Supplementary Materials and Methods - dev.biologists.orgdev.biologists.org/content/develop/suppl/2014/06/04/141.12.2402.DC... · 20" Mouse testes were fixed with 4% paraformaldehyde

Supplementary Materials and Methods 1

Germ cell isolation and flow cytometry 2

Mice heterozygous for the Dnmt3ltm1Enls mutant allele (Hata et al., 2002) were 3

intercrossed to generate Dnmt3l KO pups and littermate controls. Five postnatal mice 4

of the same genotype were used for each experiment. Seminiferous tubules were 5

treated with collagenase IV and DNase I to remove interstitial Leydig cells and 6

peritubular myoid cells, followed by trypsin digestion to generate cell suspensions 7

(Ogawa et al., 1997). THY1+ cells were isolated by magnetic-activated cell sorting 8

(MACS) (Miltenyi Biotec, Auburn, CA, USA), following the manufacturer's 9

instructions. Briefly, the dispersed testicular cells were placed in the MACS buffer 10

and incubated with a biotin-conjugated anti-CD90.2 (THY1) antibody (Lot 25136 and 11

Lot 80806, BD Pharmingen, San Diego, CA, USA) at 4°C for 10 min. After being 12

washed, the cells were resuspended and labeled with anti-biotin microbeads (Miltenyi 13

Biotec) at 4°C for 15 min and placed in collection tubes for isolation. The isolation 14

processes were done within 5 hours to maximize the living cells. A 15

PE-Cy5-conjugated anti-CD49f antibody (BD Pharmingen) was used for the SPC 16

population analysis. The date of birth for timed postnatal mice was defined as 0 dpp. 17

18

Immunohistochemistry 19

Development | Supplementary Material

Mouse testes were fixed with 4% paraformaldehyde (PFA), transferred into 20

sucrose gradients for dehydration, embedded in OCT compound (Tissue-Tek O.C.T. 21

Compound, Sakura, CA, U.S.A.), and cut into 8-µm-thick sections. The sections were 22

blocked with 10% goat serum before incubation with primary antibodies, anti-PLZF 23

(sc-22839; Santa Cruz Biotechnology, Santa Cruz, CA, USA) and anti-H3K9me3 24

(ab8898; Abcam, Cambridge, MA, USA). For whole-mount staining, seminiferous 25

tubules were digested with collagenase IV and fixed in 4% PFA. Tissues were washed 26

with PBS, treated with 0.5% Triton X-100 in PBS, and blocked in 10% goat serum 27

with 2% BSA. After incubation with the primary antibody, anti-PLZF (sc-22839; 28

Santa Cruz Biotechnology), sections and tubules were incubated with secondary 29

antibodies, stained with Hoechst33342 (Sigma, St. Louis, MO, USA), and mounted 30

with a mounting medium (P36934, Invitrogen, Carlsbad, CA, USA). 31

The specificity of the PLZF antibody was evaluated using testes from wild-type 32

and homozygous luxoid (Plzflu/lu) mice at 8 dpp (Buaas et al., 2004) (see Fig. S10 in 33

supplementary material). 34

35

Immunocytochemistry 36

The isolated THY1+ cells were placed onto poly-L-lysine slides (Thermo 37

Scientific, Waltham, MA, USA) and fixed in 4% PFA at 4°C overnight. After being 38


washed with PBST, the slides were blocked with 10% serum plus 1% bovine serum 39

albumin (BSA) for 1 hour at room temperature and incubated at 4°C overnight with 40

the following primary antibodies: anti-PLZF (sc-28319; Santa Cruz Biotechnology), 41

anti-H3K9me3 (ab8898; Abcam), and anti-Ki67 (ab15580; Abcam). After incubation 42

with secondary antibodies, the slides were counterstained with Hoechst 33342 and 43

mounted with a mounting medium (P36934, Invitrogen). Approximately 100 cells 44

were scored for each independent experiment. The slides were analyzed using a Leica 45

TCS SP5 II confocal microscope. 46

47

Quantitative reverse transcription PCR 48

Reverse transcription reactions were performed using the SuperScript 49

First-Strand Synthesis System (Invitrogen). qPCR was performed in a Roche Light 50

Cycler® 480II using SYBR Green PCR master mix. The primers used are listed in 51

Table S1 of the supplementary material. Hprt1 was used as an internal standard. 52

53

Western Blotting for anti-DNMT3L signal detection 54

Please note that the following extended protocol is necessary for detecting 55

DNMT3L from THY1+ SPCs as there are strong non-specific signals with similar 56

molecular weight to DNMT3L in this cell type. Regular western protocol is applicable 57


to embryonic stem cells or embryonic testes. To detect DNMT3L signal in SPCs 58

using Western blotting, 15 to 20 µg total proteins were loaded per gel well. The 10% 59

polyacrylamide gels were electrophoresed at 60 V, 30 minutes (min) and at 100 V, 2.5 60

hours (hr) in order to separate the non-specific signals near the real anti-DNMT3L 61

signal at ~50 KDa. After gel-membrane transfer, the PVDF membrane was blocked 62

with Bløk-PO (WBAVDP001, Millipore) for 2 hr at room temperature and then 63

moved to 4°C overnight with gentle rocking. The membranes were then transferred to 64

a new blocking solution of 5% dry milk in 1 X PBST (PBS plus 0.1% Tween-20) for 65

a second round of blocking overnight at 4°C with gentle rocking. Primary 66

anti-DNMT3L antibody (from Prof. Xiaodong Cheng and CST #13451, Lot 1) was 67

diluted in the Bløk-PO solution (a dilution of 1:1000) and incubated 68

with membranes for 1 hr at room temperature under agitation. We then washed the 69

membranes with 1 X PBST six times for 10 min each time with gentle rocking and 70

incubated them in diluted HRP-conjugated secondary antibodies (a dilution of 1:5000 71

in Bløk-PO solution) for 1 hr at room temperature under agitation. 72

The membranes were washed with PBST six times for 10 min each time with gentle 73

rocking to reduce background. Signals were detected using the Immobilon Western 74

Chemiluminescent HRP Substrate (ECL) (Millipore). 75

76


DNA extraction and bisulfite sequencing 77

Genomic DNA was extracted from THY1+ cells using a DNeasy Blood and 78

Tissue kit (#69504, Qiagen, Valencia, CA, USA). The isolated genomic DNA 79

underwent bisulfite treatment using an EZ DNA methylation kit (Zymo Research, 80

Orange, CA). The PCR products were purified and cloned for subsequent sequencing 81

using a pGEM-T Easy kit (Promega, Madison, WI, USA). 82

83

CD49f+GSC culture, transfection, and luciferase assay 84

DNA segments of the Cdk2 promoter were amplified and purified using a gel 85

extraction kit (Qiagen). The amplified products were cloned into the pGL4.17 vector 86

(Promega) to generate promoter reporter plasmids. We replaced the “CGGA” ETS1 87

binding site (EBS) sequence (-674 to -670) of the Cdk2 promoter to ATTG, in order 88

to validate its importance to Cdk2 expression in germ cells. 89

Mouse AP+ GSCs were derived from newborn testes as previously described 90

(Huang et al., 2009). Briefly, newborn testes (0~2 dpp) were collected and washed in 91

Hank’s buffer (Gibco) containing penicillin (100 units/ml) and streptomycin (100 92

µg/ml). The testes were digested in 0.1% protease type XIV (Sigma)/MCDB-201 93

medium (Sigma) at 4°C overnight, transferred to SMEM medium (Sigma) containing 94

10% fetal calf serum (FCS) for enzyme inhibition, and filtered through a 70-µm nylon 95


cell strainer. The cells were incubated with a PE-Cy5-conjugated anti-CD49f antibody 96

(BD Pharmingen) for 1 h on ice and then with anti-PE rat anti-mouse IgM-conjugated 97

magnetic Dynabeads (4 beads/cell: Dynal, Oslo, Norway) for 40 min at 4°C. The 98

CD49f+ GSCs were isolated via MACS (Miltenyi Biotec). Cell electroporation was 99

performed using an electroporator at 250 volts for 3 0.1-ms pulses at a spacing of 250 100

ms. The electroporated cells were seeded onto a laminin-coated plate at a density of 8 101

× 104 cells/cm2 and cultured in serum-free basic culture medium composed of 102

MCDB-201 medium containing 1× insulin/transferrin/selenium and 10 ng/ml of 103

epidermal growth factor (Gibco) for 48 hours. The luciferase activity was determined 104

using the ONE-Glo Luciferase Assay System (Promega) and was recorded with a 105

Berthold LB 960 Centro microplate luminometer (Berthold Technologies, Bad 106

Wilbad, Germany). The values were normalized to the values obtained in cells 107

transfected with an empty vector (pGL4.17). 108

109

RNA Sequencing and bioinformatics analysis 110

Total RNA for the library preparation, sequencing, and RNA-Seq analysis was 111

extracted using TRI Reagent (Ambion, Austin, TX, USA). The RNA concentration 112

and quality were determined using a NanoDrop ND-1000 spectrophotometer (Thermo 113

Scientific) and an Agilent 2100 Bioanalyzer (Agilent Technologies, Palo Alto, CA). 114


Poly-T oligo-attached magnetic beads were used to purify 2 µg RNA, and the mRNA 115

was fragmented into small pieces using divalent cations at an elevated temperature. 116

The cleaved mRNA fragments were copied into first-strand cDNA using reverse 117

transcriptase and random primers, followed by second-strand cDNA synthesis using 118

DNA polymerase I and RNase H. These cDNA fragments underwent end-repair, a 119

single A base addition, and adapter ligation. The products were then purified and 120

enriched using PCR to create the final cDNA library. Paired-end 100-nucleotide reads 121

from each mRNA library were obtained using HiScanSQ (Illumina Inc., CIC 122

bioGUNE, Bilbao, Spain). 123

TopHat and Cufflinks, proposed by Trapnell et al., were used for the gene 124

discovery and comprehensive expression analysis (Trapnell et al., 2012; Kim et al., 125

2013; Trapnell et al., 2013). We applied the Tuxedo protocol with two popular tools. 126

Short sequencing reads were aligned against the mm10 reference sequence using 127

TopHat. The mapped reads were provided as input to Cufflinks for transcript 128

fragment assembly. After the assembly, we employed Cuffdiff to identify 129

differentially expressed genes and transcripts. The statistical significance was filtered 130

using the selection criterion of a 2-fold difference from the corresponding genes. To 131

specifically explore repeat elements in the genes, we retrieved the mouse gene 132

annotation associated with repeat information from the University of California Santa 133


Cruz (UCSC) Table Browser (Karolchik et al., 2004) and utilized BEDTools (Quinlan 134

and Hall, 2010) to quantify the numbers of repeat elements in the reads. The gene 135

ontology (GO) and pathway analyses were performed using Panther software (Mi et 136

al., 2013) and the Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway 137

database (Kanehisa and Goto, 2000). The sequences have been deposited in the NCBI 138

GEO database and are available under accession number GSE54411. AW, wild-type 139

and AD, Dnmt3l KO. 140


Fig. S1. Increased cell proliferation among the Dnmt3l KO THY1+ SPC populationImmunofluorescence staining with an anti-Ki67 antibody of 8-dpp wild-type and Dnmt3l KO THY1+ cells. Green, Ki67; blue, Hoechst 33342. Scale bars: 50 µm.


Fig. S2. No difference in DNA methylation at the proximal CpG island of the mouse Cdk2 promoter between 8-dpp wild-type and Dnmt3l KO THY1+ cellsBisulfite sequencing analyses of the proximal CpG island of the Cdk2 promoter of isolated 8-dpp THY1+ cells. The gray line indicates the sequenced region. The white and black circles indicate unmethylated and methylated CpGs, respectively. The batch numbers are indicated on the left. Five postnatal mice of the same genotype were used for each batch.


Fig. S3. PLZF nuclear/cytoplasmic ratio(A) Immunofluorescence staining with a PLZF antibody of 8-dpp wild-type andDnmt3l KO THY1+ cells. Blue, Hoechst 33342. Scale bar: 2.5 µm. The results are presented as the means ± SEM. (B) Cytoplasmic and nuclear expression of PLZF in 8-dpp wild-type and Dnmt3l KO THY1+ cells. Similar results were observed in three independent experiments.


Fig. S4. Relative PLZF expression levels of perinatal and 8-dpp testes(A) Western blot analysis of PLZF expression in perinatal and 8-dpp testes. GAPDH was used as an internal control. (B) Bar chart dis-playing the relative expression levels of PLZF in perinatal wild-type and Dnmt3l KO testes. The bars represent the SEM from at least three independent experiments. E, embryonic day; dpp, days postpartum.


Fig. S5. Expression level of SALL4 and the SALL4A/PLZF ratio in THY1+ cells from 2-week-old mice(A) SALL4A and SALL4B expression levels in 2-week-old (13-14 dpp) wild-type and Dnmt3l KO THY1+ cells. GAPDH was used as an internal control. (B) Quantification of SALL4B expression levels in 2-week-old wild-type and Dnmt3l KO THY1+ cells. The ratio of Dnmt3l KO SALL4B to GAPDH was normalized to one. (C) Quantification of SALL4A expression levels in 2-week-old wild-type and Dnmt3l KO THY1+ cells. (D) Bar chart displaying the ratio of SALL4A to PLZF in 2-week-old THY1+ cells. The bars represent the SEM from at least three independent experiments. * denotes P < 0.05 (Student’s t-test).


Fig. S6. Functional defect in Dnmt3l KO SPCs(A) Failure of Dnmt3l KO SPCs to repopulate the recipient testes during germ cell transplantation. Germ cells for transplantation were isolated from the testes of 8- to 10-dpp Dnmt3l KO/GFP transgenic mice and their littermate controls. The testis cell suspension (1.5 × 106 cells/ml) was mixed with trypan blue dye, and approximately 50 μl of the cell suspension was injected into each testis of the recipients. One month later, the testes of the recipient animals were dissected for analysis. Significant colonization was observed in the recipient testes transplanted with wild-type GFP+ germ cells but not in those transplanted with Dnmt3l KO GFP+ germ cells. Scale bars: 1 mm. (B) Quantification of colony numbers in recipient testes one month after cell trans-plantation. Wild-type and Dnmt3l KO postnatal germ cells were transplanted into five busulfan-treated recipient testes in three indepen-dent experiments. Colonies were defined as groups of transplanted cells that occupied at least 0.1 mm of the tubules.


Fig. S7. Analysis of the RNA-Seq data with KEGG pathway and GSEA (A) Genes that were differentially expressed (2.5-fold) between 8-dpp wild-type and Dnmt3l KO THY1+ cells were mapped to Kyoto

Encyclopedia of Genes and Genomes (KEGG) pathways. The top 25 signaling pathways were represented by the KEGG analysis. (B) A set of genes involved in SPC proliferation and differentiation were examined using a gene set enrichment analysis (GSEA). The SPC proliferation- and differentiation-related genes included the following: Akt1, Akt2, Akt3, Bcl6, Bcl6b, Cdk1, Cdk2, Cdk4, Cdk6, Cdc20, Ccna1, Ccna2, Ccnb1, Ccnb2, Ccnd1, Ccnd2, Ccnd3, Ccne1, Cdh1, Csfr1, Cxcr4, E2F1, Mapk1, Mapk3, Etv5, Foxo1, Hras1, Gfra1, Lhx1, Lin28a, Lin28b, Myc, Map2k1, Map2k2, Piwil2, Neurog3, Nanos2, Cdkn1a, Cdkn1b, Cdkn2b, Cdkn2d, Pten, Pou3f1, Pou5f1, Rb1, Ret, Sall4, Sohlh2, Stat3, Tp53, Taf4b, Zbtb16, and Utf1. Gene list sorting mode: real (right) and abso-lute (left). The P value calculations were based on 5,000 permutations. Differences in expression levels between samples were used for gene ranking, and “leading-edge genes” refers to genes that contributed to significant enrichment scores. The results indicated that the SPC proliferation- and differentiation-related gene set was highly significantly enriched (P < 0.0002).

The detailed description of bioinformatics analysis is provided in supplementary materials and methods.


Fig. S8. A model of the proposed functions of DNMT3L in the modulation of SPC maintenance at the postnatal stage DNMT3L is required for the homeostasis and proper function of SPCs. In THY1+ cells, the absence of DNMT3L results in increased Cdk2/CDK2 levels, which are associated with ubiquitinated PLZF, which releases functional SALL4A. The released SALL4A and sta-bilized SALL4B cause the hyper-phosphorylation of both AKT and ERK in Dnmt3l KO THY1+ SPCs. The enhanced proliferation and aberrant expression of molecules essential for differentiation in Dnmt3l KO THY1+ SPCs lead to defects in differentiated spermatogonia and apoptotic spermatocytes.

Fig. S9. The relative expression level of transposable elements in 8 dpp wild-type and Dnmt3l KO THY1+ cells Bar chart displaying the relative expression levels of transposable elements in 8 dpp wild-type and Dnmt3l KO THY1+ cells. The bars represent the SEM from three independent experiments. ** denotes P < 0.01 (Student’s t-test).


Fig. S10. Demonstration of the specificity of the anti-PLZF antibody(A) Western blot analysis of 8-dpp wild-type THY1+ cells using an anti-PLZF antibody. (B) Immunostaining of testis sections derived from 8-dpp Plzf+/+ and Plzflu/lu mice. The anti-PLZF antibody stained germ cells in the wild-type testes (left) but not the mutant testes lacking PLZF expression (right). Scale bars: 100 µm. Permission to use the PLZF mutant (Plzflu/lu) animals to test the anti-PLZF antibody specificity was kindly provided by Professor Robert E Braun of the Jackson Laboratory.


Supplementary material Table S1. Primers

Real-time PCR

Gene Name Forward (5’ – 3’) Reverse (5’ – 3’)

Bcl6b CGCCAGGAAGTGAGTTTTTCA GCTCCAGCCCCGATGAG

Cdk1 AGATCAGACTTGAAAGCGAGGA GCAGGCTGACTATATTTGGATGT

Cdk2 CTCTCACGGGCATTCCTCTTC CCCTCTGCATTGATAAGCAGG

Cdk4 TCAGCACAGTTCGTGAGGTG TCCATCAGCCGTACAACATTG

Cdk6 TCTCACAGAGTAGTGCATCGT CGAGGTAAGGGCCATCTGAAAA

Cyclin A2 TGGATGGCAGTTTTGAATCACC CCCTAAGGTACGTGTGAATGTC

Cyclin D1 GCGTACCCTGACACCAATCTC ACTTGAAGTAAGATACGGAGGGC

Cyclin D2 GAGTGGGAACTGGTAGTGTTG CGCACAGAGCGATGAAGGT

Cyclin E GTGGCTCCGACCTTTCAGTC CACAGTCTTGTCAATCTTGGCA

Dnmt3l GGAACTCTCCAGGTGTAC GTGTCCATCATCATCATACAG

Epcam GTGTCATTAGCAGTCATCG ACCCATCTCCTTTATCTCAG

Etv5 CCCGGATGCACTCTTCTCTATG TCGGATTCTGCCTTCAGGAA

Gfra1 GGACCGCCTGGACTGTGT GCTGCAGCTCTGTTCCTTCAG

Hprt1 TCAGTCAACGGGGGACATAAA GGGGCTGTACTGCTTAACCAG

Lin28 TGTTCTGTATTGGGAGTGAGC GCTTGCATTCCTTGGCATG

Mili GTTCCTCTTTGCCTGATCCTTC AGAGACCTCAGAACTACCTCTTC

Nanos2 CCATATGCAACTTCTGCAAGC TGAGTGTATGAGCCTGGTCG

Nanos3 CACTACGGCCTAGGAGCTTGG TGATCGCTGACAAGACTGTGGC

Ngn3 GCTCTTCTCTTAACTCTCCT AGACGCAACACTGGATTA

Oct-4 CCATGCATTCAAACTGAGGCACCA AGCTATCTACTGTGTGTCCCAGTC

Plzf GCATTTACTGGCTCATTCA GTATGGGTCTGTCTGTGT

Pou3f1 TTCAAGCAACGACGCATCAA TGCGAGAACACGTTACCGTAGA

Redd1 CTCTTGTCCGCAATCTTC AAGAGGAGGACGAGAAAC

Ret GGCTGTCCCGAGATGTTTATG GACTCAATTGCCATCCACTTGA

Sox3 TTCGCACTCGCAGCGCGCGTGCCTCGG ACGGCCAAACTTTCGGTCCTC

Sohlh1 GGGCCAATGAGGATTACAGA AAGTTTGCAGCAGCCACAG

Sohlh2 TCTCAGCCACATCACAGAGG GGGGACGCGAGTCTTATACA

Thy1 AACTCTTGGCACCATGAACCC GCTGGTCACCTTCTGCCCTC

Tdrd1 GGAGATCTTACCAAGTGGGAATGT ATCGCCTGGAGTTGGTCTGT

Vasa CAGCTTCAGTAGCAGCACAAG CATGACTCGTCATCAACTGGA

LINE1-ORF2 GGAGGGACATTTCATTCTCATCA GCTGCTCTTGTATTTGGAGCATAGA


IAPGAG AACCAATGCTAATTTCACCTTGGT GCCAATCAGCAGGCGTTAGT

Bisulfite sequencing (CDK2 promoter)

Distal CpG

island

TTGGGAGGGTAGATTGTTAGTAATAAA TCACAAAAACAACAAATACCCTAAA

Proximal CpG

island

TTAATTTTATTTAAGGGGTGGTGAA CCACCTTTTAAAAATTCTCCATAAA

ChIP-qPCR

Primer pair A

(-724 to -586)

GCTGAGAAACGACTCTATTATC CTGTGTAATCTTGGCTGTC

Primer pair B

(-798 to -666)

ACGACTCTATTATCTAGCCAAA CTCCCTCCGCTTTCTTTT

Cdk2 promoter activity assay

-56 to +91 CTCGAGTCGTGACGTGAACCAATC AAGCTTAAGGAGAGCTCAGCCCTTGA

C

-339 to +91 CTCGAGATCTCACCCAAGGGGTGGTG AAGCTTAAGGAGAGCTCAGCCCT

TGACAATTT

ETS-binding site

mutation

GAAAGATTGGGGAGGCGAG CTCGCCTCCCCAATCTTTC

-906 to +91 CTCGAGATCCAAAAGCATCCAGAAGG AAGCTTAAGGAGAGCTCAGCCCT

TGAC


Supplementary material Table S2. Antibodies

Antibody Catalog Company

Anti-AKT ab8805 Abcam

(Cambridge, MA)

Anti- phospho AKT (S473) ab66138 Abcam

Anti-CDK2 ab2363 Abcam

Anti-CD90.2 (THY1) Cat. 553011; lot#

25136 and lot# 80806

BD Pharmingen

(San Diego, CA)

Anti-DNMT3L Gift from Dr. Xing Zhang and Dr. Xiaodong Cheng,

Department of Biochemistry at Emory University,

Atlanta, GA, USA.

Anti-DNMT3L #13451 (E1Y7Q) Cell Signaling Technology

(Beverly, MA)

Anti-ERK1/2 #9102 Cell Signaling Technology,

Anti-phospho ERK1/2 (Thr202/Tyr204) #4370 Cell Signaling Technology

Anti-ETS1 sc-350 Santa Cruz Biotechnology

(Santa Cruz, CA)

Anti-GAPDH MAB374 Millipore

(Billerica, MA)

Anti-H3K4me3 ab8580 Abcam

Anti-H3K9me3 ab8898 Abcam

anti-H3K27me3 07-449 Millipore

Anti-Ki67 ab15580 Abcam

Anti-MEK1/2 #9122 Cell Signaling Technology

Anti-phospho-MEK1/2 (Ser217/221) #9121 Cell Signaling Technology

Anti-PLZF sc-22839 and

sc-28319

Santa Cruz Biotechnology

Anti-PTEN ab32199 Abcam

Anti-phospho-PTEN (Ser380/Thr382/383) #9554 Cell Signaling Technology

Anti-SALL4 H00057167-M03,

clone 6E3

Abnova, Taipei, Taiwan


Documents

Supplementary Materials and Methods - dev.biologists.orgdev.biologists.org/content/develop/suppl/2014/06/04/141.12.2402.DC... · 20" Mouse testes were fixed with 4% paraformaldehyde