STS marker based tracking of slow rusting Lr34 gene in

Indian Journal of Biotechnology

Vol 8, April 2009, pp 207-213

STS marker based tracking of slow rusting Lr34 gene in Indian wheat genotypes

Priyamvada1, Ratan Tiwari*

1, M S Saharan

1, R Chatrath

1, Priyanka Siwach

2 and B Mishra

1

1Directorate of Wheat Research, Karnal 132 001, India 2Department of Bio and Nanotechnology, Guru Jambheshwar University, Hisar 125 004, India

Received 17 October 2007; revised 22 September 2008; accepted 28 November 2008

Bi-allelic STS marker was used to confirm the presence of adult plant durable rust resistance gene Lr34 in advance

generation breeding lines. These lines were scored for leaf rust three times at an equal interval and the area under disease

progress curve (AUDPC) was calculated. The lower AUDPC values of Lr34 positive lines confirmed their slow rusting

nature. In the absence of direct selection method, the breeders are selecting Lr34 gene carrying lines unintentionally as they

showed better resistance. Lines possessing Lr34, an ‘undefeated gene’, should be used in breeding programme in order to

have a broad-spectrum durable leaf rust resistance.

Keywords: AUDPC, leaf rust, Lr34 gene, Puccinia triticina

Introduction The resistance of wheat (Triticum aestivum L.)

cultivars to leaf rust, caused by Puccinia triticina

Erikss1, was traditionally based on the genes effective

throughout the developmental cycle of the plant.

Many of these resistances were overcome by new leaf

rust pathotypes. The need for durable resistance has

been recently emphasized as wheat cultivars

possessing durable leaf-rust resistance genes

worldwide have characteristics of adult plant

resistance. Several genes that confer resistance to

virulent pathotypes at adult plant stage (APR) are

Lrl12, Lr13, Lr22a, Lr22b2,3

, Lr344 and Lr35

5.

Leaf tip necrosis (Ltn), a morphological trait,

showed linkage with Lr34 and Yr18 and was

suggested to be utilized, in some environments, as a

morphological marker to identify wheat lines carrying

these genes6. Although adult plant resistance gene

Lr34 may not provide adequate resistance under high

disease pressure when it is present alone7-9

, it could

contribute to achieve acceptable levels of resistance in

combination with other slow rusting genes10,11

.

Adult plant resistance gene Lr34 has been reported

in many lines of Indian origin12-14

on the basis of Leaf

tip necrosis and area under disease progress curve

(AUDPC) scores. The combination of Lr34 with other

genes, such as Lr12 and/or Lr13, provides durable

leaf rust resistance globally15

and, therefore, not so

surprisingly, several attempts were going on to tag

Lr34 with molecular markers. The presence of Lr34

on 7D genome of wheat was known since long, but its

exact location has remained a challenge. DNA

markers are more accurate for determining the

presence of gene than the phenotypic response of the

plant to infection. Earlier works in the 7DS

chromosomal region demonstrated the close genetic

linkage of Lr34 with SSR (XGwm130, XGwm295 &

XGwm1220) and EST (cdo475, bf473324 &

be493812) markers16-18

.

Despite major efforts to identify a molecular

marker closely linked to Lr34/Yr18, there were no

diagnostic markers for universal application across

diverse wheat backgrounds. Bossolini et al19

utilized

the knowledge accrued from colinearity of rice

chromosome 6S and the Lr34/Yr18 region of wheat

chromosome 7D to develop a marker specific to the

chromosomal region of Lr34. The SWM10

microsatellite was found closest to Lr34 and was

identified to have the small allele in three independent

sources of Lr34, namely ‘Frontana’, ‘Chinese Spring’

and ‘Forno’, as well in some other genotypes

containing Lr3419

. In 2006, Lagudah20

got success in

conversion of the RFLP to a codominant sequence

tagged site (csLV34), revealing bi-allelic locus in

which 79 bp insertion in an intron sequence was with

cultivars that lacked Lr34/Yr18.

_________

*Author for correspondence:

Tel: 91-184-2267495; Fax: 91-184-2267390

E-mail: [email protected]

INDIAN J BIOTECHNOL, APRIL 2009

208

The present investigation was undertaken to

confirm the presence of Lr34 with STS (csLV34)

marker in advanced generation breeding lines and in

early generations (F1, F2) breeding lines so that these

genotype lines possessing durable rust resistance gene

can be used in further breeding programme.

Materials and Methods

The Experimental Material

The Experimental material included 82 advance

generation breeding lines (Table 1) and 70 early

generation breeding lines (F1, F2s) involving

crosses with genetic stocks possessing rust resistance

Table 1—Parentage and origin details of advance generation lines

No. Genotype Pedigree Origin

1 C 306 REGENT 1974/3*CHZ//*2C591/3/P19/C281 CCSHAU, Hisar

2 CBW 14 PRINIAA/WEAVER//STAR DWR, Karnal

3 CBW 16 KEA/TOW//LIRA DWR, Karnal

4 DBW 17 CMH 79A. 95/3*CNO 79//RAJ 3777 DWR, Karnal

5 DBW 22 NW 1012/WR 368 DWR, Karnal

6 DL 788-2 K 7537//HD 2160 MUT// HD2278/DL 896-2 IARI, N. Delhi

7 GW 322 PBW 173/GW 196 SDAU, Vijapur

8 GW 366 DL 802-3/GW 322 SDAU, Vijapur

9 HD 2189 HD 1963/HD 1931 IARI, N. Delhi

10 HD 2687 CPAN 2009/HD 2329 IARI, N. Delhi

11 HD 2733 ATTILA/3/TUI/CARC//CHEN/CHTO/4/ATTILA IARI, N. Delhi

12 HD 2781 BOW/C 306//C 591/HW 2004 IARI, N. Delhi

13 HD 2824 PTO/CNO 79/PRL/GAA//HD 1951 IARI, N. Delhi

14 HD 2833 PBW 226/HW 1042//HD 2285 IARI, N. Delhi

15 HD 2888 C 306/T.SPHAEROCOCCUM//HW 2004 IARI, N. Delhi

16 HD 2930 CNO 79/PRL//CHIL/3/HD 2329/CPAN 2068 IARI, N. Delhi

17 HD 2932 KAUZ/STAR//HD 2643 IARI, N. Delhi

18 HD 2937 TRAP#1/BOW//PFAU/MILAN IARI, N. Delhi

19 HI 1500 HW 2002*2/STREMPALLI/PNC 5 IARI, RRS, Indore

20 HI 1531 HI 1182/CPAN 1990 IARI, RRS, Indore

21 HI 1539 HI 1391/HI 1394 IARI, RRS, Indore

22 HI 1544 HINDI 62/BOBWHITE/CPAN 2099 IARI, RRS, Indore

23 HPW 251 WW 24/LEHMI P2-UI49 HPKV, Palampur

24 HS 240 AU/KAL/BB/3/WOP/PAVON IARI, RS, Shimla

25 HS 277 KAVKAZ/CIGUENA IARI, RS, Shimla

26 HS 295 CQT/AZ/IA/555/PJN S ’/PEL 1276.69 IARI, RS, Shimla

27 HS 375 BB/G 11/CJ 71/3/TA EST//KAL/BB IARI, RS, Shimla

28 HS 420 KAJ 3302//CMH 73A-497/3*CNO 79 IARI, RS, Shimla

29 HS 461 R 37/GHL 121//KAL/BB/3/JUP/MUS/4/W 3633 IARI, RS, Shimla

30 HUW 234 HUW 12*2/CPAN 1666//HUW 12 BHU, Varanasi

31 HUW 468 CPAN 1962/TONI//LIRA “S”/PRLS” BHU, Varanasi

32 HUW 598 WH 581/HUW 395//RAJ 3765 BHU, Varanasi

33 HW 2004 C 306*7//TR 380-14#7/3 AG 14 IARI, RS, Wellington

34 HW 2044 PBW 226*5//SUNSTAR*6/C 80-1 IARI, RS, Wellington

35 HW 2045 HD 2402*6/SUNTAR*6/C-80-1 IARI, RS, Wellington

36 HW 5021 MACS 2496*1//MC 10 IARI, RS, Wellington

37 HW 5044 LOK 1// WH 542 IARI, RS, Wellington

38 K 0307 K 8321/UP 2003 CSAUA&T, Kanpur

39 K 0402 HP 1731/UP 2425 CSAUA&T, Kanpur

40 K 8027 HD 1969/K 852//K 852 CSAUA&T, Kanpur

41 K 9107 K 8101/K 68 CSAUA&T, Kanpur

42 KHARCHIA 65 KHARCHIA LOCAL/EG 953 RAU, Durgapura

43 KRL 119 PBW 255/KRL 1-4 CSSRI, Karnal

44 KRL 19 PBW 255/KRL 1-4 CSSRI, Karnal

45 LOK 1 S 308/S 331 Lok Bharti Institute, Sansora

46 LOK 45 CPAN 3066/K.SONA “S”/LOK 1/CNO 79/CPAN

2081/J 24/SS-1063/CPAN 1907/CC 493//HD 2385

Lok Bharti Institute,

Sansora

Contd.—

PRIYAMVADA et al: Lr34 GENE IN INDIAN WHEAT

209

(FLW lines developed at Flowerdale, Shimla) with

elite lines/varieties (Table 2). The seed material of the

above mentioned lines were procured from the

Germplasm unit of the Directorate of Wheat

Research, Karnal.

DNA Extraction and Molecular Marker Analysis

Genomic DNA of all lines was extracted from fresh

leaves, grounded in liquid nitrogen by CTAB

method21

. Sampling of DNA was based on selection

of 6 random plants from each F2 bulk. The reported

DNA marker csLV3420

with primer sequence forward

(5′GTTGGTTAAGACTGGTGATGG3′) and reverse

(5′TGCTTGCTATTGCTGAATAGT3′) was got

synthesized from M/s Bangalore Genie Pvt. Ltd. and

utilized to know the presence of Lr34 gene in selected

wheat genotypes through DNA amplification.

Polymerase chain reaction (PCR) was performed in

25 µL of 10× PCR buffer, 2.0 mL of dNTPs (2.5 mM

each dNTPs) and 1 mL each of forward and reverse

primers (100 pmol/mL) and 100 ng of DNA in a PTC-

200 thermal cycler (MJ Research) with primer

annealing temperature of 55°C. Products of STS

primers used were fractionated on 2.5% high

resolution agarose (Bangalore Genei) with 1× TAE

buffer and visualized by ethidium bromide staining.

Results

Of 82 advance lines screened for the presence of

Lr34 gene, 16 lines namely GW 366, HD 2189, HS

277, HUW 468, HUW 598, K 0402, K 9107, NW (S)

2-4, PBW 573, PBW 574, PBW 575, RAJ 3765,

Table 1—Parentage and origin details of advance generation lines—Contd.


47 MACS 6145 C 306+ Lr 28 ARI, Pune

48 MP 3211 SKAUZ/2/FCT JNKVV, Jabalpur

49 MP 4010 ANGOSTURA 88 Gwalior

50 NI 5439 REMP 80/3* NP 710 MPKV, Niphad

51 NIAW 34 CNO 79/PRL “S” MPKV, Niphad

52 NIAW 917 GW 244/BOB WHITE MPKV, Niphad

53 NW (S) 2-4 NS 732/NER//KAUZ NDUA&T, Faizabad

54 NW 2036 BOW/CROW/BUC/PVN NDUA&T, Faizabad

55 NW 3069 ATTILA*2/KT/BAGE NDUA&T, Faizabad

56 PBW 175 HD 2160/WG 1025 PAU, Ludhiana

57 PBW 343 ND/VG 9144//KAL/BB/3/YCO “S”/4/VEE# 5 “S” PAU, Ludhiana

58 PBW 373 ND/VG 9144//KAL/BB/3/YACO “S”/4 VEE 5 “S” PAU, Ludhiana

59 PBW 396 CNO 67/MFD//MON “S”/3/SERI PAU, Ludhiana

60 PBW 502 W 485/PBW 343//RAJ 1482 PAU, Ludhiana

61 PBW 550 WH 594/RAJ 3856// W 485 PAU, Ludhiana

62 PBW 568 W 485/PBW 343//HD 2160 PAU, Ludhiana

63 PBW 573 WH 594/RAJ 3814 PAU, Ludhiana

64 PBW 574 HD 2643//CS/Ae.sq. PAU, Ludhiana

65 PBW 575 PBW 343/HUW 235 PAU, Ludhiana

66 PBW 579 W 7554/PBW 427 PAU, Ludhiana

67 RAJ 3765 HD 2402/VL 639 PAU, Ludhiana

68 RAJ 4037 DL 788-2/RAJ 3717 RAU, Durgapura

69 RAJ 4083 PBW 343/UP 2442//WR 258/UP 2425 RAU, Durgapura

70 RAJ 4101 RAJ 3765/DL 775-2 RAU, Durgapura

71 SONALIKA 1154.388/AN/3/YT 54/N 10B/LR 64 IARI, N. Delhi

72 UP 2425 HD 2320/UP 2263 GBPUAT, Pantnagar

73 VL 616 SKA/CPAN 1507 VPKAS, Almora

74 VL 738 NS 12.07/LIRA “S”//VEE “S” VPKAS, Almora

75 VV 804 CPAN 3018/CPAN 3004//PBW 65 VPKAS, Almora

76 VL 829 IBWSN 149/CPAN 2009 VPKAS, Almora

77 VL 882 CPAN 3031/PMF/MAYA/YACO VPKAS, Almora

78 VL 892 WH 542/PBW 226 VPKAS, Almora

79 WH 1021 NYOT 95/SONAK CCSHAU, Hisar

80 WH 1022 WH 283 /UP 2338 CCSHAU, Hisar

81 WH 147 E 4870/C 303//5339/PV 18 CCSHAU, Hisar

82 WH 542 JUPATECO/BLUE/JAY//URES CCSHAU, Hisar


210

UP 2425, VL 616 and VL 882 showed the presence

of 150 bp fragment specific to Lr34 and rest of the

lines showed 229 bp fragment (non Lr34

carrying allele). Approximately 20% lines carry Lr34

gene, thus expected to have durable and slow

rust resistance. AUDPC data for leaf rust of

all the entries were recorded. The AUDPC data

of the lines positive for the presence of Lr34

gene at molecular level are presented in Table 3.

The popular cultivar being grown by the farmers

for more than a decade, namely, C306, HUW234,

Kharchia 65 and WH147, showed AUDPC

value of more than 1000. Of 16 entries confirmed to

have Lr34 with marker, 12 entries showed the

AUDPC value of less than 200, which indicates the

slow rusting association with the presence of

Lr34 gene.

Tracking Lr34 Gene in Segregating Population

Several hundred crosses (single, three way or top

classes) are attempted at Directorate of Wheat

Research (DWR), Karnal every season for germplasm

enrichment and enhancement of several target

oriented breeding programmes. The F1 and F2

populations developed in one such programme from

such crosses were tested to observe the distribution of

Lr34 gene in the population. A total of 29 F1 crosses

Table 2—Parentage and origin of lines involved in breeding population


1 FLW 2 PBW 343/Blue Boy-II Flowerdale, Shimla

2 FLW 3 UP 2338/Chine 84-40022 Flowerdale, Shimla

3 FLW 6 HI 1633/HP 1776 Flowerdale, Shimla

4 FLW 8 HI 1077/Lr 9 Flowerdale, Shimla

5 FLW 9 HUW 234/Lr 19 Flowerdale, Shimla

6 CBW 14 PRINIAA/WEAVER//STAR DWR, Karnal

7 CBW 16 KEA/TOW//LIRA DWR, Karnal

8 DBW 20 PBW 373/WH 542 DWR, Karnal

9 DBW 26 PBW 343/KAUZ//STAR/LUCO-M DWR, Karnal

10 DBW 29 DL 788-2/HUW 234 DWR, Karnal

11 DBW 30 PBW 373/DBW 11 DWR, Karnal

12 GW 173 TW 275/7/7/10/LOK 1 SDAU, Vijapur

13 HD 2009 LR 64A/NA 160 IARI, N. Delhi

14 HD 2402 HD 2261/HD 2236 IARI, N. Delhi

15 HD 2733 ATTILA/3TUI/CARC//CHEM/CHTO/4/ATTILA IARI, N. Delhi

16 HP 1731 LIRA//PARULA/TONICHI PUSA, Bihar

17 HUW 234 HUW 12*2/CPAN 1666/HUW 12 BHU, Varanasi

18 K 9901 HD 2236/HD 2448//K 68 SAU, Kanpur

19 NIAW 34 CNO 79/PRL “S” MPKV, Niphad

20 PBW 343 ND/VG 9144//KAL/B 3.3/YCO ’S/4 PAU, Ludhiana

21 PBW 373 ND/VG 9144//KAL/BB 3/YACO ‘S’/4/VEE PAU, Ludhiana

22 PBW 435 HD 2160/CALIDAD PAU, Ludhiana

23 PBW 443 PBW 304/CPAN 1922 PAU, Ludhiana

24 PBW 502 W 485/PBW 343/RAJ 1482 PAU, Ludhiana

25 PBW 593 WH 581/PBW 346//CC 527 PAU, Ludhiana

26 PHR 412 UP 2338//KAUZ/ALTAR 84 DWR, Karnal

27 RAJ 3765 HD 2402/VL 639 RAU, Durgapura

28 RAJ 4119 RJ 3777/WR 413 RAU, Durgapura

29 RAJ 4123 PBW 343/UP 2442//WR 258/UP 2425 RAU, Durgapura

30 RAJ 4129 HP 1721/RAJ 3077 RAU, Durgapura

31 RWPZW5-17 CPAN 3031/PMF/MAYA/YACO//VL 75S DWR, Karnal

32 RUP2005-22 85D3 453/P 10859//RAJ 3765 DWR, Karnal

33 UP 2425 HD 2320/UP 2263 GBPUAT, Pantnagar

34 UP 2687 NAC/3/STW 163/AGEL//ANZA/4/BOW “S”/CEP 7788/HPW 42 GBPUAT, Pantnagar

35 WH 730 CPAN 2092/IMP.LOKI CCSHAU, Hisar

Table 3—AUDPC value of Lr34 positive lines

Genotypes AUDPC value

GW 366, PBW 574, PBW 575, VL 616 0

HD 2189, HS 277, HUW 468, HUW 598,

RAJ 3765, UP 2425, VL 882

101-200

HS 375, K 917 201-500

K 0402, NW(S) 2-4 501-1000


211

including 24 single cross and five top crosses were

amplified and the profile was obtained (Fig. 1).

Among these, approximately 48% F1s showed the

presence of Lr34 alleles in heterozygous state,

indicating that at least one of the parents in these

lines had Lr34 gene, while rest of the 52% F1s

were homozygous for the 229 bp allele (carrying

non-Lr34).

In F2 population, out of the total 41 bulks tested, 16

showed the presence of Lr34 gene; while 25 lines

were negative for Lr34 gene marker (Fig. 2). Thus,

39% F2 lines carried the durable rust resistance

gene Lr34.

Discussion The AUDPC scores for leaf rust indicated that most

of the lines had low disease spread; this may be due to

Fig. 1—Lr34 gene distribution in F1 population: M- 100 bp ladder; Lane 1- FLW 3/PHR 412; 2- FLW 3/DBW 30; 3- FLW 3/PBW 502;

4- FLW 2//PBW 343/K 9901; 5- FLW 2/RAJ 4123; 6- FLW 2/NIAW 34; 7- FLW 2/DBW 20; 8- FLW 2//RAJ 3765/NIAW 34; 9- FLW

2/PBW 502; 10- FLW 2/DBW 30; 11- FLW 2/DBW 29; 12- FLW 6/PBW 435//RAJ 4129; 13- FLW 6/RAJ 4119; 14- FLW 6/RWP2W5-

17; 15- FLW 6//PBW 343/K 9901; 16- FLW 6/DBW 29; 17- FLW 6/HUW 234l; 18- FLW 6/GW 173;l 19- FLW 6/CBW 14; 20- FLW

8/HUW 234; 21- FLW 8/RUP 2005; 22- FLW 3/HD 2009; 23- FLW 3//PBW 43/K 9901; 24- Tc*34; 25- FLW 6/DBW 30; 26- FLW 8/

DBW 29; 27- FLW8/GW 173; 28: FLW 8/DBW 30; 29- FLW 9/HD 2733;l 30- FLW 9/WH 730

Fig. 2—Lr34 gene distribution in F2 population: M- 100 bp ladder; Lane 1- FLW 2/HD 2402; 2- FLW 2/CBW 14; 3- FLW 2/CBW 16; 4-

FLW 2/UP 2425; 5- FLW 2/PBW 435; 6- FLW 2/NIAW 34; 7- FLW 2/DBW 30; 8- FLW 2/PBW 443; 9- FLW 2/RAJ 3765; 10- FLW

2/HP 1731; 11- FLW 2/RA J3765//UP 2687; 12- FLW 2/HD 2402//NIAW 34; 13- Tc* 34; 14- FLW 2/RAJ 4123; 15- FLW 2//NIAW

343/K 9901; 16- FLW2 /DBW 29; 17- FLW 2/DBW 30; 18- FLW 2/PBW 502; 19- FLW 2/DBW 343; 20- FLW 2//NIAW 34; 21- FLW

6//PBW 373; 22- Tc* 34; 23- FLW 6/PBW 435; 24- FLW 6/PBW 343; 25- FLW 6/HP 1731; 26- FLW 6/PBW 435//PBW 593; 27- FLW

2/CBW 14; 28- FLW 6/GW 173; 29- FLW 6/NIAW 34; 30- FLW 3/PHR 421; 31- FLW 3/PBW 502; 32- FLW3/DBW30


212

the reason that only those lines became part of

Advanced Varietal Trial which have proven resistance

against the rusts. In popular cultivars (C 306, HUW

234, Kharchia 65 & WH 147), the resistance has been

overcome by evolution of new pathotypes and,

therefore, they depicted high AUDPC values. Upon

comparing the AUDPC scores, lines found positive

for Lr34 gene were towards lower AUDPC value,

whereas the non-Lr34 possessing lines had higher

AUDPC range. Lines falling in the range of 101-200

for AUDPC truly represent the slow rusters. These

lines infer long lasting field resistance and must be

preferred while breeding to develop lines possessing

durable resistance.

In the F1 population, cultivars showed the presence

of Lr34 genes in heterozygous state and none of the

lines had Lr34 gene in homozygous state. It clearly

indicates that only one parent involved in the cross at

best carried Lr34 gene and other parent was without

Lr34 gene. In some F2 progenies, the Lr34 gene was

present in homozygous condition showing fixing of

Lr34 gene. The F2 population showed 9% decrease in

lines possessing Lr34 gene in comparison to F1

population. This may be due to the lack of direct

selection method for Lr34 gene and, therefore, the

population some times lost having Lr34 gene

(negative selection). A percentage of the lines

selected for advance generation by breeders showed

possession Lr34 durable rust resistance gene at

molecular level also, which clearly shows that, in the

absence of direct selection method, the breeders are

selecting Lr34 gene carrying lines unintentionally as

they showed better resistance.

Conclusion It was observed that about 20% of the advance

breeding lines and a good proportion of early

generation breeding lines (F1 & F2 bulks) carry

durable rust resistance gene Lr34. Breeders can now

use these Lr34 possessing lines/cultivars to rapidly

incorporate Lr34/Yr18 into adapted wheat cultivars

for minimizing the scope of losses due to leaf rust

epidemics in future and thereby realizing higher yield

potential. In order to maintain diversity of effective

resistance genes in released cultivars, durable rust

resistance gene like Lr34 should be utilized for wheat

breeding programmes.

Acknowledgement Authors thankfully acknowledge the financial

support provided by the Indo-Swiss Collaboration in

Biotechnology (ISCB) through its project “Enhancing

genetic resistance against stripe and leaf rust using

molecular markers in wheat adapted to the moisture

stress regime”. Thanks are also due to Dr Sanjay

Kumar Singh for going through the manuscript and

Mr Om Prakash for assistance in providing the details

of breeding lines.

References 1 Anilkster Y, Bushnell W R, Eilam T, Manisterski J & Roelfs

A P, Puccinia recondita causing wheat leaf rust on cultivated

wheats, wild wheats and rye, Can J Bot, 75 (1997) 2082-

2096.

2 Dyck P L & Kerber E R, Resistance of the race specific type,

in The cereal rusts, vol 2. Diseases, distribution,

epidemiology, and control, edited by A P Roelfs & W R

Bushnell (Academic Press, Orlando, Fla) 1985, 469-500.

3 Roelfs A P, Race specificity and methods of study, in The

cereal rusts, vol 1. Origin, specificity, structure and

physiology, edited by W R Bushnell & A P Roelfs

(Academic Press, Orlando, Fla) 1984, 131-154.

4 Dyck P L, The association of a gene for leaf rust resistance

with the chromosome 7D suppressor of stem rust resistance

in common wheat, Genome, 29 (1987) 467-69.

5 Kerber E R & Dyck P L, Transfer to hexaploid wheat of

linked genes for adult-plant leaf rust and seedling stem rust

resistance from an amphiploid of Aegilops speltoides ×

Triticum monococcum, Genome, 33 (1990) 530-537.

6 Singh R P, Association between gene Lr34 for leaf rust

resistance and leaf tip necrosis in wheat, Crop Sci, 32 (1990)

874-878.

7 Ma H & Singh R P, Contribution of adult plant resistance

gene Yr18 in protecting in seedlings and adult plants, Plant

Dis, 80 (1996) 66-69.

8 Singh R P & Gupta A K, Expression of wheat leaf rust

resistance gene Lr34 in seedlings and adult plants, Plant Dis,

76 (1992) 489-491.

9 Singh R P & Huerta-Espino J, Effect of leaf rust resistance

gene Lr34 on grain yield and agronomic traits of spring

wheat, Crop Sci, 37 (1997) 390-395.

10 Singh R P, Huerta-Espino J & William M, Slow rusting

genes bases resistance to leaf and yellow rusts in wheat:

Genetics and breeding at CIMMYT, Proc of 10th Assembly of

Wheat Breed Soc of Australia (Mildura, Australia) 2001,

103-10.

11 Singh R P & Rajaram S, Genetic of adult-plant resistance to

leaf rust in ‘Frontana’ and three CIMMYT wheats, Genome,

35 (1992) 24-31.

12 Saini R G, Kaur L & Kaur M, Adult plant leaf rust (Puccinia

recondita) resistance of known Lr genes against three

virulence variants of race 77 from Indian subcontinent,

Indian J Agric Sci, 68 (1998) 776-79.

13 Singh R P & Gupta A K, Genes for leaf rust resistance in

Indian and Pakistani wheats tested with Mexican pathotypes

of Puccinia recondita f. sp. tritici, Euphytica, 57 (1991) 27-

36.

14 Bahadur P, Adult plant resistance to leaf rust in 37 Indian

wheats, Proc of Indian Phytopathol Golden Jubilee, held at

IARI, New Delhi, 1998, 644-649.


213

15 Roelfs A P, Resistance to leaf and stem rust in wheat, in

Breeding strategies for resistance to rusts of wheat, edited by

N W Simmonds & S Rajaram (CIMMYT, Mexico) 1988, 10-

22.

16 Suenaga K, Singh R P, Huerta-Espino J & William H M,

Microsatellite markers for genes Lr34/Yr18 and other

quantitative trait loci for leaf rust resistance in bread wheat,

Phytopathology, 93 (2003) 881-890.

17 Schnurbusch T, Bossolini E, Messmer M & Keller B,

Tagging and validation of a major quantitative trait locus for

leaf resistance and leaf tip necrosis in winter wheat cultivar

Forno, Phytopathology, 94 (2004) 1036-1041.

18 Spielmeyer W, McIntosh R A, Kolmer J & Lagudah E S,

Powdery mildew resistance and Lr34/Yr18 genes for durable

resistance to leaf and stripe rust cosegregate at a locus on the

short arm of chromosome 7D of wheat, Theor Appl Genet,

111 (2005) 731-735.

19 Bossoline E, Krattinger S G & Keller B, Development of

simple sequence repeat markers specific for the Lr34

resistance region of wheat using sequence information from

rice and Aegilops tauschii, Theor Appl Genet, 113 (2006)

1049-1062.

20 Lagudah E S, McFadden H, Singh R P, Huerta-Espino J,

Bariana H S et al, Molecular genetic characterization of the

Lr34/Yr18 slow rusting resistance gene region in wheat,

Theor Appl Genet, 114 (2006) 21-30.

21 Doyle J J & Doyle J L, A rapid isolation procedure from

small quantities of fresh leaf tissue, Phytochem Bull, 19

(1987) 11-15.

Documents

STS marker based tracking of slow rusting Lr34 gene in