Upload
others
View
5
Download
0
Embed Size (px)
Citation preview
1
Neuron, volume 51
Supplemental Data
Subplate Neurons Regulate Maturation of Cortical Inhibition and
Outcome of Ocular Dominance Plasticity
Patrick O. Kanold and Carla J. Shatz
Materials and Methods
All experiments were performed according to the Harvard Medical School Institutional
Animal Care and Use Committee Protocol.
Surgery and Anesthesia
Ablations: Subplate neurons in visual cortex of 30 cats of both sexes were ablated
selectively between P6-P9 by focal injection of either p75-immunotoxin (ME20.4-SAP,
Advanced Targeting Systems, 0.5 µl, 0.25-1 mg/ml) or kainic acid (Sigma, 0.5 µl,
10mg/ml) (control injections: normal saline 0.5 µl) using sterile surgical techniques as
described previously (Ghosh and Shatz, 1992; Kanold et al., 2003; Lein et al., 1999).
Animals were anesthetized with 3-4% isofluorane and maintained during surgery at 3-
4%. Fluorescent latex microspheres (Lumafluor, Naples, Fl, 10% by volume) were added
to verify the injection sites. At these early ages subplate neuron ablations using either
immunotoxin or kainate are highly selective and leave neurons in the overlying cortical
plate almost completely intact (Ghosh and Shatz, 1992; Kanold et al., 2003; Lein et al.,
1999). At the early time ages used for investigation in this study (<P40) we did not see
2
evidence for atrophy of layer 4 neurons (see Fig. 1,3,4, S1) as has been occasionally seen
after very long survival times (Ghosh and Shatz, 1994). In fact as this study and our
previous study shows, the basic electrophysiological and morphological properties of
layer 4 neurons in ablated cortex are not grossly abnormal (Kanold et al., 2003). Both
ablation methods cause similar anatomical and functional deficits with immunotoxin
injections producing smaller sized ablations (Kanold et al., 2003). Indeed, methods of
subplate ablation (immunotoxin, N=2 animals vs. kainate, N=3 animals) did not give
different results for the DE projections after monocular deprivation (MD) (P>0.1). For
MD, a drop of ophthalmic local anesthetic, proparacaine HCL, was placed in one eye,
which was sutured closed under general anesthesia with isofluorane (see above). Tissue
from 5 unmanipulated animals was used for quantitative PCR and in situ hybridization
analysis of expression levels.
Minipump implantations
Animals (P6-P7) were anesthetized with 3-4% isofluorane and maintained during surgery
at 3-4%. A small craniotomy (~1mm) was performed overlying visual cortex and a
canula was inserted into the cortex (~3mm deep) (methods modified Bear et al. 1990).
The canula was connected to an osmotic minipump (Alzet 2002, delivering 0.5ul/h) filled
with 50mM DL-2-amino-5-phosphonovalerate (DL-AP5) and 10mM 6-nitro-7-
sulfamoylbenzo[f]quinoxaline-2,3-dione (NBQX, disodium salt), specific NMDA and
AMPA blockers (Sigma) in 0.9% saline or 0.9% saline alone (control). After 1-2 weeks
infusion time animals were euthanized with an IP overdose of sodium pentobarbital (200
mg/kg to effect) and the brains were rapidly removed. Coronal sections were cut (~1mm
thick) from visual cortex surrounding the infusion site (~2-3 mm from infusion site; in
3
this area a yellow/brown residue from the NBQX is clearly visible indicating
effectiveness of infusion) and from the contralateral visual cortex. RNA was extracted
and qPCR for KCC2, GABAA-α1 and HPRT was performed as described below. For
each animal 2-4 samples of the infused and contralateral hemisphere were compared. It is
likely that samples from the infused hemisphere also included some tissue not receiving
effective glutamatergic blockade due to distance from the infusion site. Thus in the
reported average data, the mRNA levels likely represent an underestimate of the mRNA
levels after infusion.
In-Situ hybridizations
Animals were sacrificed with an IP overdose of sodium pentobarbital (200 mg/kg to
effect) and the brains were rapidly removed and frozen in cryoprotective medium (M1,
Shandon). Horizontal sections were cut (12-15 µm) on a cryostat. In-situ hybridizations
were performed as described previously (Kanold et al., 2003; Lein et al., 1999). Template
sequences were generated by RT-PCR from P28 cat RNA using oligonucleotide primers
that span the regions of maximum nucleotide sequence dissimilarity between the different
GABAA receptor subunits but high similarity between mouse and human. KCC2 primers
were made to regions of high homology between mouse and human.
Primers:
GABA-A α1 (Genbank Accession number: NM_000806, 130-402 bp):
L: AGTCCATGATGGCTCAGACC R: CGGCTGTCCATAGCTTCTTC.
GABA-A α2 (Genbank Accession number: NM_000807,54-303 bp):
L:GCTGCAGTCTCGGTCTCTCT R: ATGTTAGCCAGCACCAACCT
4
GABA-A α3 (Genbank Accession number: NM_000808, 1441-1740 bp):
L: CCACCTATCCCATCAACCTG R: TTGCTGCACTGCCACTATCT
GABA-A γ2 (Genbank Accession number: X15376, 246-542 bp):
L: GGAGCACAGGAAGCTCAGTC R: CGTTCACTGGACCAATGCTA.
KCC2 (Genbank Accession number: AF208159, 4413-4918 bp):
L: TCCTCGCCAAAGACTGAAAT R: GTACCCAGTCCCAGATGGTG.
The template sequence was verified by sequencing or restriction mapping. The BDNF
template was obtained from Lein et al (Lein et al., 1999). S35-labeled riboprobes were
generated by in vitro transcription. After hybridization, sections were processed, dipped
with autoradiographic emulsion (Kodak NTB-2) and exposed for 3-6 weeks.
Expression levels were quantified by densitometry. Darkfield images were acquired with
a CCD camera and processed in MATLAB. Images were thresholded to remove
background signal and mean pixel luminance (total luminance/area) was measured
separately in all layers of the ablated and control regions. The borders between layers
were chosen according to adjacent cresyl violet stained sections (see Fig. 1D). The
threshold was computed as the 2x mean intensity outside the section. The threshold was
always lower than labeling intensity in all layers and the same threshold was applied in
ablated and control areas in each section (Fig. 1). The relative expression level in each
layer of ablated cortex was then computed relative to the same layer in unablated regions
in the same section.
5
Slice physiology
Slice preparation: Slices were obtained from animals (P25-P45) that received an IP
overdose of sodium pentobarbital (200 mg/kg to effect). A block of brain containing
visual cortex was removed rapidly and coronal slices (350 µm thick) were cut on a
vibratome in ice cold ACSF. ACSF contained (in mM): 130 NaCl, 3 KCl, 1.25 KH2PO4,
20 NaHCO3, 10 glucose, 1.3 MgSO4, 2.5 CaCl2 (pH 7.35-7.4, equilibrated with 95%O2-
5% CO2). Slices were incubated for at least 1 hour in ACSF at 30°C. Slices from the
subplate ablated hemisphere were collected within 5 mm of the injection site, which
roughly corresponds to the entire region in which subplate neurons have been ablated as
assessed anatomically (Ghosh and Shatz, 1992) or by in situ hybridization for BDNF
mRNA (Lein et al., 1999). The zone of ablation was confirmed in the slice by the
presence of fluorescent microspheres that had been coinjected at the time of ablation.
Slices from the unmanipulated hemisphere were also studied.
Perforated patch recordings:
Perforated patch recordings using gramicidin, which allows recording without disturbing
the internal Cl--concentration, were performed in slices from ablated or unmanipulated
hemisphere of 4 animals (n=30 cells in 30 subplate ablated slices; n=12 cells in 12
unmanipulated slices). Recordings were performed with a patch clamp amplifier in
voltage or current clamp using pipettes with input resistance of 4-8 MΩ. Electrodes were
filled with (in mM) 110 K-gluconate, 4 KCl, 4 NaCl, 0.2 CaCl2, 10 HEPES (free acid),
1.1 EGTA, 2 Mg-ATP, 1 MgCl2 and 5 glutathione (pH 7.2, 300 mOsm). Gramicidin from
frozen stock (20 mg/ml dissolved in DMSO) was added to the electrode solution to a
final concentration of 0.02 mg/ml. The solution was remade every 4 hours. Lucifer
6
Yellow was added to the electrode solution to monitor seal integrity and for post-hoc cell
identification (see Fig. 4D). For recording, slices were held in a chamber on a fixed stage
microscope (Zeiss Axioskop FS2) and superfused (2-4 ml/min) with ACSF containing (in
mM): 130 NaCl, 5 KCl, 10 HEPES (acid), 25 glucose, 1.3 MgCl2, 2.5 CaCl2 (pH adjusted
to 7.35-7.4 with NaOH, oxygenated with 100%O2 and 100 µM DL-AP5, 10 µM CNQX
and 1 µM tetrodotoxin (TTX). The calculated Cl-reversal potential (ECl) of these
solutions in the whole cell configuration was -78 mV. Layer 4 was identified in visually
by the distance from the pial surface (~600-800 µm). The location of neurons was
confirmed after recording by immunohistochemistry. Upon seal formation access
resistance was monitored until stable. Typical access resistances were 18-
70MΩ. Membrane voltages were corrected for the estimated liquid junction potential. To
measure the effect of muscimol on the cell, muscimol was bath-applied (100 µM) and the
evoked current from a holding potential close to the resting potential (~ -60mV) was
measured. The integrity of the patch was monitored and confirmed by fluorescent
imaging of the Lucifer Yellow. Then the patch was ruptured and the resulting whole-cell
current was measured.
Ca2+ imaging:
Slices were loaded with Fura2-AM (Molecular Probes) using a 2 step loading protocol
(Schwartz et al., 1998). Slices were incubated in the dark in 1.5mM Fura2-AM in
99.9%DMSO and 0.1% Pluronic (Molecular Probes) for 2 min. Then slices were
incubated in the dark for 2-4h in 10µM Fura2-AM, 1%DMSO and 0.001%Pluronic and
washed in the dark for 15-30 min in fresh ACSF. For imaging, slices were held in a
chamber on a fixed stage microscope (Zeiss Axioskop FS2) and superfused (2-4 ml/min)
7
with ACSF containing (in mM): 130 NaCl, 5 KCl, 10 HEPES (acid), 25 glucose, 1.3
MgCl2, 2.5 CaCl2 (pH adjusted to 7.35-7.4 with NaOH, oxygenated with 100%O2).
Glutamatergic transmission was blocked with 100 µM DL-2-amino-5-phosphonovalerate
(DL-AP5) and 10 µM 6-cyano-7-nitroquinoxaline-2,3-dione (CNQX). In some
experiments 0.5-1 µM TTX was added to the solution to block voltage-dependent Na-
currents. No difference was observed in experiments with and without TTX. Slices were
illuminated via a Lamda 10 filterwheel and shutter (Sutter) with a Halogen (Zeiss) or
Xenon (Optiquip) Arc lamp at 340nm and 380nm. Emitted fluorescence was imaged with
40x objective via a 510 nm filter and a Sensicam HQ (Cooke Instruments) using a
PowerMacintosh G4 running IPlab (Scanalytics). Muscimol was either bath-applied (50-
100 µM) or pressure-applied focally (250 µM) with a patch pipette positioned on the
surface or up to 50µm above of the slice using a picospritzer (WPI, 4 psi 500 ms-1s). A
small holding vacuum was applied in the inter-puff intervals to avoid muscimol leakage.
During bath application of muscimol images at 340 nm and 380 nm illumination were
acquired every 30s, whereas during pressure application experiments images were
acquired continuously at 380 nm illumination. Analysis was performed offline with IPlab
and MATLAB (The Mathworks) using custom routines. Changes in fluorescence were
judged as significant if the absolute change (∆F) exceeded 2 standard deviations of the
baseline.
Quantitative PCR
mRNA was obtained from animals (P0-P35) that received an IP overdose of sodium
pentobarbital (200 mg/kg to effect). A block of visual cortex from one hemisphere was
removed and homogenized in Trizol (Gibco). The other hemisphere was frozen in
8
cryopreservative medium and processed for in situ hybridizations. Total RNA was
extracted by chlorophorm and isopropanol precipitation. cDNA was generated from 1 µg
RNA by reverse transcription using Retroscript (Ambion) with OligoDT and Random
decamer primers, or iScript (Biorad). The cDNA was used for quantitative PCR using a
Smart Cycler (Cephaid). Real-time PCR reaction was carried out on a Smart Cycler
system (Cepheid, Sunnyvale, CA). A reaction mix contained 1X iQ SYBR Green
Supermix (Bio-Rad Laboratories, Hercules, CA), 100nM each oligonucleotide primers
and 10ng of cDNA in a 25-ul total volume. As internal normalizing controls we used
glyceraldehyde-3-phosphate dehydrogenase (GAPDH), hypoxanthine
phosphoribosyltransferase 1 (HPRT1) and 18s RNA. Only 18s remained constant over
the observed developmental period; thus all the KCC2 and GABAα1 developmental data
was normalized to 18s. To compare tissue at the same age both HPRT1 and 18s were
used for normalization. Primers for cat RNA were generated to regions highly
homologous in human and mouse and were confirmed by gel electrophoresis.
Primers for cat mRNA:
KCC2 (Genbank Accession number: AF208159, 435-563bp):
L:CACGGCCATCTCCATGAGTG, R:GTGCCCAGGTAGAAGCAGAG.
18srRNA (Genbank Accession number: X00686, 878-1096 bp):
L:CGCGGTTCTATTTTGTTGGT, R:AGTCGGCATCGTTTATGGTC.
GAPDH (Genbank Accession number: AF097177, 17-201bp):
L:GAGTCAACGGATTTGGTCGT, R:GACAAGCTTCCCGTTCTCAG.
HPRT1 (Genbank Accession number: NM000194, 235-429bp):
L: TGCTCGAGATGTGATGAAGG, R:TCCCCTGTTGACTGGTCATT
9
GABAA α1 (Genbank Accession number: NM_010250: 1386-1607 bp):
L: CCCGTTCAGTGGTTGTAGCA, R:CTCTGTTGAGCCAGAAGGAGAC
50 cycles of the PCR reaction were performed with the Smart Cycler with an annealing
temperature of 62°C and annealing time of 30s. The number of cycles it took the
fluorescence signal to pass an arbitrary threshold of 30 was determined by the Smart
Cycler software (typically 18-26 cycles). Difference between the obtained threshold cycle
(CT) (the Smart Cycler Operator Manual for details) for KCC2 (∆KCC2), GABAA α1
(∆GABAA α1) etc. and the normalizing control were calculated (∆KCC2= CT KCC2- CT 18s
or ∆KCC2= CT KCC2- CT HPRT1). For developmental profiles, the differences were
normalized to the oldest age. Expression levels were calculated from ∆KCC2, ∆GABAA
α1 etc. as 2^(-∆KCC2) and 2^(-∆GABAA α1) respectively.
Transneuronal Labeling
To visualize OD columns under normal circumstances and following MD, 2 mCi of L-
[2,3,4,5-3H] proline (Amersham) in 50 µl 0.9% saline was injected into the vitreous
chamber of one eye as described previously (Ghosh and Shatz, 1992). For these
injections, animals (aged P50-P70) were placed under general anesthesia (described
above) and a drop of ophthalmic local anesthetic, proparacaine HCl, was placed on the
eye. After 10-14 days (axonal transport time), animals were given an IP overdose of
sodium pentobarbital (200 mg/kg to effect). Brains were removed, frozen rapidly and
cryostat sections (20 µm) of visual cortex were cut in horizontal plane. Sections were
fixed in 4% paraformaldehyde in PBS, dipped in autoradiographic emulsion (Kodak
NTB-2) and exposed for 4-12 weeks. Dark-field images of silver grains were acquired
10
and analyzed in MATLAB (The Mathworks). To quantify the extent of the territory
belonging to the deprived (DE) or the non-deprived (NDE) eyes, linescans were made
along layer 4 of visual cortex: A line along the center of layer 4 was generated by
selecting 20-100 points, and then performing a cubic spline interpolation between these
points. At every pixel along this line, a perpendicular line through layer 4 (~200 um long)
was computed and the average signal intensity of pixels along this line was measured.
The resulting intensity line scan was low pass filtered (7 pt triangular), generating a curve
of labeling signal intensity versus distance along layer 4 (see Fig. S2 middle panels). The
resulting signal showed periodic fluctuations corresponding to OD columns. To minimize
effects of variations in labeling intensity (due to non-uniform diffusion of 3H-proline
within the eye and uneven illumination of the section) the line scan was further low pass
filtered (100-200 pixels, ~2 mm) and subtracted from the original linescan. The resulting
signal fluctuated periodically around the zero-intensity axis, corresponding to OD
columns (see Fig. S2 lower panels). We used 2 methods to measure the territory occupied
by the labeled eye, which gave similar results. First, since labeled eye column borders
(Fig. S2) are identifiable as large increases in labeling intensities, column borders were
generally detected at the half maximum intensity. The width of each DE or NDE column
was determined as the distance between 2 adjacent borders (Fig. S2). The fraction of area
occupied by radioactive label belonging to the DE in ablated or unablated regions was
calculated as DEwidth/(DEwidth+NDEwidth), where DEwidth and NDEwidth are the sum of all
column widths for the respective eye. A second measure was used to quantify the fraction
the area occupied by the DE or NDE: the total area occupied by radioactive label
belonging to the injected eye in which the line-scan has an intensity value above zero was
11
measured. The percent area occupied by the injected eye was computed as the fraction of
the line scan above zero relative to the total length of the line scan. The 2 methods gave
qualitatively similar results. A Student's T-test was performed to evaluate significance of
the changes.
Computational Modeling:
The subplate neuron (SPN) and the layer 4 neuron (L4N) were represented by "integrate
and fire neurons". Thus the membrane potential vSPN and vL4N at each time step t was
computed as:
vSPN(t)=ws*geye1(t)+ ws*geye2(t) (1)
vL4N(t)=weye1* geye1(t)+weye2* geye2(t) +wSPN*gSPN(t)+wspont+gspont (t)
(2)
geye1, geye2and gSPN are the synaptic conductances from thalamus and SPN respectively
and are of the form:
g(t)=exp(-(t-tspike+tdelay)/τsyn) (3)
tspike is the time of occurrence of the presynaptic spike and tdelay is the synaptic delay of 1
ms. τsyn gives the synaptic time constant and was set to 10 ms. weye1, weye2 and wSPN
denote the synaptic weights ("epsc amplitude"). The thalamic inputs of each eye to the
SPN (ws) were fixed at 0.5, thus there was no OD bias present in the SPN.
If vSPN or vL4N reached a threshold (0.4), a spike was generated and v was decreased by
vdelta(t) leading to a refractory period.
vdelta(t)=beta*exp(-(t-tspike)/trefr) (4)
12
To ensure model stability, vSPN and vL4N decayed slowly even if no spikes occurred. This
is equivalent to the existence of a leak current. Beta and trefr and the leak were adjusted to
10, 2 and 10%/ms respectively so that the cells fired with an average firing rate of ~1 Hz
(Kara and Reid, 2003; Kara et al., 2000).
If spikes occurred in the L4N, the synaptic weights were readjusted according to the
plasticity rule (see Fig. 5A), giving a plasticity factor ∆w(dt) as a function of the delay dt
(dt=tspike-tepsc) between the occurrence of the postsynaptic spike and the synaptic input.
w(t+dt)=w(t)*(1+∆w) (5)
The parameters of the learning rule were τS=3ms τW=20 ms. Parametric simulation
of 4900 different parameter sets (amplitude from 3*10^-3 to 21*10^-3 and τ from 1 to 30
ms) were performed for 4 different conditions (+subplate, -subplate, +subplate & MD, -
subplate & MD. 384/4900 parameter set replicated the experimental data. A parameter set
was judged as replicating the data when the results in all 4 conditions fulfilled the
following criteria:
1) +subplate: strengthening of thalamic inputs and weakening of subplate input (eye1 or
eye2 >> SP)
2) -subplate: no strengthening of eye1 or eye2 over initial strength (eye1 and eye 2 < 0.2)
3) +subplate&MD: strengthening of the open eye and weakening of both subplate inputs
and deprived eye (NDE>>DE, NDE>>SP<0.2)
4) -subplate&MD: No strengthening of either eye and paradoxical shift (DE, ND < 0.2,
DE >> NDE)
13
Synaptic weights were free to vary from their initial value between a range of 0 to 1. The
model was driven from its initial state by thalamic activity, which was simulated as
uncorrelated Poisson processes. The average LGN spike rates were 5-10 Hz if the eye
was open (Dan et al., 1996), and 0.3-1 Hz if the eye was closed. The spontaneous EPSC
inputs to the L4N was simulated as a 3rd uncorrelated Poisson process with a rate of 0.5
Hz (Kanold et al., 2003) and a weight of 0.7. Varying the absolute values of the firing
rates did not result in different results as long as the firing rates of the open eye were
larger than that of the closed eye and that of the spontaneous activity. All data presented
was simulated with rates of 5 Hz for the open eye and 0.3 Hz for the closed eye.
Physiologically OD is frequently measured on a discrete scale from 1 to 7 where a value
of 1 and 7 indicate monocular responses to contralateral and ipsilateral stimulation
respectively. A value of 4 indicates equal responses from the 2 eyes. Initial biases in OD
in layer 4 is present at early development (Albus and Wolf, 1984; Hubel and Wiesel,
1963; LeVay et al., 1978). This bias is between OD group 3 and 4 (with an estimated
mean 3.2) (Hubel and Wiesel, 1963; LeVay et al., 1978), thus slightly favoring the
contralateral eye. Here we measure OD on a finer scale using an OD bias index (OD bias
= [Ipsi-Contra]/[Ipsi +Contra]) that varies continuously from -1 to 1. A lack of OD bias
will be indicated by a value of 0, whereas monocular responses will have values of -1 and
1 respectively. The physiologically measured OD values can roughly be translated into
OD bias by calculating OD bias=[OD-4]/3, thus an OD of 3 is roughly equivalent of an
OD bias -0.33. We simulated initial contralateral biases within (initial bias between 0 and
-0.27) and outside the physiological range (initial bias < -0.27). An initial bias towards
14
the DE or NDE was simulated by reducing the initial weight of one input and increasing
the other in order to keep total synaptic input constant. The model was implemented in
C++ on a PowerMac G5. To generate the correlation plots we selected a fixed number of
layer 4 spikes and computed the time differences to spikes of the respective input in a
time window of ±50ms.
Figure S1.
15
Figure S2.
16
References Albus, K., and Wolf, W. (1984). Early post-natal development of neuronal function in the kitten's visual cortex: a laminar analysis. J Physiol 348, 153-185. Bear, M. F., Kleinschmidt, A., Gu, Q. A., and Singer, W. (1990). Disruption of experience-dependent synaptic modifications in striate cortex by infusion of an NMDA receptor antagonist. J Neurosci 10, 909-925. Dan, Y., Atick, J. J., and Reid, R. C. (1996). Efficient coding of natural scenes in the lateral geniculate nucleus: experimental test of a computational theory. J Neurosci 16, 3351-3362. Ghosh, A., and Shatz, C. J. (1992). Involvement of subplate neurons in the formation of ocular dominance columns. Science 255, 1441-1443. Ghosh, A., and Shatz, C. J. (1994). Segregation of geniculocortical afferents during the critical period: a role for subplate neurons. J Neurosci 14, 3862-3880. Hubel, D. H., and Wiesel, T. N. (1963). Receptive Fields of Cells in Striate Cortex of Very Young, Visually Inexperienced Kittens. J Neurophysiol 26, 994-1002. Kanold, P. O., Kara, P., Reid, R. C., and Shatz, C. J. (2003). Role of subplate neurons in functional maturation of visual cortical columns. Science 301, 521-525. Kara, P., and Reid, R. C. (2003). Efficacy of retinal spikes in driving cortical responses. J Neurosci 23, 8547-8557. Kara, P., Reinagel, P., and Reid, R. C. (2000). Low response variability in simultaneously recorded retinal, thalamic, and cortical neurons. Neuron 27, 635-646. Lein, E. S., Finney, E. M., McQuillen, P. S., and Shatz, C. J. (1999). Subplate neuron ablation alters neurotrophin expression and ocular dominance column formation. Proc Natl Acad Sci U S A 96, 13491-13495. LeVay, S., Stryker, M. P., and Shatz, C. J. (1978). Ocular dominance columns and their development in layer IV of the cat's visual cortex: a quantitative study. J Comp Neurol 179, 223-244. Schwartz, T. H., Rabinowitz, D., Unni, V., Kumar, V. S., Smetters, D. K., Tsiola, A., and Yuste, R. (1998). Networks of coactive neurons in developing layer 1. Neuron 20, 541-552.