A Hs.271614 up 1.59 206440_at LIN7A Hs.144333 up 1.59 206645_s_at NR0B1 Hs.268490 up 1.59 227790_at UBE2CBP Hs.148609 up 1.59 208103_s_at ANP32E Hs.656466 up 1.59 241838_at Hs.664732 Hs.664732 up 1.59 37462_i_at SF3A2 Hs.115232 up 1.59 1555487_a_at ACTR3B Hs.647117 up 1.59 235939_at Hs.633186 Hs.633186 up 1.59 1570253_a_at RHEBL1 Hs.159013 up 1.59 224450_s_at RIOK1 Hs.437474 up 1.59 239552_at VWDE Hs.669526 up 1.59 239295_at SFRS13B Hs.254414 up 1.59 209035_at MDK Hs.82045 up 1.59 222943_at GBA3 Hs.653107 up 1.59 230123_at NECAP2 Hs.437385 up 1.59 226775_at ENY2 Hs.492555 up 1.59 228904_at HOXB3 Hs.654560 up 1.58 229892_at EP400NL Hs.122115 up 1.58 226569_s_at CHTF18 Hs.153850 up 1.58 222347_at LOC644450 Hs.652926 up 1.58 219208_at FBXO11 Hs.352677 up 1.58 228171_s_at PLEKHG4 Hs.188781 up 1.58 201566_x_at ID2 Hs.180919 up 1.58 235542_at TET3 Hs.516107 up 1.58 241716_at HSPD1

up 1.58

237304_at SYCE2 Hs.655173 up 1.58 239343_at LOC728705 Hs.129828 up 1.58 219338_s_at LRRC49 Hs.12692 up 1.58 200910_at CCT3 Hs.491494 up 1.58 239792_at LOC440288

up 1.58

219347_at NUDT15 Hs.144407 up 1.58 244189_at LOC284900 Hs.602319 up 1.58 226265_at QSER1 Hs.369368 up 1.58 243531_at ORAOV1 Hs.713628 up 1.58

157

211419_s_at CHN2 Hs.654611 up 1.58 223714_at ZNF256 Hs.596242 up 1.58 208696_at CCT5 Hs.1600 up 1.58 1553479_at TMEM145 Hs.382075 up 1.58 202279_at C14orf2 Hs.109052 up 1.58 208986_at TCF12 Hs.511504 up 1.58 227996_at FARP1 Hs.403917 up 1.58 208784_s_at KLHDC3 Hs.412468 up 1.58 204637_at CGA Hs.119689 up 1.58 1558816_at ZNF664 Hs.524828 up 1.58 219793_at SNX16 Hs.492121 up 1.58 218014_at NUP85 Hs.362817 up 1.58 226355_at POC1A Hs.476306 up 1.58 221507_at TNPO2 Hs.416049 up 1.58 213262_at SACS Hs.159492 up 1.58 205741_s_at DTNA Hs.643454 up 1.58 209218_at SQLE Hs.71465 up 1.57 211750_x_at TUBA1C Hs.719091 up 1.57 205282_at LRP8 Hs.719248 up 1.57 224715_at WDR34 Hs.495240 up 1.57 231936_at HOXC9 Hs.658823 up 1.57 222797_at DPYSL5 Hs.299315 up 1.57 228820_at XPNPEP3 Hs.529163 up 1.57 222993_at MRPL37 Hs.584908 up 1.57 235334_at ST6GALNAC3 Hs.337040 up 1.57 204005_s_at PAWR Hs.643130 up 1.57 1053_at RFC2 Hs.647062 up 1.57 218305_at IPO4 Hs.411865 up 1.57 203109_at UBE2M Hs.406068 up 1.57 217815_at SUPT16H Hs.213724 up 1.57 225335_at ZNF496 Hs.654803 up 1.57 217894_at KCTD3 Hs.335139 up 1.57 242056_at TRIM45 Hs.301526 up 1.57 229351_at Hs.593575 Hs.593575 up 1.57 1557810_at Hs.668300 Hs.668300 up 1.57 219446_at RIC8B Hs.131306 up 1.57 1555281_x_at ARMC8 Hs.719108 up 1.57 219823_at LIN28A Hs.86154 up 1.57 244418_at Hs.661303 Hs.661303 up 1.57 226670_s_at PABPC1L Hs.641481 up 1.57 227283_at EFR3B Hs.4892 up 1.57 225686_at SKA2 Hs.463607 up 1.57

158

225362_at FAM122B Hs.404706 up 1.57 1554063_at C8orf76 Hs.521800 up 1.57 217499_x_at OR7E37P

up 1.57

204775_at CHAF1B Hs.75238 up 1.57 228357_at UNK Hs.584768 up 1.57 206686_at PDK1 Hs.470633 up 1.57 235333_at B4GALT6 Hs.591063 up 1.57 218708_at NXT1 Hs.516933 up 1.57 210240_s_at CDKN2D Hs.435051 up 1.57 235501_at Hs.660369 Hs.660369 up 1.57 225501_at PHF6 Hs.356501 up 1.57 229651_at SEZ6 Hs.21837 up 1.57 202003_s_at ACAA2

up 1.56

218529_at CD320 Hs.558499 up 1.56 233173_x_at GTF3C5 Hs.495417 up 1.56 204850_s_at DCX Hs.34780 up 1.56 214280_x_at HNRNPA1 Hs.546261 up 1.56 1564520_s_at PRMT5 Hs.367854 up 1.56 226215_s_at KDM2B Hs.524800 up 1.56 221952_x_at TRMT5 Hs.380159 up 1.56 226087_at LZIC Hs.327252 up 1.56 218982_s_at ZNF713 Hs.660834 up 1.56 222894_x_at C20orf7 Hs.472165 up 1.56 228090_at NMNAT3 Hs.208673 up 1.56 229332_at HPDL Hs.162717 up 1.56 219619_at DIRAS2 Hs.165636 up 1.56 207719_x_at CEP170 Hs.533635 up 1.56 212032_s_at PTOV1 Hs.587979 up 1.56 200623_s_at CALM3 Hs.515487 up 1.56 225943_at NLN Hs.247460 up 1.56 218365_s_at DARS2 Hs.647707 up 1.56 219616_at ACSS3 Hs.259559 up 1.56 225722_at Hs.675831 Hs.675831 up 1.56 225890_at C20orf72 Hs.320823 up 1.56 209524_at HDGFRP3 Hs.513954 up 1.56 218979_at RMI1 Hs.284137 up 1.56 240312_at LOC389895 Hs.127679 up 1.56 206601_s_at HOXD3 Hs.93574 up 1.56 210198_s_at PLP1 Hs.1787 up 1.56 214086_s_at PARP2 Hs.409412 up 1.56 203795_s_at BCL7A Hs.530970 up 1.56 239451_at Hs.658060 Hs.658060 up 1.55

159

232899_at FAM41C Hs.449006 up 1.55 201266_at TXNRD1 Hs.708065 up 1.55 219294_at CENPQ Hs.88663 up 1.55 241693_at Hs.660537 Hs.660537 up 1.55 226285_at CAPRIN1 Hs.471818 up 1.55 1555501_s_at RSRC1 Hs.591283 up 1.55 228930_at SCARNA15 Hs.513091 up 1.55 210250_x_at ADSL Hs.75527 up 1.55 203316_s_at SNRPE Hs.334612 up 1.55 204795_at PRR3 Hs.118354 up 1.55 220253_s_at LRP12 Hs.600630 up 1.55 243624_at PIAS2 Hs.658013 up 1.55 242586_at FSD1L Hs.136901 up 1.55 218281_at MRPL48 Hs.503239 up 1.55 219786_at MTL5 Hs.145932 up 1.55 210542_s_at SLCO3A1 Hs.311187 up 1.55 219556_at C16orf59 Hs.534491 up 1.55 219152_at PODXL2 Hs.591290 up 1.55 220277_at CXXC4 Hs.12248 up 1.55 227896_at BCCIP Hs.715543 up 1.55 200607_s_at RAD21 Hs.81848 up 1.55 213761_at MDM1 Hs.655702 up 1.55 223413_s_at LYAR Hs.425427 up 1.55 202036_s_at SFRP1 Hs.713546 up 1.55 236273_at NBPF1 Hs.467587 up 1.55 236591_at Hs.719351 Hs.719351 up 1.55 210410_s_at MSH5 Hs.647011 up 1.55 205395_s_at MRE11A Hs.192649 up 1.55 227035_x_at RP9P Hs.648086 up 1.55 206055_s_at SNRPA1 Hs.528763 up 1.55 205774_at F12 Hs.1321 up 1.55 212247_at NUP205 Hs.632299 up 1.55 242470_at EID2B Hs.135181 up 1.54 1560579_s_at Hs.418285 Hs.418285 up 1.54 209323_at PRKRIR Hs.503315 up 1.54 219162_s_at MRPL11 Hs.418450 up 1.54 203235_at THOP1 Hs.78769 up 1.54 235205_at LOC346887 Hs.127286 up 1.54 225592_at NRM Hs.519993 up 1.54 202737_s_at LSM4 Hs.515255 up 1.54 239253_at Hs.499682 Hs.499682 up 1.54 212955_s_at POLR2I Hs.47062 up 1.54

160

235048_at FAM169A Hs.91662 up 1.54 223035_s_at FARSB Hs.471452 up 1.54 244786_at SNHG10 Hs.448753 up 1.54 227650_at HSPA14 Hs.534169 up 1.54 201115_at POLD2 Hs.306791 up 1.54 230304_at Hs.143408 Hs.143408 up 1.54 222921_s_at HEY2 Hs.144287 up 1.54 216194_s_at TBCB Hs.31053 up 1.54 226723_at CCDC23 Hs.113919 up 1.54 204807_at TMEM5 Hs.216386 up 1.54 202408_s_at PRPF31 Hs.515598 up 1.54 216602_s_at FARSA Hs.23111 up 1.54 244364_at MYO3A Hs.662630 up 1.54 219739_at RNF186 Hs.124835 up 1.54 205129_at NPM3 Hs.90691 up 1.54 205728_at Hs.537002 Hs.537002 up 1.54 219951_s_at C20orf12 Hs.472225 up 1.54 243762_at Hs.634204 Hs.634204 up 1.53 226619_at SENP1 Hs.719362 up 1.53 230303_at SYNPR Hs.648668 up 1.53 203119_at CCDC86 Hs.4253 up 1.53 1554155_at MCPH1 Hs.709634 up 1.53 1554557_at ATP11B Hs.478429 up 1.53 1555764_s_at TIMM10 Hs.235750 up 1.53 236766_at Hs.624661 Hs.624661 up 1.53 235520_at ZNF280C Hs.308418 up 1.53 239282_at CCDC41 Hs.279209 up 1.53 209507_at RPA3 Hs.487540 up 1.53 1553099_at TIGD1 Hs.211823 up 1.53 231894_at Hs.656334 Hs.656334 up 1.53 219143_s_at RPP25 Hs.8562 up 1.53 225547_at SNHG6 Hs.372680 up 1.53 202487_s_at H2AFV Hs.488189 up 1.53 233713_at Hs.660880 Hs.660880 up 1.53 237299_at Hs.633025 Hs.633025 up 1.53 224767_at RPL37 Hs.80545 up 1.53 216323_x_at TUBA3D Hs.503749 up 1.53 203775_at SLC25A13 Hs.489190 up 1.53 235275_at BMP8B Hs.664022 up 1.53 212684_at ZNF3 Hs.435302 up 1.53 207891_s_at TREX2 Hs.644635 up 1.53 202309_at MTHFD1 Hs.652308 up 1.53

161

239293_at NRSN1 Hs.49230 up 1.53 210320_s_at DDX52 Hs.590937 up 1.53 226797_at MBTD1 Hs.656803 up 1.53 214700_x_at RIF1 Hs.655671 up 1.53 231808_at LOC729082 Hs.380164 up 1.53 236030_at RCOR2 Hs.98788 up 1.53 205644_s_at SNRPG Hs.465167 up 1.53 219030_at TPRKB Hs.157401 up 1.53 228783_at BVES Hs.221660 up 1.53 238856_s_at PANK2 Hs.516859 up 1.53 219061_s_at LAGE3 Hs.444619 up 1.53 228053_s_at TOMM5 Hs.130774 up 1.53 231827_at Hs.656451 Hs.656451 up 1.53 41037_at TEAD4 Hs.94865 up 1.53 244726_at Hs.669961 Hs.669961 up 1.53 1558522_at Hs.594275 Hs.594275 up 1.53 1553698_a_at C1orf96 Hs.715507 up 1.53 209431_s_at PATZ1 Hs.517557 up 1.53 228662_at SOCS7 Hs.514132 up 1.53 202264_s_at TOMM40 Hs.655909 up 1.52 211701_s_at TRO Hs.633653 up 1.52 235004_at RBM24 Hs.519904 up 1.52 204805_s_at H1FX Hs.75307 up 1.52 208627_s_at YBX1 Hs.473583 up 1.52 228557_at L3MBTL4 Hs.128279 up 1.52 202505_at SNRPB2 Hs.280378 up 1.52 233401_at Hs.636858 Hs.636858 up 1.52 236555_at LOC643749 Hs.657289 up 1.52 206626_x_at SSX1 Hs.694472 up 1.52 213330_s_at STIP1 Hs.337295 up 1.52 210230_at Hs.464404 Hs.464404 up 1.52 203239_s_at CNOT3 Hs.343571 up 1.52 225291_at PNPT1 Hs.388733 up 1.52 1569283_at LOC440122 Hs.614816 up 1.52 207332_s_at TFRC Hs.529618 up 1.52 221987_s_at TSR1 Hs.388170 up 1.52 243001_at C18orf22 Hs.593610 up 1.52 208969_at NDUFA9 Hs.75227 up 1.52 222309_at C6orf62 Hs.519930 up 1.52 241262_at Hs.666209 Hs.666209 up 1.52 218219_s_at LANCL2 Hs.595384 up 1.52 213671_s_at MARS Hs.632707 up 1.52

162

1559132_at TMEM80 Hs.448664 up 1.52 217919_s_at MRPL42 Hs.199579 up 1.52 229289_at FAM71E1 Hs.448941 up 1.52 222875_at DHX33 Hs.250456 up 1.52 212165_at TMEM183A Hs.652908 up 1.52 229075_at SPATA5 Hs.709648 up 1.52 204299_at SFRS13A Hs.3530 up 1.52 235588_at ESCO2 Hs.99480 up 1.52 212680_x_at PPP1R14B Hs.523760 up 1.52 238508_at DBF4B Hs.369998 up 1.52 219296_at ZDHHC13 Hs.188569 up 1.51 1556613_s_at LOC203107

up 1.51

206280_at CDH18 Hs.317632 up 1.51 228859_at LOC91431 Hs.444338 up 1.51 203177_x_at TFAM Hs.642966 up 1.51 223491_at COMMD2 Hs.591315 up 1.51 1555074_a_at KCNH5 Hs.27043 up 1.51 239538_at ZRANB3 Hs.658422 up 1.51 243804_at MTMR7 Hs.625674 up 1.51 229870_at LOC644656 Hs.597846 up 1.51 226470_at GGT7 Hs.433738 up 1.51 204432_at SOX12 Hs.43627 up 1.51 227037_at PLD6 Hs.31652 up 1.51 208973_at ERI3 Hs.132497 up 1.51 203931_s_at MRPL12 Hs.109059 up 1.51 212983_at HRAS Hs.37003 up 1.51 219752_at RASAL1 Hs.528693 up 1.51 228183_s_at RPAIN Hs.462086 up 1.51 213449_at POP1 Hs.252828 up 1.51 218712_at C1orf109 Hs.272673 up 1.51 226909_at ZNF518B Hs.455089 up 1.51 1561378_at C12orf42 Hs.534649 up 1.51 213054_at HAUS5 Hs.7426 up 1.51 221652_s_at C12orf11 Hs.505077 up 1.51 228433_at NFYA Hs.10441 up 1.51 226121_at DHRS13 Hs.631760 up 1.51 225703_at FBRSL1 Hs.411138 up 1.51 208977_x_at TUBB2C Hs.433615 up 1.51 218590_at C10orf2 Hs.22678 up 1.51 227072_at RTTN Hs.654809 up 1.51 202078_at COPS3 Hs.6076 up 1.51 243372_at HSPD1P4 Hs.648223 up 1.51

163

221264_s_at TARDBP Hs.300624 up 1.51 218395_at ACTR6 Hs.115088 up 1.51 239144_at B3GAT2 Hs.713609 up 1.51 213170_at GPX7 Hs.43728 up 1.51 203298_s_at JARID2 Hs.630189 up 1.51 214727_at BRCA2 Hs.34012 up 1.51 215128_at Hs.191828 Hs.191828 up 1.51 230653_at LOC100132218 Hs.671710 up 1.50 210371_s_at RBBP4 Hs.16003 up 1.50 208972_s_at ATP5G1 Hs.80986 up 1.50 201327_s_at CCT6A Hs.82916 up 1.50 209478_at STRA13 Hs.37616 up 1.50 213971_s_at SUZ12 Hs.628886 up 1.50 229889_at C17orf76 Hs.25425 up 1.50 209523_at TAF2 Hs.122752 up 1.50 214655_at GPR6 Hs.46332 up 1.50 209537_at EXTL2 Hs.357637 up 1.50 218447_at C16orf61 Hs.388255 up 1.50 1558330_x_at NFKBIL2 Hs.675285 up 1.50 236265_at SP4 Hs.88013 up 1.50 239228_at Hs.663391 Hs.663391 up 1.50 214862_x_at Hs.598166 Hs.598166 up 1.50 229520_s_at C14orf118 Hs.410231 up 1.50 1559033_at LOC255167 Hs.435515 up 1.50 210024_s_at UBE2E3 Hs.470804 up 1.50 204977_at DDX10 Hs.591931 up 1.50 237096_at Hs.668071 Hs.668071 up 1.50 226308_at HAUS8 Hs.404088 up 1.50 221842_s_at ZNF131 Hs.535804 up 1.50 226728_at SLC27A1 Hs.363138 down -1.50 237206_at MYOCD Hs.567641 down -1.50 210785_s_at C1orf38 Hs.10649 down -1.50 228890_at ATOH8 Hs.135569 down -1.50 226206_at MAFK Hs.520612 down -1.50 225076_s_at ZNFX1 Hs.371794 down -1.50 235256_s_at GALM Hs.435012 down -1.50 203467_at PMM1 Hs.75835 down -1.50 214450_at CTSW Hs.416848 down -1.50 228665_at CYYR1 Hs.37445 down -1.50 205407_at RECK Hs.388918 down -1.50 226066_at MITF Hs.166017 down -1.50 233020_at Hs.661819 Hs.661819 down -1.50

164

213352_at TMCC1 Hs.477547 down -1.50 231835_at C1orf93 Hs.462033 down -1.50 1552667_a_at SH2D3C Hs.306412 down -1.50 204468_s_at TIE1 Hs.78824 down -1.50 212415_at Hs.496666 Hs.496666 down -1.50 219186_at ZBTB7A Hs.591384 down -1.50 224576_at ERGIC1 Hs.509163 down -1.50 225273_at WWC3 Hs.527524 down -1.50 230265_at SEL1L Hs.181300 down -1.51 220356_at CORIN Hs.518618 down -1.51 225867_at VASN Hs.372579 down -1.51 202524_s_at SPOCK2 Hs.523009 down -1.51 213268_at CAMTA1 Hs.397705 down -1.51 227184_at Hs.77542 Hs.77542 down -1.51 244745_at RERG Hs.199487 down -1.51 212695_at CRY2 Hs.532491 down -1.51 1554462_a_at DNAJB9 Hs.6790 down -1.51 228304_at RBM43 Hs.302442 down -1.51 201312_s_at SH3BGRL Hs.108029 down -1.51 232125_at Hs.587185 Hs.587185 down -1.51 227721_at CPAMD8 Hs.631644 down -1.51 228450_at PLEKHA7 Hs.12332 down -1.51 1561180_at Hs.708749 Hs.708749 down -1.51 226985_at FGD5 Hs.412406 down -1.51 230104_s_at TPPP Hs.481466 down -1.51 220992_s_at C1orf25 Hs.107149 down -1.51 235095_at CCDC64B Hs.513285 down -1.51 205379_at CBR3 Hs.154510 down -1.51 227290_at Hs.60257 Hs.60257 down -1.51 208890_s_at PLXNB2 Hs.3989 down -1.51 212326_at VPS13D Hs.439381 down -1.51 205821_at KLRK1 Hs.387787 down -1.51 223599_at TRIM6 Hs.125300 down -1.51 202947_s_at GYPC Hs.59138 down -1.51 216950_s_at FCGR1C Hs.635062 down -1.51 224746_at KIAA1522 Hs.591502 down -1.51 220132_s_at CLEC2D Hs.268326 down -1.51 206584_at LY96 Hs.660766 down -1.51 212641_at HIVEP2 Hs.510172 down -1.51 238852_at Hs.657841 Hs.657841 down -1.51 226594_at Hs.655070 Hs.655070 down -1.51 228754_at SLC6A6 Hs.529488 down -1.51

165

227947_at PHACTR2 Hs.102471 down -1.51 202096_s_at TSPO Hs.202 down -1.51 226796_at ABHD15 Hs.106510 down -1.51 238478_at BNC2 Hs.656581 down -1.51 228220_at FCHO2 Hs.719247 down -1.51 209723_at SERPINB9 Hs.104879 down -1.51 211434_s_at CCRL2 Hs.535713 down -1.51 1559322_at LOC727916 Hs.706850 down -1.51 227701_at C10orf118 Hs.159066 down -1.51 212223_at IDS Hs.460960 down -1.51 237484_at C12orf69 Hs.220931 down -1.51 236922_at Hs.126889 Hs.126889 down -1.51 209770_at BTN3A1 Hs.191510 down -1.51 215813_s_at PTGS1 Hs.201978 down -1.51 228910_at Hs.634153 Hs.634153 down -1.52 238063_at TMEM154 Hs.518900 down -1.52 206263_at FMO4 Hs.386502 down -1.52 205011_at VWA5A Hs.152944 down -1.52 225869_s_at UNC93B1 Hs.502989 down -1.52 213093_at PRKCA Hs.531704 down -1.52 219064_at ITIH5 Hs.498586 down -1.52 209906_at C3AR1 Hs.591148 down -1.52 235308_at ZBTB20 Hs.655108 down -1.52 233085_s_at OBFC2A Hs.591610 down -1.52 212458_at SPRED2 Hs.59332 down -1.52 209901_x_at AIF1 Hs.76364 down -1.52 1555847_a_at LOC284454 Hs.436426 down -1.52 229021_at MCTP2 Hs.592017 down -1.52 37408_at MRC2 Hs.7835 down -1.52 201034_at ADD3 Hs.501012 down -1.52 200675_at CD81 Hs.54457 down -1.52 215185_at Hs.529860 Hs.529860 down -1.52 1569225_a_at SCML4 Hs.486109 down -1.52 217852_s_at ARL8B Hs.719100 down -1.52 204122_at TYROBP Hs.515369 down -1.52 225615_at IFFO2 Hs.466625 down -1.52 235857_at KCTD11 Hs.592112 down -1.52 221760_at MAN1A1 Hs.102788 down -1.52 230422_at FPR3 Hs.445466 down -1.52 203045_at NINJ1 Hs.494457 down -1.52 204085_s_at CLN5 Hs.30213 down -1.52 218805_at GIMAP5 Hs.647079 down -1.52

166

205641_s_at TRADD Hs.460996 down -1.52 213915_at NKG7 Hs.10306 down -1.52 205627_at CDA Hs.466910 down -1.52 201204_s_at RRBP1 Hs.472213 down -1.52 204829_s_at FOLR2 Hs.433159 down -1.52 225796_at PXK Hs.190544 down -1.52 200736_s_at GPX1 Hs.76686 down -1.52 229287_at PCNX Hs.446559 down -1.52 227177_at CORO2A Hs.113094 down -1.52 202724_s_at FOXO1 Hs.370666 down -1.52 220987_s_at C11orf17 Hs.131180 down -1.52 216191_s_at TRD@ Hs.74647 down -1.52 221790_s_at LDLRAP1 Hs.590911 down -1.52 213652_at PCSK5 Hs.368542 down -1.52 225369_at ESAM Hs.173840 down -1.52 1559883_s_at SAMHD1 Hs.580681 down -1.52 205037_at IFT27 Hs.415172 down -1.52 218078_s_at ZDHHC3 Hs.61430 down -1.52 212717_at PLEKHM1 Hs.514242 down -1.52 219452_at DPEP2 Hs.372633 down -1.52 202862_at FAH Hs.73875 down -1.52 210550_s_at RASGRF1 Hs.459035 down -1.52 203771_s_at BLVRA Hs.488143 down -1.52 204204_at SLC31A2 Hs.24030 down -1.53 214866_at PLAUR Hs.466871 down -1.53 238720_at OMG Hs.113874 down -1.53 204800_s_at DHRS12 Hs.266728 down -1.53 204503_at EVPL Hs.500635 down -1.53 203471_s_at PLEK Hs.468840 down -1.53 AFFX-HUMISGF3A/M97935_5_at STAT1 Hs.715518 down -1.53 227125_at Hs.709795 Hs.709795 down -1.53 208621_s_at EZR Hs.487027 down -1.53 203139_at DAPK1 Hs.380277 down -1.53 204306_s_at CD151 Hs.654379 down -1.53 235122_at HIVEP3 Hs.715958 down -1.53 218164_at SPATA20 Hs.103147 down -1.53 216347_s_at PPP1R13B Hs.709297 down -1.53 227492_at Hs.654872 Hs.654872 down -1.53 200678_x_at GRN Hs.514220 down -1.53 219045_at RHOF Hs.524804 down -1.53 224516_s_at CXXC5 Hs.189119 down -1.53 207387_s_at GK Hs.1466 down -1.53

167

236534_at BNIPL Hs.591473 down -1.53 201201_at CSTB Hs.695 down -1.53 212764_at ZEB1 Hs.124503 down -1.53 227791_at SLC9A9 Hs.302257 down -1.53 228469_at PPID Hs.581725 down -1.53 1555731_a_at AP1S3 Hs.632555 down -1.53 206049_at SELP Hs.73800 down -1.53 230053_at Hs.44811 Hs.44811 down -1.53 207069_s_at SMAD6 Hs.153863 down -1.53 223580_at SPSB2 Hs.479856 down -1.53 226695_at PRRX1 Hs.283416 down -1.53 210886_x_at TP53TG1 Hs.274329 down -1.53 205351_at GGCX Hs.77719 down -1.53 1559072_a_at ELFN2 Hs.660812 down -1.53 202191_s_at GAS7 Hs.462214 down -1.53 229720_at BAG1 Hs.377484 down -1.53 202351_at ITGAV Hs.436873 down -1.53 209733_at MID2 Hs.12256 down -1.54 214202_at Hs.594968 Hs.594968 down -1.54 223159_s_at NEK6 Hs.197071 down -1.54 205922_at VNN2 Hs.293130 down -1.54 239673_at Hs.664073 Hs.664073 down -1.54 227126_at Hs.594755 Hs.594755 down -1.54 203157_s_at GLS Hs.116448 down -1.54 203603_s_at ZEB2 Hs.34871 down -1.54 228150_at SEC16B Hs.709633 down -1.54 242733_at Hs.660508 Hs.660508 down -1.54 203592_s_at FSTL3 Hs.529038 down -1.54 214770_at MSR1 Hs.147635 down -1.54 213001_at ANGPTL2 Hs.653262 down -1.54 234306_s_at SLAMF7 Hs.517265 down -1.54 220122_at MCTP1 Hs.655087 down -1.54 213462_at NPAS2 Hs.156832 down -1.54 236279_at Hs.659129 Hs.659129 down -1.54 240118_at Hs.668815 Hs.668815 down -1.54 212494_at TENC1 Hs.6147 down -1.54 219505_at CECR1 Hs.170310 down -1.54 56256_at SIDT2 Hs.712144 down -1.54 204269_at PIM2 Hs.719294 down -1.54 203384_s_at GOLGA1 Hs.133469 down -1.54 217795_s_at TMEM43 Hs.517817 down -1.54 221551_x_at ST6GALNAC4 Hs.3972 down -1.54

168

203002_at AMOTL2 Hs.426312 down -1.54 212636_at QKI Hs.510324 down -1.54 218606_at ZDHHC7 Hs.592065 down -1.54 204961_s_at NCF1C Hs.648940 down -1.54 209960_at HGF Hs.396530 down -1.54 201295_s_at WSB1 Hs.446017 down -1.54 218487_at ALAD Hs.1227 down -1.54 213716_s_at SECTM1 Hs.558009 down -1.54 224762_at SERINC2 Hs.270655 down -1.54 235076_at CALCOCO2 Hs.514920 down -1.54 229011_at Hs.594584 Hs.594584 down -1.54 207686_s_at CASP8 Hs.599762 down -1.54 220066_at NOD2 Hs.592072 down -1.54 221867_at N4BP1 Hs.511839 down -1.54 219033_at PARP8 Hs.369581 down -1.54 205180_s_at ADAM8 Hs.501574 down -1.54 228258_at TBC1D10C Hs.534648 down -1.54 222793_at DDX58 Hs.190622 down -1.54 218191_s_at LMBRD1 Hs.271643 down -1.55 202430_s_at PLSCR1 Hs.130759 down -1.55 202440_s_at ST5 Hs.117715 down -1.55 210118_s_at IL1A Hs.1722 down -1.55 228718_at ZNF44

down -1.55

214511_x_at FCGR1B Hs.534956 down -1.55 222571_at ST6GALNAC6 Hs.109672 down -1.55 203243_s_at PDLIM5 Hs.480311 down -1.55 212377_s_at NOTCH2 Hs.487360 down -1.55 223809_at RGS18 Hs.440890 down -1.55 205792_at WISP2 Hs.592145 down -1.55 230769_at DENND2C Hs.654928 down -1.55 225080_at MYO1C Hs.286226 down -1.55 1554899_s_at FCER1G Hs.433300 down -1.55 206974_at CXCR6 Hs.34526 down -1.55 221724_s_at CLEC4A Hs.504657 down -1.55 212239_at PIK3R1 Hs.132225 down -1.55 208914_at GGA2 Hs.460336 down -1.55 229070_at C6orf105 Hs.126409 down -1.55 201944_at HEXB Hs.69293 down -1.55 226239_at TMEM150A Hs.591559 down -1.55 57540_at RBKS

down -1.55

227799_at MYO1G Hs.37617 down -1.55 213429_at Hs.100261 Hs.100261 down -1.55

169

201536_at DUSP3 Hs.181046 down -1.55 209457_at DUSP5 Hs.2128 down -1.55 210692_s_at SLC43A3 Hs.99962 down -1.55 235438_at Hs.657330 Hs.657330 down -1.55 204570_at COX7A1 Hs.421621 down -1.55 201850_at CAPG Hs.516155 down -1.55 202239_at PARP4 Hs.718412 down -1.55 207761_s_at METTL7A Hs.716437 down -1.55 1568619_s_at ITPRIPL2 Hs.648523 down -1.55 224893_at ATL3 Hs.356719 down -1.55 210321_at GZMH Hs.348264 down -1.55 228702_at FLJ43663 Hs.150556 down -1.55 202289_s_at TACC2 Hs.501252 down -1.55 203236_s_at LGALS9 Hs.81337 down -1.56 230142_s_at CIRBP Hs.634522 down -1.56 1552733_at KLHDC1 Hs.509258 down -1.56 201349_at SLC9A3R1 Hs.711846 down -1.56 219789_at NPR3 Hs.237028 down -1.56 32837_at AGPAT2 Hs.320151 down -1.56 226279_at PRSS23 Hs.25338 down -1.56 208296_x_at TNFAIP8 Hs.656274 down -1.56 203332_s_at INPP5D Hs.262886 down -1.56 222581_at XPR1 Hs.227656 down -1.56 212890_at SLC38A10 Hs.352240 down -1.56 205313_at HNF1B Hs.191144 down -1.56 200766_at CTSD Hs.121575 down -1.56 226101_at PRKCE Hs.580351 down -1.56 204220_at GMFG Hs.5210 down -1.56 201473_at JUNB Hs.25292 down -1.56 91826_at EPS8L1 Hs.438862 down -1.56 209740_s_at PNPLA4 Hs.264 down -1.56 232591_s_at TMEM30A Hs.108530 down -1.56 235670_at STX11 Hs.118958 down -1.56 203185_at RASSF2 Hs.631504 down -1.56 231124_x_at LY9 Hs.403857 down -1.56 230744_at Hs.42419 Hs.42419 down -1.56 201862_s_at LRRFIP1 Hs.471779 down -1.56 214318_s_at FRY Hs.507669 down -1.56 222572_at PDP1 Hs.22265 down -1.56 205987_at CD1C Hs.132448 down -1.56 219360_s_at TRPM4 Hs.467101 down -1.56 205904_at MICA Hs.130838 down -1.56

170

1558080_s_at DNAJC3 Hs.59214 down -1.56 212143_s_at IGFBP3 Hs.450230 down -1.56 227265_at FGL2 Hs.520989 down -1.56 239150_at SNTN Hs.130704 down -1.56 203778_at MANBA Hs.480415 down -1.56 225955_at LOC653506 Hs.591142 down -1.56 206544_x_at SMARCA2 Hs.298990 down -1.56 226675_s_at MALAT1 Hs.642877 down -1.56 242033_at RNF180 Hs.657843 down -1.56 214823_at ZNF204P Hs.8198 down -1.56 229937_x_at LILRB1 Hs.667388 down -1.56 204118_at CD48 Hs.243564 down -1.56 204960_at PTPRCAP Hs.155975 down -1.56 234932_s_at CDCP1 Hs.476093 down -1.56 226203_at Hs.513000 Hs.513000 down -1.56 222394_at PDCD6IP Hs.475896 down -1.56 210258_at RGS13 Hs.497220 down -1.57 215243_s_at GJB3 Hs.522561 down -1.57 201847_at LIPA Hs.643030 down -1.57 206277_at P2RY2 Hs.339 down -1.57 206666_at GZMK Hs.277937 down -1.57 203766_s_at LMOD1 Hs.519075 down -1.57 222162_s_at ADAMTS1 Hs.643357 down -1.57 226381_at PS1TP4 Hs.355655 down -1.57 228531_at SAMD9 Hs.65641 down -1.57 217504_at ABCA6 Hs.709514 down -1.57 210279_at GPR18 Hs.631765 down -1.57 226056_at ARHGAP31 Hs.668218 down -1.57 218353_at RGS5 Hs.24950 down -1.57 220428_at CD207 Hs.199731 down -1.57 229678_at LOC728431 Hs.380738 down -1.57 210276_s_at TRIOBP Hs.533030 down -1.57 235157_at Hs.664716 Hs.664716 down -1.57 218396_at VPS13C Hs.511668 down -1.57 1554648_a_at DUOXA1 Hs.356664 down -1.57 205101_at CIITA Hs.701991 down -1.57 228185_at ZNF25 Hs.499429 down -1.57 228434_at BTNL9 Hs.546502 down -1.57 243179_at LOC100130360 Hs.408455 down -1.57 229055_at GPR68 Hs.8882 down -1.57 219054_at C5orf23 Hs.13528 down -1.57 202481_at DHRS3 Hs.289347 down -1.57

171

219519_s_at SIGLEC1 Hs.31869 down -1.57 236583_at Hs.662802 Hs.662802 down -1.57 204081_at NRGN Hs.524116 down -1.57 221935_s_at C3orf64 Hs.518059 down -1.57 228058_at ZG16B Hs.105887 down -1.57 227046_at SLC39A11 Hs.221127 down -1.57 225525_at KIAA1671 Hs.419171 down -1.57 225618_at ARHGAP27 Hs.463165 down -1.57 226244_at CLEC14A Hs.525307 down -1.57 201360_at CST3 Hs.304682 down -1.57 210056_at RND1 Hs.124940 down -1.58 230349_at XKRX Hs.592216 down -1.58 230951_at Hs.369232 Hs.369232 down -1.58 205726_at DIAPH2 Hs.226483 down -1.58 226846_at PHYHD1 Hs.709447 down -1.58 213539_at CD3D Hs.504048 down -1.58 241353_s_at LOC100129105 Hs.131743 down -1.58 212509_s_at MXRA7 Hs.250723 down -1.58 206082_at HCP5 Hs.654480 down -1.58 38149_at ARHGAP25 Hs.531807 down -1.58 224707_at C5orf32 Hs.529798 down -1.58 200796_s_at MCL1 Hs.719112 down -1.58 204608_at ASL Hs.632015 down -1.58 236979_at BCL2L15 Hs.123106 down -1.58 235568_at C19orf59 Hs.709539 down -1.58 212646_at RFTN1 Hs.98910 down -1.58 222877_at Hs.660596 Hs.660596 down -1.58 219725_at TREM2 Hs.435295 down -1.58 202788_at MAPKAPK3 Hs.234521 down -1.58 218983_at C1RL Hs.631730 down -1.58 221816_s_at PHF11 Hs.369039 down -1.58 226160_at H6PD Hs.463511 down -1.58 220244_at LOH3CR2A Hs.591661 down -1.58 210944_s_at CAPN3 Hs.143261 down -1.58 213375_s_at N4BP2L1 Hs.161220 down -1.58 220761_s_at TAOK3 Hs.644420 down -1.58 201236_s_at BTG2 Hs.519162 down -1.58 229764_at TPRG1 Hs.338851 down -1.58 212812_at Hs.288232 Hs.288232 down -1.58 203887_s_at THBD Hs.2030 down -1.58 213746_s_at FLNA Hs.195464 down -1.58 236575_at Hs.370221 Hs.370221 down -1.58

172

218731_s_at VWA1 Hs.449009 down -1.58 203148_s_at TRIM14 Hs.575631 down -1.58 226908_at LRIG3 Hs.715683 down -1.58 241891_at Hs.663286 Hs.663286 down -1.58 235592_at Hs.656129 Hs.656129 down -1.58 1554285_at HAVCR2 Hs.710500 down -1.58 220088_at C5AR1 Hs.2161 down -1.58 208130_s_at TBXAS1 Hs.520757 down -1.58 227095_at Hs.655605 Hs.655605 down -1.58 219593_at SLC15A3 Hs.237856 down -1.58 224814_at DPP7 Hs.37916 down -1.58 203104_at CSF1R Hs.586219 down -1.58 208789_at PTRF Hs.437191 down -1.58 213069_at HEG1 Hs.477420 down -1.58 208126_s_at CYP2C18 Hs.511872 down -1.58 213247_at SVEP1 Hs.522334 down -1.58 210716_s_at CLIP1 Hs.524809 down -1.58 1556658_a_at Hs.687293 Hs.687293 down -1.58 211922_s_at CAT Hs.502302 down -1.58 223199_at MKNK2 Hs.515032 down -1.58 215603_x_at GGT3P Hs.568255 down -1.58 231093_at FCRL3 Hs.292449 down -1.58 209734_at NCKAP1L Hs.182014 down -1.59 202283_at SERPINF1 Hs.694727 down -1.59 215464_s_at TAX1BP3 Hs.12956 down -1.59 209919_x_at GGT1 Hs.645535 down -1.59 227889_at LPCAT2 Hs.460857 down -1.59 1552612_at CDC42SE2 Hs.508829 down -1.59 236322_at Hs.661081 Hs.661081 down -1.59 205891_at ADORA2B Hs.167046 down -1.59 235649_at ADAMTS8 Hs.271605 down -1.59 205866_at FCN3 Hs.333383 down -1.59 217783_s_at YPEL5 Hs.515890 down -1.59 229432_at NAGS Hs.8876 down -1.59 229620_at SEPP1 Hs.275775 down -1.59 214040_s_at GSN Hs.522373 down -1.59 211749_s_at VAMP3 Hs.66708 down -1.59 225536_at TMEM54 Hs.534521 down -1.59 210116_at SH2D1A Hs.349094 down -1.59 206420_at IGSF6 Hs.530902 down -1.59 223019_at FAM129B Hs.522401 down -1.59 217436_x_at HLA-A Hs.181244 down -1.59

173

209341_s_at IKBKB Hs.597664 down -1.59 210705_s_at TRIM5 Hs.370515 down -1.59 220013_at EPHX3 Hs.156457 down -1.59 210140_at CST7 Hs.143212 down -1.59 225496_s_at SYTL2 Hs.369520 down -1.59 227002_at FAM78A Hs.143878 down -1.59 204677_at CDH5 Hs.76206 down -1.59 225327_at KIAA1370 Hs.152385 down -1.59 215990_s_at BCL6 Hs.478588 down -1.59 1553960_at SNX21 Hs.472854 down -1.59 209101_at CTGF Hs.591346 down -1.59 206172_at IL13RA2 Hs.336046 down -1.59 216092_s_at SLC7A8 Hs.632348 down -1.59 214720_x_at Hs.469615 Hs.469615 down -1.59 235372_at FCRLA Hs.266331 down -1.59 218870_at ARHGAP15 Hs.171011 down -1.59 36920_at MTM1 Hs.655056 down -1.59 206983_at CCR6 Hs.46468 down -1.59 244026_at Hs.604381 Hs.604381 down -1.59 227838_at Hs.388565 Hs.388565 down -1.59 225411_at TMEM87B Hs.656298 down -1.59 218966_at MYO5C Hs.487036 down -1.59 225840_at TEF Hs.181159 down -1.59 228479_at Hs.445588 Hs.445588 down -1.59 239349_at C1QTNF7 Hs.153714 down -1.59 205611_at TNFSF12

down -1.59

238657_at UBXN10 Hs.432503 down -1.59 212420_at ELF1 Hs.135646 down -1.60 218284_at SMAD3 Hs.618504 down -1.60 31874_at GAS2L1 Hs.322852 down -1.60 204472_at GEM Hs.654463 down -1.60 221045_s_at PER3 Hs.162200 down -1.60 203879_at PIK3CD Hs.518451 down -1.60 220495_s_at TXNDC15 Hs.696335 down -1.60 212230_at PPAP2B Hs.405156 down -1.60 213900_at FAM189A2 Hs.118003 down -1.60 219386_s_at SLAMF8 Hs.438683 down -1.60 206637_at P2RY14 Hs.2465 down -1.60 218736_s_at PALMD Hs.483993 down -1.60 228731_at Hs.24321 Hs.24321 down -1.60 201655_s_at HSPG2 Hs.562227 down -1.60 219620_x_at C9orf167 Hs.495541 down -1.60

174

212667_at SPARC Hs.111779 down -1.60 201171_at ATP6V0E1 Hs.484188 down -1.60 226850_at SUMF1 Hs.350475 down -1.60 201331_s_at STAT6 Hs.524518 down -1.60 230311_s_at PRDM6 Hs.135118 down -1.60 240715_at TBX5 Hs.381715 down -1.60 219734_at SIDT1 Hs.591291 down -1.60 229223_at Hs.658624 Hs.658624 down -1.60 224928_at SETD7 Hs.480792 down -1.60 203882_at IRF9 Hs.1706 down -1.60 36030_at IFFO1 Hs.15243 down -1.60 232090_at LOC100128178 Hs.584880 down -1.60 219959_at MOCOS Hs.405028 down -1.60 228396_at PRKG1 Hs.654556 down -1.60 225647_s_at CTSC Hs.128065 down -1.60 202800_at SLC1A3 Hs.481918 down -1.60 230252_at LPAR5 Hs.155538 down -1.60 221218_s_at TPK1 Hs.660232 down -1.60 218729_at LXN Hs.478067 down -1.60 202744_at SLC20A2 Hs.653173 down -1.60 227121_at Hs.193784 Hs.193784 down -1.60 222986_s_at SHISA5 Hs.414579 down -1.60 213848_at Hs.595184 Hs.595184 down -1.60 213059_at CREB3L1 Hs.405961 down -1.60 240038_at Hs.608694 Hs.608694 down -1.60 218019_s_at PDXK Hs.284491 down -1.61 220059_at STAP1 Hs.435579 down -1.61 202133_at WWTR1 Hs.719249 down -1.61 212135_s_at ATP2B4 Hs.343522 down -1.61 226519_s_at AGXT2L2 Hs.248746 down -1.61 214068_at BEAN Hs.97805 down -1.61 226973_at VSTM2L Hs.517029 down -1.61 228345_at CHIC1 Hs.496323 down -1.61 204588_s_at SLC7A7 Hs.513147 down -1.61 202068_s_at LDLR Hs.213289 down -1.61 229670_at Hs.180284 Hs.180284 down -1.61 209310_s_at CASP4 Hs.138378 down -1.61 215565_at DTNB Hs.307720 down -1.61 222457_s_at LIMA1 Hs.525419 down -1.61 213988_s_at SAT1 Hs.28491 down -1.61 238601_at PHKB Hs.78060 down -1.61 223378_at GLIS2 Hs.592087 down -1.61

175

203729_at EMP3 Hs.9999 down -1.61 242500_at Hs.137522 Hs.137522 down -1.61 225763_at RCSD1 Hs.493867 down -1.61 224694_at ANTXR1 Hs.165859 down -1.61 209633_at PPP2R3A Hs.518155 down -1.61 205859_at LY86 Hs.653138 down -1.61 202664_at WIPF1 Hs.128067 down -1.61 216064_s_at AGA Hs.207776 down -1.61 227099_s_at AG2 Hs.714890 down -1.61 211671_s_at NR3C1 Hs.122926 down -1.61 202269_x_at GBP1 Hs.62661 down -1.61 201005_at CD9 Hs.114286 down -1.61 228670_at TEP1 Hs.508835 down -1.61 204636_at COL17A1 Hs.117938 down -1.61 232765_x_at LOC146429 Hs.447544 down -1.61 225750_at Hs.525339 Hs.525339 down -1.61 226267_at JDP2 Hs.196482 down -1.61 235566_at TMF1 Hs.267632 down -1.61 226844_at MOBKL2B Hs.369022 down -1.61 213506_at F2RL1 Hs.154299 down -1.61 225673_at MYADM Hs.380906 down -1.62 204154_at CDO1 Hs.442378 down -1.62 243237_at Hs.667206 Hs.667206 down -1.62 203275_at IRF2 Hs.654566 down -1.62 207850_at CXCL3 Hs.89690 down -1.62 216264_s_at LAMB2 Hs.439726 down -1.62 210764_s_at CYR61 Hs.8867 down -1.62 228032_s_at Hs.125056 Hs.125056 down -1.62 226895_at NFIC Hs.170131 down -1.62 218424_s_at STEAP3 Hs.647822 down -1.62 206227_at CILP Hs.442180 down -1.62 219696_at DENND1B Hs.657779 down -1.62 226522_at PODN Hs.708197 down -1.62 227276_at PLXDC2 Hs.658134 down -1.62 235747_at SLC25A16 Hs.180408 down -1.62 226013_at TRAK1 Hs.535711 down -1.62 214745_at PLCH1 Hs.567423 down -1.62 223007_s_at C9orf5 Hs.308074 down -1.62 221276_s_at SYNC Hs.712631 down -1.62 220108_at GNA14 Hs.657795 down -1.62 1566472_s_at RETSAT Hs.440401 down -1.62 238025_at MLKL Hs.119878 down -1.62

176

205019_s_at VIPR1 Hs.348500 down -1.62 203700_s_at DIO2 Hs.202354 down -1.62 234725_s_at SEMA4B Hs.474935 down -1.62 237753_at Hs.634845 Hs.634845 down -1.62 241681_at Hs.718677 Hs.718677 down -1.62 203935_at ACVR1 Hs.470316 down -1.62 214088_s_at FUT3 Hs.169238 down -1.62 201739_at SGK1 Hs.510078 down -1.62 207375_s_at IL15RA Hs.524117 down -1.62 228333_at Hs.621487 Hs.621487 down -1.62 232994_s_at RGNEF Hs.482521 down -1.62 203591_s_at CSF3R Hs.524517 down -1.62 225176_at Hs.654973 Hs.654973 down -1.63 203570_at LOXL1 Hs.65436 down -1.63 203066_at CHST15 Hs.287537 down -1.63 203143_s_at KIAA0040 Hs.518138 down -1.63 204279_at PSMB9 Hs.654585 down -1.63 1554168_a_at SH3KBP1 Hs.719268 down -1.63 207777_s_at SP140 Hs.632549 down -1.63 225922_at FNIP2 Hs.709500 down -1.63 238967_at Hs.686016 Hs.686016 down -1.63 213698_at ZMYM6 Hs.533986 down -1.63 213455_at FAM114A1 Hs.476517 down -1.63 201617_x_at CALD1 Hs.490203 down -1.63 228875_at FAM162B Hs.126712 down -1.63 218501_at ARHGEF3 Hs.476402 down -1.63 217853_at TNS3 Hs.520814 down -1.63 243041_s_at Hs.705969 Hs.705969 down -1.63 211323_s_at ITPR1 Hs.567295 down -1.63 1554741_s_at KGFLP2 Hs.536967 down -1.63 201058_s_at MYL9 Hs.504687 down -1.63 37145_at GNLY Hs.105806 down -1.63 244661_at Hs.635222 Hs.635222 down -1.63 207496_at MS4A2 Hs.386748 down -1.63 1555037_a_at IDH1 Hs.593422 down -1.63 215923_s_at PSD4 Hs.516306 down -1.63 1553835_a_at COL6A5 Hs.205403 down -1.63 210663_s_at KYNU Hs.470126 down -1.63 215617_at SPATS2L Hs.120323 down -1.63 225632_s_at RAB43 Hs.709807 down -1.63 219332_at MICALL2 Hs.376617 down -1.63 213524_s_at G0S2 Hs.432132 down -1.63

177

208960_s_at KLF6 Hs.4055 down -1.64 1554600_s_at LMNA Hs.594444 down -1.64 206181_at SLAMF1 Hs.523660 down -1.64 205419_at GPR183 Hs.784 down -1.64 214211_at FTH1 Hs.524910 down -1.64 230730_at SGCD Hs.387207 down -1.64 216627_s_at B4GALT1 Hs.272011 down -1.64 204020_at PURA Hs.443121 down -1.64 219607_s_at MS4A4A Hs.325960 down -1.64 235885_at P2RY12 Hs.591281 down -1.64 1558397_at Hs.376675 Hs.376675 down -1.64 201471_s_at SQSTM1 Hs.437277 down -1.64 229721_x_at DERL3 Hs.593679 down -1.64 205384_at FXYD1 Hs.442498 down -1.64 228781_at OBFC1 Hs.62314 down -1.64 223595_at TMEM133 Hs.44004 down -1.64 209239_at NFKB1 Hs.654408 down -1.64 225512_at ZBTB38 Hs.715534 down -1.64 221087_s_at APOL3 Hs.474737 down -1.64 232381_s_at DNAH5 Hs.212360 down -1.64 236616_at Hs.199671 Hs.199671 down -1.64 218498_s_at ERO1L Hs.592304 down -1.64 214974_x_at CXCL5 Hs.89714 down -1.64 225941_at EIF4E3 Hs.581355 down -1.64 209360_s_at RUNX1 Hs.149261 down -1.64 231779_at IRAK2 Hs.449207 down -1.64 204516_at ATXN7 Hs.476595 down -1.64 225415_at DTX3L Hs.518201 down -1.64 211661_x_at PTAFR Hs.709174 down -1.64 211163_s_at TNFRSF10C Hs.655801 down -1.64 205579_at HRH1 Hs.1570 down -1.64 223592_s_at RNF135 Hs.29874 down -1.64 228221_at SLC44A3 Hs.483423 down -1.64 203547_at CD4 Hs.631659 down -1.64 241898_at Hs.351126 Hs.351126 down -1.64 202808_at C10orf26 Hs.500897 down -1.64 226047_at MRVI1 Hs.501898 down -1.64 209441_at RHOBTB2 Hs.372688 down -1.64 204693_at CDC42EP1 Hs.225356 down -1.64 220170_at FHL5 Hs.632608 down -1.64 227438_at ALPK1 Hs.652825 down -1.64 212099_at RHOB Hs.502876 down -1.64

178

218706_s_at GRAMD3 Hs.363558 down -1.65 201243_s_at ATP1B1 Hs.291196 down -1.65 209940_at PARP3 Hs.271742 down -1.65 205730_s_at ABLIM3 Hs.49688 down -1.65 222455_s_at PARVA Hs.607144 down -1.65 39402_at IL1B Hs.126256 down -1.65 212907_at SLC30A1 Hs.519469 down -1.65 244485_at Hs.661688 Hs.661688 down -1.65 206682_at CLEC10A Hs.54403 down -1.65 231897_at PTGR1 Hs.584864 down -1.65 206118_at STAT4 Hs.80642 down -1.65 222129_at FAM134A Hs.516707 down -1.65 219615_s_at KCNK5 Hs.444448 down -1.65 213156_at Hs.592414 Hs.592414 down -1.65 1559263_s_at ZC3H12D Hs.632618 down -1.65 209502_s_at BAIAP2 Hs.128316 down -1.65 205801_s_at RASGRP3 Hs.143674 down -1.65 203474_at IQGAP2 Hs.291030 down -1.65 202238_s_at NNMT Hs.503911 down -1.65 238725_at IRF1 Hs.436061 down -1.65 212865_s_at COL14A1 Hs.409662 down -1.65 226436_at RASSF4 Hs.522895 down -1.65 204491_at PDE4D Hs.117545 down -1.65 210139_s_at PMP22 Hs.372031 down -1.65 214070_s_at ATP10B Hs.109358 down -1.65 204606_at CCL21 Hs.57907 down -1.65 212510_at GPD1L Hs.82432 down -1.65 219191_s_at BIN2 Hs.14770 down -1.65 202957_at HCLS1 Hs.14601 down -1.65 230051_at C10orf47 Hs.435775 down -1.65 202435_s_at CYP1B1 Hs.154654 down -1.65 236577_at Hs.443420 Hs.443420 down -1.65 220330_s_at SAMSN1 Hs.473341 down -1.66 209568_s_at RGL1 Hs.497148 down -1.66 204273_at EDNRB Hs.82002 down -1.66 202796_at SYNPO Hs.435228 down -1.66 227376_at GLI3 Hs.21509 down -1.66 219371_s_at KLF2 Hs.715677 down -1.66 239486_at Hs.599944 Hs.599944 down -1.66 229114_at GAB1 Hs.80720 down -1.66 217732_s_at ITM2B Hs.643683 down -1.66 203803_at PCYOX1 Hs.567502 down -1.66

179

226841_at MPEG1 Hs.718450 down -1.66 203767_s_at STS Hs.522578 down -1.66 226380_at PTPN21 Hs.437040 down -1.66 227983_at RILPL2 Hs.488173 down -1.66 209522_s_at CRAT Hs.12068 down -1.66 218999_at TMEM140 Hs.719309 down -1.66 204463_s_at EDNRA Hs.183713 down -1.66 229323_at LOC387723 Hs.127394 down -1.66 225373_at C10orf54 Hs.47382 down -1.66 223502_s_at TNFSF13B Hs.525157 down -1.66 239847_at Hs.105791 Hs.105791 down -1.66 212298_at NRP1 Hs.131704 down -1.66 242750_at MMAA Hs.452864 down -1.66 203416_at CD53 Hs.443057 down -1.66 230986_at KLF8 Hs.646614 down -1.66 238780_s_at Hs.444595 Hs.444595 down -1.66 213909_at LRRC15 Hs.288467 down -1.67 206991_s_at CCR5 Hs.536735 down -1.67 221268_s_at SGPP1 Hs.24678 down -1.67 223325_at TXNDC11 Hs.313847 down -1.67 232594_at HSBP1L1 Hs.191582 down -1.67 226474_at NLRC5 Hs.528836 down -1.67 205291_at IL2RB Hs.474787 down -1.67 214995_s_at APOBEC3F Hs.660143 down -1.67 225782_at MSRB3 Hs.339024 down -1.67 225239_at Hs.593027 Hs.593027 down -1.67 209124_at MYD88 Hs.82116 down -1.67 230174_at LYPLAL1 Hs.657617 down -1.67 229566_at LOC645638 Hs.463652 down -1.67 228698_at SOX7 Hs.709543 down -1.67 206115_at EGR3 Hs.534313 down -1.67 206600_s_at SLC16A5 Hs.592095 down -1.67 219929_s_at ZFYVE21 Hs.592322 down -1.67 202073_at OPTN Hs.332706 down -1.67 210839_s_at ENPP2 Hs.190977 down -1.67 200986_at SERPING1 Hs.384598 down -1.67 205518_s_at CMAH Hs.484918 down -1.67 226722_at FAM20C Hs.134742 down -1.67 225847_at NCEH1 Hs.444099 down -1.68 205059_s_at IDUA Hs.89560 down -1.68 209074_s_at FAM107A Hs.506357 down -1.68 219922_s_at LTBP3 Hs.289019 down -1.68

180

230076_at PITPNM3 Hs.183983 down -1.68 205213_at ACAP1 Hs.337242 down -1.68 204955_at SRPX Hs.15154 down -1.68 224917_at MIR21

down -1.68

226688_at C3orf23 Hs.55131 down -1.68 226335_at RPS6KA3 Hs.445387 down -1.68 203264_s_at ARHGEF9 Hs.54697 down -1.68 205498_at GHR Hs.125180 down -1.68 209885_at RHOD Hs.15114 down -1.68 219315_s_at TMEM204 Hs.459652 down -1.68 225912_at TP53INP1 Hs.492261 down -1.68 227961_at CTSB Hs.520898 down -1.68 222912_at ARRB1 Hs.503284 down -1.68 218589_at LPAR6 Hs.123464 down -1.68 203821_at HBEGF Hs.799 down -1.68 207808_s_at PROS1 Hs.64016 down -1.68 230925_at APBB1IP Hs.310421 down -1.68 223343_at MS4A7 Hs.530735 down -1.68 204236_at FLI1 Hs.504281 down -1.68 202771_at FAM38A Hs.513807 down -1.68 205088_at MAMLD1 Hs.20136 down -1.69 209879_at SELPLG Hs.591014 down -1.69 228728_at C7orf58 Hs.189652 down -1.69 212558_at SPRY1 Hs.436944 down -1.69 200791_s_at IQGAP1 Hs.430551 down -1.69 235046_at Hs.176376 Hs.176376 down -1.69 211529_x_at HLA-G Hs.512152 down -1.69 224311_s_at CAB39 Hs.632536 down -1.69 209684_at RIN2 Hs.472270 down -1.69 226051_at SELM Hs.55940 down -1.69 226770_at MAGI3 Hs.486189 down -1.69 205504_at BTK Hs.159494 down -1.69 209365_s_at ECM1 Hs.81071 down -1.69 228949_at WLS Hs.647659 down -1.69 223540_at PVRL4 Hs.492490 down -1.69 204276_at TK2 Hs.512619 down -1.69 228751_at CLK4 Hs.406557 down -1.69 209156_s_at COL6A2 Hs.420269 down -1.69 202241_at TRIB1 Hs.444947 down -1.69 223233_s_at CGN Hs.591464 down -1.69 238044_at Hs.606630 Hs.606630 down -1.69 200600_at MSN Hs.87752 down -1.69

181

230741_at Hs.439682 Hs.439682 down -1.69 205141_at ANG Hs.283749 down -1.69 200742_s_at TPP1 Hs.523454 down -1.70 1552386_at GAPT Hs.547697 down -1.70 224823_at MYLK Hs.477375 down -1.70 223322_at RASSF5 Hs.497579 down -1.70 213285_at TMEM30B Hs.146180 down -1.70 226773_at Hs.709966 Hs.709966 down -1.70 203845_at KAT2B Hs.533055 down -1.70 211902_x_at TRA@

down -1.70

202023_at EFNA1 Hs.516664 down -1.70 217226_s_at SFXN3 Hs.283844 down -1.70 212670_at ELN Hs.647061 down -1.70 223058_at FAM107B Hs.446315 down -1.70 211962_s_at ZFP36L1 Hs.85155 down -1.70 223194_s_at SLC22A23 Hs.713588 down -1.70 206715_at TFEC Hs.125962 down -1.70 216920_s_at TRGC2 Hs.534032 down -1.70 218923_at CTBS Hs.513557 down -1.70 203595_s_at IFIT5 Hs.252839 down -1.70 227565_at Hs.633326 Hs.633326 down -1.70 220146_at TLR7 Hs.659215 down -1.70 225931_s_at RNF213 Hs.195642 down -1.70 201809_s_at ENG Hs.76753 down -1.71 223204_at FAM198B Hs.567498 down -1.71 227762_at Hs.536218 Hs.536218 down -1.71 204949_at ICAM3 Hs.654563 down -1.71 215563_s_at MST1P9 Hs.655432 down -1.71 201367_s_at ZFP36L2 Hs.503093 down -1.71 242388_x_at Hs.601883 Hs.601883 down -1.71 204201_s_at PTPN13 Hs.436142 down -1.71 201953_at CIB1 Hs.715556 down -1.71 229041_s_at Hs.661035 Hs.661035 down -1.71 204368_at SLCO2A1 Hs.518270 down -1.71 235299_at SLC41A2 Hs.577463 down -1.71 202878_s_at CD93 Hs.97199 down -1.71 225344_at NCOA7 Hs.171426 down -1.71 204284_at PPP1R3C Hs.303090 down -1.71 231929_at IKZF2 Hs.604950 down -1.71 207275_s_at ACSL1 Hs.406678 down -1.71 209264_s_at TSPAN4 Hs.654836 down -1.71 221898_at PDPN Hs.468675 down -1.71

182

221864_at ORAI3 Hs.460617 down -1.71 1553998_at DMRTC1 Hs.712728 down -1.71 204562_at IRF4 Hs.401013 down -1.71 204686_at IRS1 Hs.471508 down -1.72 208829_at TAPBP Hs.714746 down -1.72 1556314_a_at Hs.224794 Hs.224794 down -1.72 214177_s_at PBXIP1 Hs.505806 down -1.72 209417_s_at IFI35 Hs.632258 down -1.72 235103_at MAN2A1 Hs.432822 down -1.72 206150_at CD27 Hs.355307 down -1.72 242277_at Hs.701344 Hs.701344 down -1.72 227272_at C15orf52 Hs.32433 down -1.72 205819_at MARCO Hs.67726 down -1.72 219508_at GCNT3 Hs.194710 down -1.72 220432_s_at CYP39A1 Hs.387367 down -1.72 216598_s_at CCL2 Hs.303649 down -1.72 201792_at AEBP1 Hs.439463 down -1.72 202897_at SIRPA Hs.581021 down -1.72 227001_at NIPAL2 Hs.309489 down -1.72 228365_at CPNE8 Hs.40910 down -1.72 210895_s_at CD86 Hs.171182 down -1.72 202177_at GAS6 Hs.646346 down -1.72 206249_at MAP3K13 Hs.656069 down -1.72 221081_s_at DENND2D Hs.557850 down -1.72 229437_at MIR155HG Hs.697120 down -1.72 219209_at IFIH1 Hs.163173 down -1.72 203585_at ZNF185 Hs.16622 down -1.72 204908_s_at BCL3 Hs.31210 down -1.72 235146_at TMCC3 Hs.370410 down -1.73 205227_at IL1RAP Hs.478673 down -1.73 226377_at Hs.715591 Hs.715591 down -1.73 204546_at KIAA0513 Hs.301658 down -1.73 205969_at AADAC Hs.506908 down -1.73 219666_at MS4A6A Hs.523702 down -1.73 203868_s_at VCAM1 Hs.109225 down -1.73 1556421_at LOC286189 Hs.593427 down -1.73 201302_at ANXA4 Hs.422986 down -1.73 209474_s_at ENTPD1 Hs.719076 down -1.73 226192_at Hs.76704 Hs.76704 down -1.73 204019_s_at SH3YL1 Hs.515951 down -1.73 228256_s_at EPB41L4A Hs.584954 down -1.73 209827_s_at IL16 Hs.459095 down -1.73

183

201576_s_at GLB1 Hs.443031 down -1.73 243395_at Hs.664329 Hs.664329 down -1.73 202546_at VAMP8 Hs.714302 down -1.73 204446_s_at ALOX5 Hs.89499 down -1.73 205959_at MMP13 Hs.2936 down -1.73 211395_x_at FCGR2C Hs.713617 down -1.73 205237_at FCN1 Hs.440898 down -1.73 218162_at OLFML3 Hs.9315 down -1.73 231876_at TRIM56 Hs.521092 down -1.73 202017_at EPHX1 Hs.89649 down -1.73 202587_s_at AK1 Hs.175473 down -1.73 206043_s_at ATP2C2 Hs.6168 down -1.73 221011_s_at LBH Hs.567598 down -1.74 225123_at Hs.120633 Hs.120633 down -1.74 229560_at TLR8 Hs.660543 down -1.74 227266_s_at FYB Hs.370503 down -1.74 203504_s_at ABCA1 Hs.719214 down -1.74 227679_at HDAC11 Hs.404802 down -1.74 219305_x_at FBXO2 Hs.132753 down -1.74 226731_at PELO Hs.644352 down -1.74 206702_at TEK Hs.89640 down -1.74 235061_at PPM1K Hs.291000 down -1.74 1552478_a_at IRF6 Hs.719361 down -1.74 230061_at TM4SF18 Hs.22026 down -1.74 216971_s_at PLEC Hs.434248 down -1.74 235556_at Hs.656072 Hs.656072 down -1.74 208873_s_at REEP5 Hs.429608 down -1.74 225564_at SPATA13 Hs.657121 down -1.74 227061_at Hs.86538 Hs.86538 down -1.74 201315_x_at IFITM2 Hs.709321 down -1.74 204806_x_at HLA-F Hs.519972 down -1.74 222722_at OGN Hs.109439 down -1.74 205342_s_at SULT1C2 Hs.436123 down -1.74 201778_s_at KIAA0494 Hs.719205 down -1.74 201324_at EMP1 Hs.707901 down -1.74 201641_at BST2 Hs.118110 down -1.74 204929_s_at VAMP5 Hs.534373 down -1.74 227677_at JAK3 Hs.515247 down -1.74 208703_s_at APLP2 Hs.709184 down -1.74 208949_s_at LGALS3 Hs.531081 down -1.74 217763_s_at RAB31 Hs.714730 down -1.75 219118_at FKBP11 Hs.655103 down -1.75

184

200660_at S100A11 Hs.417004 down -1.75 213428_s_at COL6A1 Hs.474053 down -1.75 229635_at Hs.235795 Hs.235795 down -1.75 219259_at SEMA4A Hs.408846 down -1.75 227235_at GUCY1A3 Hs.24258 down -1.75 233176_at Hs.557780 Hs.557780 down -1.75 229331_at SPATA18 Hs.527090 down -1.75 231579_s_at TIMP2 Hs.633514 down -1.75 225442_at DDR2 Hs.275757 down -1.75 221756_at PIK3IP1 Hs.26670 down -1.75 208885_at LCP1 Hs.381099 down -1.75 225817_at CGNL1 Hs.148989 down -1.75 202686_s_at AXL Hs.590970 down -1.75 238581_at GBP5 Hs.513726 down -1.75 223422_s_at ARHGAP24 Hs.444229 down -1.75 1555137_a_at FGD6 Hs.506381 down -1.75 215891_s_at GM2A Hs.483873 down -1.75 32625_at NPR1 Hs.490330 down -1.75 212956_at TBC1D9 Hs.480819 down -1.75 203473_at SLCO2B1 Hs.7884 down -1.75 205206_at KAL1 Hs.521869 down -1.76 202086_at MX1 Hs.517307 down -1.76 202888_s_at ANPEP Hs.1239 down -1.76 1555963_x_at B3GNT7 Hs.299329 down -1.76 239294_at Hs.561747 Hs.561747 down -1.76 202625_at LYN Hs.699154 down -1.76 201645_at TNC Hs.143250 down -1.76 226077_at RNF145 Hs.349306 down -1.76 207734_at LAX1 Hs.272794 down -1.76 221872_at RARRES1 Hs.131269 down -1.76 219427_at FAT4 Hs.702217 down -1.76 228243_at Hs.655690 Hs.655690 down -1.76 211799_x_at HLA-C Hs.654404 down -1.76 53720_at C19orf66 Hs.655613 down -1.76 243582_at SH3RF2 Hs.443728 down -1.76 203828_s_at IL32 Hs.943 down -1.76 225166_at ARHGAP18 Hs.486458 down -1.76 228094_at AMICA1 Hs.16291 down -1.76 228555_at CAMK2D Hs.144114 down -1.76 230391_at CD84 Hs.439064 down -1.76 203131_at PDGFRA Hs.74615 down -1.76 221085_at TNFSF15 Hs.241382 down -1.76

185

212294_at GNG12 Hs.431101 down -1.76 209242_at PEG3 Hs.719209 down -1.77 203934_at KDR Hs.479756 down -1.77 204519_s_at PLLP Hs.632215 down -1.77 233223_at Hs.675435 Hs.675435 down -1.77 202545_at PRKCD Hs.155342 down -1.77 203903_s_at HEPH Hs.31720 down -1.77 212285_s_at AGRN Hs.273330 down -1.77 225557_at CSRNP1 Hs.370950 down -1.77 229127_at JAM2 Hs.517227 down -1.77 211339_s_at ITK Hs.558348 down -1.77 205842_s_at JAK2 Hs.656213 down -1.77 228298_at FAM113B Hs.560100 down -1.77 205590_at RASGRP1 Hs.591127 down -1.77 227300_at TMEM119 Hs.449718 down -1.77 236098_at LOC100130933 Hs.662541 down -1.77 218747_s_at TAPBPL Hs.504597 down -1.77 203837_at MAP3K5 Hs.186486 down -1.77 209354_at TNFRSF14 Hs.512898 down -1.77 230333_at Hs.656630 Hs.656630 down -1.77 228739_at CYS1 Hs.718671 down -1.77 204923_at SASH3 Hs.61469 down -1.77 213160_at DOCK2 Hs.586174 down -1.77 223220_s_at PARP9 Hs.518200 down -1.77 203085_s_at TGFB1 Hs.645227 down -1.77 1558214_s_at CTNNA1 Hs.534797 down -1.77 205043_at CFTR Hs.489786 down -1.78 207677_s_at NCF4 Hs.474781 down -1.78 226525_at STK17B Hs.88297 down -1.78 214117_s_at BTD Hs.517830 down -1.78 201042_at TGM2 Hs.517033 down -1.78 231769_at FBXO6 Hs.464419 down -1.78 218764_at PRKCH Hs.333907 down -1.78 212203_x_at IFITM3 Hs.374650 down -1.78 214808_at Hs.620837 Hs.620837 down -1.78 211675_s_at MDFIC Hs.427236 down -1.78 221870_at EHD2 Hs.719225 down -1.78 209708_at MOXD1 Hs.6909 down -1.78 202910_s_at CD97

down -1.78

1557236_at APOL6 Hs.257352 down -1.78 235078_at Hs.656818 Hs.656818 down -1.78 204858_s_at TYMP Hs.592212 down -1.78

186

205330_at MN1 Hs.268515 down -1.78 214703_s_at MAN2B2 Hs.188464 down -1.78 209540_at IGF1 Hs.160562 down -1.78 207993_s_at CHP Hs.406234 down -1.78 226185_at CDS1 Hs.654899 down -1.78 204039_at CEBPA Hs.699463 down -1.78 201061_s_at STOM Hs.253903 down -1.78 226403_at TMC4 Hs.355126 down -1.78 238513_at PRRG4 Hs.471695 down -1.78 227353_at TMC8 Hs.592102 down -1.78 218186_at RAB25 Hs.632469 down -1.79 203281_s_at UBA7 Hs.16695 down -1.79 204497_at ADCY9 Hs.391860 down -1.79 206742_at FIGF Hs.11392 down -1.79 209199_s_at MEF2C Hs.653394 down -1.79 228648_at LRG1 Hs.655559 down -1.79 212423_at ZCCHC24 Hs.523080 down -1.79 228964_at PRDM1 Hs.436023 down -1.79 200923_at LGALS3BP Hs.514535 down -1.79 203986_at STBD1 Hs.109590 down -1.79 243929_at Hs.687201 Hs.687201 down -1.79 225957_at C5orf41 Hs.484195 down -1.79 219597_s_at DUOX1 Hs.272813 down -1.79 201743_at CD14 Hs.163867 down -1.79 222719_s_at PDGFC Hs.570855 down -1.79 225288_at COL27A1 Hs.494892 down -1.79 1559776_at Hs.595177 Hs.595177 down -1.79 210081_at AGER Hs.534342 down -1.79 225078_at EMP2 Hs.531561 down -1.79 209785_s_at PLA2G4C Hs.631562 down -1.79 217525_at OLFML1 Hs.503500 down -1.80 224657_at ERRFI1 Hs.605445 down -1.80 205269_at LCP2 Hs.304475 down -1.80 211574_s_at CD46 Hs.510402 down -1.80 235371_at GXYLT2 Hs.710275 down -1.80 225755_at KLHDC8B Hs.13781 down -1.80 204912_at IL10RA Hs.504035 down -1.80 228232_s_at VSIG2 Hs.112377 down -1.80 229638_at IRX3 Hs.499205 down -1.80 225524_at ANTXR2 Hs.162963 down -1.80 228617_at XAF1 Hs.441975 down -1.80 213817_at IRAK3 Hs.369265 down -1.80

187

202695_s_at STK17A Hs.709489 down -1.80 204774_at EVI2A Hs.591198 down -1.80 227727_at MRGPRF Hs.118513 down -1.80 234989_at NEAT1 Hs.648467 down -1.80 228153_at RNF144B Hs.148741 down -1.81 231866_at LNPEP Hs.656905 down -1.81 214274_s_at ACAA1 Hs.643487 down -1.81 230499_at Hs.664299 Hs.664299 down -1.81 230875_s_at ATP11A Hs.29189 down -1.81 201151_s_at MBNL1 Hs.478000 down -1.81 225822_at TMEM125 Hs.104476 down -1.81 206337_at CCR7 Hs.370036 down -1.81 220327_at VGLL3 Hs.435013 down -1.81 210325_at CD1A Hs.1309 down -1.81 228812_at Hs.633900 Hs.633900 down -1.81 206010_at HABP2 Hs.422542 down -1.81 211911_x_at HLA-B Hs.703277 down -1.81 218686_s_at RHBDF1 Hs.57988 down -1.81 214467_at GPR65 Hs.513440 down -1.81 206513_at AIM2 Hs.281898 down -1.81 206482_at PTK6 Hs.51133 down -1.81 219243_at GIMAP4 Hs.647101 down -1.81 201508_at IGFBP4 Hs.462998 down -1.81 219440_at RAI2 Hs.446680 down -1.82 235534_at Hs.153944 Hs.153944 down -1.82 206295_at IL18 Hs.83077 down -1.82 1556325_at FILIP1 Hs.696158 down -1.82 208078_s_at SIK1 Hs.282113 down -1.82 225162_at SH3D19 Hs.567725 down -1.82 203911_at RAP1GAP Hs.148178 down -1.82 227066_at MOBKL2C Hs.632401 down -1.82 214455_at HIST1H2BC Hs.658713 down -1.82 212192_at KCTD12 Hs.644125 down -1.82 203562_at FEZ1 Hs.224008 down -1.82 235276_at EPSTI1 Hs.546467 down -1.82 227616_at BCL9L Hs.414740 down -1.82 204363_at F3 Hs.62192 down -1.82 208983_s_at PECAM1 Hs.514412 down -1.82 219436_s_at EMCN Hs.152913 down -1.82 219256_s_at SH3TC1 Hs.479116 down -1.82 214783_s_at ANXA11 Hs.530291 down -1.82 205997_at ADAM28 Hs.174030 down -1.82

188

201858_s_at SRGN Hs.1908 down -1.82 209761_s_at SP110 Hs.145150 down -1.82 214719_at SLC46A3 Hs.117167 down -1.82 212989_at SGMS1 Hs.654698 down -1.83 231879_at COL12A1 Hs.101302 down -1.83 219412_at RAB38 Hs.591975 down -1.83 206276_at LY6D Hs.415762 down -1.83 205907_s_at OMD Hs.94070 down -1.83 242868_at Hs.691259 Hs.691259 down -1.83 213519_s_at LAMA2 Hs.200841 down -1.83 206262_at ADH1C Hs.654537 down -1.83 205382_s_at CFD Hs.155597 down -1.83 241359_at Hs.547494 Hs.547494 down -1.83 217967_s_at FAM129A Hs.518662 down -1.83 235924_at Hs.561511 Hs.561511 down -1.83 209276_s_at GLRX Hs.28988 down -1.83 244008_at Hs.537059 Hs.537059 down -1.83 205467_at CASP10 Hs.5353 down -1.83 219327_s_at GPRC5C Hs.446438 down -1.83 226344_at ZMAT1 Hs.496512 down -1.83 204099_at SMARCD3 Hs.647067 down -1.83 202551_s_at CRIM1 Hs.699247 down -1.83 227850_x_at CDC42EP5 Hs.415791 down -1.83 227013_at LATS2 Hs.78960 down -1.84 226939_at CPEB2 Hs.656937 down -1.84 203287_at LAD1 Hs.519035 down -1.84 213488_at SNED1 Hs.471834 down -1.84 229824_at LOC100131540 Hs.292737 down -1.84 229629_at Hs.96886 Hs.96886 down -1.84 223816_at SLC46A2 Hs.512668 down -1.84 221900_at COL8A2 Hs.353001 down -1.84 202838_at FUCA1 Hs.370858 down -1.84 226627_at Hs.522057 Hs.522057 down -1.84 225911_at NPNT Hs.518921 down -1.84 230266_at RAB7B Hs.534612 down -1.84 235944_at HMCN1 Hs.58877 down -1.84 1568658_at C2orf74 Hs.140617 down -1.84 205225_at ESR1 Hs.208124 down -1.84 210889_s_at FCGR2B Hs.654395 down -1.84 224701_at PARP14 Hs.518203 down -1.84 212993_at NACC2 Hs.112895 down -1.85 235199_at RNF125 Hs.633703 down -1.85

189

228188_at FOSL2 Hs.220971 down -1.85 228532_at C1orf162 Hs.288010 down -1.85 228831_s_at GNG7 Hs.515544 down -1.85 214181_x_at LST1 Hs.436066 down -1.85 226142_at GLIPR1 Hs.205558 down -1.85 237400_at Hs.656689 Hs.656689 down -1.85 203932_at HLA-DMB Hs.654428 down -1.85 221666_s_at PYCARD Hs.499094 down -1.85 205236_x_at SOD3 Hs.2420 down -1.85 227458_at Hs.655937 Hs.655937 down -1.85 201150_s_at TIMP3 Hs.644633 down -1.85 1560850_at Hs.553018 Hs.553018 down -1.85 229450_at IFIT3 Hs.714337 down -1.85 202863_at SP100 Hs.369056 down -1.86 221773_at ELK3 Hs.46523 down -1.86 207643_s_at TNFRSF1A Hs.279594 down -1.86 203561_at FCGR2A Hs.352642 down -1.86 205049_s_at CD79A Hs.631567 down -1.86 228391_at CYP4V2

down -1.86

206504_at CYP24A1 Hs.89663 down -1.86 205309_at SMPDL3B Hs.123659 down -1.86 201497_x_at MYH11 Hs.460109 down -1.86 205666_at FMO1 Hs.1424 down -1.86 227808_at DNAJC15 Hs.438830 down -1.86 211272_s_at DGKA Hs.524488 down -1.86 201185_at HTRA1 Hs.501280 down -1.86 222173_s_at TBC1D2 Hs.371016 down -1.86 214835_s_at SUCLG2 Hs.655250 down -1.86 227238_at MUC15 Hs.407152 down -1.86 221477_s_at SOD2 Hs.487046 down -1.86 226757_at IFIT2 Hs.437609 down -1.86 241412_at BTC Hs.710156 down -1.86 218017_s_at HGSNAT Hs.600384 down -1.86 201535_at UBL3 Hs.145575 down -1.87 212314_at SEL1L3 Hs.479384 down -1.87 202201_at BLVRB Hs.515785 down -1.87 227134_at SYTL1 Hs.469175 down -1.87 224009_x_at DHRS9 Hs.179608 down -1.87 205357_s_at AGTR1 Hs.719071 down -1.87 212256_at GALNT10 Hs.655011 down -1.87 226977_at C5orf53 Hs.696360 down -1.87 1554464_a_at CRTAP Hs.719160 down -1.87

190

223620_at GPR34 Hs.495989 down -1.87 1555349_a_at ITGB2 Hs.375957 down -1.87 212614_at ARID5B Hs.535297 down -1.87 207194_s_at ICAM4 Hs.706750 down -1.87 209546_s_at APOL1 Hs.114309 down -1.87 218631_at AVPI1 Hs.23918 down -1.87 224404_s_at FCRL5 Hs.415950 down -1.87 203186_s_at S100A4 Hs.654444 down -1.87 221581_s_at LAT2 Hs.647049 down -1.87 201744_s_at LUM Hs.406475 down -1.87 204036_at LPAR1 Hs.126667 down -1.87 201130_s_at CDH1 Hs.461086 down -1.87 232151_at MACC1 Hs.598388 down -1.87 225189_s_at RAPH1 Hs.471162 down -1.87 205349_at GNA15 Hs.73797 down -1.87 203642_s_at COBLL1 Hs.470457 down -1.88 204981_at SLC22A18 Hs.50868 down -1.88 238460_at FAM83A Hs.379821 down -1.88 228372_at C10orf128 Hs.385493 down -1.88 222288_at Hs.657591 Hs.657591 down -1.88 1552502_s_at RHBDL2 Hs.524626 down -1.88 235242_at Hs.633256 Hs.633256 down -1.88 227417_at MOSC2 Hs.369042 down -1.88 226837_at SPRED1 Hs.525781 down -1.88 207085_x_at CSF2RA Hs.520937 down -1.88 216250_s_at LPXN Hs.125474 down -1.88 209295_at TNFRSF10B Hs.521456 down -1.88 206036_s_at REL Hs.631886 down -1.88 226702_at CMPK2 Hs.7155 down -1.88 235183_at Hs.201488 Hs.201488 down -1.88 202748_at GBP2 Hs.386567 down -1.89 212543_at AIM1 Hs.643590 down -1.89 235016_at REEP3 Hs.499833 down -1.89 216542_x_at IGHA1 Hs.510635 down -1.89 213974_at ADAMTSL3 Hs.459162 down -1.89 236179_at CDH11 Hs.116471 down -1.89 218810_at ZC3H12A Hs.656294 down -1.89 226219_at ARHGAP30 Hs.389374 down -1.89 202575_at CRABP2 Hs.405662 down -1.89 202995_s_at FBLN1 Hs.24601 down -1.89 205569_at LAMP3 Hs.518448 down -1.89 203060_s_at PAPSS2 Hs.524491 down -1.89

191

213388_at PDE4DIP Hs.584841 down -1.89 210026_s_at CARD10 Hs.57973 down -1.89 205018_s_at MBNL2 Hs.657347 down -1.89 223822_at SUSD4 Hs.497841 down -1.89 203741_s_at ADCY7 Hs.513578 down -1.89 235000_at Hs.592801 Hs.592801 down -1.89 235419_at Hs.658370 Hs.658370 down -1.89 219681_s_at RAB11FIP1 Hs.696035 down -1.90 208965_s_at IFI16 Hs.380250 down -1.90 235349_at FAM82A1 Hs.591566 down -1.90 233947_s_at LOC255480 Hs.567915 down -1.90 225895_at SYNPO2 Hs.655519 down -1.90 205392_s_at CCL14 Hs.714858 down -1.90 213272_s_at TMEM159 Hs.258212 down -1.90 219836_at ZBED2 Hs.136912 down -1.90 207265_s_at KDELR3 Hs.528305 down -1.90 209496_at RARRES2 Hs.647064 down -1.90 232297_at Hs.633187 Hs.633187 down -1.90 210972_x_at TRAC

down -1.91

210029_at IDO1 Hs.840 down -1.91 235072_s_at Hs.94499 Hs.94499 down -1.91 209686_at S100B Hs.422181 down -1.91 223385_at CYP2S1 Hs.98370 down -1.91 207574_s_at GADD45B Hs.110571 down -1.91 204897_at PTGER4 Hs.199248 down -1.91 1556185_a_at Hs.287168 Hs.287168 down -1.91 202822_at LPP Hs.444362 down -1.91 228750_at Hs.657621 Hs.657621 down -1.91 214414_x_at HBA1 Hs.449630 down -1.91 203217_s_at ST3GAL5 Hs.415117 down -1.91 203234_at UPP1 Hs.488240 down -1.91 233329_s_at KRCC1 Hs.469254 down -1.91 236331_at CDKL2 Hs.591698 down -1.91 238619_at Hs.662069 Hs.662069 down -1.91 213261_at TRANK1 Hs.170999 down -1.91 242722_at LMO7 Hs.207631 down -1.92 212859_x_at MT1E Hs.534330 down -1.92 211416_x_at GGTLC1 Hs.355394 down -1.92 228167_at KLHL6 Hs.659147 down -1.92 224990_at C4orf34 Hs.576320 down -1.92 212196_at IL6ST Hs.532082 down -1.92 214247_s_at DKK3 Hs.292156 down -1.92

192

218634_at PHLDA3 Hs.268557 down -1.92 213432_at MUC5B Hs.523395 down -1.92 209788_s_at ERAP1 Hs.716426 down -1.92 208407_s_at CTNND1 Hs.166011 down -1.92 205883_at ZBTB16 Hs.591945 down -1.92 206693_at IL7 Hs.591873 down -1.92 222062_at IL27RA Hs.132781 down -1.92 203501_at PGCP Hs.156178 down -1.92 219727_at DUOX2 Hs.71377 down -1.92 217287_s_at TRPC6 Hs.159003 down -1.92 205463_s_at PDGFA Hs.535898 down -1.93 236295_s_at NLRC3 Hs.592091 down -1.93 227004_at Hs.696079 Hs.696079 down -1.93 201215_at PLS3 Hs.496622 down -1.93 217362_x_at HLA-DRB6

down -1.93

230083_at USP53 Hs.431081 down -1.93 229150_at Hs.659093 Hs.659093 down -1.93 223377_x_at CISH Hs.655334 down -1.93 219197_s_at SCUBE2 Hs.523468 down -1.93 200983_x_at CD59 Hs.709466 down -1.93 236280_at Hs.445500 Hs.445500 down -1.93 212592_at IGJ Hs.643431 down -1.94 201170_s_at BHLHE40 Hs.719093 down -1.94 225613_at MAST4 Hs.595458 down -1.94 205027_s_at MAP3K8 Hs.432453 down -1.94 227614_at HKDC1 Hs.522988 down -1.94 201904_s_at CTDSPL Hs.475963 down -1.94 209604_s_at GATA3 Hs.524134 down -1.94 243764_at VSIG1 Hs.177164 down -1.94 208335_s_at DARC Hs.153381 down -1.94 232424_at PRDM16 Hs.99500 down -1.94 235871_at LIPH Hs.68864 down -1.95 221718_s_at AKAP13 Hs.459211 down -1.95 219543_at PBLD Hs.198158 down -1.95 212660_at PHF15 Hs.483419 down -1.95 206060_s_at PTPN22 Hs.535276 down -1.95 212713_at MFAP4 Hs.296049 down -1.95 203279_at EDEM1 Hs.224616 down -1.95 221044_s_at TRIM6-TRIM34 down -1.95 228885_at MAMDC2 Hs.547172 down -1.95 217546_at MT1M Hs.647370 down -1.95 217437_s_at TACC1 Hs.279245 down -1.95

193

204646_at DPYD Hs.335034 down -1.95 203789_s_at SEMA3C Hs.269109 down -1.95 1552316_a_at GIMAP1 Hs.647087 down -1.95 210367_s_at PTGES Hs.146688 down -1.95 226103_at NEXN Hs.612385 down -1.95 213295_at CYLD Hs.578973 down -1.95 236489_at Hs.72307 Hs.72307 down -1.96 205935_at FOXF1 Hs.155591 down -1.96 229308_at Hs.355689 Hs.355689 down -1.96 202341_s_at TRIM2 Hs.435711 down -1.96 229285_at RNASEL Hs.518545 down -1.96 202145_at LY6E Hs.521903 down -1.96 220630_s_at CHIA Hs.128814 down -1.96 203233_at IL4R Hs.513457 down -1.96 1552703_s_at CARD16 Hs.348365 down -1.96 206167_s_at ARHGAP6 Hs.435291 down -1.96 218541_s_at C8orf4 Hs.591849 down -1.96 210538_s_at BIRC3 Hs.127799 down -1.96 212914_at CBX7 Hs.356416 down -1.96 205364_at ACOX2 Hs.444959 down -1.96 203305_at F13A1 Hs.335513 down -1.96 204041_at MAOB Hs.654473 down -1.97 209357_at CITED2 Hs.82071 down -1.97 1555419_a_at ASAH1 Hs.527412 down -1.97 210815_s_at CALCRL Hs.470882 down -1.97 208763_s_at TSC22D3 Hs.716410 down -1.97 228707_at CLDN23 Hs.183617 down -1.97 220180_at CCDC68 Hs.120790 down -1.97 226742_at Hs.592837 Hs.592837 down -1.97 211676_s_at IFNGR1 Hs.520414 down -1.97 235427_at Hs.611075 Hs.611075 down -1.97 214279_s_at NDRG2 Hs.525205 down -1.97 216836_s_at ERBB2 Hs.446352 down -1.97 207339_s_at LTB Hs.376208 down -1.97 227070_at GLT8D2 Hs.631650 down -1.97 214265_at ITGA8 Hs.171311 down -1.98 228869_at Hs.660456 Hs.660456 down -1.98 232122_s_at VEPH1 Hs.658046 down -1.98 209267_s_at SLC39A8 Hs.288034 down -1.98 202902_s_at CTSS Hs.181301 down -1.98 232269_x_at METRN Hs.533772 down -1.98 229779_at COL4A4 Hs.591645 down -1.98

194

230263_s_at DOCK5 Hs.195403 down -1.98 230659_at Hs.673002 Hs.673002 down -1.99 212657_s_at IL1RN Hs.81134 down -1.99 1555326_a_at ADAM9 Hs.591852 down -1.99 201300_s_at PRNP Hs.472010 down -1.99 201412_at LRP10 Hs.525232 down -1.99 46142_at LMF1 Hs.71912 down -1.99 219478_at WFDC1 Hs.36688 down -1.99 238067_at TBC1D8B Hs.351798 down -1.99 209606_at CYTIP Hs.270 down -1.99 223696_at ARSD Hs.528631 down -1.99 229435_at GLIS3 Hs.162125 down -1.99 206595_at CST6 Hs.139389 down -1.99 209212_s_at KLF5 Hs.508234 down -1.99 224061_at INMT Hs.632629 down -1.99 203571_s_at C10orf116 Hs.642660 down -1.99 236297_at Hs.585479 Hs.585479 down -1.99 229723_at TAGAP Hs.529984 down -1.99 220751_s_at C5orf4 Hs.713175 down -1.99 219352_at HERC6 Hs.529317 down -2.00 203397_s_at GALNT3 Hs.170986 down -2.00 227346_at IKZF1 Hs.488251 down -2.00 226213_at ERBB3 Hs.118681 down -2.00 229830_at Hs.714993 Hs.714993 down -2.00 205640_at ALDH3B1 Hs.523841 down -2.00 34210_at CD52 Hs.276770 down -2.00 235570_at Hs.594906 Hs.594906 down -2.00 228376_at GGTA1 Hs.97469 down -2.00 204931_at TCF21 Hs.78061 down -2.00 200701_at NPC2 Hs.433222 down -2.00 228152_s_at DDX60L Hs.535011 down -2.00 238447_at RBMS3 Hs.696468 down -2.00 212093_s_at MTUS1 Hs.7946 down -2.00 1557411_s_at SLC25A43 Hs.496658 down -2.01 205552_s_at OAS1 Hs.524760 down -2.01 223434_at GBP3

down -2.01

209605_at TST Hs.474783 down -2.01 202411_at IFI27 Hs.532634 down -2.01 210619_s_at HYAL1 Hs.75619 down -2.01 220431_at TMPRSS11E Hs.645299 down -2.01 38241_at BTN3A3 Hs.167741 down -2.01 232843_s_at DOCK8 Hs.132599 down -2.02

195

205185_at SPINK5 Hs.331555 down -2.02 203923_s_at CYBB Hs.292356 down -2.02 202450_s_at CTSK Hs.632466 down -2.02 1555759_a_at CCL5 Hs.514821 down -2.02 200795_at SPARCL1 Hs.62886 down -2.02 213888_s_at TRAF3IP3 Hs.147434 down -2.02 225776_at RBMS2 Hs.505729 down -2.02 230036_at SAMD9L Hs.489118 down -2.02 206385_s_at ANK3 Hs.499725 down -2.02 219584_at PLA1A Hs.437451 down -2.02 238222_at GKN2 Hs.16757 down -2.02 213317_at CLIC5 Hs.485489 down -2.02 213006_at CEBPD Hs.440829 down -2.02 204563_at SELL Hs.82848 down -2.03 235182_at ISM1 Hs.559353 down -2.03 211796_s_at TRBC1

down -2.03

1552797_s_at PROM2 Hs.469313 down -2.03 207222_at PLA2G10 Hs.567366 down -2.03 209447_at SYNE1 Hs.12967 down -2.03 210751_s_at RGN Hs.77854 down -2.03 1553102_a_at CCDC69 Hs.655336 down -2.03 226878_at HLA-DOA Hs.631991 down -2.03 213241_at PLXNC1 Hs.584845 down -2.03 241994_at XDH Hs.250 down -2.03 227188_at C21orf63 Hs.208358 down -2.03 200904_at HLA-E Hs.650174 down -2.03 228772_at HNMT Hs.42151 down -2.03 206101_at ECM2 Hs.117060 down -2.04 209116_x_at HBB Hs.523443 down -2.04 228640_at PCDH7 Hs.479439 down -2.04 212647_at RRAS Hs.515536 down -2.04 204719_at ABCA8 Hs.58351 down -2.04 238327_at ODF3B Hs.531314 down -2.04 212611_at DTX4 Hs.523696 down -2.04 207569_at ROS1 Hs.1041 down -2.04 230250_at PTPRB Hs.434375 down -2.04 200761_s_at ARL6IP5 Hs.518060 down -2.04 221511_x_at CCPG1 Hs.285051 down -2.04 229964_at C9orf152 Hs.125608 down -2.04 219684_at RTP4 Hs.43388 down -2.04 221012_s_at TRIM8 Hs.336810 down -2.04 209949_at NCF2 Hs.587558 down -2.05

196

224989_at Hs.205952 Hs.205952 down -2.05 204894_s_at AOC3 Hs.198241 down -2.05 219962_at ACE2 Hs.178098 down -2.05 212912_at RPS6KA2 Hs.655277 down -2.05 1554966_a_at FILIP1L Hs.104672 down -2.05 226863_at FAM110C Hs.710113 down -2.05 219434_at TREM1 Hs.283022 down -2.05 225629_s_at ZBTB4 Hs.35096 down -2.05 219147_s_at C9orf95 Hs.494186 down -2.05 210830_s_at PON2 Hs.719159 down -2.05 201041_s_at DUSP1 Hs.171695 down -2.05 228325_at KIAA0146 Hs.381058 down -2.05 203799_at CD302 Hs.130014 down -2.05 232024_at GIMAP2 Hs.647071 down -2.05 201474_s_at ITGA3 Hs.265829 down -2.06 210239_at IRX5 Hs.435730 down -2.06 202820_at AHR Hs.171189 down -2.06 223044_at SLC40A1 Hs.643005 down -2.06 213316_at KIAA1462 Hs.533953 down -2.06 207238_s_at PTPRC Hs.654514 down -2.06 220005_at P2RY13 Hs.546396 down -2.06 221748_s_at TNS1 Hs.471381 down -2.06 204070_at RARRES3 Hs.17466 down -2.07 236065_at Hs.443967 Hs.443967 down -2.07 228071_at GIMAP7 Hs.647074 down -2.07 203499_at EPHA2 Hs.171596 down -2.07 218885_s_at GALNT12 Hs.47099 down -2.07 226067_at C20orf114 Hs.65551 down -2.07 210382_at SCTR Hs.42091 down -2.07 204116_at IL2RG Hs.84 down -2.07 243818_at SFTA1P Hs.31562 down -2.07 232267_at GPR133 Hs.719239 down -2.07 224822_at DLC1 Hs.134296 down -2.07 238439_at ANKRD22 Hs.217484 down -2.07 204537_s_at GABRE Hs.22785 down -2.07 203232_s_at ATXN1 Hs.434961 down -2.07 207651_at GPR171 Hs.549152 down -2.07 226641_at Hs.432706 Hs.432706 down -2.07 215536_at HLA-DQB2

down -2.07

230585_at Hs.129583 Hs.129583 down -2.07 206011_at CASP1 Hs.2490 down -2.08 223218_s_at NFKBIZ Hs.319171 down -2.08

197

225579_at PQLC3 Hs.274415 down -2.08 218084_x_at FXYD5 Hs.333418 down -2.08 206407_s_at CCL13 Hs.414629 down -2.08 230903_s_at C8orf42 Hs.289293 down -2.08 235306_at GIMAP8 Hs.647121 down -2.09 1555812_a_at ARHGDIB Hs.504877 down -2.09 217730_at TMBIM1 Hs.591605 down -2.09 204990_s_at ITGB4 Hs.632226 down -2.09 218368_s_at TNFRSF12A Hs.355899 down -2.09 205844_at VNN1 Hs.12114 down -2.09 205700_at HSD17B6 Hs.524513 down -2.09 203543_s_at KLF9 Hs.150557 down -2.09 213056_at FRMD4B Hs.709671 down -2.09 213994_s_at SPON1 Hs.705394 down -2.09 205831_at CD2 Hs.523500 down -2.10 218901_at PLSCR4 Hs.477869 down -2.10 212586_at CAST Hs.436186 down -2.10 225806_at JUB Hs.655832 down -2.10 208683_at CAPN2 Hs.350899 down -2.10 213060_s_at CHI3L2 Hs.514840 down -2.10 224414_s_at CARD6 Hs.200242 down -2.10 209732_at CLEC2B Hs.85201 down -2.10 226789_at EMB Hs.561411 down -2.11 209114_at TSPAN1 Hs.38972 down -2.11 209598_at PNMA2 Hs.591838 down -2.11 204735_at PDE4A Hs.89901 down -2.11 204972_at OAS2 Hs.414332 down -2.11 209821_at IL33 Hs.348390 down -2.11 229367_s_at GIMAP6 Hs.647105 down -2.11 203908_at SLC4A4 Hs.5462 down -2.11 208306_x_at Hs.534322 Hs.534322 down -2.11 203815_at GSTT1 Hs.268573 down -2.11 209687_at CXCL12 Hs.522891 down -2.11 232541_at Hs.664233 Hs.664233 down -2.11 210166_at TLR5 Hs.604542 down -2.12 204934_s_at HPN Hs.182385 down -2.12 231270_at CA13 Hs.127189 down -2.12 226865_at Hs.99472 Hs.99472 down -2.12 227354_at PAG1 Hs.266175 down -2.12 204457_s_at GAS1 Hs.65029 down -2.12 226576_at ARHGAP26 Hs.654668 down -2.12 201601_x_at IFITM1 Hs.458414 down -2.12

198

225008_at ASPH Hs.591874 down -2.12 204811_s_at CACNA2D2 Hs.476273 down -2.12 238668_at Hs.527860 Hs.527860 down -2.13 227404_s_at EGR1 Hs.708393 down -2.13 217728_at S100A6 Hs.275243 down -2.13 224828_at CPEB4 Hs.127126 down -2.13 238689_at GPR110 Hs.256897 down -2.13 224916_at TMEM173 Hs.379754 down -2.14 222717_at SDPR Hs.26530 down -2.14 214470_at KLRB1 Hs.169824 down -2.14 205159_at CSF2RB Hs.592192 down -2.14 231807_at KIAA1217 Hs.445885 down -2.14 218986_s_at DDX60 Hs.591710 down -2.15 205671_s_at HLA-DOB Hs.1802 down -2.15 205200_at CLEC3B Hs.476092 down -2.15 205316_at SLC15A2 Hs.518089 down -2.15 213415_at CLIC2 Hs.655445 down -2.15 217281_x_at IGHM Hs.700112 down -2.15 219279_at DOCK10 Hs.46578 down -2.15 206377_at FOXF2 Hs.484423 down -2.15 217757_at A2M Hs.212838 down -2.16 228224_at PRELP Hs.632481 down -2.16 1554240_a_at ITGAL Hs.174103 down -2.16 225033_at ST3GAL1 Hs.374257 down -2.16 236430_at TMED6 Hs.658619 down -2.16 210145_at PLA2G4A Hs.497200 down -2.16 218723_s_at C13orf15 Hs.507866 down -2.16 219890_at CLEC5A Hs.446235 down -2.16 205786_s_at ITGAM Hs.172631 down -2.16 226932_at SSPN Hs.183428 down -2.16 204971_at CSTA Hs.518198 down -2.16 214033_at ABCC6 Hs.442182 down -2.17 211742_s_at EVI2B Hs.5509 down -2.17 241382_at PCP4L1 Hs.433150 down -2.17 223253_at EPDR1 Hs.563491 down -2.17 207419_s_at RAC2 Hs.517601 down -2.17 209803_s_at PHLDA2 Hs.154036 down -2.18 201650_at KRT19 Hs.654568 down -2.18 208250_s_at DMBT1 Hs.279611 down -2.18 203638_s_at FGFR2 Hs.533683 down -2.18 223349_s_at BOK Hs.293753 down -2.18 214203_s_at PRODH Hs.517352 down -2.18

199

223784_at TMEM27 Hs.129614 down -2.18 233177_s_at PNKD Hs.98475 down -2.18 211026_s_at MGLL Hs.277035 down -2.18 211317_s_at CFLAR Hs.390736 down -2.19 226425_at CLIP4 Hs.122927 down -2.19 213618_at ARAP2 Hs.479451 down -2.19 221667_s_at HSPB8 Hs.400095 down -2.19 203510_at MET Hs.132966 down -2.19 206978_at CCR2 Hs.644637 down -2.19 226992_at NOSTRIN Hs.189780 down -2.19 215784_at CD1E Hs.249217 down -2.19 201531_at ZFP36 Hs.534052 down -2.19 227803_at ENPP5 Hs.35198 down -2.19 202071_at SDC4 Hs.632267 down -2.19 208892_s_at DUSP6 Hs.298654 down -2.19 206726_at HPGDS Hs.128433 down -2.19 211668_s_at PLAU Hs.77274 down -2.20 204439_at IFI44L Hs.389724 down -2.20 230383_x_at Hs.585792 Hs.585792 down -2.20 239272_at MMP28 Hs.380710 down -2.20 236129_at GALNT5 Hs.269027 down -2.20 1555950_a_at CD55 Hs.126517 down -2.20 228726_at Hs.592409 Hs.592409 down -2.20 202746_at ITM2A Hs.17109 down -2.21 219093_at PID1 Hs.715695 down -2.21 223690_at LTBP2 Hs.512776 down -2.21 209691_s_at DOK4 Hs.279832 down -2.21 204254_s_at VDR Hs.524368 down -2.21 219995_s_at ZNF750 Hs.653124 down -2.21 201280_s_at DAB2 Hs.481980 down -2.21 205894_at ARSE Hs.386975 down -2.21 211986_at AHNAK Hs.502756 down -2.22 225871_at STEAP2 Hs.489051 down -2.22 231747_at CYSLTR1 Hs.201300 down -2.22 201860_s_at PLAT Hs.491582 down -2.22 235292_at FLJ32255 Hs.535791 down -2.22 214453_s_at IFI44 Hs.82316 down -2.22 204192_at CD37 Hs.166556 down -2.22 209499_x_at TNFSF12-TNFSF13 Hs.54673 down -2.23 219580_s_at TMC5 Hs.115838 down -2.23 223395_at ABI3BP Hs.477015 down -2.23 231043_at PCDP1 Hs.496753 down -2.23

200

222802_at EDN1 Hs.511899 down -2.23 202525_at PRSS8 Hs.75799 down -2.24 205076_s_at MTMR11 Hs.425144 down -2.24 229910_at SHE Hs.591481 down -2.24 235651_at Hs.173704 Hs.173704 down -2.24 226725_at Hs.14691 Hs.14691 down -2.24 204174_at ALOX5AP Hs.507658 down -2.24 205992_s_at IL15 Hs.654378 down -2.25 209493_at PDZD2 Hs.481819 down -2.25 213572_s_at SERPINB1 Hs.381167 down -2.25 205968_at KCNS3 Hs.414489 down -2.26 239331_at Hs.658407 Hs.658407 down -2.26 214587_at COL8A1 Hs.654548 down -2.26 206641_at TNFRSF17 Hs.2556 down -2.26 221840_at PTPRE Hs.127022 down -2.26 213624_at SMPDL3A Hs.486357 down -2.26 218035_s_at RBM47 Hs.518727 down -2.26 201137_s_at HLA-DPB1 Hs.485130 down -2.27 228806_at RORC Hs.256022 down -2.27 226701_at GJA5 Hs.447968 down -2.28 227998_at S100A16 Hs.515714 down -2.28 209676_at TFPI Hs.516578 down -2.28 218204_s_at FYCO1 Hs.714847 down -2.28 231941_s_at MUC20 Hs.698211 down -2.28 41660_at CELSR1 Hs.252387 down -2.28 212845_at SAMD4A Hs.98259 down -2.28 1555745_a_at LYZ Hs.524579 down -2.28 207655_s_at BLNK Hs.665244 down -2.29 226040_at Hs.593351 Hs.593351 down -2.29 241879_at Hs.557980 Hs.557980 down -2.29 213068_at DPT Hs.80552 down -2.29 201069_at MMP2 Hs.513617 down -2.30 219368_at NAP1L2 Hs.66180 down -2.30 212067_s_at C1R Hs.524224 down -2.31 202917_s_at S100A8 Hs.416073 down -2.31 230867_at COL6A6 Hs.591282 down -2.31 215193_x_at HLA-DRB3 Hs.696211 down -2.31 210072_at CCL19 Hs.50002 down -2.31 201525_at APOD Hs.522555 down -2.31 201008_s_at TXNIP Hs.715525 down -2.31 210982_s_at HLA-DRA Hs.520048 down -2.31 214696_at C17orf91 Hs.597755 down -2.31

201

1557136_at ATP13A4 Hs.674423 down -2.31 200878_at EPAS1 Hs.468410 down -2.31 37005_at NBL1 Hs.654502 down -2.32 235666_at Hs.592472 Hs.592472 down -2.32 203535_at S100A9 Hs.112405 down -2.32 203088_at FBLN5 Hs.332708 down -2.33 204470_at CXCL1 Hs.789 down -2.33 210119_at KCNJ15 Hs.411299 down -2.33 213664_at SLC1A1 Hs.444915 down -2.33 217179_x_at Hs.654512 Hs.654512 down -2.33 242625_at RSAD2 Hs.17518 down -2.33 226435_at PAPLN Hs.655583 down -2.34 213397_x_at RNASE4

down -2.34

202180_s_at MVP Hs.632177 down -2.34 201425_at ALDH2 Hs.632733 down -2.34 201286_at SDC1 Hs.224607 down -2.34 200953_s_at CCND2 Hs.376071 down -2.35 209301_at CA2 Hs.155097 down -2.35 217995_at SQRDL Hs.511251 down -2.35 212573_at ENDOD1 Hs.167115 down -2.36 1567628_at CD74 Hs.436568 down -2.36 224396_s_at ASPN Hs.435655 down -2.36 226671_at LAMP2 Hs.496684 down -2.36 212814_at AHCYL2 Hs.600789 down -2.36 213293_s_at TRIM22 Hs.501778 down -2.36 229554_at Hs.597993 Hs.597993 down -2.37 226218_at IL7R Hs.635723 down -2.37 211726_s_at FMO2 Hs.144912 down -2.37 203153_at IFIT1 Hs.20315 down -2.37 205500_at C5 Hs.494997 down -2.37 212187_x_at PTGDS Hs.446429 down -2.38 210377_at ACSM3 Hs.706754 down -2.38 227480_at SUSD2 Hs.131819 down -2.38 40665_at FMO3 Hs.445350 down -2.38 202449_s_at RXRA Hs.590886 down -2.38 1566557_at FLJ90757 Hs.448889 down -2.38 203065_s_at CAV1 Hs.74034 down -2.39 204924_at TLR2 Hs.519033 down -2.39 205464_at SCNN1B Hs.414614 down -2.39 209047_at AQP1 Hs.76152 down -2.39 217478_s_at HLA-DMA Hs.351279 down -2.39 226982_at ELL2 Hs.192221 down -2.40

202

201124_at ITGB5 Hs.536663 down -2.40 228854_at Hs.586747 Hs.586747 down -2.40 222150_s_at PION Hs.186649 down -2.40 215034_s_at TM4SF1 Hs.715499 down -2.41 227702_at CYP4X1 Hs.439760 down -2.41 218960_at TMPRSS4 Hs.161985 down -2.42 201785_at RNASE1 Hs.78224 down -2.42 201843_s_at EFEMP1 Hs.76224 down -2.42 203498_at RCAN2 Hs.440168 down -2.42 223315_at NTN4 Hs.201034 down -2.42 239587_at Hs.201600 Hs.201600 down -2.42 1555756_a_at CLEC7A Hs.143929 down -2.42 238332_at ANKRD29 Hs.374774 down -2.42 201998_at ST6GAL1 Hs.207459 down -2.42 207565_s_at MR1 Hs.101840 down -2.43 219263_at RNF128 Hs.496542 down -2.43 221884_at MECOM Hs.719216 down -2.43 203758_at CTSO Hs.75262 down -2.43 201012_at ANXA1 Hs.494173 down -2.44 211991_s_at HLA-DPA1 Hs.347270 down -2.44 212671_s_at HLA-DQA2 Hs.387679 down -2.44 209795_at CD69 Hs.208854 down -2.44 209696_at FBP1 Hs.494496 down -2.45 227314_at ITGA2 Hs.482077 down -2.46 206271_at TLR3 Hs.657724 down -2.46 1557078_at SLFN5 Hs.709347 down -2.46 223541_at HAS3 Hs.592069 down -2.47 222859_s_at DAPP1 Hs.436271 down -2.47 222453_at CYBRD1 Hs.715531 down -2.47 204438_at MRC1 Hs.75182 down -2.48 223278_at GJB2 Hs.524894 down -2.48 209369_at ANXA3 Hs.480042 down -2.48 221019_s_at COLEC12 Hs.464422 down -2.48 206714_at ALOX15B Hs.111256 down -2.48 205668_at LY75 Hs.153563 down -2.48 1557080_s_at ITGBL1 Hs.696554 down -2.49 209487_at RBPMS Hs.334587 down -2.49 226237_at Hs.718575 Hs.718575 down -2.49 204959_at MNDA Hs.153837 down -2.49 219667_s_at BANK1 Hs.480400 down -2.50 218627_at DRAM1 Hs.525634 down -2.50 229105_at GPR39 Hs.432395 down -2.50

203

225809_at PARM1 Hs.105460 down -2.51 209270_at LAMB3 Hs.497636 down -2.51 207076_s_at ASS1 Hs.160786 down -2.52 202295_s_at CTSH Hs.148641 down -2.52 200872_at S100A10 Hs.143873 down -2.52 224895_at YAP1 Hs.503692 down -2.52 228592_at MS4A1 Hs.712553 down -2.53 208168_s_at CHIT1 Hs.201688 down -2.54 823_at CX3CL1 Hs.531668 down -2.55 206932_at CH25H Hs.47357 down -2.55 202489_s_at FXYD3 Hs.301350 down -2.55 217258_x_at IGL@ Hs.449585 down -2.55 244780_at SGPP2 Hs.591604 down -2.55 229242_at Hs.23349 Hs.23349 down -2.56 235352_at Hs.13500 Hs.13500 down -2.56 212998_x_at HLA-DQB1 Hs.409934 down -2.58 201348_at GPX3 Hs.719149 down -2.58 208451_s_at C4B Hs.534847 down -2.58 222853_at FLRT3 Hs.41296 down -2.59 209498_at CEACAM1 Hs.512682 down -2.60 202267_at LAMC2 Hs.591484 down -2.60 204052_s_at SFRP4 Hs.658169 down -2.62 204803_s_at RRAD Hs.1027 down -2.62 224999_at Hs.605083 Hs.605083 down -2.62 222073_at COL4A3 Hs.570065 down -2.63 205898_at CX3CR1 Hs.78913 down -2.63 229831_at CNTN3 Hs.12723 down -2.63 223454_at CXCL16 Hs.711652 down -2.63 210004_at OLR1 Hs.412484 down -2.64 219795_at SLC6A14 Hs.522109 down -2.64 203324_s_at CAV2 Hs.212332 down -2.66 204475_at MMP1 Hs.83169 down -2.66 208944_at TGFBR2 Hs.82028 down -2.67 205945_at IL6R Hs.709210 down -2.68 209189_at FOS Hs.707896 down -2.68 241981_at FAM20A Hs.268874 down -2.68 205234_at SLC16A4 Hs.351306 down -2.69 204748_at PTGS2 Hs.196384 down -2.69 212950_at GPR116 Hs.362806 down -2.70 222549_at CLDN1 Hs.439060 down -2.70 1555564_a_at CFI Hs.312485 down -2.70 241560_at Hs.164225 Hs.164225 down -2.70

204

203407_at PPL Hs.192233 down -2.71 219454_at EGFL6 Hs.12844 down -2.71 206311_s_at PLA2G1B Hs.992 down -2.72 1569344_a_at Hs.205745 Hs.205745 down -2.72 205259_at NR3C2 Hs.163924 down -2.72 218717_s_at LEPREL1 Hs.374191 down -2.72 228528_at LOC100286909 Hs.445414 down -2.72 204753_s_at HLF Hs.196952 down -2.73 214433_s_at SELENBP1 Hs.632460 down -2.75 209515_s_at RAB27A Hs.654978 down -2.76 205776_at FMO5 Hs.642706 down -2.76 204268_at S100A2 Hs.516484 down -2.76 219529_at CLIC3 Hs.64746 down -2.77 211734_s_at FCER1A Hs.897 down -2.77 221530_s_at BHLHE41 Hs.177841 down -2.77 213800_at CFH Hs.363396 down -2.78 225645_at EHF Hs.653859 down -2.79 224391_s_at SIAE Hs.10056 down -2.80 206170_at ADRB2 Hs.591251 down -2.80 211689_s_at TMPRSS2 Hs.439309 down -2.82 223503_at TMEM163 Hs.369471 down -2.83 205476_at CCL20 Hs.75498 down -2.84 208498_s_at AMY1C Hs.654437 down -2.85 203726_s_at LAMA3 Hs.436367 down -2.85 202992_at C7 Hs.78065 down -2.85 217428_s_at COL10A1 Hs.520339 down -2.85 218211_s_at MLPH Hs.102406 down -2.85 205041_s_at ORM1 Hs.522356 down -2.86 203780_at MPZL2 Hs.116651 down -2.86 211864_s_at MYOF Hs.602086 down -2.87 228979_at SFTA3 Hs.509165 down -2.87 209774_x_at CXCL2 Hs.75765 down -2.87 206100_at CPM Hs.654387 down -2.88 226811_at FAM46C Hs.356216 down -2.88 202149_at NEDD9 Hs.37982 down -2.89 212014_x_at CD44 Hs.502328 down -2.89 227450_at ERP27 Hs.162143 down -2.89 205239_at AREG Hs.270833 down -2.89 204259_at MMP7 Hs.2256 down -2.89 205216_s_at APOH Hs.445358 down -2.93 229254_at MFSD4 Hs.567714 down -2.93 214354_x_at SFTPB Hs.512690 down -2.93

205

240242_at Hs.231852 Hs.231852 down -2.93 218322_s_at ACSL5 Hs.11638 down -2.93 207847_s_at MUC1 Hs.89603 down -2.93 229659_s_at Hs.709003 Hs.709003 down -2.94 202638_s_at ICAM1 Hs.643447 down -2.95 220542_s_at PLUNC Hs.211092 down -2.95 205654_at C4BPA Hs.1012 down -2.96 215719_x_at FAS Hs.244139 down -2.96 227848_at PEBP4 Hs.491242 down -2.98 215059_at Hs.709443 Hs.709443 down -2.99 213674_x_at IGHD

down -2.99

219747_at C4orf31 Hs.709520 down -3.00 226228_at AQP4 Hs.315369 down -3.01 228055_at NAPSB Hs.636624 down -3.01 229584_at LRRK2 Hs.187636 down -3.01 226560_at Hs.210043 Hs.210043 down -3.02 206651_s_at CPB2 Hs.512937 down -3.02 228504_at SCN7A Hs.695947 down -3.02 235766_x_at Hs.626665 Hs.626665 down -3.02 238017_at SDR16C5 Hs.170673 down -3.06 209335_at DCN Hs.718429 down -3.06 201983_s_at EGFR Hs.488293 down -3.09 212992_at AHNAK2 Hs.441783 down -3.11 204379_s_at FGFR3 Hs.1420 down -3.11 226960_at CXCL17 Hs.445586 down -3.13 238778_at MPP7 Hs.499159 down -3.13 228241_at AGR3 Hs.100686 down -3.16 219010_at C1orf106 Hs.518997 down -3.16 227725_at ST6GALNAC1 Hs.105352 down -3.17 205927_s_at CTSE Hs.644082 down -3.18 202687_s_at TNFSF10 Hs.478275 down -3.18 209173_at AGR2 Hs.530009 down -3.20 206754_s_at CYP2B7P1 Hs.1360 down -3.21 209373_at MALL Hs.185055 down -3.22 228143_at CP Hs.558314 down -3.25 1559584_a_at C16orf54 Hs.331095 down -3.26 218835_at SFTPA2 Hs.523084 down -3.26 226621_at Hs.655172 Hs.655172 down -3.30 202357_s_at CFB Hs.408903 down -3.31 203108_at GPRC5A Hs.631733 down -3.32 203939_at NT5E Hs.153952 down -3.32 202948_at IL1R1 Hs.701982 down -3.34

206

205421_at SLC22A3 Hs.567337 down -3.35 1555236_a_at PGC Hs.1867 down -3.36 227038_at SGMS2 Hs.595423 down -3.39 229030_at CAPN8 Hs.291487 down -3.42 206884_s_at SCEL Hs.534699 down -3.45 209395_at CHI3L1 Hs.382202 down -3.46 1555229_a_at C1S Hs.458355 down -3.47 228708_at RAB27B Hs.25318 down -3.51 216474_x_at TPSB2 Hs.405479 down -3.53 212444_at Hs.632997 Hs.632997 down -3.53 205729_at OSMR Hs.120658 down -3.55 217767_at C3 Hs.529053 down -3.56 228782_at SCGB3A2 Hs.483765 down -3.58 208161_s_at ABCC3 Hs.463421 down -3.59 212741_at MAOA Hs.183109 down -3.61 203757_s_at CEACAM6 Hs.466814 down -3.62 227475_at FOXQ1 Hs.591352 down -3.64 205597_at SLC44A4 Hs.335355 down -3.69 209613_s_at ADH1B Hs.4 down -3.70 210096_at CYP4B1 Hs.436317 down -3.72 208792_s_at CLU Hs.436657 down -3.73 218677_at S100A14 Hs.288998 down -3.79 230319_at Hs.90250 Hs.90250 down -3.79 204885_s_at MSLN Hs.408488 down -3.80 219630_at PDZK1IP1 Hs.431099 down -3.84 225987_at STEAP4 Hs.521008 down -3.86 205624_at CPA3 Hs.646 down -3.90 211597_s_at HOPX Hs.654864 down -3.94 223631_s_at C19orf33 Hs.631544 down -4.09 230378_at SCGB3A1 Hs.62492 down -4.09 204124_at SLC34A2 Hs.479372 down -4.12 212531_at LCN2 Hs.204238 down -4.19 214199_at SFTPD Hs.253495 down -4.19 204437_s_at FOLR1 Hs.73769 down -4.21 202286_s_at TACSTD2 Hs.23582 down -4.25 214387_x_at SFTPC Hs.1074 down -4.29 229177_at C16orf89 Hs.11782 down -4.30 211478_s_at DPP4 Hs.368912 down -4.42 203913_s_at HPGD Hs.596913 down -4.48 226535_at ITGB6 Hs.470399 down -4.52 219476_at C1orf116 Hs.32417 down -4.83 203021_at SLPI Hs.517070 down -4.98

207

223678_s_at SFTPA1 Hs.645340 down -5.00 202833_s_at SERPINA1 Hs.525557 down -5.14 226147_s_at PIGR Hs.497589 down -5.50 39248_at AQP3 Hs.234642 down -5.51 223806_s_at NAPSA Hs.714418 down -5.61 244056_at SFTA2 Hs.211267 down -7.03

208

Table S13: List of relevant gene sets identified by GSEA from the Broad Institute Database

corresponding to various GO terms (C5) and curated signatures (C2), including resistance to drugs

or response to drugs, overlapping with our list of up- and down-regulated genes in P3 aggressive lung tumors. Gene set group

in Fig 6

NAME SIZE

Enrichment Score

Normalized Enrichment Score

NOM p-val

FDR q-val

FWER p-val

C2 yes WONG_EMBRYONIC_STEM_CELL_CORE 302 0.62 7.04 <0.0001 <0.0001 <0.001

C2

BENPORATH_ES_1 335 0.52 5.99 <0.0001 <0.0001 <0.001

C2

BENPORATH_ES_CORE_NINE_CORRELATED 97 0.45 3.68 <0.0001 <0.0001 <0.001

C2

BHATTACHARYA_EMBRYONIC_STEM_CELL 67 0.51 3.65 <0.0001 <0.0001 <0.001

C2

SU_TESTIS 75 0.51 3.83 <0.0001 <0.0001 <0.001

C5 yes CELL_CYCLE_PROCESS 176 0.56 5.56 <0.0001 <0.0001 <0.001

C5 yes NUCLEAR_PART 496 0.42 5.19 <0.0001 <0.0001 <0.001

C5

MITOTIC_CELL_CYCLE 136 0.56 5.17 <0.0001 <0.0001 <0.001

C5

CELL_CYCLE_PHASE 156 0.55 5.14 <0.0001 <0.0001 <0.001

C5

CELL_CYCLE_GO_0007049 289 0.45 5.13 <0.0001 <0.0001 <0.001

C5

M_PHASE 104 0.58 4.89 <0.0001 <0.0001 <0.001

C5

M_PHASE_OF_MITOTIC_CELL_CYCLE 77 0.62 4.79 <0.0001 <0.0001 <0.001

C2

REACTOME_CELL_CYCLE_MITOTIC 277 0.58 6.39 <0.0001 <0.0001 <0.001

C2

KEGG_CELL_CYCLE 119 0.55 4.85 <0.0001 <0.0001 <0.001

C2

BENPORATH_PROLIFERATION 134 0.70 6.36 <0.0001 <0.0001 <0.001

C2

REACTOME_MITOTIC_M_M_G1_PHASES 143 0.61 5.74 <0.0001 <0.0001 <0.001

C5 yes DEFENSE_RESPONSE 243

-0.38

-5.21 <0.0001 <0.0001 <0.001

C5 yes IMMUNE_RESPONSE 221

-0.40

-5.20 <0.0001 <0.0001 <0.001

C5

IMMUNE_SYSTEM_PROCESS 311

-0.31

-4.52 <0.0001 <0.0001 <0.001

C5

INFLAMMATORY_RESPONSE 115

-0.42

-4.42 <0.0001 <0.0001 <0.001

C5

RESPONSE_TO_WOUNDING 174

-0.35

-4.35 <0.0001 <0.0001 <0.001

C2 yes SHEDDEN_LUNG_CANCER_POOR_SURVIVAL_A6 408 0.69 8.38 <0.0001 <0.0001 <0.001

C2 yes SHEDDEN_LUNG_CANCER_GOOD_SURVIVAL_A5 62 0.25 1.76 0.020173 <0.05 <0.001

C2

BIDUS_METASTASIS_UP 175 0.63 6.37 <0.0001 <0.0001 <0.001

C2

BIDUS_METASTASIS_DN 133

-0.33

-3.77 <0.0001 <0.0001 <0.001

C2

WINNEPENNINCKX_MELANOMA_METASTASIS_UP 138 0.72 6.61 <0.0001 <0.0001 <0.001

C2

LIAO_METASTASIS 476 0.36 4.57 <0.0001 <0.0001 <0.001

C2

JAEGER_METASTASIS_UP 42 0.73 4.45 <0.0001 <0.0001 <0.001

C2

RHODES_CANCER_META_SIGNATURE 52 0.56 3.70 <0.0001 <0.0001 <0.001

C2

RICKMAN_METASTASIS_UP 284 0.33 3.64 <0.0001 <0.0001 <0.001

C2

PROVENZANI_METASTASIS_UP 178 0.34 3.31 <0.0001 <0.0001 <0.001

C2

RAMASWAMY_METASTASIS_UP 53 0.41 2.74 <0.0001 <0.001 <0.05

C2

POOLA_INVASIVE_BREAST_CANCER_UP 268 0.33 3.61 <0.0001 <0.0001 <0.001

C2 yes KANG_DOXORUBICIN_RESISTANCE_UP 50 0.92 6.00 <0.0001 <0.0001 <0.001

209

C2 yes COLDREN_GEFITINIB_RESISTANCE_UP 77 0.45 3.45 <0.0001 <0.0001 <0.001

C2 yes BLUM_RESPONSE_TO_SALIRASIB_DN 319 0.61 6.96 <0.0001 <0.0001 <0.001

C2 yes MITSIADES_RESPONSE_TO_APLIDIN_DN 220 0.56 5.88 <0.0001 <0.0001 <0.001

C2

CONCANNON_APOPTOSIS_BY_EPOXOMICIN_DN 150 0.49 4.62 <0.0001 <0.0001 <0.001

C2

MARTINEZ_RESPONSE_TO_TRABECTEDIN_DN 218 0.30 3.18 <0.0001 <0.0001 <0.001

C2

ZHANG_RESPONSE_TO_IKK_INHIBITOR_AND_TNF_DN 94 0.37 3.01 <0.0001 <0.0001 <0.01

C2

ZHANG_RESPONSE_TO_CANTHARIDIN_DN 52 0.46 3.03 <0.0001 <0.0001 <0.01

C2

MAYBURD_RESPONSE_TO_L663536_DN 52 0.44 2.96 <0.0001 <0.0001 <0.01

C2

CAFFAREL_RESPONSE_TO_THC_DN 25 0.59 2.92 <0.0001 <0.0001 <0.01

C2

PENG_RAPAMYCIN_RESPONSE_DN 63 0.40 2.82 <0.0001 <0.0001 <0.05

C2

KAN_RESPONSE_TO_ARSENIC_TRIOXIDE 115 0.32 2.80 <0.0001 <0.0001 <0.05

Documents

Supplementary Materials for · 2013-05-20 · Supplementary Materials and Methods Analysis of the epigenetic characteristics of the promoter regions of testis and placenta restricted