Substance P promotes diabetic corneal epithelial wound ... · Substance P promotes diabetic corneal epithelial wound healing through molecular mechanisms mediated via the neurokinin-1

Substance P promotes diabetic corneal epithelial wound healing through

molecular mechanisms mediated via the neurokinin-1 receptor

Running title: Mechanisms of SP on diabetic corneal wound healing

Lingling Yang1﹟

, Guohu Di1﹟

, Xia Qi1, Mingli Qu

1, Yao Wang

1, Haoyun Duan

1, Patrik Danielson

2,

Lixin Xie1*, Qingjun Zhou

1*

1 State Key Laboratory Cultivation Base, Shandong Provincial Key Laboratory of Ophthalmology,

Shandong Eye Institute, Shandong Academy of Medical Sciences, Qingdao, China.

2 Department of Integrative Medical Biology, Anatomy, Umeå University, Umeå, Sweden

# Contribute equally to this study

* Correspondence: Qingjun Zhou & Lixin Xie

Address: Shandong Eye Institute, 5 Yan’erdao Road, Qingdao, 266071, China.

Email: [email protected] (Zhou Q); [email protected] (Xie L).

Tel: 86-532-8589-9270;

Fax: 86-532-8589-1110

Word count: 3993; number of Figures: 7; supplement Figures/Tables: 5/2

Page 1 of 34 Diabetes

Diabetes Publish Ahead of Print, published online July 9, 2014

Abstract

Substance P (SP) is a neuropeptide, predominantly released from sensory nerve fibers, with a

potentially protective role in diabetic corneal epithelial wound healing. However, the molecular

mechanism remains unclear. We investigated the protective mechanism of SP against

hyperglycemia-induced corneal epithelial wound healing defects, using type 1 diabetic mice and high

glucose-treated corneal epithelial cells. Hyperglycemia induced delayed corneal epithelial wound

healing, accompanied with attenuated corneal sensation, mitochondrial dysfunction, and impairments

of Akt-, EGFR-, and Sirt1-activation, as well as decreased reactive oxygen species (ROS) scavenging

capacity. However, SP application promoted the epithelial wound healing, the recovery of corneal

sensation, the improvement of mitochondrial function, and the reactivation of Akt, EGFR and Sirt1, as

well as increased ROS scavenging capacity, in both diabetic mouse corneal epithelium and high

glucose-treated corneal epithelial cells. The promotion of SP on diabetic corneal epithelial healing was

completely abolished by a NK-1 receptor antagonist. Moreover, the subconjunctival injection of NK-1

receptor antagonist also caused diabetic corneal pathological changes in normal mice. In conclusion,

the results suggest that SP-NK-1 receptor signaling plays a critical role in the maintenance of corneal

epithelium homeostasis, and that SP signaling through the NK-1 receptor contributes to the promotion

of diabetic corneal epithelial wound healing by rescued activation of Akt, EGFR, and Sirt1,

improvement of mitochondrial function, and increased ROS scavenging capacity.

Keywords: Corneal epithelium; Diabetes; Substance P; Neurokinin-1 receptor

Page 2 of 34Diabetes

INTRODUCTION

Among various pathological conditions by diabetes mellitus, ocular complications have been a

leading cause of blindness in the world, including diabetic retinopathy, cataract, and various ocular

surface disorders (1). The most recognized diabetic changes in the cornea, i.e. clinical diabetic

keratopathy, include impaired corneal sensation, superficial punctate keratitis, and persistent corneal

epithelium defects (2). The uncontrolled impairment of corneal wound healing increases the

susceptibility of corneal ulcer, microbial keratitis, and even perforation. Diabetic corneal pathology

always exhibits epithelial basement membrane abnormalities, reduced hemidesmosome density, and

delayed wound healing (3; 4). However, hyperglycemia also directly impairs the cellular metabolism

and causes abnormal changes of corneal epithelium, such as Akt-, epidermal growth factor receptor

(EGFR)- and Sirt1-mediated cell responses to environmental challenges (5-7). Moreover, excess

oxidative stress, resulting from enhanced accumulation of reactive oxygen species (ROS) and impaired

antioxidant capabilities in response to hyperglycemia, has been postulated as an important pathological

mechanism, while the reduction of ROS attenuated the progression of various diabetic complications

(8-13), including in the cornea (5; 14).

Substance P (SP), released predominantly by peripheral terminal, is an 11-amnio acid

neuropeptide which acts as a neurotransmitter mediating nociceptive transmission. It mainly functions

through the interaction with neurokinin receptors, members of the tachykinin subfamily of

G-protein-coupled receptors, among which the neurokinin-1 (NK-1) receptor shows a preferential

affinity for SP. SP is currently known as a neuro-immunomodulatory regulator of the immune system

(15). In the cornea, SP has been detected in the nerve fibers of naïve cornea (16; 17) and in

antigen-presenting cells in herpetic stromal keratitis (18). Moreover, SP causes the mobilization of

bone marrow-derived stem cells to participate in corneal wound healing (19; 20). Interestingly, recent

evidences have shown that SP activates the EGFR, mitogen-activated protein kinases (MAPK),

extracellular signal regulated kinases (ERK), and phosphoinositide 3-kinase-Akt (PI3K-Akt) signaling

pathways, as well as promotes the healing of inflamed colonic epithelium (21) and possesses

anti-apoptotic effects in colonocytes (22), dendritic cells (23), tenocytes (24), neutrophils (25), and

bone marrow-derived stem cells (26).

The cornea is one of the most densely innervated tissues in the body, containing nerve fibers

derived from the trigeminal ganglion. Corneal nerve fibers exert important trophic influences and


contribute to the maintenance of corneal epithelium homeostasis, whereas the dysfunction of corneal

innervation produces an impairment of corneal epithelial wound healing, known as neurotrophic

keratitis, as caused by for instance herpetic viral infections, trigeminal nerve damage, or diabetes

mellitus (27-29). Although tear fluid impairment is also involved (30), the neurotrophic deficits may

play a major role in the pathogenesis of diabetic keratopathy, as the density of corneal nerve fibers and

corneal sensation decreased in diabetic patients (31-33). However, although being the major sensory

neurotransmitter and neuropeptide released from corneal nerve fibers, SP was shown not to be

significantly decreased in diabetic cornea (34). Nevertheless, paradoxically, topical SP application

promoted corneal epithelial wound healing in diabetic animals and human when combined with

insulin-like growth factor (IGF)-1 or epidermal growth factor (EGF) per group. The promoting

mechanisms of SP on diabetic corneal epithelial wound healing remain elusive. In this study, we sought

to demonstrate the protective mechanism of SP against diabetic corneal epithelial wound healing using

streptozotocin-induced type 1 diabetic mice and high glucose-treated corneal epithelial cells.

RESEARCH DESIGN AND METHODS

Animals

Adult male C57BL/6 mice were purchased from the Beijing Pharmacology Institute (Beijing,

China). All animal experiments were carried out in accordance with the Association for Research in

Vision and Ophthalmology (ARVO) Statement for the Use of Animals in Ophthalmic and Vision

Research. The mice underwent induction of type 1 diabetes mellitus with an intraperitoneal injection of

50 mg/kg streptozotocin (STZ, Sigma, St. Louis, MO) in ice-cold citrate-citric acid buffer (pH 4.5) for

5 days, while control mice received equal amount of buffer. Blood glucose levels were monitored with

an OneTouch Basic glucometer (LifeScan, Johnson & Johnson, Milpitas, CA). In the present study,

diabetic mice were used after 12 weeks of final STZ injection, at which point the HbA1c values were

10.83±0.74% ( 94.75±7.93 mmol/mol), whereas normal mice had HbA1c values of 4.25±0.1% (22.5±1

mmol/mol). For topical SP application, 5 µl SP (1mM, Calbiochem, San Diego, CA) in distilled water

were dropped on the corneal surface by a 10 µl tip, 6 times daily per eye for 4 days (for the

measurement of corneal sensitivity) or 4 days pre-scrape and 3 days post-scrape (for the measurement

of corneal epithelial wound healing). For NK-1 receptor inhibition, NK-1 receptor antagonist

L-733,060 (6.6 µg in 5 µl distilled water, Sigma) was injected subconjunctivally 3 days before corneal


sensitivity measurement and corneal epithelium scrape in normal mice, or 24 h before corneal

epithelium scrape in diabetic mice according to our preliminary experiments. Control mice were treated

with distilled water vehicle.

Corneal sensitivity

Corneal sensation was measured bilaterally by using a Cochet-Bonnet esthesiometer (Luneau

Ophtalmologie, Chartres Cedex, France) in unanesthetized control, diabetic, SP-treated diabetic mice,

and the NK-1 receptor antagonist-injected mice before the scrape of corneal epithelium. The testing

began with the maximal length (6 cm) nylon filament, and shortened by 0.5 cm each time until the

corneal touch threshold was found. The longest filament length resulting in a positive response was

considered as the corneal sensitivity threshold, which was verified 4 times.

Corneal epithelial wound healing

Normal, diabetic and SP-treated diabetic mice were anesthetized by an intraperitoneal injection of

xylazine and ketamine followed by topical application of 2% xylocaine. The entire corneal epithelium

including limbal region (marked with 3 mm trephine) was scraped with algerbrush II corneal rust ring

remover (Alger Co, Lago Vista, TX) and subsequently applied with ofoxacin eye drops to avoid

infection. Usually, one eye was wounded at a time in each animal. The defects of corneal epithelium

were visualized at 24, 48 and 72 h by instilling 0.25% fluorescein sodium and photographed under slit

lamp (BQ900, Haag-Streit, Bern, Switzerland). The staining area was analyzed by using Image J

software and calculated as the percentage of residual epithelial defect.

Corneal epithelial cell culture and treatment

Mouse corneal epithelial cell line (TKE2) was presented from Dr. Tetsuya Kawakita of Keio

University (Tokyo, Japan) (35). Human corneal tissues were handled according to the tenets of the

Declaration of Helsinki. Primary human corneal epithelial cells (HCECs) were established from limbal

explants of donor corneas according to a previous report (36). For the analysis of Akt-, EGFR- and

Sirt1-signaling activation, and the staining of ROS, glutathione and mitochondria, both cells were

starved overnight in bovine pituitary extract (BPE)-free keratinocyte serum-free medium (KSFM,

Invitrogen, Carlsbad, CA) and subsequently incubated in 30 mM glucose or mannose (osmotic control)

for 3 days with or without 1 µM SP.

Cell proliferation and migration analysis

For the proliferation analysis, the TKE2 cells were starved overnight in BPE-free KSFM, treated


with high glucose for 3 days in the absence or presence of 1 µM SP, and measured using MTT assay.

For the migration analysis, the cells were cultured in high glucose until confluence, subsequently

wounded with a micropipette tip, and incubated with or without SP for 24 h. Digital images of wound

closure were used for quantitative assessment of migration by using Image J software. Each assay was

conducted at least triplicate.

Immunofluorescence staining

Eyeballs were snap-frozen in Tissue-Tek optimum cutting temperature compound (Sakura

Finetechnical, Tokyo, Japan). Frozen corneal sections were fixed in 4% paraformaldehyde for 15 min,

permeabilized with 0.1% Triton X-100 for 10 min and blocked with normal serum for 1 h at room

temperature. The samples were stained with primary antibodies overnight at 4°C, washed, and

incubated with fluorescein-conjugated secondary antibodies at 37°C for 1 h (antibody information as

listed in Table S1). All staining was observed under a confocal microscope or an Eclipse TE2000-U

microscope (Nikon, Japan) after counterstained with 4’,6-diamidino-2-phenylindole (DAPI).

Reverse transcription quantitative-polymerase chain reaction

Total RNA was extracted from mouse corneal epithelium using NucleospinRNA Kits (BD

Biosciences, Palo Alto, CA). cDNAs were synthesized using the Primescript™ First-Strand cDNA

Synthesis kit (TaKaRa, Dalian, China). Real time-PCR was carried out using SYBR® Green reagents

and the Applied Biosystems 7500 Real Time PCR System (Applied Biosystems, Foster City, CA). The

specific primers used are listed in Table S2. The cycling conditions were 10 sec at 95°C followed by 45

two-step cycles (15 sec at 95°C and 1 min at 60°C). The quantification data were analyzed with the

Sequence Detection System software (Applied Biosystems) using GAPDH as an internal control.

Western blot analysis

Total protein was extracted from the lyzed samples of mouse corneal epithelium, cultured TKE2

cells and HCECs in RIPA buffer. Samples (total protein concentration: 40 µg for mouse corneal

epithelium, 45 µg for cultured cells) were run on 12% SDS-PAGE gels and then transferred to a PVDF

membrane (Millipore, Billerica, MA). The blots were blocked by non-fat dry milk for at least 1 h, and

incubated with primary antibodies (Table S1) in TBST for 1 h at room temperature. The blots were

washed three times and incubated with a HRP-conjugated secondary antibody (Amersham Biosciences,

Piscataway, NJ). Finally, the blots were visualized via enzyme-linked chemiluminescence using the

ECL kit (Chemicon, Temecula, CA).


Mitochondria superoxide and membrane potential staining

For the observation of mitochondrial structure, superoxide generation, and membrane potential,

the cells were preloaded with 100 nM Mitotracker green (Beyotime, China) for 30 min, 5 µM

MitoSOXTM red reagent (Beyotime), and 5 µg/ml 5,5’,6,6’-tetrachloro-1,1’,3,3’-tetraethyl-

benzimidazole-carbocyanide iodine (JC-1; Beyotime), respectively, for 15 min at 37°C. The

fluorescence was observed and captured using a Nikon confocal microscopy.

Measurement of intracellular ROS generation and glutathione content

For the observation of intracellular ROS and glutathione staining, fresh corneal cryostat sections

and cultured cells were loaded with 10 µM fluorescence probe 2,7-dichlorodihydrofluorescein diacetate,

acetyl ester (DCHF-DA; Molecular Probes, Eugene, OR) and 50 µM monochlorobimane (MCB,

Sigma), respectively, for 30 min at 37°C. The staining was observed and captured using a Nikon

confocal microscopy. For the measurement of ROS generation, 50,000 cells were harvested and

incubated with 5 µM DCHF-DA for 20 min at 37°C. For the measurement of glutathione (GSH)

content, 50,000 cells were harvested and freeze-thawed with liquid nitrogen and a 37°C water bath for

3 times. The supernatant was collected and mixed with the provided working buffer and NADPH. The

total glutathione content was quantified by comparison with known glutathione standards according to

the manufacturer instructions (Beyotime). The ROS and glutathione fluorescence intensity was

measured using a MultiMode Microplate Reader (SpectraMax M2, Molecular Devices, Menlo Park,

CA).

Statistical analysis

Data in this study were representative of at least three different experiments and presented as the

means±SD. Statistical analysis was performed using SPSS 17.0 software (SPSS, Chicago, IL, USA)

and one-way ANOVA (analysis of variance). Differences were considered statistically significant at

p<0.05.

RESULTS

Substance P promotes corneal epithelial wound healing and sensitivity recovery in diabetic mice

To assess the effects of SP on diabetic corneal epithelial wound healing, entire corneal epithelium

was scraped in age-matched normal mice and diabetic mice with or without topical SP application for 7

days. Punctate fluorescence staining showed that SP was detected in corneal epithelium after topical


application, which suggests the applied SP penetrated the apical tight junction barrier in diabetic mice

(Fig. S1). The corneal epithelial healing rate exhibited a significant difference from 48 h after corneal

epithelium scrape (Fig. 1A). The defect size of corneal epithelium in SP-treated diabetic mice (48 h:

28.78±11.78%; 72 h: 4.44±2.29%, n=6) was significantly improved from that of diabetic mice (48 h:

63.59±7.85%; 72 h: 22.73±9.85%, n=6), and reached the equal level of normal mice (48 h:

19.59±5.67%; 72 h: 3.08±2.17%, n=6) (Fig. 1B). Moreover, the attenuated corneal sensitivity in

diabetic mice was also restored by topical SP application, although still being lower than that of normal

mice (Fig. 1C, n=8 per group). In addition, compared with diabetic mice, more inflammatory cell

infiltration was found underneath the corneal epithelium margin of SP-treated diabetic mice at 48 h,

while reduced at 72 h after corneal epithelium scrape (Fig. S2). The results suggest that topical-applied

SP penetrates into corneal epithelium and promotes corneal epithelial wound healing in diabetic mice,

accompanied with recovery of corneal sensitivity, and an early inflammatory and resolution response.

Substance P promotes corneal epithelial cell migration and proliferation in vitro

To assess the effect of SP on corneal epithelial wound healing in vitro, mouse corneal epithelial

cells were treated with high glucose with equal concentration of mannose as osmotic control.

Subsequently, the confluent cells were wounded and treated with or without SP for another 24 h to

analyze the migration rate. The results showed that high-glucose treatment caused significant delay of

corneal epithelial cell migration, while SP addition improved the migration capacity of high

glucose-treated cells to the same level of normal cells (Fig. 2A, B, n=3 per group). In addition, SP

promoted the proliferation rate of corneal epithelial cells that was impaired by high-glucose treatment

for 3 days (Fig. 2C, n=3 per group). The experiments were performed three times with similar results.

Substance P reactivates Akt, EGFR and Sirt1 altered by hyperglycemia

To elucidate the mechanism underlying the promotion of SP on corneal epithelial wound healing,

we investigated the effects of SP on the activation of Akt, EGFR and Sirt1 that altered in diabetic

corneal epithelium. Representative phosphorylated (p)-Akt, p-EGFR and Sirt1 staining is shown in

Figure 3A. The expression levels of p-Akt, p-EGFR and Sirt1 were significantly up-regulated in

diabetic corneal epithelium after topical SP application for 4 days (Fig. 3B, n=3 per group).

Furthermore, SP also up-regulated the expression levels of p-Akt, p-EGFR and Sirt1 in both mouse

TKE2 cells and human primary corneal epithelial cells that was impaired by high-glucose treatment

(Fig. S3). The results suggest that SP application in both diabetic mice and cultured corneal epithelial


cells reactivates Akt, EGFR and Sirt1 that are altered by hyperglycemia, which may in part explain the

promoting mechanisms of SP in diabetic corneal epithelial wound healing.

Substance P attenuates oxidative stress of corneal epithelium by hyperglycemia

To evaluate the effect of SP on the regulation of hyperglycemia-induced oxidative stress in corneal

epithelium, corneal sections were loaded with fluorescence probe DCHF-DA and MCB for the

detection of intracellular ROS and glutathione. Representative results showed that a significant

increased ROS and reduced glutathione staining were detected in diabetic mouse corneal epithelium

than in that of normal mice. However, a weak ROS and strong glutathione staining of corneal

epithelium was found after topical SP application in diabetic mice (Fig. 4A). Moreover, the expression

of major intracellular free radical scavengers in corneal epithelium, including manganese superoxide

dismutase (MnSOD), catalase, NAD(P)H: quinone oxidoreductase 1 (NQO1), thioredoxin (TXN) and

heme oxygenase 1 (Hmox1) in mRNA transcription level, were recovered from the diabetes mellitus

after topical SP application (Fig. 4B, n=4 per group). In addition, immunofluorescence staining and

Western blot revealed that the protein levels of NQO1, Catalase and MnSOD in diabetic corneal

epithelium partially recovered after topical SP application (Fig. 4C, D, n=4 per group). The results

suggest that topical SP application attenuates hyperglycemia-induced oxidative stress in diabetic

corneal epithelium, at least via the mechanism of reducing ROS accumulation, and increasing

intracellular glutathione content and antioxidant gene expression.

Substance P attenuates mitochondrial dysfunction induced by high glucose

Mitochondrial dysfunction plays an important role in the progress of various diabetic

complications. To evaluate the effects of SP on the mitochondrial dysfunction in corneal epithelium

induced by hyperglycemia, cultured corneal epithelial cells were treated with high glucose in the

presence or absence of SP for 3 days. Exposure to elevated glucose caused increased ROS

accumulation and reduced glutathione content of corneal epithelial cells in vitro (Fig. 5A, B), similar to

the diabetic corneal epithelium in vivo. However, SP treatment significantly reduced the oxidative

stress caused by high glucose in corneal epithelial cells, as showed by decreased ROS accumulation

and increased glutathione content (Fig. 5A, B, n=3 per group). The results were also repeated by using

the primary human corneal epithelial cells (Fig. S4). Furthermore, compared with normal or

mannose-treated cells, high glucose-treated cells assumed apparent mitochondrial superoxide staining

(MitoSox staining in Fig. 5C), accompanied with significant change of mitochondrial structure


(Mitotracker staining in Fig. 5C), and loss of mitochondrial membrane potential (red to green

fluorescence of JC-1 staining in Fig. 5C). However, the addition of SP attenuated the generation of

mitochondrial superoxide, and promoted the recovery of mitochondrial structure and membrane

potential that were impaired by high-glucose treatment in corneal epithelial cells (Fig. 5C).

The NK-1 receptor mediates the promotion of substance P on diabetic corneal epithelial wound

healing

To assess if the NK-1 receptor mediates the improvements of SP on diabetic corneal epithelial

wound healing, the NK-1 receptor specific antagonist L-733,060 was injected before topical SP

application in diabetic mice. In unwounded mouse corneal epithelium, the staining density of p-Akt,

p-EGFR and Sirt1 were attenuated in antagonist-injected SP-treated diabetic mice, as compared to in

the diabetic mice treated with SP alone (Fig. 6A). In corneal epithelium-scraped mice, the antagonist

injection before SP application fully reversed the promotion of SP on diabetic corneal epithelial wound

healing, with 28.95±3.89% epithelial defect in antagonist-injected SP-treated mice as compared to only

4.44±2.29% defect in mice treated with SP alone, and to 22.73±9.85% defect in untreated diabetic mice

at 72 h (Fig. 6B, n=5 per group). Moreover, at 72 h post scrape, a stronger staining intensity of p-Akt

and proliferation marker Ki-67 was found in the migrating area of SP-treated diabetic corneal

epithelium than in that of either untreated or antagonist-injected diabetic corneal epithelium (Fig. 6C).

The results suggest that the NK-1 receptor mediates the reactivation of Akt, EGFR, and Sirt1 by SP,

and that the promotion of SP on diabetic corneal epithelial wound healing is also NK-1 receptor

mediated.

Local injection of NK-1 receptor antagonist causes diabetic pathological changes in normal mice

To assess the effects of SP-NK-1 receptor signaling inhibition on corneal epithelium, L-733,060

was injected subconjunctivally in normal mice. After 3 days of antagonist injection, the unwounded

corneal epithelium assumed a similar attenuation of p-Akt, p-EGFR, Sirt1 staining to that in diabetic

mice (Fig.7A), accompanied with decreased corneal sensitivity (Fig. 7B, n=5 per group). After 72 h of

corneal epithelium scrape, the antagonist-injected mice showed a significant delay of corneal epithelial

wound healing, with 31.77±5.07% epithelial defect in antagonist-injected mice as compared to only

3.08±2.17% defect in control mice (Fig. 7C, n=5 per group), and an attenuated p-Akt and Ki-67

staining in the migrating area of corneal epithelium as compared to that in normal mice (Fig. 7D),

which were similar to the pathological changes in diabetic corneal epithelium (Fig. 7C, D). Similar


results were also obtained with the injection of another NK-1 receptor antagonist Spantide I (data not

shown). The results show that local injection of NK-1 receptor antagonist in normal mice causes

similar pathological changes in corneal epithelial wound healing and corneal sensitivity as that seen in

diabetic mice, suggesting normal activation of SP-NK-1 receptor signaling plays a critical role in the

homeostasis of corneal epithelium and corneal sensation.

DISCUSSION

The cornea is one of the most densely innervated parts of the human body, and as such its sensory

nerves play not only a prominent role in nociception, but also in providing trophism to the corneal

tissue. In diabetic mellitus, corneal sensitivity, nerve fiber density and epithelial wound healing is

reduced significantly (27; 31; 32). However, the mechanisms are not completely understood. In the

present study, we found that SP promoted epithelial wound healing, stimulated the reactivation of Akt,

EGFR, and Sirt1, as well as attenuated oxidative stress in diabetic corneal epithelium. Furthermore, the

study shows that the impairment of SP-NK-1 receptor signaling causes changes of normal corneal

epithelium similar to those of diabetic mice. The results suggest that SP-NK-1 receptor signaling

regulates the activation of multiple signaling pathways that are needed for the corneal epithelial wound

healing, whereas this regulation is impaired in diabetic corneal epithelium and rescued by SP via an

auto-regulatory mechanism (37; 38). Moreover, SP restored the corneal sensitivity of diabetic mice

close to the same level of normal mice, whereas local inhibition of SP-NK-1 receptor signaling caused

decreased corneal sensitivity in normal mice similar to that in diabetic mice. The results suggest that

the impairment of SP-NK-1 receptor signaling may also be involved in the attenuation of corneal

sensitivity in diabetes mellitus, which is supported by the fact that the NK-1 receptor exists in

peripheral nerve (39). Taken together, SP, secreted by corneal sensory nerve fibers, may be the key

neurotransmitter and neuropeptide that mediates corneal nociception transmission and provides

trophism to the corneal epithelium. Furthermore, as for the treatment of diabetic keratopathy, many

growth factors, cytokines and various agents have been evaluated as their capacity of accelerating

corneal wound healing (40). However, SP and its functional derivative (FGLM-amide), with the

advantages of smaller molecules and higher efficiency, have been shown to be effective for the

treatment of persistent corneal epithelial defects in clinical studies (40-42). In addition, we found that

SP promoted the regeneration of nerve fibers in diabetic corneal epithelium and accelerated trigeminal


neuronal growth in vitro that impaired by high glucose (Fig. S5).

The NK-1 receptor, the preferred receptor of SP, mediates a variety of physiological and

pathophysiological responses (22; 23; 43). Although previous studies have confirmed that SP enhances

corneal epithelial migration when combined with IGF-1 or EGF (41; 44; 45), the exact mechanism

remains unclear. Here we show that SP reactivates the Akt, EGFR and Sirt1, and promotes ROS

scavenging capacity that is impaired by hyperglycemia. The results suggest a molecular basis for the

synergistic effects of SP and IGF-1 or EGF on the enhancement of diabetic corneal epithelial wound

healing (46; 47). Even more interestingly, we found that the local inhibition of the SP-NK-1 receptor

signaling in normal mice causes pathological changes of the corneal epithelium similar to those of

diabetic corneal epithelium. These results suggest that SP-NK-1 receptor signaling may be involved in

the maintenance of corneal epithelium homeostasis, and also in the protection from hyperglycemia

stress, whereas the impairment of SP-NK-1 receptor signaling may explain the fragility of diabetic

corneal epithelium in vivo.

Prolonged hyperglycemia always causes the perturbation of catabolic pathways and the

over-production of ROS in the mitochondria, which in turn plays a critical role in the development of

diabetic complications (48), including diabetic keratopathy (5). In the present study, we confirmed that

the mitochondrial superoxide level was up-regulated in high glucose-treated corneal epithelial cells,

accompanied by changes of mitochondria structure and loss of mitochondrial membrane potential.

Interestingly, we found that SP attenuates the dysfunction of the mitochondria by high glucose.

Moreover, SP also elevates the intracellular glutathione level, the main antioxidant in the cells. In

addition, although increased Nrf2 expression was detected in diabetic corneal epithelium (data not

shown), the expressions of Nrf2 downstream antioxidant genes, including MnSOD, catalase, NQO1,

TXN and Hmox1, were down-regulated in diabetic corneal epithelium, while up-regulated after SP

application, which suggests that additional regulatory mechanisms may exist between Nrf2 and its

downstream antioxidant gene expressions in diabetes mellitus (49; 50). All things considered, the

improvement of oxidative stress by SP via the improved mitochondrial function, elevated GSH level

and up-regulated expression of antioxidant genes may also plays an important role in the protection of

corneal epithelium in diabetes mellitus.

In conclusion, our study demonstrates, for the first time, that SP promotes diabetic corneal

epithelial wound healing while simultaneously triggering the reactivation of the Akt-, EGFR- and


Sirt1-signaling of importance for that healing, as well as rescuing corneal sensation, improving

mitochondrial function, and decreasing ROS accumulation impaired by hyperglycemia. We

furthermore show that local inhibition of SP-NK-1 receptor signaling abolishes the promotion of SP on

corneal epithelial healing in diabetic mice, and causes diabetic corneal pathological changes in normal

mice. Thus, the SP-NK-1 receptor signaling may play a critical role in the maintenance of corneal

epithelium homeostasis, and SP signaling may, through the NK-1 receptor, contribute to the promotion

of diabetic corneal epithelial wound healing by the rescued activation of Akt, EGFR and Sirt1, the

improvement of mitochondrial function, and the increased ROS scavenging capacity of corneal

epithelium.

ACKNOWLEDGMENTS

This work was partially supported by the National Basic Research Program of China

(2012CB722409) and the National Natural Science Foundation of China (81170816, 81200665).

Qingjun Zhou is partially supported by the Shandong Provincial Excellent Innovation Team Program

and Taishan Scholar Program (20081148). Patrik Danielson is partially supported by the J.C. Kempe

and Seth M. Kempe Memorial Foundations, the Swedish Society of Medicine, the Cronqvist and KMA

foundations, and the National Swedish Research Council (521-2013-2612; Q. Zhou co-applicant). The

authors thank Yangyang Zhang, Wenjie Sui, Qian Wang, Hua Gao, Suxia Li and Zhaoli Chen of

Shandong Eye Institute for their help with the animal experiments, statistical analysis, and human

tissue collection.

No potential conflicts of interest relevant to this article were reported.

L.Y and G. D contributed to sample testing, data analysis and study design; X. Q, M. Q, Y. W, and

H. D contributed to samples testing and data analysis; P. D , L. X and Q. Z contributed to study design,

data analysis and manuscript preparation. L. X and Q. Z are the guarantors of this work and, as such,

have full access to all the data in the study and take responsibility for the integrity of the data and the

accuracy of the data analysis.


REFERENCES

1. Clark CM, Jr., Lee DA: Prevention and treatment of the complications of diabetes mellitus. N Engl J

Med 332:1210-1217, 1995

2. Schultz RO, Van Horn DL, Peters MA, Klewin KM, Schutten WH: Diabetic keratopathy. Trans Am

Ophthalmol Soc 79:180-199, 1981

3. Ljubimov AV, Huang ZS, Huang GH, Burgeson RE, Gullberg D, Miner JH, Ninomiya Y, Sado Y,

Kenney MC: Human corneal epithelial basement membrane and integrin alterations in diabetes and

diabetic retinopathy. J Histochem Cytochem 46:1033-1041, 1998

4. Rehany U, Ishii Y, Lahav M, Rumelt S: Ultrastructural changes in corneas of diabetic patients: an

electron-microscopy study. Cornea 19:534-538, 2000

5. Xu KP, Li Y, Ljubimov AV, Yu FS: High glucose suppresses epidermal growth factor

receptor/phosphatidylinositol 3-kinase/Akt signaling pathway and attenuates corneal epithelial wound

healing. Diabetes 58:1077-1085, 2009

6. Xu K, Yu FS: Impaired epithelial wound healing and EGFR signaling pathways in the corneas of

diabetic rats. Invest Ophthalmol Vis Sci 52:3301-3308, 2011

7. Wang Y, Zhao X, Shi D, Chen P, Yu Y, Yang L, Xie L: Overexpression of SIRT1 promotes high

glucose-attenuated corneal epithelial wound healing via p53 regulation of the IGFBP3/IGF-1R/AKT

pathway. Invest Ophthalmol Vis Sci 54:3806-3814, 2013

8. Forbes JM, Cooper ME: Mechanisms of diabetic complications. Physiol Rev 93:137-188, 2013

9. Gorin Y, Block K: Nox as a target for diabetic complications. Clin Sci (Lond) 125:361-382, 2013

10. Anderson EJ, Kypson AP, Rodriguez E, Anderson CA, Lehr EJ, Neufer PD: Substrate-specific

derangements in mitochondrial metabolism and redox balance in the atrium of the type 2 diabetic

human heart. J Am Coll Cardiol 54:1891-1898, 2009

11. Song B, Scheuner D, Ron D, Pennathur S, Kaufman RJ: Chop deletion reduces oxidative stress,

improves beta cell function, and promotes cell survival in multiple mouse models of diabetes. J Clin

Invest 118:3378-3389, 2008

12. Bhatt MP, Lim YC, Hwang J, Na S, Kim YM, Ha KS: C-peptide prevents hyperglycemia-induced

endothelial apoptosis through inhibition of reactive oxygen species-mediated transglutaminase 2

activation. Diabetes 62:243-253, 2013

13. Uruno A, Furusawa Y, Yagishita Y, Fukutomi T, Muramatsu H, Negishi T, Sugawara A, Kensler TW,

Yamamoto M: The Keap1-Nrf2 system prevents onset of diabetes mellitus. Mol Cell Biol

33:2996-3010, 2013

14. Kim J, Kim CS, Kim H, Jeong IH, Sohn E, Kim JS: Protection against advanced glycation end

products and oxidative stress during the development of diabetic keratopathy by KIOM-79. J Pharm

Pharmacol 63:524-530, 2011

15. Mantelli F, Micera A, Sacchetti M, Bonini S: Neurogenic inflammation of the ocular surface. Curr

Opin Allergy Clin Immunol 10:498-504, 2010

16. Tervo K, Tervo T, Eranko L, Eranko O: Substance P immunoreactive nerves in the rodent cornea.

Neurosci Lett 25:95-97, 1981

17. Miller A, Costa M, Furness JB, Chubb IW: Substance P immunoreactive sensory nerves supply the

rat iris and cornea. Neurosci Lett 23:243-249, 1981

18. Twardy BS, Channappanavar R, Suvas S: Substance P in the corneal stroma regulates the severity

of herpetic stromal keratitis lesions. Invest Ophthalmol Vis Sci 52:8604-8613, 2011

19. Hong HS, Lee J, Lee E, Kwon YS, Ahn W, Jiang MH, Kim JC, Son Y: A new role of substance P as


an injury-inducible messenger for mobilization of CD29(+) stromal-like cells. Nat Med 15:425-435,

2009

20. Lan Y, Kodati S, Lee HS, Omoto M, Jin Y, Chauhan SK: Kinetics and function of mesenchymal

stem cells in corneal injury. Invest Ophthalmol Vis Sci 53:3638-3644, 2012

21. Castagliuolo I, Morteau O, Keates AC, Valenick L, Wang CC, Zacks J, Lu B, Gerard NP,

Pothoulakis C: Protective effects of neurokinin-1 receptor during colitis in mice: role of the epidermal

growth factor receptor. Br J Pharmacol 136:271-279, 2002

22. Koon HW, Zhao D, Zhan Y, Moyer MP, Pothoulakis C: Substance P mediates antiapoptotic

responses in human colonocytes by Akt activation. Proc Natl Acad Sci U S A 104:2013-2018, 2007

23. Janelsins BM, Mathers AR, Tkacheva OA, Erdos G, Shufesky WJ, Morelli AE, Larregina AT:

Proinflammatory tachykinins that signal through the neurokinin 1 receptor promote survival of

dendritic cells and potent cellular immunity. Blood 113:3017-3026, 2009

24. Backman LJ, Danielson P: Akt-mediated anti-apoptotic effects of substance P in Anti-Fas-induced

apoptosis of human tenocytes. J Cell Mol Med 17:723-733, 2013

25. Zhou Z, Barrett RP, McClellan SA, Zhang Y, Szliter EA, van Rooijen N, Hazlett LD: Substance P

delays apoptosis, enhancing keratitis after Pseudomonas aeruginosa infection. Invest Ophthalmol Vis

Sci 49:4458-4467, 2008

26. An YS, Lee E, Kang MH, Hong HS, Kim MR, Jang WS, Son Y, Yi JY: Substance P stimulates the

recovery of bone marrow after the irradiation. J Cell Physiol 226:1204-1213, 2011

27. Muller LJ, Marfurt CF, Kruse F, Tervo TM: Corneal nerves: structure, contents and function. Exp

Eye Res 76:521-542, 2003

28. Wang F, Gao N, Yin J, Yu FS: Reduced innervation and delayed re-innervation after epithelial

wounding in type 2 diabetic Goto-Kakizaki rats. Am J Pathol 181:2058-2066, 2012

29. Okada Y, Reinach PS, Kitano A, Shirai K, Kao WW, Saika S: Neurotrophic keratopathy; its

pathophysiology and treatment. Histol Histopathol 25:771-780

30. Dogru M, Katakami C, Inoue M: Tear function and ocular surface changes in noninsulin-dependent

diabetes mellitus. Ophthalmology 108:586-592, 2001

31. He J, Bazan HE: Mapping the nerve architecture of diabetic human corneas. Ophthalmology

119:956-964, 2012

32. Tavakoli M, Kallinikos PA, Efron N, Boulton AJ, Malik RA: Corneal sensitivity is reduced and

relates to the severity of neuropathy in patients with diabetes. Diabetes Care 30:1895-1897, 2007

33. Hossain P, Sachdev A, Malik RA: Early detection of diabetic peripheral neuropathy with corneal

confocal microscopy. Lancet 366:1340-1343, 2005

34. Marfurt CF, Echtenkamp SF: The effect of diabetes on neuropeptide content in the rat cornea and

iris. Invest Ophthalmol Vis Sci 36:1100-1106, 1995

35. Kawakita T, Shimmura S, Hornia A, Higa K, Tseng SC: Stratified epithelial sheets engineered from

a single adult murine corneal/limbal progenitor cell. J Cell Mol Med 12:1303-1316, 2008

36. Kim HS, Jun Song X, de Paiva CS, Chen Z, Pflugfelder SC, Li DQ: Phenotypic characterization of

human corneal epithelial cells expanded ex vivo from limbal explant and single cell cultures. Exp Eye

Res 79:41-49, 2004

37. Koh YH, Moochhala S, Bhatia M: Activation of neurokinin-1 receptors up-regulates substance P

and neurokinin-1 receptor expression in murine pancreatic acinar cells. J Cell Mol Med 16:1582-1592

38. Goode T, O'Connor T, Hopkins A, Moriarty D, O'Sullivan GC, Collins JK, O'Donoghue D, Baird

AW, O'Connell J, Shanahan F: Neurokinin-1 receptor (NK-1R) expression is induced in human colonic


epithelial cells by proinflammatory cytokines and mediates proliferation in response to substance P. J

Cell Physiol 197:30-41, 2003

39. Steinhoff MS, von Mentzer B, Geppetti P, Pothoulakis C, Bunnett NW: Tachykinins and their

receptors: contributions to physiological control and the mechanisms of disease. Physiol Rev

94:265-301

40. Abdelkader H, Patel DV, McGhee C, Alany RG: New therapeutic approaches in the treatment of

diabetic keratopathy: a review. Clin Experiment Ophthalmol 39:259-270, 2011

41. Yamada N, Matsuda R, Morishige N, Yanai R, Chikama TI, Nishida T, Ishimitsu T, Kamiya A:

Open clinical study of eye-drops containing tetrapeptides derived from substance P and insulin-like

growth factor-1 for treatment of persistent corneal epithelial defects associated with neurotrophic

keratopathy. Br J Ophthalmol 92:896-900, 2008

42. Chikama T, Fukuda K, Morishige N, Nishida T: Treatment of neurotrophic keratopathy with

substance-P-derived peptide (FGLM) and insulin-like growth factor I. Lancet 351:1783-1784, 1998

43. Quartara L, Maggi CA: The tachykinin NK1 receptor. Part II: Distribution and pathophysiological

roles. Neuropeptides 32:1-49, 1998

44. Nakamura M, Chikama T, Nishida T: Synergistic effect with Phe-Gly-Leu-Met-NH2 of the

C-terminal of substance P and insulin-like growth factor-1 on epithelial wound healing of rabbit cornea.

Br J Pharmacol 127:489-497, 1999

45. Nakamura M, Nishida T, Ofuji K, Reid TW, Mannis MJ, Murphy CJ: Synergistic effect of

substance P with epidermal growth factor on epithelial migration in rabbit cornea. Exp Eye Res

65:321-329, 1997

46. Yamada N, Yanai R, Inui M, Nishida T: Sensitizing effect of substance P on corneal epithelial

migration induced by IGF-1, fibronectin, or interleukin-6. Invest Ophthalmol Vis Sci 46:833-839, 2005

47. Nakamura M, Ofuji K, Chikama T, Nishida T: The NK1 receptor and its participation in the

synergistic enhancement of corneal epithelial migration by substance P and insulin-like growth factor-1.

Br J Pharmacol 120:547-552, 1997

48. Blake R, Trounce IA: Mitochondrial dysfunction and complications associated with diabetes.

Biochim Biophys Acta, 2013

49. Cheng X, Chapple SJ, Patel B, Puszyk W, Sugden D, Yin X, Mayr M, Siow RC, Mann GE:

Gestational diabetes mellitus impairs nrf2-mediated adaptive antioxidant defenses and redox signaling

in fetal endothelial cells in utero. Diabetes 62:4088-4097, 2013

50. He X, Ma Q: Redox regulation by nuclear factor erythroid 2-related factor 2: gatekeeping for the

basal and diabetes-induced expression of thioredoxin-interacting protein. Mol Pharmacol 82:887-897


FIGURE LEGENDS

Figure 1. Substance P promotes corneal epithelial wound healing and restores corneal

sensitivity in diabetic mice. Topical SP application for 7 days was used to examine the wound

healing rate in diabetic corneal epithelium. The corneal epithelial wound was inflicted after 4 days

of SP application and then stained with fluorescein sodium at 24, 48 and 72 h after the corneal

epithelium scrape, with continuous daily SP administration in the ‘Diabetic+SP’-group (A).

Histogram of residual epithelial defect is presented as the percentage of the original wound (B,

n=6 per group). Corneal sensitivity was measured in unanesthetized control, diabetic and

SP-treated diabetic mice after 4 days’ topical application (C, n=8 per group). * p < 0.05, ns: no

significance.

Figure 2. Substance P promotes the migration and proliferation of corneal epithelial cells

impaired by high glucose. Confluent mouse corneal epithelial cells were wounded after the

treatment with 30 mM glucose or mannose for 3 days. Cell migration was observed with or

without SP treatment for another 24 h (A), and the migration area was analyzed by Image J

software (B, n=3 per group). Cell proliferation was measured using MTT assay after the treatment

for 3 days with glucose or mannose in the absence or presence of SP (C, n=3 per group). * p <

0.05, ns: no significance.

Figure 3. Substance P reactivates Akt, EGFR and Sirt1 in diabetic corneal epithelium.

Topical SP application for 4 days was used to examine the reactivation of Akt, EGFR and Sirt1 in

diabetic corneal epithelium. SP recovered the positive staining (A) and up-regulated the protein

levels of phosphorylated (p)-Akt, p-EGFR and Sirt1 in diabetic corneal epithelium, as compared

to that of untreated diabetic mice (B, n=3 per group). * p < 0.05, ns: no significance.

Figure 4. Substance P attenuates oxidative stress of diabetic corneal epithelium. Topical SP

application for 4 days was used to examine the attenuation of oxidative stress in diabetic corneal

epithelium. SP restored the ROS and glutathione (GSH) staining in diabetic corneal epithelium to

similar levels as those in normal corneal epithelium (A). SP elevated the mRNA transcript levels

of antioxidant genes MnSOD, Catalase, NQO1, GCLC, TXN and Hmox1 (B, n=4 per group), as


well as the staining density and protein levels of NQO1, Catalase and MnSOD in diabetic corneal

epithelium, as compared to that in untreated diabetic corneal epithelium (C, D, n=4 per group). * p

< 0.05, ns: no significance.

Figure 5. Substance P improves mitochondrial functions of corneal epithelial cells triggered

by high glucose. Mouse corneal epithelial cells were treated with 30 mM glucose or mannose for

3 days in the presence or absence of SP. SP recovered the staining density and levels of

intracellular ROS and glutathione (GSH) (A, B, n=3 per group). SP improved the impaired

mitochondrial functions by high glucose (C), including the mitochondrial superoxide (MitoSox

staining), mitochondrial structure (Mitotacker staining) and mitochondrial membrane potential

(JC-1 staining). * p < 0.05.

Figure 6. NK-1 receptor antagonist blocks the promotion of substance P on diabetic corneal

epithelial wound healing. NK-1 receptor antagonist L-733,060 was injected subconjunctivally at

24 h before topical SP application in diabetic mice. In the unwounded corneal epithelium, the

elevation of p-Akt, p-EGFR and Sirt1 staining density by SP application was attenuated in

antagonist-injected SP-treated diabetic mice (A). In the corneal epithelium 72 h after scrape, the

antagonist injection reversed the promotion of SP on diabetic corneal epithelial wound healing (B,

n=5 per group) and the staining intensity of p-Akt and the proliferation marker Ki-67 in the

regenerated corneal epithelium (C). * p < 0.05, ns: no significance.

Figure 7. Local inhibition of SP-NK-1 receptor signaling causes diabetic-like pathological

changes in the cornea of normal mice. NK-1 receptor antagonist L-733,060 was injected

subconjunctivally in normal mice. In the unwounded corneal epithelium of 3 days after antagonist

injection, the staining density of p-Akt, p-EGFR and Sirt1 (A) and corneal sensitivity (B, n=5 per

group) was attenuated similarly to that in diabetic mice. In the corneal epithelium of 72 h after

scrape, the local antagonist injection caused a significant delay of corneal epithelial wound healing

(C, n=5 per group) as well as attenuated p-Akt and Ki-67 staining density in the regenerated

corneal epithelium (D). * p < 0.05, ns: no significance.


ONLINE SUPPLEMENTAL MATERIALS

Figure S1. Topically applied substance P penetrates into the corneal epithelium in diabetic

mice. SP was detected in the cytoplasm of corneal epithelial cells by immunofluorescence staining,

which suggests that topically applied SP can penetrate into the corneal epithelium in diabetic mice.

Figure S2. Substance P promotes the early inflammatory and resolution response in diabetic

cornea. At 48 h after corneal epithelium scrape, more inflammatory cell infiltration was found

underneath the corneal epithelium margin of SP-treated diabetic mice as compared to untreated

diabetic mice, whereas this response was reduced at 72 h when compared with diabetic mice

(black lines represent the basal of regenerating corneal epithelium).

Figure S3. Substance P recovers p-Akt, p-EGFR and Sirt1 levels impaired by high glucose in

cultured corneal epithelial cells. Mouse TKE2 (A) cells or human primary corneal epithelial

cells (B) were treated with high glucose in the absence or presence of SP for 3 days, with mannose

as osmotic control. SP recovered the expression levels of p-Akt, p-EGFR and Sirt1 that was

impaired by high-glucose treatment in both mouse TKE2 cells (A, n=4 per group) and primary

human corneal epithelial cells (B, n=3 per group). * p < 0.05, ns: no significance.

Figure S4. Substance P attenuates oxidative stress of primary human corneal epithelial cells

induced by high glucose. Human primary corneal epithelial cells were treated with 30 mM

glucose or mannose for 3 days in the presence or absence of SP. SP recovered the staining density

of intracellular ROS and glutathione (GSH).

Figure S5. Substance P promotes the regeneration of diabetic corneal nerve fibers in vivo

and the growth of high glucose-treated trigeminal ganglion cells in vitro. To explore the

promotion of SP on corneal nerve fiber regeneration in diabetic mice, central corneal epithelium

(marked with 2 mm trephine) was scraped after 6 times of topical SP application per day for 4 days.

The SP application was continued with 6 times per day for another 3-4 days until the completion of

corneal epithelial wound healing, subsequently with 1-2 times per day for 2 weeks until sample

collection. The whole-mounted corneal staining with β3-tubulin antibody demonstrated that SP


application significantly promoted the regeneration of nerve fibers in diabetic corneal epithelium (A, C,

n=3 per group). In vitro, mouse trigeminal nerves were isolated and incubated in Neurobasal A medium

as previous descriptions [1]. The fresh-isolated trigeminal neuronal cells were treated with 30 mM

glucose for 3 days with or without 1 µM SP. The results demonstrated that SP accelerated neuronal

growth that was impaired by high glucose, as showed by the immunofluorescence staining with

β3-tubulin antibody (B) and the counting of total nerve fiber length (D, n=6 per group). * p < 0.05, ns:

no significance.

References

[1] Malin SA, Davis BM, Molliver DC. Production of dissociated sensory neuron cultures and

considerations for their use in studying neuronal function and plasticity. Nat Protoc. 2007;2:152–160.


Figure 1. Substance P promotes corneal epithelial wound healing and restores corneal sensitivity in diabetic mice. Topical SP application for 7 days was used to examine the wound healing rate in diabetic corneal

epithelium. The corneal epithelial wound was inflicted after 4 days of SP application and then stained with

fluorescein sodium at 24, 48 and 72 h after the corneal epithelium scrape, with continuous daily SP administration in the ‘Diabetic+SP’-group (A). Histogram of residual epithelial defect is presented as the percentage of the original wound (B, n=6 per group). Corneal sensitivity was measured in unanesthetized control, diabetic and SP-treated diabetic mice after 4 days’ topical application (C, n=8 per group). * p <

0.05, ns: no significance. 88x165mm (300 x 300 DPI)


Figure 2. Substance P promotes the migration and proliferation of corneal epithelial cells impaired by high glucose. Confluent mouse corneal epithelial cells were wounded after the treatment with 30 mM glucose or mannose for 3 days. Cell migration was observed with or without SP treatment for another 24 h (A), and the migration area was analyzed by Image J software (B, n=3 per group). Cell proliferation was measured using MTT assay after the treatment for 3 days with glucose or mannose in the absence or presence of SP (C, n=3

per group). * p < 0.05, ns: no significance. 88x92mm (300 x 300 DPI)


Figure 3. Substance P reactivates Akt, EGFR and Sirt1 in diabetic corneal epithelium. Topical SP application for 4 days was used to examine the reactivation of Akt, EGFR and Sirt1 in diabetic corneal epithelium. SP recovered the positive staining (A) and up-regulated the protein levels of phosphorylated (p)-Akt, p-EGFR

and Sirt1 in diabetic corneal epithelium, as compared to that of untreated diabetic mice (B, n=3 per group). * p < 0.05, ns: no significance. 88x75mm (300 x 300 DPI)


Figure 4. Substance P attenuates oxidative stress of diabetic corneal epithelium. Topical SP application for 4 days was used to examine the attenuation of oxidative stress in diabetic corneal epithelium. SP restored the

ROS and glutathione (GSH) staining in diabetic corneal epithelium to similar levels as those in normal

corneal epithelium (A). SP elevated the mRNA transcript levels of antioxidant genes MnSOD, Catalase, NQO1, GCLC, TXN and Hmox1 (B, n=4 per group), as well as the staining density and protein levels of

NQO1, Catalase and MnSOD in diabetic corneal epithelium, as compared to that in untreated diabetic corneal epithelium (C, D, n=4 per group). * p < 0.05, ns: no significance.

88x119mm (300 x 300 DPI)


Figure 5. Substance P improves mitochondrial functions of corneal epithelial cells triggered by high glucose. Mouse corneal epithelial cells were treated with 30 mM glucose or mannose for 3 days in the presence or absence of SP. SP recovered the staining density and levels of intracellular ROS and glutathione (GSH) (A,

B, n=3 per group). SP improved the impaired mitochondrial functions by high glucose (C), including the mitochondrial superoxide (MitoSox staining), mitochondrial structure (Mitotacker staining) and mitochondrial

membrane potential (JC-1 staining). * p < 0.05. 88x155mm (300 x 300 DPI)


Figure 6. NK-1 receptor antagonist blocks the promotion of substance P on diabetic corneal epithelial wound healing. NK-1 receptor antagonist L-733,060 was injected subconjunctivally at 24 h before topical SP

application in diabetic mice. In the unwounded corneal epithelium, the elevation of p-Akt, p-EGFR and Sirt1

staining density by SP application was attenuated in antagonist-injected SP-treated diabetic mice (A). In the corneal epithelium 72 h after scrape, the antagonist injection reversed the promotion of SP on diabetic

corneal epithelial wound healing (B, n=5 per group) and the staining intensity of p-Akt and the proliferation marker Ki-67 in the regenerated corneal epithelium (C). * p < 0.05, ns: no significance.

88x177mm (300 x 300 DPI)


Figure 7. Local inhibition of SP-NK-1 receptor signaling causes diabetic-like pathological changes in the cornea of normal mice. NK-1 receptor antagonist L-733,060 was injected subconjunctivally in normal mice. In the unwounded corneal epithelium of 3 days after antagonist injection, the staining density of p-Akt, p-

EGFR and Sirt1 (A) and corneal sensitivity (B, n=5 per group) was attenuated similarly to that in diabetic mice. In the corneal epithelium of 72 h after scrape, the local antagonist injection caused a significant delay

of corneal epithelial wound healing (C, n=5 per group) as well as attenuated p-Akt and Ki-67 staining density in the regenerated corneal epithelium (D). * p < 0.05, ns: no significance.

177x118mm (300 x 300 DPI)


Figure S1. Topically applied substance P penetrates into the corneal epithelium in diabetic mice. SP was detected in the cytoplasm of corneal epithelial cells by immunofluorescence staining, which suggests that

topically applied SP can penetrate into the corneal epithelium in diabetic mice. 21x17mm (300 x 300 DPI)


Figure S2. Substance P promotes the early inflammatory and resolution response in diabetic cornea. At 48 h after corneal epithelium scrape, more inflammatory cell infiltration was found underneath the corneal epithelium margin of SP-treated diabetic mice as compared to untreated diabetic mice, whereas this response was reduced at 72 h when compared with diabetic mice (black lines represent the basal of

regenerating corneal epithelium). 88x42mm (300 x 300 DPI)


Figure S3. Substance P recovers p-Akt, p-EGFR and Sirt1 levels impaired by high glucose in cultured corneal epithelial cells. Mouse TKE2 (A) cells or human primary corneal epithelial cells (B) were treated with high glucose in the absence or presence of SP for 3 days, with mannose as osmotic control. SP recovered the

expression levels of p-Akt, p-EGFR and Sirt1 that was impaired by high-glucose treatment in both mouse TKE2 cells (A, n=4 per group) and primary human corneal epithelial cells (B, n=3 per group). * p < 0.05,

ns: no significance. 88x104mm (300 x 300 DPI)


Figure S4. Substance P attenuates oxidative stress of primary human corneal epithelial cells induced by high glucose. Human primary corneal epithelial cells were treated with 30 mM glucose or mannose for 3 days in the presence or absence of SP. SP recovered the staining density of intracellular ROS and glutathione (GSH).

88x49mm (300 x 300 DPI)


Figure S5. Substance P promotes the regeneration of diabetic corneal nerve fibers in vivo and the growth of high glucose-treated trigeminal ganglion cells in vitro. To explore the promotion of SP on corneal nerve fiber regeneration in diabetic mice, central corneal epithelium (marked with 2 mm trephine) was scraped after 6

times of topical SP application per day for 4 days. The SP application was continued with 6 times per day for another 3-4 days until the completion of corneal epithelial wound healing, subsequently with 1-2 times per

day for 2 weeks until sample collection. The whole-mounted corneal staining with β3-tubulin antibody demonstrated that SP application significantly promoted the regeneration of nerve fibers in diabetic corneal

epithelium (A, C, n=3 per group). In vitro, mouse trigeminal nerves were isolated and incubated in Neurobasal A medium as previous descriptions [1]. The fresh-isolated trigeminal neuronal cells were treated

with 30 mM glucose for 3 days with or without 1 µM SP. The results demonstrated that SP accelerated neuronal growth that was impaired by high glucose, as showed by the immunofluorescence staining with β3-

tubulin antibody (B) and the counting of total nerve fiber length (D, n=6 per group). * p < 0.05, ns: no significance.

References [1] Malin SA, Davis BM, Molliver DC. Production of dissociated sensory neuron cultures and considerations

for their use in studying neuronal function and plasticity. Nat Protoc. 2007;2:152–160. 88x95mm (300 x 300 DPI)



Supplementary Table 1: Primary antibodies for immunofluorescent staining and Western blots

Primary antibody Residue Supplier Code

Substance P Santa cruz sc9758

p-AKT pS473 Epitomics 2118-1

AKT - Epitomics 1085-1

p-EGFR pY1068 Epitomics 1727-1

EGFR - Epitomics 1902-1

Sirt1 - AbCam Ab12193

NQO1 C-terminus AbCam Ab34173

Catalase - AbCam Ab16731

MnSOD - AbCam Ab13533

Ki-67 Abcam Ab15580

β3-tubulin R&D NL1195R

Alexa Fluor 488 donkey anti-rabbit IgG Life technologies A21206

Alexa Fluor 594 donkey anti-rabbit IgG Life technologies A21207

Donkey anti-goat IgG-CFL 488 Santa cruz sc362255


Supplementary Table 2: Primer sequences for qRT-PCR

Gene Accession

number Forward primer Reverse primer

MnSOD NM_013671.3 GTGGAGAACCCAAAGGAGAG AACCTTGGACTCCCACAGAC

Catalase NM_009804.2 GTCTTCGTCCCGAGTCTCTC CTGCCTCTCCATCTGCATTA

NQO1 NM_008706.5 GGCCCATTCAGAGAAGACAT TTCGAGTACCTCCCATCCTC

GCLC NM_010295.2 CAGCACGTTGCTCATCTCTT TTTGGAGGAGGAGGCTTAAA

TXN NM_011660.3 TGGTGGACTTCTCTGCTACG CTTCACAGTCTGCAGCAACA

Hmox1 NM_010442.2 GCACTAGCTCATCCCAGACA CATGGCATAAATTCCCACTG

GLRX NM_053108.4 CCTCAGTCAACTGCCTTTCA CTCCGGTGAGCTGTTGTAAA


Documents

Substance P promotes diabetic corneal epithelial wound ... · Substance P promotes diabetic corneal epithelial wound healing through molecular mechanisms mediated via the neurokinin-1