Click here to load reader

Stone Age Genomics

  • View
    20

  • Download
    0

Embed Size (px)

DESCRIPTION

Stone Age Genomics. Nature, 1987. - PowerPoint PPT Presentation

Text of Stone Age Genomics

Slide 1

Stone Age GenomicsNature, 1987Mitochondrial DNA from 147 people, drawn from five geographic populations have been analyzed by restriction mapping. All these mtDNAs stem from one woman who is postulated to have lived about 200,000 years ago, probably in Africa. All the populations examined except the African population have multiple origins, impling that each area was colonized repeatedly.Mitochondrial Eve hypothesisAll living people could be traced back to a single femaleShe lived ~200,000 years agoShe came from a population of about 10,000 individualsThat population is the founding population for humansDescendents spread into the rest of the Old World and replaced any existing populations of various species of sapiens or erectusConsistent with the out-of-Africa model / single-origin modelMitochondrial DNA16, 569 base pairsLocated in organelle responsible for energy metabolismEach cell has 100s of mitochondriaHas 37 genesAccumulates mutations on average 10x faster than nDNAGood for tracking relatively recent evolutionary eventsComes only from motherClonal haploid transmissionNo recombination of maternal and paternal genesSurprises.Amount of variation of mtDNA in humans is quite low (1/10 of that of chimps)Maybe because we evolved recently?Was there a bottleneck that reduced variation?Since we know our population overlapped with Neanderthal, do we share mtDNA?

H. sapiens vs. H. neanderthalensisOf 16,568 nucleotides206 differed from that of NeanderthalAmong 53 modern humans you will find 2 118 differencesNeanderthal sequences is outside of the range of variation among modern humans

This is strange becauseIt is quite plausible that there was interbreeding because H. sapiens and H. neanderthalensis lived in overlapping ranges as recent as 30,000 years ago.Estimated common ancestry between the two using mtDNA shows 660,000 years ago.Maybe only human female by Neanderthal male matings occurred (never the reverse)We may have to sample all 400 fossils of Neanderthal to have a good samplePreliminary nDNA studies also do not show a recent ancestor with neanderthalensis but instead show ancestries of ~700,000 years ago

http://www.africanancestry.com

Considerable caution is warranted when assessing claims to be able to trace ancestrymtDNA diversity is larger within Africa than outside of AfricaPoor sampling coverage (especially central Africa)Many groups in Africa were widely dispersed before slave tradeBantu dispersal is a recent phenomenon The most important translocation in human historyA mutation resulting from attachment of a chromosomal fragment to a nonhomologous chromosome

The most important translocation in human history

CHROMOSOME PARTSAll Chromosomes have telomeres at their ends(like shoelace aglets!) HeadTelomereCentromere TailTelomereTelomeres have a unique DNA sequencettagggttagggttagggttagggttagggttaggg||||||||||||||||||||||||||||||||||||aatcccaatcccaatcccaatcccaatcccaatcccPREDICTIONIf fusion occurred, then we should see DNA evidence of the head-to-head telomeres together near middle of our #2 chromosomeChimp #12Chimp #13Human #2Fusion Area?

EXPECTATIONSWhat will you look for?tandem repeats in fusion areaWhere will you look for them?middle of our chromosome #2How can you look for them?search online DNA databaseWhat if evidence is NOT found?fusion may not have happenedRESULTS CLARIFIED108061 agcacagacc tgggggtcac cgtaaaggtg gagcagcatt cccctaagca cagaggttgg 108121 ggccactgcc tggctttgtg acaactcggg gcgcatcaac ggtgaataaa atctttcccg 108181 gttgcagccg tgaataatca aggttagaga ccagttagag cggttcagtg cggaaaacgg 108241 gaaagaaaaa gcccctctga atcctgggca gcgagattct cccaaagcaa ggcgaggggc 108301 tgcattgcag ggtgagggtg agggttaggg tttgggttgg gtttggggtt ggggttgggg 108361 taggggtggg gttggggttg gggttggggt taggggtagg ggtaggggta ggggtagggt 108421 cagggtcagg gtcagggtta gggttttagg gttaggattt tagggttagg gtaagggtta 108481 agggttgggg ttggggttag ggttaggggt tagggttggg gttggggttg gggttggggt 108541 tggggttggg gttagggtta gctaaaccta accctaaccc ctaaccccaa ccccaacccc 108601 aaccctaccc ctacccctac ccctaacccc aacccccacc cttaaccctt aacccttacc 108661 ctaaccctaa cccaaaccct aaccctaccc taaccctaac ccaaccctaa ccctaaccct 108721 accctaaccc taacacccta aaaccgtgac cctgaccttg accctgaccc ttaaccctta 108781 accctaacca taaccctaaa ccctaaccct aaaccctaac cctaaaccct aaccctaaca 108841 ctaccctacc ctaaccccaa cccctaaccc ctaaccctaa ccctacccct aaccccaacc 108901 ccagccccaa cccttaccct aaccctaccc taacccttaa ccctaacccc taaccctaac 108961 ccctaaccct aaccctaccc caaccccaaa cccaacccta acccaaccct aacccctaac 109021 cctaacccct accctaaccc ctagccctag ccctagccct aaccctaacc ctcgccctaa 109081 ccctcaccct aaccctcacc ctcaccctaa cccaacgtct gtgctgagaa gaatgctgct 109141 ccgcctttaa ggtgcccccc aggtctgtgc tgaacagaac gcagctccgc cgtcgcagtg 109201 ccctcagccc gcccgcccgg gtctgacctg agaagaactc tgctccgcct tcgcaatagc 109261 cccgaagtct gtgcagagga gaacgcagct ccgccctcgc gatgctctcc ggctgtgtgc 109321 taaagagaac gcaactccgc cctcgcaaag gcggcgcgcc ggcggaggcg cggagaggcg HEAD 13HEAD 12See where the head-to-head fusion occurred?Further ConfirmationComparison of DNA in Our Chrom. #2 with...

Another Confirmation Comparison of DNA in Our Chrom. #3 with...

Search related