Staphylococcus epidermidis SrrAB Regulates Bacterial Growth andBiofilm Formation Differently under Oxic and MicroaerobicConditions

Youcong Wu,a,b Yang Wu,a Tao Zhu,a,c Haiyan Han,a Huayong Liu,a Tao Xu,a Patrice Francois,d Adrien Fischer,d Li Bai,b

Friedrich Götz,e Di Qua

Key Laboratory of Medical Molecular Virology of Ministries of Education and Health, Institute of Medical Microbiology and Institutes of Biomedical Sciences, ShanghaiMedical College of Fudan University, Shanghai, Chinaa; Integrated Laboratory of Pathogenic Biology, College of Preclinical Medicine, Dali University, Dali, Chinab;Department of Medical Parasitology, Wannan Medical College, Wuhu, Chinac; Genomic Research Laboratory, Service of Infectious Diseases, University of GenevaHospitals, Geneva, Switzerlandd; Microbial Genetics, University of Tübingen, Tübingen, Germanye

SrrAB expression in Staphylococcus epidermidis strain 1457 (SE1457) was upregulated during a shift from oxic to microaerobicconditions. An srrA deletion (�srrA) mutant was constructed for studying the regulatory function of SrrAB. The deletion re-sulted in retarded growth and abolished biofilm formation both in vitro and in vivo and under both oxic and microaerobic con-ditions. Associated with the reduced biofilm formation, the �srrA mutant produced much less polysaccharide intercellular adhe-sion (PIA) and showed decreased initial adherence capacity. Microarray analysis showed that the srrA mutation affectedtranscription of 230 genes under microaerobic conditions, and 51 genes under oxic conditions. Quantitative real-time PCR con-firmed this observation and showed downregulation of genes involved in maintaining the electron transport chain by support-ing cytochrome and quinol-oxidase assembly (e.g., qoxB and ctaA) and in anaerobic metabolism (e.g., pflBA and nrdD). In the�srrA mutant, the expression of the biofilm formation-related gene icaR was upregulated under oxic conditions and downregu-lated under microaerobic conditions, whereas icaA was downregulated under both conditions. An electrophoretic mobility shiftassay further revealed that phosphorylated SrrA bound to the promoter regions of icaR, icaA, qoxB, and pflBA, as well as its ownpromoter region. These findings demonstrate that in S. epidermidis SrrAB is an autoregulator and regulates biofilm formationin an ica-dependent manner. Under oxic conditions, SrrAB modulates electron transport chain activity by positively regulatingqoxBACD transcription. Under microaerobic conditions, it regulates fermentation processes and DNA synthesis by modulatingthe expression of both the pfl operon and nrdDG.

Staphylococcus epidermidis is an opportunistic pathogen, sel-dom excreting virulence factors and less aggressive in compar-

ison to Staphylococcus aureus but capable of forming a multilay-ered biofilm on implanted medical devices, such as vascularcatheters, prosthetic joints, artificial heart valves, etc. (1, 2). Thebacteria within the biofilm are protected against killing by antibi-otics and the host immune system, which contributes to increas-ing resistance to antimicrobial drugs and persistent infections (3–5). Biofilm-related infections persist until the biomedical implantis removed, resulting in extra trauma and cost to the patients.

Biofilm formation is a complicated process in staphylococci,being regulated by multiple regulatory factors, including Agr P2/P3, SarA, SigB, and two-component signal transduction systems(TCSs) (6–10). TCSs serve as a basic stimulus-response couplingmechanism by which bacteria adapt the environmental changesand consequently play a key role in pathogenesis (11–13). Ourprevious study revealed that the TCSs LytSR, SaeRS, and ArlRS areinvolved in S. epidermidis biofilm formation (14–16), whereas therole of the SrrAB (staphylococcal respiratory response) remainedunclear.

The SrrAB shares considerable homology with ResDE of Bacil-lus subtilis (17, 18), and in S. aureus acts as a global regulator ofvirulence factors (SPA, TSST-1, RNAIII, etc.) in response to oxy-gen tension (19–22). A study by Yarwood et al. demonstrated thatsrrAB deletion (in S. aureus MN8) resulted in growth reductiononly under anaerobic conditions, and the expression of RNAIIIwas inversely related to expression of srrAB (20). Throup et al.

found that srrA deletion (in S. aureus WCUH29) led to changes inthe expression of enzymes involved in fermentative metabolism(e.g., alcohol dehydrogenase, L-lactate dehydrogenase, NADH de-hydrogenase, etc.), suggesting a role in the retarded growth of S.aureus under anaerobic conditions (19). In addition, a transposonmutation in srrA resulted in reduction of biofilm formation in S.aureus, although PIA production was increased, suggesting that inS. aureus srrAB affects biofilm formation via an ica-independentpathway (23).

Development of biofilm formation has been described as a

Received 22 August 2014 Accepted 13 November 2014

Accepted manuscript posted online 17 November 2014

Citation Wu Y, Wu Y, Zhu T, Han H, Liu H, Xu T, Francois P, Fischer A, Bai L, Götz F,Qu D. 2015. Staphylococcus epidermidis SrrAB regulates bacterial growth andbiofilm formation differently under oxic and microaerobic conditions. J Bacteriol197:459 – 476. doi:10.1128/JB.02231-14.

Editor: G. A. O’Toole

Address correspondence to Di Qu, dqu@fudan.edu.cn.

Youcong Wu, Yang Wu, and Tao Zhu contributed equally to this article.

Supplemental material for this article may be found at http://dx.doi.org/10.1128/JB.02231-14.

Copyright © 2015, American Society for Microbiology. All Rights Reserved.

doi:10.1128/JB.02231-14

The authors have paid a fee to allow immediate free access to this article.

February 2015 Volume 197 Number 3 jb.asm.org 459Journal of Bacteriology

on May 1, 2020 by guest

http://jb.asm.org/

Dow

nloaded from

two-step process involving an initial attachment, then an aggrega-tion and maturation phase (4, 8). The initial adhesion of bacterialcells to a polymer surfaces is influenced by a number of factors inS. epidermidis, including AtlE, Embp, and other staphylococcalsurface-associated proteins (6, 7, 11). In the maturation phase ofbiofilm development, the most important adhesive biofilm matrixis PIA (polysaccharide intercellular adhesion) (12). The biosyn-thesis, exportation, and modification of PIA are accomplished bythe products of icaADBC operon, and the icaA is negatively regu-lated by the divergently transcribed icaR gene (3, 4, 24). BesidesIcaR, several DNA-binding proteins regulate ica transcription, in-cluding SarA, RsbU, ArlR, etc. (10, 13, 16). However, it is possiblethat other biofilm matrix components are critical for staphylococ-cal biofilm formation, such as accumulation-associated protein(Aap), and extracellular DNA (eDNA), which mediated cell-cellaggregation and multilayered biofilm formation (25, 26). Envi-ronmental factors (such as oxygen limitation, alcohol, NaCl, etc.)may also influence staphylococcal biofilm formation (16, 27).

Much attention has been focused on the relevance of SrrAB asvirulence factors, while the mechanisms by which staphylococcalSrrAB regulates biofilm formation have not been investigated ingreat detail. Here, we come up with new aspects of the role ofSrrAB in the regulatory network of biofilm formation in S. epider-midis.

MATERIALS AND METHODSEthics statement. All procedures performed on rabbits were carried outaccording to relevant national and international guidelines (the Regula-tions for the Administration of Affairs Concerning Experimental Ani-mals, China, and the National Institutes of Health Guide for the Care andUse of Laboratory Animals) and were approved by the Institutional AnimalCare and Use Committee (IACUC) of Shanghai Medical College, FudanUniversity (IACUC animal project number 20110628-16-qu).

Bacterial strains, plasmids, and growth conditions. The bacterialstrains and plasmids used in the present study are listed in Table 1. S.epidermidis 1457 (SE1457) and S. aureus RN4220 were kindly provided byYicun Gao from Hong Kong University; S. epidermidis RP62A (accessionnumber NC_002976) (28) was purchased from the American Type Cul-ture Collection (ATCC; Manassas, VA). All staphylococci were routinelycultured in tryptone soy broth (TSB; Oxoid, Basingstoke, United King-dom) or tryptone soy agar (TSA). For the detection of biofilm formation,S. epidermidis was cultured in TSA medium supplemented with 0.5%glucose. For the transformation of recombinant plasmids, B2 medium(1% casein hydrolysate, 2.5% yeast extract, 0.5% glucose, 2.5% NaCl,0.1% K2HPO4 [pH 7.5]) was used for the recovery of staphylococcal cellsafter electroporation. Luria-Bertani medium was used for culture of Esch-erichia coli. Oxic conditions were created by incubation into a flask, inwhich the culture medium did not exceed 15% of the flask volume, and formicroaerobic conditions bacteria were incubated into a syringe fully filledwith medium. For static incubation under microaerobic conditions, poly-styrene plates inoculated with bacteria were placed in an anaerobic bagwith Anaerocult C Mini (Merck KGaA, Darmstadt, Germany). Whenappropriate, antibiotics were used at the following concentrations: eryth-romycin (5 �g/ml), spectinomycin (100 �g/ml), chloramphenicol (10�g/ml), ampicillin (100 �g/ml), and kanamycin (50 �g/ml).

Extraction of bacterial DNA. Genomic DNA of S. epidermidis wasextracted as described by Flamm et al. with minor modifications (29). Inbrief, staphylococcus cells were treated with lysostaphin (20 �g/ml;Sigma, St. Louis, MO) and proteinase K (100 �g/ml; Merck KGaA, Darm-stadt, Germany) and extracted with phenol-chloroform, and the nucleicacids were precipitated with ethanol.

Plasmid DNA from E. coli was extracted with a plasmid purification kit(Qiagen, Hilden, Germany) according to manufacturer’s instructions. Af-ter harvesting and resuspension, bacterial cells were lysed under alkalineconditions. The lysate was neutralized by the addition of potassium ace-tate. The cleared lysate was loaded onto a Qiagen-tip by gravity flow, andthen the eluted plasmid DNA was concentrated by isopropanol precipita-tion. Plasmid DNA from S. epidermidis or S. aureus 4220 was extracted

TABLE 1 Bacterial strains and plasmids used in this study

Plasmid or strain Descriptiona Source or reference(s)

PlasmidspET28a E. coli expression plasmid; Kmr NovagenpET28a-srrA pET28a harboring the srrA gene, used for SrrA expression This studypMAD Shuttle vector, temperature sensitive; Ampr Emr 30pMAD-�srrA Recombinant plasmid This studypCN51 Shuttle vector; Ampr Emr 32pCN51-srrAB The srrAB gene was cloned into pCN51 This studypRAB11 Shuttle vector; Ampr Cmr 31pRAB11-srrA The srrA gene was cloned into pRAB11 This studypRAB11-srrB The srrB gene was cloned into pRAB11 This study

Bacterial strainsS. epidermidis

RP62A Biofilm positive, genome sequenced, and published 26, 281457 Biofilm positive, clinical isolate, wild-type strain 7, 16

�srrA mutant srrA deletion, Spcr, derivative of S. epidermidis 1457 This study�srrA(pCN51-srrAB) mutant �srrA strain complemented with plasmid pCN51-srrAB This study�srrA(pRAB11-srrA) mutant �srrA strain complemented with plasmid pRAB11-srrA This study�srrA(pRAB11-srrB) mutant �srrA strain complemented with plasmid pRAB11-srrB This study�srrA(pCN51) mutant �srrA mutation introduced with plasmid pCN51 This study

S. aureus 4220 Restriction negative, modification positive 14, 32E. coli

DH5� supE44 �lacU169 (�80dlacZ�M15) hsdR17 recA1 endA1 gyrA96 thi-1 relA1 InvitrogenBL21(DE3) F� ompT hsdSB(rB

� mB�) gal dcm (DE3) Invitrogen

a Kmr, kanamycin resistance; Ampr, ampicillin resistance; Cmr, chloramphenicol resistance; Emr, erythromycin resistance; Spcr, spectinomycin resistance.

Wu et al.

460 jb.asm.org February 2015 Volume 197 Number 3Journal of Bacteriology

on May 1, 2020 by guest

http://jb.asm.org/

Dow

nloaded from

using the same method except for an additional step of lysostaphin treat-ment.

Construction of S. epidermidis srrA deletion mutant and comple-mentary strains. We first characterized the S. epidermidis srrAB genes inSE1457 by PCR and sequencing and then compared it to that in thegenome of the ATCC 35984 strain (GenBank accession numberNC_002976). The srrA gene was 726 bp in length, and the srrB gene was1,770 bp in length. The srrA deletion mutant was constructed by allelicreplacement using the temperature-sensitive plasmid pMAD as describedpreviously (30). In brief, the spectinomycin resistance cassette (spc, �1kb) digested with SmaI and BamHI endonucleases (MBI Fermentas, Vil-nius, Lithuania) was inserted into the pMAD plasmid, designated pMAD-spc (15). PCR products �0.9 kb upstream and downstream flanking theregion of srrA were cloned into pMAD-spc. The recombinant plasmid wassuccessively transferred into E. coli DH5�, S. aureus RN4220, and theninto SE1457, followed by the process of allelic replacement as performedpreviously (15, 30). The spectinomycin-resistant and erythromycin-sen-sitive white colonies were screened as an srrA deletion (�srrA) mutant.The 662-bp fragment (bp �4 to �665 relative to the transcription startsite) of srrA, including the REC domain and the major part of Trans_reg-Cdomain (see Fig. S1 in the supplemental material) was replaced by spec-tinomycin-resistance cassette (spc, 1,029 bp). The �srrA mutant wasverified by PCR and DNA sequencing (see Fig. S2A in the supplementalmaterial). In the �srrA mutant, srrA expression was below the detectionlevel, and srrB expression was downregulated to 14% of that in the wild-type strain, as detected by quantitative reverse transcription-PCR (qRT-PCR) (see Fig. S2B in the supplemental material).

For complementation of the �srrA mutant, we constructed three re-combinant expression plasmids containing srrA, srrB, or srrAB genes, re-spectively. The srrA, srrB, and srrAB genes with the associated Shine-Dalgarno sequence in SE1457 were separately amplified by PCR with theprimers pRAB11-srrA-F/pRAB11-srrA-R, pRAB11-srrB-F/pRAB11-srrB-R, and pCN51-srrAB-F/pCN51-srrAB-R, respectively (the se-quences are listed in Table 2). Plasmid pRAB11-srrA was constructedfrom pRAB11 following insertion of a fragment of srrA digested with KpnIand EcoRI, plasmid pRAB11-srrB was constructed from pRAB11 follow-ing insertion of a fragment of srrB digested with KpnI and BglII (31), andplasmid pCN51-srrAB was constructed from pCN51 following insertionof a fragment of srrAB digested with BamHI and KpnI (32). The comple-mentary plasmids were transferred into S. aureus RN4220 and then intothe �srrA mutant by electroporation, yielding three complementarystrains, referred to here as the �srrA(pRAB11-srrA), �srrA(pRAB11-srrB), or �srrA(pCN51-srrAB) strain, respectively. The vector plasmids,pRAB11 or pCN51, were introduced as blank controls into the �srrAmutant and referred to here as the �srrA(pRAB11) or �srrA(pCN51)strain.

Growth curves of SE1457 isogenic srrA mutants. The growth curvesof S. epidermidis strains were determined by measuring the optical density(OD600) (15). For oxic growth, overnight bacterial cultures were inocu-lated into flasks, incubated at 37°C with shaking at 220 rpm, and theOD600 values of the cultures were measured at 60-min intervals for 12 h.For microaerobic growth, the cultures were transferred into screw-top50-ml syringes which were completely filled with medium (with no airbubbles), followed by incubation under vigorous agitation (220 rpm) at37°C. Then, 200 �l of bacteria in the syringe was removed by syringe everyhour until 18 h, and the OD600 values were measured.

Semiquantitative detection of biofilm formation of SE1457 isogenicsrrA mutants in vitro. The biofilm-forming ability of S. epidermidisstrains in vitro was determined by semiquantitative plate assay (14).In brief, overnight cultures of SE1457, �srrA, �srrA(pCN51-srrAB),�srrA(pRAB11-srrA), and �srrA(pCN51) strains were diluted with TSBmedium containing 0.5% glucose, inoculated into a polystyrene 96-wellmicroplate (Corning Inc., NY), and incubated statically at 37°C for 6, 12,24, or 48 h under oxic conditions or for 12, 24, 48, or 72 h under mi-croaerobic conditions (Anaerocult C Mini). After incubation, the plates

were washed with phosphate-buffered saline (PBS), fixed with methanol,and stained with 2% crystal violet. The OD570 was measured using a spec-trophotometer (DTX880; Beckman Coulter, Fullerton, CA). Three inde-pendent experiments were carried out.

Detection of biofilm formation of SE1457 isogenic srrA mutants invivo. The biofilm-forming ability of S. epidermidis strains in vivo wasdetermined by using a New Zealand rabbit subcutaneous foreign bodyinfection model as described by He et al. with minor modifications (33).Disks were cut from polyethylene 96-well plates (8-mm diameter, 1-mmthickness, with a 2-mm projecting rim or chimb), sterilized with 75%ethanol, washed with sterile distilled water, and then disinfected by usingUV light. The rabbit (2.0 to 2.5 kg, female) was anesthetized with pento-barbital sodium (5 mg/kg, administered intravenously), and four inci-sions (10 mm) were made on the back bilaterally along the spine afterremoval of the fur. The subcutis was then carefully dissected to form a2-cm-by-3-cm cavity. After three disks were implanted into each cavity, 1ml of bacteria (�108 CFU) suspended in fresh TSB was injected into thecavity. The same volume of TSB was injected as a control. To minimize theeffect of between-animal variation, SE1457, �srrA, and �srrA(pCN51-srrAB) strains were separately injected into cavities of the same rabbit.

At 72 h after bacterial inoculation, the rabbits were euthanized, andthe implants were taken out, washed with PBS, and observed by usingscanning electron microscopy (SEM). The biofilms were scraped from thedisks, and the viable bacteria were determined by CFU counting as previ-ously described (16, 33). Five independent experiments were carried out.

Initial adherence capacity of SE1457 isogenic srrA mutants. Primaryattachment of SE1457 isogenic srrA mutant strains to a polystyrene sur-face was assessed as described previously (7, 15, 34), with a modification.Briefly, overnight cultures of the SE1457, �srrA, �srrA(pCN51-srrAB),and �srrA(pCN51) strains were inoculated into TSB and cultured at 37°C.After growth to an OD600 of 0.6 to 0.8, the bacteria were adjusted to anOD600 of 0.1 with PBS and inoculated into six-well plates (2 ml/well;Nunc, Roskilde, Denmark). After incubation at 37°C for 2 h, the plateswere washed gently with PBS and observed under microcopy using a40-fold objective lens. The numbers of attached cells in photomicro-graphs (at least five microscopic fields per sample) were counted by usingImageJ software. In addition, the adhesion capacity of SE1457 isogenicsrrA mutant strains was determined by crystal violet staining. Staphylo-coccal strains grown at 37°C to an OD600 of 1.0 were pipetted into a96-well microplate (200 �l/well) and incubated at 37°C for 2 h, followedby washing with PBS, and the subsequent procedures were the same asthose used for the semiquantitative biofilm formation assay measuringthe OD570 using a spectrophotometer. Three independent experimentswere carried out.

Assay of PIA in biofilms of SE1457 isogenic srrA mutants. Polysac-charide intercellular adhesion (PIA) in the biofilms of SE1457 isogenicsrrA mutant strains was semiquantified by dot blot assay with wheat germagglutinin-horseradish peroxidase (WGA-HRP) conjugate as describedby Wu et al. (16) and Gerke et al. (35). In brief, overnight cultures of S.epidermidis strains were inoculated into a six-well plates (Nunc) and in-cubated at 37°C for 24 h under both oxic and microaerobic conditions(Anaerocult C Mini). Biofilms were scraped off from the bottom of thewells, resuspended in 0.5 M EDTA (3 �l per 1 mg [wet weight]), andcentrifuged (13,000 g, 5 min) after heating at 100°C for 5 min. Thesupernatant was treated with proteinase K (20 mg/ml) at 37°C for 3 h andinactivated at 100°C for 5 min. Serial dilutions of the PIA extract weretransferred to a nitrocellulose membrane (Millipore, Billerica, MA) usinga 96-well dot blot device (Biometra GmbH, Gottingen, Germany). Theair-dried membrane was blocked with 5% (wt/vol) skim milk and subse-quently incubated with WGA (3.2 �g/ml) conjugated for 1 h with HRP(Lectinotest Laboratory, Lviv, Ukraine). The HRP activity was visualizedby chromogenic detection using 4-chloride-1-naphthol (Sigma) as thesubstrate. The quantitation (titer) of the PIA was represented as the high-est dilution of the supernatant detectable.

SrrAB Regulates Growth and Biofilm Formation

February 2015 Volume 197 Number 3 jb.asm.org 461Journal of Bacteriology

on May 1, 2020 by guest

http://jb.asm.org/

Dow

nloaded from

Detection of Aap. Accumulation-associated protein (Aap) expressionof SE1457 isogenic srrA mutant strains was determined by Western blot-ting with an Aap-specific monoclonal antibody (MAb18B6) made in ourlaboratory (26). In brief, 24-h biofilm and 12-h planktonic cells of S.epidermidis strains were collected and adjusted to an identical OD600 after

being washed with PBS. The bacteria were treated with lysostaphin(Sigma) and centrifuged (20,000 g) at 4°C for 30 min. The supernatantswere separated using SDS-PAGE (7%) and blotted onto polyvinylidenefluoride membrane (0.45 �m; Millipore) by electrotransfer. The mem-brane was incubated with MAb18B6 (10 ng/ml) and then with goat anti-

TABLE 2 Primers used in this studya

Method and primer Sequence (5=–3=)b Location (bp)c

Restrictionenzyme

Productsize (bp)

Construction andidentification of srrAdeletion mutant

srrA-US-F GAAGATCTGGAGAGTCAAATGAGTAAAGAAC 1103298–1103320 BglII 884srrA-US-R TCCCCCGGGCATACTTTCTACTACCTCCTACA 1102437–1102459 SmaI 884srrA-DS-F CGGAATTCAACTGTGTGGGGTGTCGG 1101757–1101774 EcoRI 907srrA-DS-R CGGGATCCTCATCAGCCATCTTGTTCG 1100868–1100886 BamHI 907spc-F TGGTTCAGCAGTAAATGGTGG 1,029spc-R CATCTGTGGTATGGCGGGTA 1,029

srrA, srrB, and srrABcomplementation

pCN51-srrAB-F CGCGGATCCCCTTTGAGTCACTCAATAAC 1102500–1102519 BamHI 2,572pCN51-srrAB-R CGGGGTACCTGATACTTTTCAGTTTCTAA 1099948–1099967 KpnI 2,572pRAB11-srrA-F GGGGTACCCCTTTGAGTCACTCAATAAC 1102500–1102519 KpnI 806pRAB11-srrA-R CGGAATTCCTATTTAGTCGGTTCATCAC 1101714–1101733 EcoRI 806pRAB11-srrB-F CGGGGTACCAATGATACAAACTGTGTGG 1101765–1101783 KpnI 1,836pRAB11-srrB-R GGAAGATCTTGATACTTTTCAGTTTCTAA 1099948–1099967 BglII 1,836

eDNA quantificationusing qPCR

gyrB-F GCTGGACAGATACAAGTT 2611681–2611698 137gyrB-R GCTAATGCCTCGTCAATA 2611562–2611579 137serp0306-F ATGCCACATCCACGAAAGA 309331–309349 179serp0306-R TGTAACTGACAATGCCCAATC 309489–309509 179lysA-F TGACAATGGGAGGTACAAGC 988594–988613 76lysA-R TGGTCTTCATCGTAAACAATCG 988648–988669 76leuA-F GTGAACGGTATTGGTGAAAGAG 1708472–1708493 78leuA-R GTGGTCCTTCCTTACATATAAAGC 1708526–1708549 78

SrrA expressionpET-28a-srrA-F CCGGAATTCATGACTAACGAAATTTTAATCGTTG 1102415–1102439 EcoRI 723pET-28a-srrA-R CCGCTCGAGTTTAGTCGGTTCATCACTAGGTT 1101717–1101739 XhoI 723

Amplification of promoterfragments

Psrr-F ACTTTCTACTACCTCCTA 1102440–1102457 132Psrr-R CACCAAAAAGATGTAATT 1102554–1102571 132PicaA-F GTATAACAACATTCTATT 2334137–2334154 85PicaA-R ATTTTTTCACCTACCTTT 2334204–2334221 85PicaR-F ATTCTAAAATCTCCCCCT 2334055–2334072 82PicaR-R TGAAACAGTAATATTTGT 2334119–2334136 82PqoxB-F TTTTTGACCTCCTAATAC 641914–641931 145PqoxB-R AATCTTACAAACCCCGTC 642041–642058 145PpflB-F ACTCTCCGCCTCCATTTC 2414402–2414419 151PpflB-R TTTATTCACAAACTGTTA 2414535–2414552 151PrsbU-F GAAATGCGCCTCCTTACT 1725459–1725476 147PrsbU-R GCTTTAGGTTATCCATTC 1725588–1725605 147PsarA-F GACACTTTCGTATTTTCATAAGA 279934–279956 160PsarA-R ATTAATGAAACCTCCCTATTTA 279797–279818 160PrpsJ-F AAGATTCTCGTGAACAATTC 1862226–1862245 119PrpsJ-R GATGTCTACACCTGATGG 1862127–1862144 119

a The primers were designed using Primer Premier 5 software according to the genomic sequence of S. epidermidis RP62A (GenBank accession number NC_002976).b Restriction sites are indicated by underlining.c The locations of primers are indicated according to the S. epidermidis RP62A genome.

Wu et al.

462 jb.asm.org February 2015 Volume 197 Number 3Journal of Bacteriology

on May 1, 2020 by guest

http://jb.asm.org/

Dow

nloaded from

mouse IgG conjugated with HRP (Santa Cruz, Santa Cruz, CA) and thenvisualized by using an ECL Western blotting system (Thermo Fisher Sci-entific, Waltham, MA).

Quantification of extracellular DNA. The isolation of extracellularDNA (eDNA) from biofilms was performed as described previously (15,26). In brief, the 24-h biofilms cultured in a 96-well polystyrene plate werechilled at 4°C for 1 h, and EDTA was added at a final concentration of 2.5mM. After measurement of the OD600 of unwashed biofilm (biofilm bio-mass), eDNA extraction solution (50 mM Tris-HCl, 10 mM ETDA, 500mM NaCl [pH 8.0]) was added to the wells. The biofilms were scrapedoff and centrifuged (13,000 g) for 5 min at 4°C. The eDNA in the

supernatant was extracted with phenol-chloroform-isoamyl alcohol(25:24:1), precipitated with 100% alcohol, and resuspended in Tris-EDTA buffer.

The amount of eDNA was quantified by qPCR with SYBR PremixExTaq (TaKaRa Bio, Inc., Shiga, Japan) using the gyrB (gyrase B), serp0306(ferrichrome transport ATP-binding protein A), leuA (2-isopropylmalatesynthase), and lysA (diaminopimelate decarboxylase A) primers listed inTable 2. Each gene in the qPCR was assayed in triplicate for three inde-pendent experiments. The relative quantitation of eDNA in each sam-ple was calculated as total the eDNA (in ng) divided by the biofilmbiomass (OD600).

TABLE 3 Primers used for transcriptional analysis by qRT-PCRa

Primer Sequence (5=–3=) Location (bp)b Product size (bp)

sarA-F GTAATGAACACGATGAAAGAACT 279526–279548 103sarA-R GCTTCTGTGATACGGTTGT 279446–279464 103rsbU-F GCTTATGGACATTCACAA 1724925–1724942 121rsbU-R GATTCATCTCTTCATACAGT 1724822–1724841 121icaA-F ATCAAGCGAAGTCAATCTC 2334781–2334799 127icaA-R CAGCAATATCCTCAGTAATCA 2334887–2334907 127icaR-F GCACATCGCTTTGGATAA 2333646–2333663 146icaR-R TTAACAGTGAATATACTTGGTCTT 2333518–2333541 146atlE-F CAATTACAGGAGACACAAT 631207–631225 149atlE-R TCATTATCATTAGAAGCAGTT 631077–631097 149aap-F CGAGGAATTACAATCATCACA 2460758–2460778 166aap-R CGTAGTTGGCGGTATATCTA 2460613–2460632 166srrA-F TCACCTAGAGAAGTAGTATT 1102108–1102127 130srrA-R GAGCGTCATTATCAATCA 1101998–1102015 130srrB-F TCCATAGTAGACGGTATAGT 1100559–1100578 136srrB-R ATAATCCTTCAGCATCCATA 1100443–1100462 136ctaA-F CTACGATTATTATGACCTT 703606–703624 146ctaA-R ACTCAGTTCTATAATTGTT 703479–703497 146qoxB-F TCTATGGATACAATGACAAGTT 641416–641437 126qoxB-R TGAGTTACGACCTCTGAA 641312–641329 126serp0257-F AACCTGGAGAAGCATTAG 265234–265251 101serp0257-R TAGCGTTACACCTGTTAC 265317–265334 101serp2257-F AGGTAATGCTGGCTTATCT 2286255–2286273 110serp2257-R CGAATGCGTTGACTGTAA 2286164–2286181 110pflA-F ACACTTACACTCCGTTGA 2412105–2412122 140pflA-R CTTCTCTTGATGGTTCGTTA 2411983–2412002 140serp2381-F AGAAGGTAATCAAGTTGT 2428977–2428994 136serp2381-R CGTATTATATTGTTGTAGCA 2428859–2428878 136lacA-F GGAAGACAACGATTATGAT 1841284–1841302 135lacA-R GCACCATAGGCATCTATA 1841168–1841185 135ureF-F TTAGGTGTAGATGTGGAAT 1898186–1898204 148ureF-R CGTGTCTTCTCAATATGG 1898317–1898334 148rbsK-F GCAGGTATTCATACACAAT 2125633–2125651 150rbsK-R CACACTCATCTCAACATC 2125502–2125519 150betB-F TATCCATTACTTCAAGCATCT 2209851–2209871 128betB-R CCAACTTCCTCCATCAAT 2209744–2209761 128cysH-F TTGGTGCTGAGAGTATGG 2227130–2227147 148cysH-R TTAATGCGTAATTGCGGATAT 2227000–2227020 148rplB-F AAGATGGAATCATTGCTAA 1860237–1860255 130rplB-R TGACCTACTTGTAATCCT 1860126–1860143 130rpsJ-F AAGATTCTCGTGAACAATTC 1862226–1862245 119rpsJ-R GATGTCTACACCTGATGG 1862127–1862144 119opp1B-F TGATTCCATTATTGATTGTAGTGA 2419641–2419664 111opp1B-R GCGTTATATTAGGCGTTCC 2419554–2419572 111rpoA-F TGAAGTTAGTGAAGATGCTA 1849776–1849795 113rpoA-R CTGGTAATGAAGATAGTAGGA 1849683–1849703 113nrdD-F GATAGTAATACATTCTCAACAA 2217415–2217436 145nrdD-R ATGGATGGTAATCTAAGTC 2217292–2217310 145a Primers used in qRT-PCR were designed with Beacon Designer 7 software according to the genomic sequence of S. epidermidis RP62A (GenBank accession number NC_002976).b The locations of primers are indicated according to the S. epidermidis RP62A genome.

SrrAB Regulates Growth and Biofilm Formation

February 2015 Volume 197 Number 3 jb.asm.org 463Journal of Bacteriology

on May 1, 2020 by guest

http://jb.asm.org/

Dow

nloaded from

Observation of biofilms with CLSM and SEM. For observation of bac-terial biofilms under confocal laser scanning microscopy (CLSM; Leica TCSSP5, Mannheim, Germany), overnight cultures of SE1457, �srrA, and�srrA(pCN51-srrAB) strains were inoculated into Fluorodishes (2 ml/dish;FD35-100; WPI, Sarasota, FL) and incubated statically at 37°C for 24 h (7, 26).

The biofilms on the dishes were then rinsed gently with 0.85% NaCland observed using CLSM with SYTO9 and propidium iodide (PI)staining (Live/Dead kit; Invitrogen, Carlsbad, CA). The z-stack com-posite confocal photomicrographs of viable cells (green) and dead cells(red) were generated using Leica LAS AF software. The fluorescence of

FIG 1 Effect of srrA deletion on the S. epidermidis growth. (A) Transcriptional levels of srrA and srrB in the S. epidermidis strain 1457 under microaerobic stress.After culture for 4 h under oxic conditions, SE1457 was transferred into a 50-ml syringe (sealed entirely with no bubbles inside) for 0.5 or 1 h of incubation undermicroaerobic conditions (�O2). Bacterial cells were collected, and the total RNA was extracted. The relative expression levels of srrA and srrB were analyzed byqRT-PCR in comparison to the transcription level of gyrB (housekeeping gene). The two-component regulatory system (TCS) arlRS was used as a control. Dataare represented as means the standard deviations (SD) from three independent experiments. (B) The srrA deletion mutant displayed a defect in growth of S.epidermidis. SE1457 and its isogenic srrA mutant strains were streaked on TSA plates and incubated at 37°C for 24 h under oxic conditions (�O2) or undermicroaerobic conditions (�O2). The results represent one of three independent experiments. (C) Growth curves of SE1457 isogenic srrA mutants. Under oxicconditions (�O2), S. epidermidis strains were cultured in a flask (1:8 culture-to-flask volume ratio) at 37°C with shaking. For microaerobic conditions (�O2),cultures were inoculated into 50-ml syringes, all air bubbles were removed, and the syringes were incubated at 37°C with shaking. The cultures were measuredhourly at OD600. The experiments were repeated at least three times, and a representative set of growth curves is shown.

Wu et al.

464 jb.asm.org February 2015 Volume 197 Number 3Journal of Bacteriology

on May 1, 2020 by guest

http://jb.asm.org/

Dow

nloaded from

each stack was quantified using ImageJ software. At least three inde-pendent experiments were carried out.

For observation of bacterial biofilms under SEM (JSM-6700F; JEOL,Tokyo, Japan), staphylococcal SE1457, �srrA, and �srrA(pCN51-srrAB)strains were cultured in a six-well plate (35-mm diameter) with threesterile disks (8-mm diameter, 1-mm thickness, with a 2-mm chimb) ineach well. After 24 h of incubation at 37°C, the disks were rinsed with PBS,fixed with 2.5% glutaraldehyde in PBS, vacuum dried for 72 h, sputteredwith platinum, and then observed under a field emission source instru-ment.

RNA isolation and microarray analysis. Total RNA was isolated byusing an RNeasy minikit (Qiagen) according to the manufacturer’s in-structions. In brief, bacterial cultures in a flask for oxic conditions or in50-ml syringes for microaerobic condition were harvested after 6 h ofincubation at 37°C with shaking. The cell pellets were washed with ice-cold 0.85% NaCl and then homogenized using 0.1-mm zirconia-silicabeads in a Mini-BeadBeater (Biospec, Bartlesville, OK) at a speed of 4,800

rpm for 40 s as a cycle for five times with 1-min intervals on ice in eachcycle. The RNA eluted from the silica-based filter was extracted with phe-nol-chloroform-isoamyl alcohol and precipitated with ethanol. Thequantity and quality of the total RNA were assessed by using a NanoDropND-1000 spectrophotometer (NanoDrop Technologies, Wilmington,DE) and gel electrophoresis.

Microarray analysis was performed by in situ synthesis of 14,527, 60-mer-long oligonucleotide probes (Agilent, Palo Alto, CA), as previouslydescribed by Lou et al. (15) and Charbonnier et al. (36), which cover morethan 95% of the open reading frames (ORFs) annotated in S. epidermidisstrains ATCC 12228 (accession number NC_004461) and ATCC 35984(accession number NC_002976). Total RNAs (10 �g) from SE1457 werelabeled by cyanine-3 dCTP (green Cy3; Perkin-Elmer Life Sciences, Bos-ton, MA) using the SuperScript II (Invitrogen, Basel, Switzerland). Puri-fied genomic DNA from the reference strains was labeled with cyanine-5dCTP (red Cy5) and used for microarray normalization. Mixtures of Cy5-labeled DNA and Cy3-labeled cDNA were hybridized and scanned in a

FIG 2 Effect of srrA deletion on the in vitro biofilm formation of S. epidermidis. Overnight cultures of the S. epidermidis strains were 1:200 diluted with TSBmedium and inoculated into 96-well polystyrene plates in triplicate. (A) After static incubation for 6, 12, 24, and 48 h under oxic conditions (�O2) or for 12, 24,48, and 72 h under microaerobic conditions (�O2), biofilms were stained with crystal violet and observed. (B and C) Biofilm formation under oxic andmicroaerobic conditions was detected at OD570. The experiments were repeated three times, and the data represent means the SD. **, P � 0.01 (�srrA mutantversus SE1457).

SrrAB Regulates Growth and Biofilm Formation

February 2015 Volume 197 Number 3 jb.asm.org 465Journal of Bacteriology

on May 1, 2020 by guest

http://jb.asm.org/

Dow

nloaded from

dedicated oven as previously described (37). The fluorescence inten-sities were quantified using Agilent Feature Extraction software (ver-sion 8). The data were normalized to baseline using red channel data asa control. A false discovery rate value of 5% (P value cutoff, 0.05) wasused for variance analysis of three biological replicates, and an arbi-trary threshold of 3.0-fold was used for defining significant differencesin expression ratios.

qRT-PCR. The RNA extracted from bacterial strains was treated withDNase I and reverse transcribed into cDNA using iScript reverse trans-criptase (Bio-Rad, Hercules, CA) by incubation for 5 min at 25°C, fol-lowed by 30 min at 42°C and 5 min at 85°C. Next, qPCRs were performedusing SYBR green PCR reagents (Premix EX Taq; TaKaRa Biotechnology,Dalian, China) in the MasterCycler Realplex system (Eppendorf AG,Hamburg, Germany), with the amplification conditions as 95°C for 30 s,followed by 40 cycles of 95°C for 5 s and 60°C for 34 s, followed in turn bymelting-curve analysis. A housekeeping gene gyrB (DNA gyrase subunitB) was used to normalize the transcript levels of genes in the qPCRs. AllqRT-PCRs were carried out in triplicate with at least three independent

RNA samples. The sequences of the primers were designed using Beacondesigner software (Premier Biosoft International, Ltd., Palo Alto, CA) andare listed in Table 3.

Expression and purification of recombinant SrrA. To determine theDNA-binding properties of SrrA, a recombinant expression plasmid(pET28a-srrA) was constructed by inserting the srrA fragment amplifiedfrom SE1457 with the primers pET-28a-srrA-F/pET-28a-srrA-R (listed inTable 2) into vector pET28a(�) and transferred into E. coli BL21(DE3).When bacteria were grown to an OD600 of 0.6 at 37°C, 0.8 mM IPTG(isopropyl-�-D-thiogalactopyranoside) was added for overnight incuba-tion at 22°C. The cells resuspended in lysis buffer (50 mM NaH2PO4 [pH8.0], 300 mM NaCl, 0.1 mM EDTA, 1 mM phenylmethylsulfonyl fluo-ride) were sonicated and centrifuged at 15,000 g for 30 min, and thesupernatants were loaded onto a nickel-nitrilotriacetic acid column (Qia-gen). His-tagged SrrA was eluted using a linear gradient of 20 to 300 mMimidazole and enriched by ultrafiltration, and the protein concentrationwas determined by using a Bradford protein quantification kit (Tiangen,Beijing, China).

FIG 3 Observation of S. epidermidis biofilm under CLSM. The 24-h biofilms cultured in vitro were visualized using Live/Dead viability staining under CLSM. Thethree-dimension structural images (zoom 1, 63 magnification) were reconstructed, and the thickness of biofilm was measured using Imaris software. The toplayer, middle layer, and bottom layer within a biofilm are shown. The viable and dead cells were stained in green (SYTO9) and red (PI), respectively. The amountof fluorescence from the bottom to the top layer of the biofilm was determined using ImageJ software (zoom 3, 63 magnification). The value of the PI/totalflorescence indicates the proportion of dead cells within the biofilm. The figures represent one of three independent experiments.

Wu et al.

466 jb.asm.org February 2015 Volume 197 Number 3Journal of Bacteriology

on May 1, 2020 by guest

http://jb.asm.org/

Dow

nloaded from

EMSA. To determine the interaction between SrrA and the promoterregions of putative target genes, electrophoresis mobility shift assay (EMSA)was carried out using a digoxigenin gel shift kit (Roche Diagnostics GmbH,Mannheim, Germany) according to the manufacturer’s instructions. In brief,the predicted promoter regions of icaA, icaR (�80-bp fragments), srrAB,qoxB, pflB, sarA, and rsbU (�140-bp fragments) were amplified by PCR withthe primers listed in Table 2. The DNA fragments were purified by using a gelextraction kit (Qiagen) and labeled with digoxigenin using terminal trans-ferase. Purified His-tagged SrrA was phosphorylated (SrrA-P) by incubationwith 50 mM acetyl phosphate (Sigma) for 1 h at room temperature. Each gelshift assay included the probe labeled with digoxigenin plus increasing con-

centrations of SrrA-P (ranging from 1.2 to 0.3 �M in 2-fold dilutions); a125-fold molar excess of unlabeled probe as a competitor was also added tothe labeled probe plus 1.2 �M SrrA-P with a labeled probe as a control. The119-bp coding sequence of S. epidermidis rpsJ was designated a negativecontrol for SrrA-DNA binding. All samples were incubated at 25°C for 20min, separated by electrophoresis on 6% nondenaturing polyacrylamidegel, and blotted onto a positively charged nylon membrane (Millipore).The blots were incubated with alkaline phosphatase conjugated anti-digoxigenin antibody, followed by chloro-5-substituted adamantyl-1,2-dioxetane phosphate (CSPD) solution for chemiluminescent detection,and then exposed to X-ray film.

FIG 4 Effect of srrA deletion on biofilm formation by S. epidermidis in vivo. The New Zealand rabbit model of local S. epidermidis biofilm infection was used.Subcutaneous incisions were made on the backs of the animal. Sterile polyethylene disks were implanted, and then overnight bacterial cultures (108 CFU) wereresuspended in 1 ml of TSB and inoculated into the cavities. (A) After 72 h, the disks were removed, fixed with 2.5% glutaraldehyde, and observed using SEM.As a control, 24-h biofilms cultured in vitro were observed under SEM. (B) The biofilms were scraped from the disks, and the viable bacteria were determined byCFU counting. The data are from one of three independent experiments. **, P � 0.01 (�srrA mutant versus SE1457).

SrrAB Regulates Growth and Biofilm Formation

February 2015 Volume 197 Number 3 jb.asm.org 467Journal of Bacteriology

on May 1, 2020 by guest

http://jb.asm.org/

Dow

nloaded from

Statistical analysis. Data from the biofilm assay, the initial attachmentassay, and the CFU enumeration assay were analyzed by the GraphPadPrism program (San Diego, CA) using the Student t test. Differences witha P value of �0.05 were considered statistically significant.

Microarray data accession number. The complete microarray dataset is posted in the Gene Expression Omnibus database (http://www.ncbi.nlm.nih.gov/geo/) under accession numbers GPL13532 for the platformdesign and GSE47101 for the original data set.

RESULTSThe �srrA mutant displayed growth defects under oxic and mi-croaerobic conditions. To assess whether srrAB expression re-sponds to oxygen stress, the transcription of srrAB in SE1457 wasanalyzed by qRT-PCR during the shift from oxic to microaerobicconditions. Indeed, both srrA and srrB expressions were upregu-lated (a 2- or 3-fold increase) under microaerobic conditions,whereas the expression of arlRS monitored as a control showed noobvious change (Fig. 1A), indicating that SrrAB displayed func-tion differently under oxic and microaerobic conditions.

The S. aureus (WCUH29) srrA mutant displayed a markedreduction in growth under anaerobic conditions, whereas itshowed no differences in colony size or growth rate under oxicconditions compared to the parent strain (19). In contrast, wefound here that under oxic conditions the SE1457 �srrA strainformed smaller colonies than parent strain and that, under mi-croaerobic conditions, no �srrA colonies were evident on TSAplates even after 24 h of incubation (Fig. 1B).

In liquid medium under oxic conditions, SE1457 entered earlylog phase (OD600 of 0.65) by 4 h after inoculation, but the �srrAmutant took about 6 h to reach a similar growth level (OD600

of 0.74). The growth of the srrAB complementation strain�srrA(pCN51-srrAB) was restored to the a wild-type level,whereas the growth of the srrA complementation strain�srrA(pRAB11-srrA) was partially recovered. Under microaero-bic conditions, to reach an OD600 of 1.0 the �srrA mutant needed15 h of incubation, whereas the parent strain needed only 7 h. The�srrA(pCN51-srrAB) and �srrA(pRAB11-srrA) complementa-tion strains required 6 or 9 h of incubation, respectively, to reachan OD600 of 1.0 (Fig. 1C). Under either oxic or microaerobic con-ditions, the transformation of pCN51 or pRAB11-srrB had noeffect on the growth of the �srrA mutant.

Deletion of srrA impaired biofilm development in vitro. The

impact of the srrA deletion on the biofilm formation of S. epider-midis in vitro was investigated by a semiquantitative microplateassay. Bacterial biofilm formation was monitored at 6, 12, 24, and48 h under oxic conditions or at 12, 24, 48, and 72 h under mi-croaerobic conditions.

Under oxic conditions, the �srrA mutant also produced lessbiofilm than did the parent strain at these time points, whereas thebiofilm of the �srrA mutant (OD570 0.61 0.03) was dramat-ically decreased compared to the wild-type strain (OD570 2.65 0.08) (Fig. 2A and B). Under microaerobic conditions, nobiofilm formation was observed in the �srrA mutant at 12 h or 24h. After 48 h of incubation, biofilm produced by the �srrA mutanthad an OD570 of 0.25 0.02, which is significantly less than that ofits wild-type counterpart (OD570 0.93 0.04) (Fig. 2A and C).

Under both oxic and microaerobic conditions, the biofilm-form-ing ability was restored in the �srrA(pCN51-srrAB) complementa-tion strain (OD570 1.93 0.14 and 0.95 0.11, respectively) andpartially restored in the �srrA(pRAB11-srrA) strain (OD570 1.13 0.03 and 0.67 0.02, respectively). Transformation of the vectoralone had no effect on �srrA strain biofilm formation.

When biofilms of the SE1457, �srrA, and �srrA(pCN51-srrAB) strains that had been cultured under oxic conditions wereobserved under CLSM with Live/Dead staining, the thickness ofthe �srrA mutant biofilm was much less (5.97 0.34 �m) thanthat of the parent strain (22.2 2.06 �m) (P � 0.01), and thethickness was restored by complementation with pCN51-srrAB(10.16 1.51 �m). There were more dead cells in the �srrA bio-film than in the wild-type counterpart (PI/total 0.23 versus0.072, P � 0.01), whereas fewer dead cells were observed in�srrA(pCN51-srrAB) biofilm (PI/total 0.017) (Fig. 3).

Deletion of srrA abolished biofilm formation in vivo. To de-termine whether srrA deletion had an impact on in vivo biofilmformation, a rabbit subcutaneous foreign body infection modelwas used. Staphylococcal strains (108 CFU) were injected into thecavities with implanted polystyrene disks on the animal’s back.After 72 h, biofilm on the disks was observed under SEM. SE1457formed a compact biofilm covered with secreted substance on theimplanted disks, while the �srrA mutant formed only a fewbacterial clusters. The amount of biofilm produced by the�srrA(pCN51-srrAB) complementation strain was similar to thatof the wild-type strain (Fig. 4A). The viable bacterial cells in the

FIG 5 Effect of srrA deletion on initial adherence capacity in vitro. (A and B) Mid-log-phase bacterial cells were adjusted to an OD600 of 0.1 in PBS and then addedto a 6-well plate (2 ml/well) (A) or a 96-well microplate (200 �l/well) (B). The plates were then incubated at 37°C for 2 h. The attached bacterial cells on the 6-wellplate were counted by microcopy (A), and attached cells on the 96-well microplate were determined at OD570 after crystal violet staining (B). The data representone of three independent experiments. **, P � 0.01 (�srrA mutant versus SE1457).

Wu et al.

468 jb.asm.org February 2015 Volume 197 Number 3Journal of Bacteriology

on May 1, 2020 by guest

http://jb.asm.org/

Dow

nloaded from

�srrA biofilm formed in vivo (CFU 8.82 103) were signifi-cantly fewer than that in those of the SE1457 (CFU 5.49 104)(P � 0.01) and �srrA(pCN51-srrAB) (CFU 6.14 104) strains(Fig. 4B).

Deletion of srrA diminished initial attachment of S. epider-midis. Biofilm formation by S. epidermidis is generally a two-stepprocess involving an initial attachment and a subsequent matura-tion phase. The initial attachment of the �srrA mutant to polysty-rene plates was determined by using ImageJ software. Attachedcells of the �srrA strain (about 1.35 103per field) were 3.4-foldless than those of the parent strain (about 4.54 103per field) andof the �srrA(pCN51-srrAB) complementation strain (about5.61 103) (Fig. 5A), and this was confirmed by crystal violetstaining with measurement at OD570 (Fig. 5B).

Deletion of srrA affected the biofilm matrix production in S.epidermidis. To investigate the effect of srrA deletion on the bio-film matrix production, the release of PIA, eDNA, and Aap were

determined in the SE1457, �srrA, �srrA(pCN51-srrAB), and�srrA(pCN51) strains. PIA, a major factor affecting biofilm accu-mulation, was detected semiquantitatively with WGA-HRP. Un-der both oxic and microaerobic conditions, the �srrA mutantstrain and the �srrA(pCN51) vector control strain produced lessPIA than either SE1457 or the �srrA(pCN51-srrAB) complemen-tation strain (Fig. 6A). No differences of Aap expression in bio-films or planktonic cells of the SE1457, �srrA, and �srrA(pCN51-srrAB) strains were detected by Western blotting with monoclonalantibody (18B6) against the Aap protein B repeat region (Fig. 6B).The relative concentrations of eDNA in 24-h biofilms of the �srrAmutant and the vector control �srrA(pCN51) strain were �5-foldhigher than that of either the SE1457 parent strain (P � 0.01) orthe �srrA(pCN51-srrAB) complementation strain, as shown inFig. 6C.

In the �srrA mutant the transcriptional profile was severelyaltered compared to the wild-type strain. DNA microarray was

FIG 6 Effect of srrA deletion on the extracellular matrix biosynthesis of S. epidermidis. (A) PIA biosynthesis semiquantified by dot blot assay with WGA.Twenty-four-hour biofilms, cultured aerobically (�O2) or microaerobically (�O2) were scraped off and suspended in EDTA (3 �l/1 mg [wet weight]). Serialdilutions of the PIA extractions were spotted onto nitrocellulose membranes, subsequently incubated with WGA conjugated with HRP, and visualized usingchromogenic detection. (B) Aap expression of SE1457 and its isogenic srrA deletion mutants. Twenty-four-hour biofilms and 12-h planktonic bacteria werecollected after being washed with PBS. Lysostaphin-treated samples with identical OD600s were centrifuged at 20,000 g for 30 min at 4°C. The supernatant wereseparated using 7% SDS-PAGE, and the gel pieces that carried �130-kDa proteins were used for Western blotting (upper panel).The remaining gel pieceswere stained using Coomassie blue as an endogenous reference (lower panel). MAb18B6 (10 ng/ml) was used for the primary antibody. Immunoreactivity wasdetected with an ECL Western blotting system after incubation with HRP-conjugated secondary antibody. (C) eDNA quantified by qPCRs of four chromosomalloci (gyrB, serp0306, leuA, and lysA). Unwashed 24-h biofilms were measured at OD600 in order to normalize to biofilm biomass and then used for eDNA isolationby phenol-chloroform-isoamyl alcohol extraction and ethanol precipitation. The results are shown as nanograms per biomass of eDNA (means the SD) andwere derived from three independent experiments. **, P � 0.01 (�srrA mutant versus SE1457).

SrrAB Regulates Growth and Biofilm Formation

February 2015 Volume 197 Number 3 jb.asm.org 469Journal of Bacteriology

on May 1, 2020 by guest

http://jb.asm.org/

Dow

nloaded from

TABLE 4 Transcription levels of genes involved in growth and biofilm formation of the S. epidermidis �srrA mutant under microaerobic conditions

Gene function and ORF Gene Description or predicted function

Expression ratio(mutant/WT)a

Microarray qRT-PCR

Respiratory chain and energymetabolism

SERP1055 srrA DNA-binding response regulator 0.10 0.00001SERP1054 srrB Histidine kinase sensor UD 0.09 0.02SERP0705 ctaA Cytochrome oxidase assembly protein 0.22 0.04 0.01SERP0706 ctaB Protoheme IX farnesyltransferase 0.28 NDSERP0646 qoxB Quinol oxidase subunit II UD 0.31 0.08SERP0645 qoxA Quinol oxidase subunit I 0.30 NDSERP0644 qoxC Quinol oxidase polypeptide III 0.20 NDSERP0643 qoxD Quinol oxidase polypeptide IV 0.25 NDSERP2381 NADH:flavinoxidoreductase/fumarate reductase flavoprotein subunit 0.21 0.20 0.17SERP0257 Alcohol dehydrogenase 0.32 0.08 0.04SERP2112 Alcohol dehydrogenase, zinc containing 0.28 NDSERP2257 Acetoin reductase, oxidoreductase, ligand is NAD 0.18 0.02 0.01SERP2365 pflA Pyruvate formate-lyase-activating enzyme 0.15 0.15 0.11SERP2366 pflB Formateacetyltransferase 0.31 NDSERP2183 nrdD Anaerobic ribonucleoside triphosphate reductase 0.33 NDSERP1795 lacA Galactose-6-phosphate isomerase LacA subunit 0.32 1.72 0.37SERP1793 lacC Tagatose-6-phosphate kinase 0.30 NDSERP1791 lacF PTS system, lactose-specific IIA component 0.31 NDSERP1873 ureF Urease accessory protein UreF 0.34 1.38 0.6SERP1874 ureG Urease accessory protein UreG 0.33 NDSERP1875 ureD Urease accessory protein UreD 0.33 NDSERP2100 rbsK Ribokinase, catalyzes the phosphorylation of ribose to ribose-5-phosphate

using ATP, this reaction is the first step in the ribose metabolism0.16 0.14 0.06

SERP2101 D-Ribose pyranase 0.27 NDSERP2102 rbsU Ribose transporter RbsU 0.30 NDSERP2347 bioB Biotin synthase 0.32 0.44 0.20SERP2396 bioD Dethiobiotinsynthetase 0.34 NDSERP2190 cysI Sulfite reductase (NADPH) hemoprotein beta-component 3.68 NDSERP2191 cysJ Sulfite reductase (NADPH) flavoprotein 4.33 NDSERP2192 cysH Phosophoadenylyl-sulfate reductase 5.22 NDSERP2176 betA Choline dehydrogenase 3.84 NDSERP2177 betB Betaine aldehyde dehydrogenase, ligand is NAD 4.25 7.29 2.56

Biofilm formationSERP2292 icaR Intercellular adhesion regulator 0.33 0.32 0.07SERP2293 icaA N-Glycosyltransferase UD 0.10 0.02SERP2398 aap Accumulation associated protein UD 0.89 0.21SERP0274 sarA Accessory regulator A UD 0.87 0.33SERP1680 rsbU Sigma factor B regulator protein UD 1.35 0.26

Protein synthesisSERP0044 rpsF 30S ribosomal protein S6 3.8 NDSERP1832 rpsJ 30S ribosomal protein S10 5.09 6.85 2.06SERP0186 rpsL 30S ribosomal protein S12 3.04 NDSERP1807 rpsM 30S ribosomal protein S13 3.34 NDSERP1818 rpsN 30S ribosomal protein S14 5.58 NDSERP1822 rpsQ 30S ribosomal protein S17 3.11 NDSERP1828 rplB 50S ribosomal protein L2 4.17 17.1 3.22SERP1831 rplC 50S ribosomal protein L3 4.77 NDSERP1821 rplN 50S ribosomal protein L14 3.09 NDSERP1824 rplP 50S ribosomal protein L16 3.41 NDSERP1815 rplR 50S ribosomal protein L18 4.37 NDSERP1826 rplV 50S ribosomal protein L22 3.4 NDSERP1820 rplX 50S ribosomal protein L24 3.11 NDSERP2371 opp-1B Peptide ABC transporter, permease protein 1B 0.19 0.25 0.15SERP2370 opp-1C Peptide ABC transporter, permease protein 1C 0.26 ND

(Continued on following page)

Wu et al.

470 jb.asm.org February 2015 Volume 197 Number 3Journal of Bacteriology

on May 1, 2020 by guest

http://jb.asm.org/

Dow

nloaded from

used to compare the transcriptional profiles of the SE1457 and�srrA strains under oxic or microaerobic conditions. Under mi-croaerobic conditions, 230 differentially expressed genes werefound, which were involved in respiratory and energy metabo-lism, biofilm formation, and cell wall biosynthesis, etc. Amongthem, 118 genes were upregulated and 112 were downregulated inthe �srrA mutant. The latter included genes involved in cyto-chrome and quinol-oxidase biosynthesis and assembly (e.g., qox-ACD, ctaAB, and atpC), as well as anaerobic metabolism-relatedgenes such as pflBA (formate acetyltransferase), nrdD (anaerobicribonucleoside triphosphate reductase), serp0257 (alcohol dehy-drogenase), serp2257 (acetoin reductase), serp2133 (D-lactatedehydrogenase), and serp2381 (NADH:flavin oxidoreductase/fumarate reductase flavoprotein subunit) (Table 4). Under oxicconditions the srrA mutation affected the expression of 51 genes;33 genes were upregulated, and 18 genes were downregulated.Similar to findings under microaerobic conditions, downregula-tion was observed in respiratory and energy metabolism-relatedgenes, including srrA, serp2324 (branched-chain alpha-keto aciddehydrogenase subunit E2), serp2327 (acetoin dehydrogenase, E3component, dihydrolipoamide dehydrogenase), serp2379 (aceto-indiacetyl reductase), ppdK (pyruvate phosphate dikinase), andnrdDG. Protein synthesis-related genes, including rpsORTD andrplNS, were upregulated (Table 5). These results were confirmedby qRT-PCR and suggested that retarded growth may result fromlow expression levels of the genes involved in the respiratory elec-tron transport chain and anaerobic metabolism.

Transcription levels of biofilm-related genes were also con-firmed by qRT-PCR. Compared to SE1457, icaR in the �srrA mu-tant was downregulated 3.1-fold under microaerobic conditionsbut upregulated 5.1-fold under oxic conditions. The transcriptionlevels of icaA and atlE in the �srrA mutant were downregulatedabout 10- and 5-fold, respectively, under microaerobic condi-tions, and 8- and 4-fold under oxic conditions. In addition, nosignificant difference in the expression of rsbU, sarA, and aap wasdetected by qRT-PCR between SE1457 and the �srrA mutant un-der either condition (Tables 4 and 5).

Binding of recombinant SrrA protein to the putative pro-moter regions. To further study the regulation role of SrrAB in thebiofilm formation, EMSA was carried out with digoxigenin-la-beled putative promoter regions and recombinant SrrA (His-tagged SrrA). The 132-bp DNA fragment upstream of srr (p-srr)formed a shifted complex with phosphorylated SrrA (SrrA-P) in adose-dependent manner but not with unphosphorylated SrrA(Fig. 7A and B, lane 2 to lane 4). The addition of a 125-fold excess

of unlabeled p-srr as a specific competitor blocked SrrA-DIG-DNA complex formation (Fig. 7B, lane 5).

SrrA-P resulted in a mobility shift of the 82-bp, 85-bp, 145-bp,or 151-bp fragments upstream of icaR, icaA, qoxB, or pflB, respec-tively (Fig. 7C, D, E, and F). SrrA-P did not bind to the fragmentupstream of sarA and rsbU (Fig. 7G and H). As a negative control,a 119-bp DNA fragment of rpsJ gene did not form a complex withSrr-P under the same conditions (Fig. 7I).The results indicatedthat SrrA-P was able to bind specifically to the promoter regions ofcertain biofilm-related genes, as well as some genes involved inrespiratory metabolism.

DISCUSSION

SrrAB in S. aureus modulates biofilm formation and expression ofvirulence factors (such as tst, spa, agr, ica, etc.) under oxic andanaerobic conditions (20–22, 38–40). However, the role of SrrABin regulation of S. epidermidis biofilm formation and growth is notclear. In the present study, we first compared the protein sequenceof SrrA in S. epidermidis strain 1457 to that in S. aureus strain COL.They shared 90.5% identity (see Fig. S1A in the supplementalmaterial). SE1457 srrA and srrB were oriented in tandem andoverlapped by 20 nucleotides. srrAB forms an operon with a pu-tative promoter upstream of srrA and a transcription terminatorstructure (ATATATGAAAAACGCCTGCGACTCAGAGTGATGTCTCAGGCGTTTTTTTGTATATA, where boldface nucleotidesrepresent reverse complement sequences to form a hairpin struc-ture that may function in transcription termination) located 81 bpdownstream of the srrB translational stop codon. By RT-PCR, asingle mRNA covering srrAB was verified (see Fig. S1B in the sup-plemental material). We then found that oxygen limitation in-duced the expression of srrAB in S. epidermidis, whereas stressorssuch as vancomycin, ethanol, or high NaCl had no effect (see Fig.S3 in the supplemental material). This indicated that S. epidermi-dis SrrAB selectively responds to microaerobic stress.

To study the role of SrrAB in regulating biofilm formation andgrowth of S. epidermidis, an srrA deletion (�srrA) mutant fromSE1457 was constructed. The �srrA mutant exhibited impairedbiofilm formation and delayed growth under both oxic and mi-croaerobic conditions, which was restored by complementationwith srrAB. A double gene deletion mutant (�srrAB) was con-structed and showed a phenotype similar to that of the �srrAmutant. This demonstrates that SrrAB regulates S. epidermidisgrowth under both oxic and microaerobic conditions. However,in S. aureus, srrAB regulated bacterial growth only under anaero-bic conditions (20–22, 38), suggesting that the role of SrrAB in the

TABLE 4 (Continued)

Gene function and ORF Gene Description or predicted function

Expression ratio(mutant/WT)a

Microarray qRT-PCR

TranscriptionSERP1805 rpoA DNA-directed RNA polymerase subunit alpha 3.24 3.54 2.28SERP0183 rpoB DNA-directed RNA polymerase subunit beta 2.96 NDSERP0184 rpoC DNA-directed RNA polymerase subunit beta= 3.53 NDSERP1127 rpoD RNA polymerase sigma factor 4.07 NDSERP1677 rpoF RNA polymerase sigma factor SigB 3.2 ND

a WT, wild type; UD, under the detection level in the microarray analysis; ND, not done. qRT-PCR data are given as means standard deviations of results from three independentexperiments.

SrrAB Regulates Growth and Biofilm Formation

February 2015 Volume 197 Number 3 jb.asm.org 471Journal of Bacteriology

on May 1, 2020 by guest

http://jb.asm.org/

Dow

nloaded from

growth of S. epidermidis is different from that in S. aureus. Whenwe further analyzed the transcriptional profile by microarray andqRT-PCR, we found that the mRNA levels of qoxBACD, ctaA,pflBA, nrdDG, etc., were significantly reduced in the srrA mutantcompared to the parent strain (Tables 4 and 5).

The qoxBACD operon encodes the cytochrome aa3-typequinol oxidase, one of the two terminal oxidases in S. aureus.Terminal oxidases deficiency usually results in an inability to re-spire and a severe growth defect in bacteria. Hammer et al. (41)

found that a double mutant lacking both qoxB and cydB showedsignificantly reduced aerobic growth and a small-colony variantphenotype, indicating that the mutant was unable to respire aer-obically. Similar results were found by Kinkel et al. (42): theqoxBACD mutant exhibited a modest growth defect under aerobicconditions, and either srrAB or qoxBACD mutant strains wereunable to reach a maximal final cell density. In the present study,the expression of the qoxBACD operon in the �srrA mutant wasdownregulated, and SrrA was able to bind the promoter region of

TABLE 5 Transcription levels of genes involved in growth and biofilm formation of the S. epidermidis �srrA strain under oxic conditions

Gene function and ORF Gene Description or predicted function

Expression ratio(mutant/WT)a

Microarray qRT-PCR

Respiratory chain and energymetabolism

SERP1055 srrA DNA-binding response regulator 0.30 0.00001SERP1054 srrB Histidine kinase sensor UD 0.10 0.02SERP0705 ctaA Cytochrome oxidase assembly protein UD 0.18 0.08SERP0646 qoxB Quinol oxidase subunit II UD 0.17 0.05SERP2381 NADH:flavinoxidoreductase/fumarate reductase flavoprotein subunit UD 0.35 0.21SERP0257 Alcohol dehydrogenase UD 0.16 0.07SERP2257 Acetoin reductase, oxidoreductase, ligand is NAD UD 0.13 0.07SERP2327 Acetoin dehydrogenase, E3 component, dihydrolipoamide

dehydrogenase0.31 ND

SERP2379 Acetoin (diacetyl) reductase 0.28 NDSERP2324 Branched-chain alpha-keto acid dehydrogenase subunit E2 0.32 NDSERP2365 pflA Pyruvate formate-lyase-activating enzyme UD 0.12 0.05SERP2170 ppdK Pyruvate phosphate dikinase 0.23 NDSERP2182 nrdG Anaerobic ribonucleoside-triphosphate reductase activating protein 0.33 NDSERP2183 nrdD Anaerobic ribonucleoside triphosphate reductase 0.30 NDSERP1795 lacA Galactose-6-phosphate isomerase LacA subunit UD 0.39 0.12SERP1873 ureF Urease accessory protein UreF UD 0.27 0.15SERP2192 cysH Phosophoadenylyl-sulfate reductase UD 5.26 1.36

Biofilm formationSERP2292 icaR Intercellular adhesion regulator UD 5.14 0.63SERP2293 icaA N-Glycosyltransferase UD 0.13 0.06SERP2295 icaB Intercellular adhesion protein B UD 0.17 0.1SERP2294 icaD Intercellular adhesion protein D UD NDSERP0636 atlE Bifunctional autolysin UD 0.25 0.12SERP2398 aap Accumulation-associated protein UD 0.68 0.14SERP0274 sarA Accessory regulator A UD 0.74 0.21SERP1680 rsbU Sigma factor B regulator protein UD 0.93 0.29

Protein synthesisSERP0840 rpsO 30S ribosomal protein S15 3.16 NDSERP0046 rpsR 30S ribosomal protein S18 3.25 NDSERP1153 rpsT 30S ribosomal protein S20 4.56 NDSERP1284 rpsD 30S ribosomal protein S4 4.39 NDSERP1821 rplN 50S ribosomal protein L14 3.88 NDSERP0807 rplS 50S ribosomal protein L19 3.69 NDSERP0001 rpmH 50S ribosomal protein L34 3.54 NDSERP2371 opp-1B Peptide ABC transporter, permease protein 1B 0.34 1.01 0.55SERP2105 pgsA Poly-gamma-glutamate synthesis protein PgsA 3.39 NDSERP2107 pgsB Poly-gamma-glutamate synthesis protein PgsB 3.51 ND

TranscriptionSERP0926 parC DNA topoisomerase IV subunit A 2.96 NDSERP0838 truB tRNA pseudouridine synthase B 3.10 NDSERP1307 trmB tRNA [guanine-N(7)-]-methyltransferase 2.95 ND

a WT, wild type; UD, under the detection level in the microarray analysis; ND, not done. qRT-PCR data are given as means standard deviations of results from three independentexperiments.

Wu et al.

472 jb.asm.org February 2015 Volume 197 Number 3Journal of Bacteriology

on May 1, 2020 by guest

http://jb.asm.org/

Dow

nloaded from

qoxBACD (Fig. 7). Therefore, we speculated that the aerobicgrowth retardation of the S. epidermidis srrA mutant may haveresulted from the downregulation of the qoxBACD operon im-pairing respiratory chain reaction.

Under anaerobic conditions, expression levels of pflBA operonand nrdDG were reported highly induced in S. aureus (43, 44).PflA is an activating enzyme of PflB, a pyruvate formatelyase thatcatalyzes the reversible conversion of pyruvate to formate, therebyproducing acetyl coenzyme A. Thus, the pflBA operon is impor-

tant for energy supply when pyruvate is available and favors thegrowth of cells under fermentation conditions (45). The proteinencoded by nrdDG is a class III ribonucleotide reductase that cat-alyzes the synthesis of deoxynucleoside triphosphates (dNTPs) viathe reduction of NTPs under anaerobic conditions (17, 42, 46). Inthe present study, under microaerobic conditions, the S. epider-midis �srrA mutant displayed severe growth retardation and in-ability to reach maximal final cell density, which may be related tothe downregulation of pflBA and nrdDG expression and a subse-

FIG 7 EMSA analysis of S. epidermidis SrrA with the putative promoter regions. His-tagged SrrA was purified and phosphorylated (SrrA-P) by incubation with50 mM acetyl phosphate. The putative promoter regions of srrAB, icaR, icaA, qoxB, pflB, sarA, and rsbU genes were PCR amplified. DNA probes were purified andlabeled with digoxigenin (Dig). Gel shift reactions were performed by incubating labeled probe with increasing concentrations of SrrA-P (range, 0.3 to 1.2 �M).Lane 1 and lane 5 of each blot contained a no-protein control and a 125-fold excess of unlabeled probe competitor control, respectively. All samples wereelectrophoresed on a nondenaturing polyacrylamide gel and blotted onto nylon membrane. After incubation with antidigoxigenin antibody, CSPD chemilu-minescent reagent was added. The arrows indicate the positions of phosphorylated SrrA-bound probes; triangles indicate the positions of free probes. The DNAfragment within the rpsJ coding region was used as a negative control.

SrrAB Regulates Growth and Biofilm Formation

February 2015 Volume 197 Number 3 jb.asm.org 473Journal of Bacteriology

on May 1, 2020 by guest

http://jb.asm.org/

Dow

nloaded from

quent decrease in fermentation and DNA replication. In addition,SrrA was able to bind the promoter region of pflBA (Fig. 7). Thisindicates that under microaerobic conditions SrrAB regulates S.epidermidis growth via pflBA (Fig. 8).

Besides its effect on bacterial growth, SrrAB regulates S. aureusbiofilm formation (22, 39, 42). In the present study, srrA deletionresulted in a decrease in S. epidermidis biofilm formation underboth oxic and microaerobic conditions. Although under oxic con-ditions the �srrA mutant needed two more hours to enter station-ary phase than did the wild-type strain (Fig. 1), the optical densityof the two strains was similar after entering stationary phase (seeFig. S4 in the supplemental material). This indicates that underoxic conditions decreased biofilm formation by the �srrA mutantmay not be directly related to growth defects. Nevertheless, undermicroaerobic conditions, where the biofilm formed by the �srrAmutant was less than that by SE1457, and the �srrA mutant wasunable to reach the optical density as high as SE1457 even if theculture time was extended to 48 h (Fig. 2A and C). This suggeststhat under microaerobic conditions an effect of growth retarda-tion on decreased biofilm formation in the srrA mutant cannot beexcluded.

Then, we further analyzed the possible mechanism that led tobiofilm reduction in the S. epidermidis �srrA mutant. The initialadherence, as a crucial step in biofilm formation, was decreased inthe �srrA mutant (Fig. 5), which indicated that SrrAB participatedin the early stage of biofilm development. PIA production, whichis regarded as the most important intercellular adherence factorand glue in the accumulation stage of biofilm formation in staph-

ylococci (4, 9), was decreased in the �srrA mutant compared tothe parent strain, especially under microaerobic conditions (Fig.6). In the S. aureus srrA transposon mutant, PIA synthesis wasincreased, whereas biofilm formation was decreased (23). Thissuggests that the mechanisms of biofilm formation regulated bySrrAB in S. epidermidis differ from those of S. aureus.

In S. aureus, SrrAB regulates biofilm formation via IcaR, a re-pressor of the ica operon. Under aerobic conditions, S. aureusSrrAB decreased biofilm formation by upregulating icaR expres-sion but enhanced biofilm formation through downregulatingicaR expression under microaerobic conditions (39). In the pres-ent study, we found that the transcription of icaR was upregulatedin the S. epidermidis �srrA mutant under oxic conditions butdownregulated under microaerobic conditions; icaA expressionwas downregulated under both conditions. Under oxic condi-tions, S. epidermidis SrrAB positively regulated icaADBC expres-sion and downregulated icaR expression, which is correlated withPIA production and biofilm formation. Under microaerobic con-ditions, the transcription of both icaR and icaADBC in the �srrAmutant were downregulated, and PIA synthesis was decreased. Wedemonstrated that phosphorylated SrrA of S. epidermidis boundto the promoter regions of icaR and icaA. This suggests that the S.epidermidis SrrAB response to oxygen variation is to modulatebiofilm formation in an ica-dependent pathway (Fig. 8).

Other intercellular matrix components may play importantrole in the biofilm formation. Extracellular DNA (eDNA) is re-leased following bacterial autolysis (7, 15). The amount of eDNAwithin �srrA mutant biofilm was more than that in the parent

FIG 8 Proposed model of srrAB regulation in S. epidermidis. SrrB represents the membrane-associated sensor kinase that becomes activated and autophospho-rylated (indicated by circled “P”s) in the absence of O2 (indicated by bright red spheres). The SrrB-P phosphorylates SrrA to SrrA-P, which acts as a responseregulator that directly positively controls its own srrAB operon, as well as the ica, qox, and pfl operons (solid lines). Genes that are indirectly positively regulatedare indicated by dotted lines. At the same time, SrrA-P acts also as a repressor for icaR, which encodes the repressor of the ica operon. �O2, under oxic conditions;�O2, under microaerobic conditions.

Wu et al.

474 jb.asm.org February 2015 Volume 197 Number 3Journal of Bacteriology

on May 1, 2020 by guest

http://jb.asm.org/

Dow

nloaded from

strain. The percentage of dead cells in �srrA biofilm was muchhigher than that in the parent strain biofilm, although there wasno difference between the �srrA and SE1457 strains in cell viabil-ity in planktonic conditions or in Triton X-100-induced autolysis(see Fig. S5 in the supplemental material). Kinkel et al. (42) dem-onstrated that the srrAB mutant of S. aureus UAMS-1 had reducedcapacity to form biofilm under static aeration conditions and thatits biofilm contained significantly more dead cells than did thewild-type biofilm, and this was correlated with the loss of its struc-tural integrity. It has been reported that pflBA was upregulated inthe deeper layer of the biofilm, which may be related with thesurvival of biofilm cells in that place (45). In the present study,transcription of pfl operon was downregulated in the srrA mutantof S. epidermidis, which may be associated with the increased pro-portion of dead cells found in �srrA biofilm.

In summary, S. epidermidis SrrAB responds to microaerobicstress and modulates biofilm formation in an ica-dependent man-ner. The mechanism that SrrAB regulates bacterial growth varieswith environmental oxygen concentration: under oxic conditions,SrrAB modulates respiratory chain reaction by positively regulat-ing qoxBACD transcription, while under microaerobic conditionsit regulates fermentation processes and DNA replication via the pfloperon and nrdDG (Fig. 8). These results provide new insight intothe SrrAB-mediated regulation of biofilm formation and thegrowth of S. epidermidis.

ACKNOWLEDGMENTS

We thank Caiguang Yang and Xing Liu from the Chinese Academy ofSciences for assistance with the gel shift reactions. We also thank Li Chenfrom the Shanghai Medical College of Fudan University for helpful dis-cussions.

This study was supported by the National Science and TechnologyMajor Project of China (2012ZX09301002-005 and 2012ZX10003008-010), the National Natural Science Foundation of China (81271791 and81101214), and Deutsche Forschungsgemeinschaft SFB766.

REFERENCES1. Maduka-Ezeh AN, Greenwood-Quaintance KE, Karau MJ, Berbari EF,

Osmon DR, Hanssen AD, Steckelberg JM, Patel R. 2012. Antimicrobialsusceptibility and biofilm formation of Staphylococcus epidermidis small col-ony variants associated with prosthetic joint infection. Diagn MicrobiolInfect Dis 74:224 –229. http://dx.doi.org/10.1016/j.diagmicrobio.2012.06.029.

2. Götz F, Peters G. 2000.Colonization of medical devices by coagulase-negative staphylococci, p 55– 88. In Waldvogel FA, Bisno AL (ed), Infec-tions associated with indwelling medical devices, 3rd ed. American Societyfor Microbiology, Washington, DC.

3. Otto M. 2008. Staphylococcal biofilms. Curr Top Microbiol Immunol322:207–228. http://dx.doi.org/10.1007/978-3-540-75418-3_10.

4. Götz F. 2002. Staphylococcus and biofilms. Mol Microbiol 43:1367–1378.http://dx.doi.org/10.1046/j.1365-2958.2002.02827.x.

5. Dunne WM, Jr. 2002. Bacterial adhesion: seen any good biofilms lately?Clin Microbiol Rev 15:155–166. http://dx.doi.org/10.1128/CMR.15.2.155-166.2002.

6. Rupp ME, Fey PD, Heilmann C, Götz F. 2001. Characterization of theimportance of Staphylococcus epidermidis autolysin and polysaccharideintercellular adhesin in the pathogenesis of intravascular catheter-associated infection in a rat model. J Infect Dis 183:1038 –1042. http://dx.doi.org/10.1086/319279.

7. Qin Z, Ou Y, Yang L, Zhu Y, Tolker-Nielsen T, Molin S, Qu D. 2007.Role of autolysin-mediated DNA release in biofilm formation of Staphy-lococcus epidermidis. Microbiology 153:2083–2092. http://dx.doi.org/10.1099/mic.0.2007/006031-0.

8. Otto M. 2012. Staphylococcal infections: mechanisms of biofilm maturationand detachment as critical determinants of pathogenicity. Annu Rev Med64:175–188. http://dx.doi.org/10.1146/annurev-med-042711-140023.

9. Periasamy S, Joo HS, Duong AC, Bach TH, Tan VY, Chatterjee SS,Cheung GY, Otto M. 2012. How Staphylococcus aureus biofilms developtheir characteristic structure. Proc Natl Acad Sci U S A 109:1281–1286.http://dx.doi.org/10.1073/pnas.1115006109.

10. Knobloch JK, Bartscht K, Sabottke A, Rohde H, Feucht HH, Mack D.2001. Biofilm formation by Staphylococcus epidermidis depends on func-tional RsbU, an activator of the sigB operon: differential activation mech-anisms due to ethanol and salt stress. J Bacteriol 183:2624 –2633. http://dx.doi.org/10.1128/JB.183.8.2624-2633.2001.

11. Heilmann C, Hussain M, Peters G, Götz F. 1997. Evidence for autolysin-mediated primary attachment of Staphylococcus epidermidis to a polysty-rene surface. Mol Microbiol 24:1013–1024. http://dx.doi.org/10.1046/j.1365-2958.1997.4101774.x.

12. Olson ME, Garvin KL, Fey PD, Rupp ME. 2006. Adherence of Staphylo-coccus epidermidis to biomaterials is augmented by PIA. Clin Orthop RelatRes 451:21–24. http://dx.doi.org/10.1097/01.blo.0000229320.45416.0c.

13. Tormo MA, Marti M, Valle J, Manna AC, Cheung AL, Lasa I, PenadesJR. 2005. SarA is an essential positive regulator of Staphylococcus epider-midis biofilm development. J Bacteriol 187:2348 –2356. http://dx.doi.org/10.1128/JB.187.7.2348-2356.2005.

14. Zhu T, Lou Q, Wu Y, Hu J, Yu F, Qu D. 2010. Impact of the Staphylo-coccus epidermidis LytSR two-component regulatory system on mureinhydrolase activity, pyruvate utilization and global transcriptional profile.BMC Microbiol 10:287. http://dx.doi.org/10.1186/1471-2180-10-287.

15. Lou Q, Zhu T, Hu J, Ben H, Yang J, Yu F, Liu J, Wu Y, Fischer A,Francois P, Schrenzel J, Qu D. 2011. Role of the SaeRS two-component regulatory system in Staphylococcus epidermidis autolysisand biofilm formation. BMC Microbiol 11:146. http://dx.doi.org/10.1186/1471-2180-11-146.

16. Wu Y, Wang J, Xu T, Liu J, Yu W, Lou Q, Zhu T, He N, Ben H, HuJ, Götz F, Qu D. 2012. The two-component signal transduction sys-tem ArlRS regulates Staphylococcus epidermidis biofilm formation in anica-dependent manner. PLoS One 7:e40041. http://dx.doi.org/10.1371/journal.pone.0040041.

17. Sun G, Sharkova E, Chesnut R, Birkey S, Duggan MF, Sorokin A, PujicP, Ehrlich SD, Hulett FM. 1996. Regulators of aerobic and anaerobicrespiration in Bacillus subtilis. J Bacteriol 178:1374 –1385.

18. Nakano MM, Zuber P, Glaser P, Danchin A, Hulett FM. 1996. Two-component regulatory proteins ResD-ResE are required for transcrip-tional activation of fnr upon oxygen limitation in Bacillus subtilis. J Bacte-riol 178:3796 –3802.

19. Throup JP, Zappacosta F, Lunsford RD, Annan RS, Carr SA, LonsdaleJT, Bryant AP, McDevitt D, Rosenberg M, Burnham MK. 2001. ThesrhSR gene pair from Staphylococcus aureus: genomic and proteomic ap-proaches to the identification and characterization of gene function. Bio-chemistry 40:10392–10401. http://dx.doi.org/10.1021/bi0102959.

20. Yarwood JM, McCormick JK, Schlievert PM. 2001. Identification of anovel two-component regulatory system that acts in global regulation ofvirulence factors of Staphylococcus aureus. J Bacteriol 183:1113–1123.http://dx.doi.org/10.1128/JB.183.4.1113-1123.2001.

21. Pragman AA, Yarwood JM, Tripp TJ, Schlievert PM. 2004. Character-ization of virulence factor regulation by SrrAB, a two-component systemin Staphylococcus aureus. J Bacteriol 186:2430 –2438. http://dx.doi.org/10.1128/JB.186.8.2430-2438.2004.

22. Ulrich M, Bastian M, Cramton SE, Ziegler K, Pragman AA, Bragonzi A,Memmi G, Wolz C, Schlievert PM, Cheung A, Döring G. 2007. Thestaphylococcal respiratory response regulator SrrAB induces ica genetranscription and polysaccharide intercellular adhesin expression, pro-tecting Staphylococcus aureus from neutrophil killing under anaerobicgrowth conditions. Mol Microbiol 65:1276 –1287. http://dx.doi.org/10.1111/j.1365-2958.2007.05863.x.

23. Tu Quoc PH, Genevaux P, Pajunen M, Savilahti H, Georgopoulos C,Schrenzel J, Kelley WL. 2007. Isolation and characterization of biofilmformation-defective mutants of Staphylococcus aureus. Infect Immun 75:1079 –1088. http://dx.doi.org/10.1128/IAI.01143-06.

24. Cerca N, Brooks JL, Jefferson KK. 2008. Regulation of the intercel-lular adhesin locus regulator (icaR) by SarA, sigmaB, and IcaR in Staph-ylococcus aureus. J Bacteriol 190:6530 – 6533. http://dx.doi.org/10.1128/JB.00482-08.

25. Rohde H, Burdelski C, Bartscht K, Hussain M, Buck F, HorstkotteMA, Knobloch JK, Heilmann C, Herrmann M, Mack D. 2005.Induction of Staphylococcus epidermidis biofilm formation via proteolyticprocessing of the accumulation-associated protein by staphylococcal and

SrrAB Regulates Growth and Biofilm Formation

February 2015 Volume 197 Number 3 jb.asm.org 475Journal of Bacteriology

on May 1, 2020 by guest

http://jb.asm.org/

Dow

nloaded from

host proteases. Mol Microbiol 55:1883–1895. http://dx.doi.org/10.1111/j.1365-2958.2005.04515.x.

26. Hu J, Xu T, Zhu T, Lou Q, Wang X, Wu Y, Huang R, Liu J, Liu H, YuF, Ding B, Huang Y, Tong W, Qu D. 2011. Monoclonal antibodiesagainst accumulation-associated protein affect EPS biosynthesis and en-hance bacterial accumulation of Staphylococcus epidermidis. PLoS One6:e20918. http://dx.doi.org/10.1371/journal.pone.0020918.

27. Christner M, Heinze C, Busch M, Franke G, Hentschke M, BayardDuhring S, Buttner H, Kotasinska M, Wischnewski V, Kroll G, Buck F,Molin S, Otto M, Rohde H. 2012. sarA negatively regulates Staphylococcusepidermidis biofilm formation by modulating expression of 1 MDa extra-cellular matrix binding protein and autolysis-dependent release of eDNA.Mol Microbiol 86:394 – 410. http://dx.doi.org/10.1111/j.1365-2958.2012.08203.x.

28. Gill SR, Fouts DE, Archer GL, Mongodin EF, Deboy RT, Ravel J,Paulsen IT, Kolonay JF, Brinkac L, Beanan M, Dodson RJ, DaughertySC, Madupu R, Angiuoli SV, Durkin AS, Haft DH, Vamathevan J,Khouri H, Utterback T, Lee C, Dimitrov G, Jiang L, Qin H, WeidmanJ, Tran K, Kang K, Hance IR, Nelson KE, Fraser CM. 2005. Insights onevolution of virulence and resistance from the complete genome analysisof an early methicillin-resistant Staphylococcus aureus strain and a biofilm-producing methicillin-resistant Staphylococcus epidermidis strain. J Bacte-riol 187:2426 –2438. http://dx.doi.org/10.1128/JB.187.7.2426-2438.2005.

29. Flamm RK, Hinrichs DJ, Thomashow MF. 1984. Introduction ofpAM�1 into Listeria monocytogenes by conjugation and homology be-tween native L. monocytogenes plasmids. Infect Immun 44:157–161.

30. Arnaud M, Chastanet A, Debarbouille M. 2004. New vector for efficientallelic replacement in naturally nontransformable, low-GC-content,gram-positive bacteria. Appl Environ Microbiol 70:6887– 6891. http://dx.doi.org/10.1128/AEM.70.11.6887-6891.2004.

31. Helle L, Kull M, Mayer S, Marincola G, Zelder ME, Goerke C, Wolz C,Bertram R. 2011. Vectors for improved Tet repressor-dependent gradualgene induction or silencing in Staphylococcus aureus. Microbiology 157:3314 –3323. http://dx.doi.org/10.1099/mic.0.052548-0.

32. Charpentier E, Anton AI, Barry P, Alfonso B, Fang Y, Novick RP. 2004.Novel cassette-based shuttle vector system for gram-positive bacteria.Appl Environ Microbiol 70:6076 – 6085. http://dx.doi.org/10.1128/AEM.70.10.6076-6085.2004.

33. He N, Hu J, Liu H, Zhu T, Huang B, Wang X, Wu Y, Wang W, Qu D.2011. Enhancement of vancomycin activity against biofilms by using ul-trasound-targeted microbubble destruction. Antimicrob Agents Che-mother 55:5331–5337. http://dx.doi.org/10.1128/AAC.00542-11.

34. Liu Q, Fan J, Niu C, Wang D, Wang J, Wang X, Villaruz AE, Li M,Otto M, Gao Q. 2011. The eukaryotic-type serine/threonine proteinkinase Stk is required for biofilm formation and virulence in Staphylo-coccus epidermidis. PLoS One 6:e25380. http://dx.doi.org/10.1371/journal.pone.0025380.

35. Gerke C, Kraft A, Sussmuth R, Schweitzer O, Götz F. 1998. Char-acterization of the N-acetylglucosaminyltransferase activity involvedin the biosynthesis of the Staphylococcus epidermidis polysaccharide in-tercellular adhesin. J Biol Chem 273:18586 –18593. http://dx.doi.org/10.1074/jbc.273.29.18586.

36. Charbonnier Y, Gettler B, Francois P, Bento M, Renzoni A, Vaudaux P,Schlegel W, Schrenzel J. 2005. A generic approach for the design ofwhole-genome oligoarrays, validated for genomotyping, deletion map-ping and gene expression analysis on Staphylococcus aureus. BMC Genom-ics 6:95. http://dx.doi.org/10.1186/1471-2164-6-95.

37. Scherl A, Francois P, Charbonnier Y, Deshusses JM, Koessler T,Huyghe A, Bento M, Stahl-Zeng J, Fischer A, Masselot A, VaezzadehA, Galle F, Renzoni A, Vaudaux P, Lew D, Zimmermann-Ivol CG,Binz PA, Sanchez JC, Hochstrasser DF, Schrenzel J. 2006. Exploringglycopeptide-resistance in Staphylococcus aureus: a combined proteom-ics and transcriptomics approach for the identification of resistance-related markers. BMC Genomics 7:296. http://dx.doi.org/10.1186/1471-2164-7-296.

38. Pragman AA, Herron-Olson L, Case LC, Vetter SM, Henke EE, KapurV, Schlievert PM. 2007. Sequence analysis of the Staphylococcus aureussrrAB loci reveals that truncation of srrA affects growth and virulencefactor expression. J Bacteriol 189:7515–7519. http://dx.doi.org/10.1128/JB.00547-07.

39. Pragman AA, Ji YD, Schlievert PM. 2007. Repression of Staphylococcusaureus SrrAB using inducible antisense srrA alters growth and virulencefactor transcript levels. Biochemistry-Us 46:314 –321. http://dx.doi.org/10.1021/bi0603266.

40. Cramton SE, Ulrich M, Götz F, Doring G. 2001. Anaerobic conditionsinduce expression of polysaccharide intercellular adhesin in Staphylococ-cus aureus and Staphylococcus epidermidis. Infect Immun 69:4079 – 4085.http://dx.doi.org/10.1128/IAI.69.6.4079-4085.2001.

41. Hammer ND, Reniere ML, Cassat JE, Zhang Y, Hirsch AO, IndriatiHood M, Skaar EP. 2013. Two heme-dependent terminal oxidases powerStaphylococcus aureus organ-specific colonization of the vertebrate host.mBio 4:e00241–13. http://dx.doi.org/10.1128/mBio.00241-13.

42. Kinkel TL, Roux CM, Dunman PM, Fang FC. 2013. The Staphylococcusaureus SrrAB two-component system promotes resistance to nitrosativestress and hypoxia. mBio 4:e00696 –13. http://dx.doi.org/10.1128/mBio.00696-13.

43. Fuchs S, Pane-Farre J, Kohler C, Hecker M, Engelmann S. 2007.Anaerobic gene expression in Staphylococcus aureus. J Bacteriol 189:4275–4289. http://dx.doi.org/10.1128/JB.00081-07.

44. Masalha M, Borovok I, Schreiber R, Aharonowitz Y, Cohen G. 2001.Analysis of transcription of the Staphylococcus aureus aerobic class Ib andanaerobic class III ribonucleotide reductase genes in response to oxygen. JBacteriol 183:7260 –7272. http://dx.doi.org/10.1128/JB.183.24.7260-7272.2001.

45. Leibig M, Liebeke M, Mader D, Lalk M, Peschel A, Gotz F. 2011.Pyruvate formate lyase acts as a formate supplier for metabolic processesduring anaerobiosis in Staphylococcus aureus. J Bacteriol 193:952–962.http://dx.doi.org/10.1128/JB.01161-10.

46. Roca I, Ballana E, Panosa A, Torrents E, Gibert I. 2008. Fumarateand nitrate reduction (FNR)-dependent activation of the Escherichiacoli anaerobic ribonucleotide reductase nrdDG promoter. Int Microbiol11:49 –56.

Wu et al.

476 jb.asm.org February 2015 Volume 197 Number 3Journal of Bacteriology

on May 1, 2020 by guest

http://jb.asm.org/

Dow

nloaded from