Upload
jodie-barton
View
216
Download
0
Tags:
Embed Size (px)
Citation preview
Next Generation Sequence Alignment & Variant Discovery on the BRC-MH Linux
Cluster
Steve Newhouse28 Jan 2011
Practical guide to processing next generation sequencing data
No details on the inner workings of the software/code & theory
Based on the 1KG pipeline from the Broad Institute using their Genome Analysis Tool Kit (GATK).
Focus on Illumina paired-end sequence data Alignment with BWA or Novoalign SNP & Indel calling with GATK NB: This is one way processing the data that
works well
Overview
BRC Cluster Software : http://compbio.brc.iop.kcl.ac.uk/cluster/software.php Maq: http://maq.sourceforge.net/ Fastqc : http://www.bioinformatics.bbsrc.ac.uk/projects/fastqc/ Fastx: http://hannonlab.cshl.edu/fastx_toolkit/ cmpfastq.pl : http://compbio.brc.iop.kcl.ac.uk/software/cmpfastq.php BWA: http://bio-bwa.sourceforge.net/bwa.shtml Novoalign: http://www.novocraft.com Genome Analysis Toolkit:
http://www.broadinstitute.org/gsa/wiki/index.php/The_Genome_Analysis_Toolkit PICARD TOOLS: http://picard.sourceforge.net/ SAMTOOLS: http://samtools.sourceforge.net/ VCFTOOLS: http://vcftools.sourceforge.net/ FASTQ Files : http://en.wikipedia.org/wiki/FASTQ_format, SAM/BAM Format : http://samtools.sourceforge.net/SAM1.pdf PHRED Scores: http://en.wikipedia.org/wiki/Phred_quality_score Next Generation Sequencing Library: http://ngslib.genome.tugraz.at http://seqanswers.com http://www.broadinstitute.org/gsa/wiki/index.php/File:Ngs_tutorial_depristo_121
0.pdf
Main Tools/Resources
Convert Illumina Fastq to sanger Fastq QC raw data Mapping (BWA, QC-BWA, Novoalign) Convert Sequence Alignment/Map (SAM) to BAM
Local realignment around Indels Remove duplicates Base Quality Score Recalibration Variant Discovery
Analysis Pipeline
Work flow Illumina Raw fastq
Convert Illumina Fastq to sanger Fastq
QC raw data
Mapping (BWA, QC-BWA, Novoalign)
Convert SAM to BAM
Local realignment around Indels
Remove duplicates
Base Quality Score Recalibration
Analysis-readyreads
Indels & SNPs
Fastq Format :*_sequence.txt; ◦ s_1_1_sequence.txt = lane 1, read 1◦ s_1_2_sequence.txt = lane 1, read 2
Text file storing both nucleotide sequence and quality scores.
Both the sequence letter and quality score are encoded with a single ASCII character for brevity.
Standard for storing the output of high throughput sequencing instruments such as the Illumina Genome Analyzer
http://en.wikipedia.org/wiki/FASTQ_format
What does the raw data look like?
Raw Data :-
@315ARAAXX090414:8:1:567:552#0
TGTTTCTTTAAAAAGGTAAGAATGTTGTTGCTGGGCTTAGAAATATGAATAACCATATGCCAGATAGATAGATGGA
+
;<<=<===========::==>====<<<;;;:::::99999988887766655554443333222211111000//
@315ARAAXX090414: the unique instrument name 8: flowcell lane 1: tile number within the flowcell lane 567: 'x'-coordinate of the cluster within the tile 552: 'y'-coordinate of the cluster within the tile # :index number for a multiplexed sample (0 for no indexing) 0 :the member of a pair, /1 or /2 (paired-end or mate-pair reads only) http://en.wikipedia.org/wiki/FASTQ_format
FASTQ Format
Illumina Raw fastq
Convert Illumina Fastq to sanger Fastq
QC raw data
Mapping (BWA, QC-BWA, Novoalign)
Convert SAM to BAM
Local realignment around Indels
Remove duplicates
Base Quality Score Recalibration
Analysis-readyreads
Indels & SNPs
Convert Illumina Fastq to sanger FastqQC raw data
Convert Illumina Fastq to sanger Fastq
$: maq ill2sanger s_1_1_sequence.txt foo.1.sanger.fastq$: maq ill2sanger s_1_2_sequence.txt foo.2.sanger.fastq
Quality Control & Pre-Alignment Processing.1
FastQC: Provides a simple way to do some quality control checks on raw sequence data. ◦ Quick impression of whether the data has problems.◦ Import of data from BAM, SAM or FastQ◦ Summary graphs and tables to quickly assess your data◦ Export of results to an HTML based permanent report◦ Offline operation to allow automated generation of reports without running the
interactive application
$: fastqc foo.1.sanger.fastq;$: fastqc foo.2.sanger.fastq;
http://www.bioinformatics.bbsrc.ac.uk/projects/fastqc/
Quality Control & Pre-Alignment Processing.2
FastQC
Illumina Raw fastq
Convert Illumina Fastq to sanger Fastq
QC raw data
Mapping (BWA, QC-BWA, Novoalign)
Convert SAM to BAM
Local realignment around Indels
Remove duplicates
Base Quality Score Recalibration
Analysis-readyreads
Indels & SNPs
Mapping (BWA, QC-BWA, Novoalign)Convert SAM to BAM
Available genomes◦ Homo_sapiens_assembly18.fasta ◦ human_b36_both.fasta ◦ human_g1k_v37.fasta (1000 genomes)
Indexed for use with BWA or Novoalign
Location: /scratch/data/reference_genomes/human
Human reference sequences and dbSNP reference metadata are available in a tarball: ◦ ftp://ftp.broadinstitute.org/pub/gsa/gatk_resources.tgz
Reference genomes
## Align with BWA
$: REF=/scratch/data/reference_genomes/human/human_g1k_v37.fasta
$: bwa aln -t 8 $REF foo.1.sanger.fastq > foo.1.sai;
$: bwa aln -t 8 $REF foo.2.sanger.fastq > foo.2.sai;
## Generate alignment in the SAM format
$: bwa sampe $REF foo.1.sai foo.2.sai foo.1.sanger.fastq foo.2.sanger.fastq > foo.bwa.raw.sam;
## Sort bwa SAM file using PICARD TOOLS SortSam.jar - this will also produce the BAM file
$: java -jar SortSam.jar SORT_ORDER=coordinate VALIDATION_STRINGENCY=SILENT \
INPUT= foo.bwa.raw.sam OUTPUT= foo.bwa.raw.bam;
## samtools index
$: samtools index foo.novo.raw.bam;
Use option -q15 if the quality is poor at the 3' end of reads http://bio-bwa.sourceforge.net/bwa.shtml
BWA: Burrows-Wheeler Aligner
Fastx: http://hannonlab.cshl.edu/fastx_toolkit◦ QC filter raw sequence data ◦ always use -Q 33 for sanger phred scaled data (-Q 64)
$: cat foo.1.sanger.fastq | \
fastx_clipper -Q 33 -l 20 -v -a ACACTCTTTCCCTACACGACGCTCTTCCGATCT | \
fastx_clipper -Q 33 -l 20 -v -a CGGTCTCGGCATTCCTACTGAACCGCTCTTCCGATCT | \
fastx_clipper -Q 33 -l 20 -v -a ATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATC | \
fastx_clipper -Q 33 -l 20 -v –a CAAGCAGAAGACGGCATACGAGATCGGTCTCGGCATTCCTGCTGAACCGCTCTTCCGATC | \
fastq_quality_trimmer -Q 33 -t 20 -l 20 -v | \
fastx_artifacts_filter -Q 33 -v | \
fastq_quality_filter -Q 33 -q 20 -p 50 -v -o foo.1.sanger.qc.fastq;
$: cat foo.2.sanger.fastq | \
fastx_clipper -Q 33 -l 20 -v -a ACACTCTTTCCCTACACGACGCTCTTCCGATCT | \
fastx_clipper -Q 33 -l 20 -v -a CGGTCTCGGCATTCCTACTGAACCGCTCTTCCGATCT | \
fastx_clipper -Q 33 -l 20 –v -a ATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATC | \
fastx_clipper -Q 33 -l 20 -v –a CAAGCAGAAGACGGCATACGAGATCGGTCTCGGCATTCCTGCTGAACCGCTCTTCCGATC | \
fastq_quality_trimmer -Q 33 -t 20 -l 20 -v | \
fastx_artifacts_filter -Q 33 -v | \
fastq_quality_filter -Q 33 -q 20 -p 50 -v -o foo.2.sanger.qc.fastq;#
BWA : with pre-alignment QC.1
Compare QCd fastq files◦ One end of each read could be filtered out in QC◦ BWA cant deal with mixed PE & SE data◦ Need to id reads that are still paired after QC◦ Need to id reads that are no longer paired after QC
$: perl cmpfastq.pl foo.1.sanger.qc.fastq foo.2.sanger.qc.fastq
Reads matched on presence/absence of id's in each file : ◦ foo.1.sanger.qc.fastq : @315ARAAXX090414:8:1:567:552#1◦ foo.2.sanger.qc.fastq : @315ARAAXX090414:8:1:567:552#2
Output: 2 files for each *QC.fastq file
◦ foo.1.sanger.qc.fastq-common-out (reads in foo.1.* == reads in foo.2.*) ◦ foo.1.sanger.qc.fastq-unique-out (reads in foo.1.* not in foo.2.*)◦ foo.2.sanger.qc.fastq-commont-out◦ foo.2.sanger.qc.fastq-unique-out
BWA : with pre-alignment QC.2
http://compbio.brc.iop.kcl.ac.uk/software/cmpfastq.php
Align with BWA
$: REF=/scratch/data/reference_genomes/human/human_g1k_v37.fasta$: bwa aln -t 8 $REF foo.1.sanger.qc.fastq-common-out > foo.1.common.sai;$: bwa aln -t 8 $REF foo.2.sanger.qc.fastq-common-out > foo.2.common.sai;$: bwa aln -t 8 $REF foo.1.sanger.qc.fastq-unique-out > foo.1.unique.sai;$: bwa aln -t 8 $REF foo.1.sanger.qc.fastq-unique-ou > foo.2.unique.sai;
Multi threading option : -t N http://bio-bwa.sourceforge.net/bwa.shtml
BWA : with pre-alignment QC.3
Generate alignments in the SAM/BAM format
$: REF=/scratch/data/reference_genomes/human/human_g1k_v37.fasta
## bwa sampe for *common*
$: bwa sampe $REF foo.1.common.sai foo.2.common.sai foo.1.sanger.qc.fastq-common-out foo.2.sanger.qc.fastq-common-out > foo.common.sam;
## bwa samse for *unique*
$: bwa samse $REF foo.1.unique.sai foo.1.sanger.qc.fastq-unique-out > foo.1.unique.sam;
$: bwa samse $REF foo.2.unique.sai foo.2.sanger.qc.fastq-unique-out > foo.2.unique.sam;
## merge SAM files using PICARD TOOLS MergeSamFiles.jar - this will also sort the BAM file
$: java -jar MergeSamFiles.jar INPUT=foo.common.sam INPUT=foo.1.unique.sam INPUT=foo.2.unique.sam ASSUME_SORTED=false VALIDATION_STRINGENCY=SILENT OUTPUT=foo.bwa.raw.bam;
## samtools index
samtools index foo.bwa.raw.bam;
Details SAM/BAM Format : http://samtools.sourceforge.net/SAM1.pdf
BWA : with pre-alignment QC.4
Has options for adaptor stripping and quality filters – and much more
More accurate than BWA but slower unless running MPI version
$1,990/year for full set of tools – worth it!
$: REF=/scratch/data/reference_genomes/human/human_g1k_v37
$: novoalign -d $REF -F STDFQ -f foo.1.sanger.fastq foo.2.sanger.fastq \
-a GATCGGAAGAGCGGTTCAGCAGGAATGCCGAG ACACTCTTTCCCTACACGACGCTCTTCCGATCT \
-r Random -i PE 200,50 -c 8 --3Prime -p 7,10 0.3,10 -k -K foo.novo.test \
-o SAM $'@RG\tID:foo\tPL:Illumina\tPU:Illumina\tLB:tumour\tSM:foo' \
> foo.novo.stats > foo.novo.raw.sam;
http://www.novocraft.com
Novoalign : quality aware gapped aligner.1
Novoalign produces a name sorted SAM file which needs to be co-ordinate sorted for downstream processing
## Sort novo SAM file using PICARD TOOLS SortSam.jar - this will also produce the BAM file
$: java -jar SortSam.jar SORT_ORDER=coordinate VALIDATION_STRINGENCY=SILENT \ INPUT= foo.novo.raw.sam OUTPUT= foo.novo.raw.bam;
## samtools index
$: samtools index foo.novo.raw.bam;
Novoalign : quality aware gapped aligner.2
Local realignment around Indels Remove duplicate reads Base Quality Score Recalibration
GATK: http://www.broadinstitute.org/gsa/wiki/index.php/The_Genome_Analysis_Toolkit
PICARD TOOLS: http://picard.sourceforge.net SAMTOOLS: http://samtools.sourceforge.net
Many other quality stats/options for processing files using these tools : see web documentation
Post Aligment processing of BAM files
Illumina Raw fastq
Convert Illumina Fastq to sanger Fastq
QC raw data
Mapping (BWA, QC-BWA, Novoalign)
Convert SAM to BAM
Local realignment around Indels
Remove duplicates
Base Quality Score Recalibration
Analysis-readyreads
Indels & SNPs
Local realignment around Indels
Sequence aligners are unable to perfectly map reads containing insertions or deletions◦ Alignment artefacts ◦ False positives SNPs
Steps to the realignment process: ◦ Step 1: Determining (small) suspicious intervals
which are likely in need of realignment◦ Step 2: Running the realigner over those intervals◦ Step 3: Fixing the mate pairs of realigned reads
http://www.broadinstitute.org/gsa/wiki/index.php/Local_realignment_around_indels
Local realignment around Indels.1
Local realignment around Indels.2
Original BAM file
forRealigner.intervals (interval file)
Realigned BAM file
RealignerTargetCreator (GATK)
IndelRealigner (GATK)
Co-ordinate sorted Realigned BAM file
SortSam (PICARD)
Co-ordinate sorted Realigned fixed BAM file
FixMateInformation (PICARD)
$: REF=/scratch/data/reference_genomes/human/human_g1k_v37.fasta$:
ROD=/scratch/data/reference_genomes/human/dbsnp_131_b37.final.rod
$: TMPDIR=~/scratch/tmp$: GATK=/share/apps/gatk_20100930/Sting/dist/GenomeAnalysisTK.jar
## 1. Creating Intervals : RealignerTargetCreator $: java –Xmx5g -jar $GATK -T RealignerTargetCreator -R $REF -D $ROD \-I foo.novo.bam -o foo.novo.bam.forRealigner.intervals;
## 2. Realigning : IndelRealigner $: java -Djava.io.tmpdir=$TMPDIR –Xmx5g -jar $GATK -T IndelRealigner \-R $REF -D $ROD -I foo.novo.bam -o foo.novo.realn.bam \-targetIntervals foo.novo.bam.forRealigner.intervals;
## samtools index$: samtools index foo.novo.realn.bam;
Local realignment around Indels.3
## 3. Sort realigned BAM file using PICARD TOOLS SortSam.jar
## GATK IndelRealigner produces a name sorted BAM
$: java –Xmx5g -jar SortSam.jar \
INPUT= foo.novo.realn.bam OUTPUT=foo.novo.realn.sorted.bam \
SORT_ORDER=coordinate TMP_DIR=$TMPDIR VALIDATION_STRINGENCY=SILENT;
## samtools index
$: samtools index foo.novo.realn.soretd.bam;
## 4. Fixing the mate pairs of realigned reads using Picard tools FixMateInformation.jar
$: java -Djava.io.tmpdir=$TMPDIR -jar -Xmx6g FixMateInformation.jar \
INPUT= foo.novo.realn.sorted.bam OUTPUT= foo.novo.realn.sorted.fixed.bam \
SO=coordinate VALIDATION_STRINGENCY=SILENT TMP_DIR=$TMPDIR;
## samtools index
samtools index foo.novo.realn.sorted.fixed.bam ;
Local realignment around Indels.3
Illumina Raw fastq
Convert Illumina Fastq to sanger Fastq
QC raw data
Mapping (BWA, QC-BWA, Novoalign)
Convert SAM to BAM
Local realignment around Indels
Remove duplicates
Base Quality Score Recalibration
Analysis-readyreads
Indels & SNPs
Remove duplicates
Examine aligned records in the supplied SAM or BAM file to locate duplicate molecules and remove them
$: TMPDIR=~/scratch/tmp## Remove duplicate reads with Picard tools MarkDuplicates.jar $: java -Xmx6g –jar MarkDuplicates.jar \INPUT= foo.novo.realn.sorted.fixed.bam \OUTPUT= foo.novo.realn.duperemoved.bam \METRICS_FILE=foo.novo.realn.Duplicate.metrics.file \REMOVE_DUPLICATES=true \ASSUME_SORTED=false TMP_DIR=$TMPDIR \VALIDATION_STRINGENCY=SILENT;## samtools indexsamtools index foo.novo.realn.duperemoved.bam;
Remove duplicate reads
Illumina Raw fastq
Convert Illumina Fastq to sanger Fastq
QC raw data
Mapping (BWA, QC-BWA, Novoalign)
Convert SAM to BAM
Local realignment around Indels
Remove duplicates
Base Quality Score Recalibration
Analysis-readyreads
Indels & SNPs
Base Quality Score RecalibrationAnalysis-ready reads
Correct for variation in quality with machine cycle and sequence context
Recalibrated quality scores are more accurate Closer to the actual probability of mismatching the reference
genome
Done by analysing the covariation among several features of a base ◦ Reported quality score◦ The position within the read◦ The preceding and current nucleotide (sequencing chemistry effect) observed
by the sequencing machine◦ Probability of mismatching the reference genome◦ Known SNPs taken into account (dbSNP 131)
Covariates are then used to recalibrate the quality scores of all reads in a BAM file
http://www.broadinstitute.org/gsa/wiki/index.php/Base_quality_score_recalibration
Base Quality Score Recalibration.1
Base Quality Score Recalibration.2
Co-ordinate sorted Realigned fixed BAM file
Covariates table (.csv)
Final Recalibrated BAM file
CountCovariates
TableRecalibraion
Recalibrated covariatestable (.csv)
CountCovariates
AnalyzeCovariates
Post-recalibrationanalysis plots
Pre-recalibrationanalysis plots
AnalyzeCovariates
## set env variables
$: GATK=/share/apps/gatk_20100930/Sting/dist/GenomeAnalysisTK.jar
$: REF=/scratch/data/reference_genomes/human/human_g1k_v37.fasta
$: ROD=/scratch/data/reference_genomes/human/dbsnp_131_b37.final.rod
## 1. GATK CountCovariates
java -Xmx8g -jar $GATK -T CountCovariates -R $REF --DBSNP $ROD \
-I foo.novo.realn.duperemoved.bam \-recalFile foo.novo.realn.duperemoved.bam.recal_data.csv \
--default_platform Illumina \
-cov ReadGroupCovariate \
-cov QualityScoreCovariate \
-cov CycleCovariate \
-cov DinucCovariate \
-cov TileCovariate \
-cov HomopolymerCovariate \
-nback 5;
http://www.broadinstitute.org/gsa/wiki/index.php/Base_quality_score_recalibration
Base Quality Score Recalibration.3
## set env variables $: GATK=/share/apps/gatk_20100930/Sting/dist/GenomeAnalysisTK.jar$: GATKacov=/share/apps/gatk_20100930/Sting/dist/AnalyzeCovariates.jar$: GATKR=/share/apps/gatk_20100930/Sting/R$: REF=/scratch/data/reference_genomes/human/human_g1k_v37.fasta$: ROD=/scratch/data/reference_genomes/human/dbsnp_131_b37.final.rod$: Rbin=/share/apps/R_current/bin/Rscript
## 2. GATK AnalyzeCovariatesjava -Xmx5g –jar $GATKacov \-recalFile foo.novo.realn.duperemoved.bam.recal_data.csv \-outputDir foo.novo.realn.duperemoved.bam.recal.plots \-resources $GATKR \-Rscript $Rbin;
http://www.broadinstitute.org/gsa/wiki/index.php/Base_quality_score_recalibration
Base Quality Score Recalibration.4
Generate the final analysis ready BAM file for Variant Discovery and Genotyping
## set env variables $: GATK=/share/apps/gatk_20100930/Sting/dist/GenomeAnalysisTK.jar$: REF=/scratch/data/reference_genomes/human/human_g1k_v37.fasta$: ROD=/scratch/data/reference_genomes/human/dbsnp_131_b37.final.rod
## 3. GATK TableRecalibration $: java –Xmx6g -jar $GATK -T TableRecalibration -R $REF \-I foo.novo.realn.duperemoved.bam \--out foo.novo.final.bam \-recalFile foo.novo.realn.duperemoved.bam.recal_data.csv \--default_platform Illumina;
##samtools index$: samtools index foo.novo.final.bam;
http://www.broadinstitute.org/gsa/wiki/index.php/Base_quality_score_recalibration
Base Quality Score Recalibration.5
Illumina Raw fastq
Convert Illumina Fastq to sanger Fastq
QC raw data
Mapping (BWA, QC-BWA, Novoalign)
Convert SAM to BAM
Local realignment around Indels
Remove duplicates
Base Quality Score Recalibration
Analysis-readyreads
Indels & SNPsSNP & Indel calling with GATK
SNP & Indel calling with GATKFinal Recalibrated BAM file
IndelGenotyperV2
gatk.raw.indels.verbose.output.bed
gatk.raw.indels.bed
gatk.raw.indels.detailed.output.vcf
gatk.indels.filtered.bed
filterSingleSampleCalls.pl
gatk.filtered.indels.simple.bed...chr1 556817 556817 +G:3/7chr1 3535035 3535054 -TTCTGGGAGCTCCTCCCCC:9/21 chr1 3778838 3778838 +A:15/48...
UnifiedGenotyper
makeIndelMask.py
gatk.raw.snps.vcf
VariantFiltration
indels.mask.bed
gatk.filtered.snps.vcf
## set env variables
$: GATK=/share/apps/gatk_20100930/Sting/dist/GenomeAnalysisTK.jar
$: GATKPERL=/share/apps/gatk_20100930/Sting/perl
$: GATKPYTHON=/share/apps/gatk_20100930/Sting/python
$: REF=/scratch/data/reference_genomes/human/human_g1k_v37.fasta
$: ROD=/scratch/data/reference_genomes/human/dbsnp_131_b37.final.rod
## Generate raw indel calls
$: java -Xmx6g -jar $GATK -T IndelGenotyperV2 -R $REF --DBSNP $ROD \
-I foo.novo.final.bam \
-bed foo.gatk.raw.indels.bed \
-o foo.gatk.raw.indels.detailed.output.vcf \
--metrics_file foo.gatk.raw.indels.metrics.file \
-verbose foo.gatk.raw.indels.verbose.output.bed \
-minCoverage 8 -S SILENT –mnr 1000000;
## Filter raw indels
$: perl $GATKPERL/filterSingleSampleCalls.pl --calls foo.gatk.raw.indels.verbose.output.bed \
--max_cons_av_mm 3.0 --max_cons_nqs_av_mm 0.5 --mode ANNOTATE > foo.gatk.filtered.indels.bed
http://www.broadinstitute.org/gsa/wiki/index.php/Indel_Genotyper_V2.0
Short Indels (GATK IndelGenotyperV2)
The output of the IndelGenotyper is used to mask out SNPs near indels.
“makeIndelMask.py” creates a bed file representing the masking intervals based on the output of IndelGenotyper.
$: GATKPYTHON=/share/apps/gatk_20100930/Sting/python
## Create indel mask file
$: python $GATKPYTHON/makeIndelMask.py foo.gatk.raw.indels.bed 5 indels.mask.bed
The number in this command stands for the number of bases that will be included on either side of the indel.
http://www.broadinstitute.org/gsa/wiki/index.php/Indel_Genotyper_V2.0
Creating an indel mask file
## set env variables
$: GATK=/share/apps/gatk_20100930/Sting/dist/GenomeAnalysisTK.jar
$: REF=/scratch/data/reference_genomes/human/human_g1k_v37.fasta
$: ROD=/scratch/data/reference_genomes/human/dbsnp_131_b37.final.rod
## SNP Calling
$: java -Xmx5g -jar $GATK -T UnifiedGenotyper -R $REF -D $ROD \
-baq CALCULATE_AS_NECESSARY -baqGOP 30 -nt 8 \
-A DepthOfCoverage -A AlleleBalance -A HaplotypeScore -A HomopolymerRun -A MappingQualityZero -A QualByDepth -A RMSMappingQuality -A SpanningDeletions \
-I foo.novo.final.bam -o foo.gatk.raw.snps.vcf \
-verbose foo.gatk.raw.snps.vcf.verbose -metrics foo.gatk.raw.snps.vcf.metrics;
This results in a VCF (variant call format) file containing raw SNPs.◦ VCF is a text file format. It contains meta-information lines, a header line, and then
data lines each containing information about a position in the genome (SNP/INDEL calls).
http://www.1000genomes.org/wiki/Analysis/Variant%20Call%20Format/vcf-variant-call-format-version-40
http://www.broadinstitute.org/gsa/wiki/index.php/Unified_genotyper
SNP Calling (GATK UnifiedGenotyper)
VariantFiltration is used annotate suspicious calls from VCF files based on their failing given filters. It annotates the FILTER field of VCF files for records that fail any one of several filters:
◦ Variants that lie in clusters, using the specified values to define a cluster (i.e. the number of variants and the window size).
◦ Any variant which overlaps entries from a masking rod. ◦ Any variant whose INFO field annotations match a specified expression (i.e. the expression is used to describe
records which should be filtered out).
## set env variables $: GATK=/share/apps/gatk_20100930/Sting/dist/GenomeAnalysisTK.jar$: REF=/scratch/data/reference_genomes/human/human_g1k_v37.fasta$: ROD=/scratch/data/reference_genomes/human/dbsnp_131_b37.final.rod## VariantFiltration & annotation$: java –Xmx5g -jar $GATK -T VariantFiltration -R $REF -D $ROD \-o foo.gatk.VariantFiltration.snps.vcf \-B variant,VCF, foo.gatk.raw.snps.vcf \-B mask,Bed, indels.mask.bed --maskName InDel \--clusterSize 3 --clusterWindowSize 10 \--filterExpression "DP <= 8" --filterName "DP8" \--filterExpression "SB > -0.10" --filterName "StrandBias" \--filterExpression "HRun > 8" --filterName "HRun8" \--filterExpression "QD < 5.0" --filterName "QD5" \--filterExpression "MQ0 >= 4 && ((MQ0 / (1.0 * DP)) > 0.1)" --filterName "hard2validate";
More information on the parameters used can be found in: http://www.broadinstitute.org/gsa/wiki/index.php/VariantFiltrationWalker http://www.broadinstitute.org/gsa/wiki/index.php/Using_JEXL_expressions
SNP Filtering & annotation (GATK VariantFiltration)
VCFTOOLS: methods for working with VCF files: filtering,validating, merging, comparing and calculate some basic population genetic statistics.
Example of some basic hard filtering:
## filter poor quality & suspicious SNP calls
vcftools --vcf foo.gatk.VariantFiltration.snps.vcf \
--remove-filtered DP8 --remove-filtered StrandBias --remove-filtered LowQual \
--remove-filtered hard2validate --remove-filtered SnpCluster \
--keep-INFO AC --keep-INFO AF --keep-INFO AN --keep-INFO DB \
--keep-INFO DP --keep-INFO DS --keep-INFO Dels --keep-INFO HRun --keep-INFO HaplotypeScore --keep-INFO MQ --keep-INFO MQ0 --keep-INFO QD --keep-INFO SB --out foo.gatk.good.snps ;
this produces the file " foo.gatk.good.snps.recode.vcf"
SNP Filtering: VCFTOOLS
VCFTOOLS can be used to generate useful QC measures, PLINK ped/map, Impute input and more....
## QC & info$: for MYQC in missing freq2 counts2 depth site-depth site-mean-depth geno-depth het
hardy singletons;dovcftools --vcf foo.gatk.good.snps.recode.vcf --$MYQC \--out foo.gatk.good.snps.QC;done## write genotypes, genotype qualities and genotype depth to separate files$: for MYFORMAT in GT GQ DP;dovcftools --vcf foo.gatk.good.snps.recode.vcf \--extract-FORMAT-info $MYFORMAT --out foo.gatk.good.snps;done## make PLINK ped and map filesvcftools --vcf foo.gatk.good.snps.recode.vcf --plink --out foo.gatk.good.snps
http://vcftools.sourceforge.net/
VCFTOOLS for SNP QC and statistics
See : http://www.broadinstitute.org/files/shared/mpg/nextgen2010/nextgen_fennell.pdf
Picard Tools : Post Alignment Summary reports
Email : [email protected] More useful links:
◦ http://www.broadinstitute.org/gsa/wiki/index.php/Prerequisites
◦ http://www.broadinstitute.org/gsa/wiki/index.php/Building_the_GATK
◦ http://www.broadinstitute.org/gsa/wiki/index.php/Downloading_the_GATK
◦ http://www.broadinstitute.org/gsa/wiki/index.php/Input_files_for_the_GATK
◦ http://www.broadinstitute.org/gsa/wiki/index.php/Preparing_the_essential_GATK_input_files:_the_reference_genome
◦ http://www.broadinstitute.org/gsa/wiki/index.php/The_DBSNP_rod
Questions?