Upload
others
View
2
Download
0
Embed Size (px)
Citation preview
Iranian Journal of Military Medicine Vol. 14, No. 3, Autumn 2012; 235 - 248
*Correspondant author: Ataee RA. Please, direct all correspondence to [email protected].
Standardizing Molecular Detection of the entC Gene of Staphylococcus
Aureus Isolated from Human Infections and Sequencing it
Ataee RA.*1 PhD, Kamali M.3 PhD, Ranjbar R.4 PhD, Karami A.4 PhD, Ghorbani M.2 MSc
1Department of Microbiology and Applied Microbiology Research Center, Baqiyatallah University of Medical
Sciences, Tehran, Iran 2 Applied Microbiology Research Center, Baqiyatallah University of Medical Sciences, Tehran, Iran 3 Nanothechnology Research Center, Baqiyatallah University of Medical Sciences, Tehran, Iran 4 Molecular Biology Research Center, Baqiyatallah University of Medical Sciences, Tehran, Iran
Abstract
Aims: The goal of this research is standardizing molecular detection of the entC gene of
Staphylococcus aureus isolated from human infections and determining its sequence.
Methods: At first, the primer was prepared using the standard gene in the gene bank. Then, the
molecular PCR method was set up to identify the entC gene in the Staphylococcus aureus bacteria
extracted from human specimens (300 strains). The PCR product was sequenced and compared
with the standard gene. Also, the ability of all entC gene carrier strains to produce enterotoxin C
was tested using an ELISA kit.
Results: The results showed that the molecular technique of PCR had been well set up with various
primers, because, the first and second primer pairs easily amplified a 102bp and a 1223bp
fragment, respectively. A comparison of the sequence of the 1223bp fragment with the reference
gene showed 99% compliance. The translated form shows a difference in position 218 only where
alanine had replaced valine. The results of the ELISA test for assessing the toxigenicity of all the
strains carrying the entC gene showed that 37% of the strains contained the gene.
Conclusion: Not only coagulase positive Staphylococcus aureus strains but also coagulase
negative strains produce superantigenic enterotoxins. This research provides a simple and fast
method of detecting toxigenicity of the Staphylococcus aureus bacteria and a method of
standardizing detection of enterotoxin C-producing strains, because the detection of superantigenic
enterotoxins can be a very valuable help intreating patients infected with them and preventing
further complications.
Keywords: Standardization, Staphylococcus Aureus, entC, PCR
Introduction Staphylococcus aureus is the most common
opportunistic pathogenic organism which is
reportedly found in 30% of healthy carriers
and which produces toxin in 50% of the
isolated human strains [1, 2]. In recent years,
the toxigenicity of Staphylococcus aureus has
attracted the attention of scientists for
different reasons. A)some coagulase negative
strains, too, have been able to generate
enterotoxins causing food poisoning [3].
This has reduced the validity of the coagulase
test in determining the toxigenicity of
Staphylococcus aureus. B)all toxins
generated by these bacteria show a
superantigenic activity which can make for
various effects on the host [4]. C) this type of
bacteria is reported to have connections to
non-digestive diseases [5, 6]. D) researches
have shown that the Staphylococcus bacteria
which produce toxic shock syndrome toxins
always creates enterotoxin C [7, 8].E),
According to some researches,
Dow
nloa
ded
from
mili
tary
med
j.ir
at 1
5:49
+04
30 o
n S
unda
y A
pril
12th
202
0
Ataee RA. et al.
Ir J Military Medicine Vol. 14, No. 3, Autumn 2012
Staphylococcus enterotoxins can be used as
an antineoplastic drug [8-10] and as an
accelerating agent in treating broken bones of
animals [11]. Although the prevalence of the
toxigenic strains of this type of bacteria has
not been precisely specified, according to
many reports, these bacteria have been
isolated from dairy products [12] and
different infections [13]. So far, 20 types of
Staphylococcus aureus antigenic
enterotoxins have been introduced and
named [14]. Enterotoxin C is one of the five
most widespread enterotoxins involved in
food poisoning and the toxic shock
syndrome. It has also been suggested that
Staphylococcus enterotoxin C (SEC) has a
role in deteriorating infection in experimental
animal models. This toxin has three biotypes:
SEC1, SEC2 and SEC3.(A sentence missed
here) Staphylococcus enterotoxins are
notorious for causing food poisoning in vitro,
which means eating contaminated food can
result into food poisoning. This fact reveals
that these Enterotoxins are resistant to
digestive enzymes. Although the
superantigenic mechanism of these
enterotoxins and their function in the
digestive system are known, exactly how
they affect the other parts of the body is not
yet clear. It is believed that the SEC-coding
gene is located on the plasmid carrying the
antibiotic-resistant gene [15], which accounts
for its possible prevalence and dissemination.
This is why enterotoxin C is the most
widespread food-poisoning agent in dairy
products after SEC. Although the
relationship between entC and entA is not yet
clear, some of the strains producing entC
generate other enterotoxins as well as the
toxin responsible for the toxic shock
syndrome at the same time. This is why food
poisoning epidemies are common [16].
Because of the widespread distribution of
Staphylococcus bacteria in nature and their
ability to produce different types of
enterotoxins, all sorts of food are exposed to
contamination with enterotoxins. Even
aquatics such as shrimps have been reported
to be contaminated with Staphylococcus
enterotoxins [17]. It should be noted that
enterotoxins are not only created by
coagulase-positive Staphylococcus bacteria
but, as recent studies have shown, also by
coagulase-negative ones…. [18, 19].
Although the role of enterotoxins in causing
non-digestive diseases is not clear, the
presence of Staphylococcus enterotoxins
genes has been reported in patients suffering
from atopic dermatitis, psoriasis and
erythema [20], which reveals the possible
role of enterotoxins in some diseases. Malam
et al (1992) have referred to the sudden death
of babies as a result of accumulation of
Staphylococcus enterotoxins in kidnies [21].
It is worth noting that the sequence of the
Enterotoxins- coding genes vary in different
geographical areas [22]. Yet, it is not clear
whether or not this variation in the gene
sequence causes changes in the sequence of
amino acids and specific antibodies. In any
case, since identifying pathogenic
Staphylococcus aureus depends on coagulase
tests, and because coagulase-negative
Staphylococci can produce superantigenic
enterotoxins, the detection of the toxigenicity
of these bacteria while carrying out coagulase
tests can be of great help in providing the
accurate diagnosis and preventing further
complications. Accordingly, it is
unavoidably necessary to standardize the
detection of enterotoxin-producing strains,
especially for epidemiological studies. In
addition, it has been reported that there is a
relationship between the ability to produce
enterotoxins and resistance to methicillin [23,
24], but it is not yet clear whether resistance
to methicillin makes for the induction of
enterotoxins or vice versa. In view of the
above explanations, the aim of this study is to
standardize the method for detecting the SEC
gene isolated from clinical specimens.
Dow
nloa
ded
from
mili
tary
med
j.ir
at 1
5:49
+04
30 o
n S
unda
y A
pril
12th
202
0
Standardizing Molecular Detection and Sequencing of entC Gene of Staphylococcus Aureus
Ir J Military Medicine Vol. 14, No. 3, Autumn 2012
Methods Materials: The molecular material needed
for this research was purchased from an
Iranian company called Sinagene, which is a
provider of Fermentase products in Iran. The
culture media were bought from Arya Vajd
Company, which sells German Merck in Iran.
The PCR product extraction kit (DNA
Extraction; Cat. No. K- 3032, Lot No. 10032)
was bought from Takapoozist, which sells
Bioneer products in Iran. The kit for
detecting enterotoxins was purchased from
Rocket International, providing the r-
Biofarm products.
Methods: In this experimental research, a
method was set up for detecting enterotoxin
C (entC) genes in Staphylococcus aureus
strains isolated from patients. Three hundred
strains of Staphylococcus aureus strains
isolated from clinical specimens were studied
and the strains bearing entC genes were
examined with RIDASCREEN SET
A,B,C,D,E: Art. No.: R4101 in terms of
producing enterotoxin C. Also, using
immunoblot analysis and monospecific
polyclonal antibodies (Rb PAb
Staphylococcus enterotoxin C 500 Ug
(1mg/ml), Ab 15897, Abcam) the existence
of enterotoxin C was confirmed.
Criteria for choosing bacterial strains were as
follows. The bacteria isolated from the
culture of infected specimens with gram-
positive cocci in grape-like clusters, positive
catalase, positive coagulase, positive DNase
and ability to grow in mannitol salt agar
media were included in this research. Thus,
300 strains of Staphylococcus aureus studied
were isolated from superficial infections,
blood, stool, throat culture, urine and spinal
fluid. In order to preserve the strains, 20%
glycerol was added to their 18-hour culture
and they were kept in a freezer at a
temperature of -20 degree Celsius.
Bacteria culture and genome
extraction:The genomes were extracted
using a slightly-changed slating-out method
[25]. The colonies of each bacterium were
separately inoculated into LB culture media
and after 24 hours of incubation, 1ml of it was
put in 2ml sterile tubes and centrifuged for 10
minutes at g x 5000. The supernatant fluid
was discarded and the remaining part was
added to and completely mixed with the
cellular sediment of a 400μl STE buffer
solution. 125μl of a 2% SDS solution and
250μl of a 3-molar sodium stat solution were
added to it and inverted for 10 times to
complete mixing. The material was then
centrifuged for 5 minutes at g x 5000. At this
point, the genome entered the supernatant
fluid. This fluid was then transferred into a
sterile tube where, after adding 750μl of cold
isopropanol (or absolute ethanol) to it, the
materials were slowly mixed and the mixture
was kept in the freezer at -20 degrees for one
hour and sometimes overnight. Then, the
solution was centrifuged for 5 minutes at g x
12000 and 4 degrees Celsius, and then the
supernatant fluid was discarded. The
sediments were completely dried and 750μl
of cold 70% ethanol was added to it and after
being frozen for 1 hour at -20 degrees Celsius
was centrifuged for 5 minutes at g x 12000
and 4 degrees Celsius. Again, the supernatant
fluid was discarded and the sediment was
thoroughly dried. Fifty μl of a TE buffer
solution was added to the sediment and the
product was kept at 35 degrees Celsius for 45
minutes. Then, the DNA concentration was
measured using a NanoDrop unit. One μl of
the resulted genome solution was put as a
template in special PCR tubes and frozen at -
20 degrees Celsius. Whenever necessary,
each of the tubes was taken out of the freezer
and after preparing gradients, were used for
PCR purposes.
Primers: Two pairs of primers were utilized
in this research. After studying many articles,
one pair of primers, which had been
frequently used by researchers and had the
sequence of
Dow
nloa
ded
from
mili
tary
med
j.ir
at 1
5:49
+04
30 o
n S
unda
y A
pril
12th
202
0
Ataee RA. et al.
Ir J Military Medicine Vol. 14, No. 3, Autumn 2012
F1: 5TGTATGTATGGAGGTGTAAC-3
and R1: 5-
AATTGTGTTTCTTTTATTTTCATAA,
was chosen [17]. Using the sequence of the
reference entC gene, the other pair was
taken from the Gene Bank: AB084256.1 and
designed as the specific pair using the Alel
ID software and with the sequence
F2: 5-GGAATGTTGGATGAAGGAG-3
and R2: 5-
TATGGACACAATGATACTGG-3. These
pairs were then synthesized by Sina-Gene
Company. According to bioinformatics
analyses, the primer pair of F1 and R1
multiplied a 102bp fragment and the primer
pair of F2 and R2 multiplied a bp
1223fragment.
Polymerase chain reaction:A polymerase
chain reaction was done to multiply the
bp102 fragment based on the protocol given
in Table 1.
Table 1) Conditions of Carrying of the PCR for Detecting the Complete entC Gene with a 102bp in Staphylococcus
Strains Isolated from Clinical Specimens
Master Mix PCR Condition reaction
Reagents Reagents Step Condition
reaction Time
D.D. Water 18.6μl Denaturation primal 95 C 3 min
Template DNA 15 ng/0.5μl
Buffer 1X 15 ng/0.5μl Denaturation 94 C 30 sec
MgCl2 1 mM/1μl Annealing 53 C 30 sec / 35 cycles
dNTP 0.2 mM each/0.7 μl Elongation 72 C 5 min
F1- Primer 0.3 mM/1 μl Final Extension
R1- Primer 0.3 mM/1μl
Incubation 4 5 min Taq enzyme 2 unit/0.3μl
Total 25
Table 2) Conditions of Carrying of the PCR for Identifying the Complete entC Gene with a 1223bp in
Staphylococcus Strains Isolated from Clinical Specimens
Master Mix PCR Condition reaction
Reagents Reagents Step Condition
reaction Time
D.D. Water 16.9μl Denaturation primal 95 C 4 min
Template DNA 15 ng/1μl
Buffer 1X 2.5μl Denaturation 94 C 40 sec / 35 cycles
MgCl2 1 mM/1.5μl Annealing 60 C 40 sec / 35 cycles
dNTP 0.5 mM, each 0.7μl Elongation 72 C
6 sec / 35cycles
10min / 1 cycle F1- Primer 0.3 mM/1 μl Final Extension
R1- Primer 0.3 mM/1μl
Incubation 4 5 min Taq enzyme 2 unit/0.4μl
Total 25
Dow
nloa
ded
from
mili
tary
med
j.ir
at 1
5:49
+04
30 o
n S
unda
y A
pril
12th
202
0
Standardizing Molecular Detection and Sequencing of entC Gene of Staphylococcus Aureus
Ir J Military Medicine Vol. 14, No. 3, Autumn 2012
Figure 2) The process of detection and purification of a portion of an entC gene in the localized Staphylococcus
aureus bacteria for the purpose of sequencing. Picture A, which depicts wells 1, 2, 3, 9, 11, 13, 14 and 15, reveals
that in well 8, the standard molecular weight is 50bp. Picture B shows wells 5 and 6 of the 102bp fragment, where
well 8 is the standard molecular mass of the 100bp fragment. Picture C shows wells 1-6 of the optimized conditions
of the PCR, where well 8 is the standard molecular mass of the 100bp fragment. Picture D is a depiction of wells 1-5
and a repetition of well 5 of the purification of the 102bp fragment. Well 7 is the standard molecular mass of 50bp.
In order to optimize the PCR conditions, a
temperature gradient (of 46-56 C),
magnesium chloride concentration gradient
(of 5.1 – 8.0 mM) and a template
concentration gradient (of 10 -100 ng/ml of
the extracted genome) were utilized. This
reaction was carried out using the Thermal
Cycler, C1000 manufactured by Bio-RAD.
The PCR product was electrophoresed with
agarose gel of 1 -1.5%, stained with ethidium
Figure 1 . The left picture depicts measuring the concentration of the DNA extracted from Staphylococcus
aureus bacteria. Concentration ranges 2-10 and 3-10 were used at templates. The right picture (A) shows
the electrophoresis of 2-3μl of the genome extracted from the specimens using the salting out method
(wells 1-5) and picture B shows the extraction of the genome with the Genome DNA Extraction kit of
Bioneer company (wells 1-4).
Dow
nloa
ded
from
mili
tary
med
j.ir
at 1
5:49
+04
30 o
n S
unda
y A
pril
12th
202
0
Ataee RA. et al.
Ir J Military Medicine Vol. 14, No. 3, Autumn 2012
bromide and examined under ultraviolet light
(of a Gel Doc). In order to determine the
sequence, the certain band was purified using
a PCR product extraction kit and was sent to
an Iranian company called Nasl-e Omid.
Since it is possible for the part making up the
bp102 fragment to be shared by other
enterotoxins, primers F2 and R2 were
designed and used which multiplied complete
entC genes and the bp1223 fragment. In fact,
the PCR was run to multiply the bp1223
fragment based on the protocol given in
Table 2. A temperature gradient (of 53 – 62.9
C), a magnesium chloride concentration
gradient (of 1 -2 mM)
and a template concentration (of 10 – 100 ng/l
of the extracted genome) were used.
Detection of toxigenecity: All the strains
which were confirmed as carrying the entC
gene using the molecular PCR method were
inducted into the BHI-broth culture medium
and centrifuged after 24 hours of incubation.
The supernatant fluid was then checked for
the presence of entC using an ELISA kit.
Also, as a quality control process, the
toxigenicity of the non-entC-carrying strains
were tested using ELISA. In order to carry
out the ELISA test, a specific kit of detecting
5 most widespread enterotoxins of
Staphylococcus aureus (RIDASCREEN SET
A,B,C,D,E: Art. No.: R41011), manufactured
by the German company of r-Biofarm was
used and the company instructions were
followed.
Results The results of phenotype testing on all strains
confirmed that they were all Staphylococcus
aureus bacteria, and thus 300 strains were
included in the study. The results of
extracting the genomes of all the strains using
a slightly-changed salting out method were
comparable to those of commercial kits.
Figure 1 shows the concentration
measurement and electrophoresis of the
genome extracted from the Staphylococcus
aureus bacteria.
The results of optimizing the multiplication
of a portion of an entC gene are shown in
Figure 2. Picture A depicts the PCR with a
temperature gradient (of 46-56 C) and an
Mgcl2 gradient (of 5.1-8.0 mM). The
multiplication of the entC in non-optimum
conditions generated a band in the 102bp
area. In picture B, by producing optimum
temperature conditions (a gradient of 47-57
C), the PCR product made a strong band in
the 102bp area in wells 5 and 6. In picture C,
using the optimum temperature conditions
(51.9 C) an optimum (2 millimolar)
concentration of MgCl2 and the primers, the
chosen bands were amplified and the other
bands were eliminated. Picture D depicts the
purification of the PCR product and its
preparation for sending to be sequenced.
Since previous researches have reported the
entC gene to be 613-1095bp long, tracing the
102bp fragment in various strains of
Staphylococcus might not properly represent
entC. Accordingly, and based on the existing
sequence in the gene bank, primers were
designed which could multiply a 1223bp
fragment with 128 bases more than the given
sequence (Figure A3). By providing the
optimum conditions, as Table 2 reveals, the
PCR came to be the 1223bp fragment. Picture
B in Figure 3 shows the purified PCR product
which was prepared to be sent for
sequencing.
The entC sequencing results:A comparison
of the gene sequencing of this research with
the entC gene of the gene bank (GeneBank:
X05815.1) is given in Figure 3. As shown in
the Figure, in base 104, amino acid A has
replaced T; in base 636, amino acid G has
replaced A; in base 659, amino acid C has
replaced T; in base 980, amino acid T and in
base 1049 amino acid G have been replaced.
In this research, primers were used which had
multiplied a fragment of about 1223bp. A
comparison of the PCR product sequencing
Dow
nloa
ded
from
mili
tary
med
j.ir
at 1
5:49
+04
30 o
n S
unda
y A
pril
12th
202
0
Standardizing Molecular Detection and Sequencing of entC Gene of Staphylococcus Aureus
Ir J Military Medicine Vol. 14, No. 3, Autumn 2012
reveals that bases 91-1056 match and there is
no match in 6 sequences only, while the
translated sequences showed a mismatch in
one amino acid only (Figure 4).
The results of ELISA test for confirming
the production of enterotoxin C:The results
of ELISA testing on the strains with and
without entC are shown in Figure 6. As
shown, columns 9 and 10 include the strains
that produced enterotoxin C only. Columns 1,
2, 4 and 6 show the strains which produced
enterotoxin A only. Columns 3 and 7 are
populated by the strains which produced no
enterotoxins at all. Column 8 concerns the
strains that produced a little of enterotoxins B
and C and much enterotoxin E. Columns 11
gives the strains that produced much
enterotoxin A but little of enterotoxins D and
E. Column 12 contains the strains that
produced enterotoxins C and E. The PCR
with the strains studied in columns 8, 9, 10
and 12 confirms the existence of entC in
them. In this picture, rows F and G are
negative controls and row H is a positive
control related to the standard enterotoxin (2-
10 ng/ml) in the ELISA kit.
The results of studying 300 strains of
Staphylococcus aureus using the molecular
PCR showed that 37% of the strains
contained the entC gene. But ELISA revealed
that only 11% of the strains produced the
entC gene exclusively while the remaining
26% of the strains generated enterotoxin C as
well as other types of enterotoxins. In Figure
6, columns 3 and 7 contain strains of
Staphylococcus that produced none of the 5
most widespread types of enterotoxins.
Columns 1, 2, 4 and 6, however, include the
strains that produced enterotoxin A without
being carriers of the entC gene. Both the
ELISA kit and immunoblotting confirmed
that the strains containing the entC gene
produced enterotoxin.
Discussion In this research, the existence of the entC
gene in Staphylococcus strains and their
ability to make enterotoxin were confirmed
using both an ELISA kit with the sensitivity
of RICASCREEN SET A, B, C, D, E (0.2
ng/ml) and immunoblot analysis (Figure 6).
Figure 3) The optimized conditions of the complete entC
gene in Staphylococcus aureus strains. In picture A, wells
1-12 show the multiplied 1223bp fragment. Well 14 is the
standard molecular weight of 1kb. Picture B shows wells
1-6 of preparing the PCR product for sequencing. Well 7
is the standard molecular weight of 1kb.
Dow
nloa
ded
from
mili
tary
med
j.ir
at 1
5:49
+04
30 o
n S
unda
y A
pril
12th
202
0
Ataee RA. et al.
Ir J Military Medicine Vol. 14, No. 3, Autumn 2012
Figure 2) A comparison of the sequence provided by this study and the standard Staphylococcus aureus
of the gene bank coded X.5815.1
Dow
nloa
ded
from
mili
tary
med
j.ir
at 1
5:49
+04
30 o
n S
unda
y A
pril
12th
202
0
Standardizing Molecular Detection and Sequencing of entC Gene of Staphylococcus Aureus
Ir J Military Medicine Vol. 14, No. 3, Autumn 2012
Figure 3) A comparison of the amino acid sequence obtained in this study with the translated sequence of the
standard gene of entC1 reveals that, of amino acids 46-321, there is only one mismatch in amino acid 218.
Figure 4) The results of the ELISA reaction with the pre-provided in the kit of RICASCREEN
SET A,B,C,C,E manufactured by the German company of r-Biofarm. The ELISA test was carried
out following the instructions provided by the manufacturing company and the plate picture was
scanned. This picture depicts the undersurface of the plate.
Dow
nloa
ded
from
mili
tary
med
j.ir
at 1
5:49
+04
30 o
n S
unda
y A
pril
12th
202
0
Ataee RA. et al.
Ir J Military Medicine Vol. 14, No. 3, Autumn 2012
Only 11% of the entC-carrying strains
produced enterotoxin C only, while other
strains produced not only enterotoxin C but
also other types of enterotoxins. The reason
for this is not completely clear and it is not
possible to say exactly why one bacterial
strain can make more than one type of
enterotoxin. The ability to produce multiple
types of enterotoxins, however, has been
reported by other researchers, too. As Ifesan
et al showed in 2009, some Staphylococcus
aureus strains generated more than one type
of enterotoxin [26]. Many studies have been,
or are being, carried out to gain a precise
knowledge of the role of enterotoxins, of the
mechanism of their functioning and of their
specific receptors. Perhaps one of the reasons
for these intensive researches on the role of
enterotoxins of Staphylococcus aureus [27] is
the provocation of various types of cytokines
including IL-1 and TNF-α [28].
Since these poisons are involved in causing
various diseases and detecting them is
possible only by means of standard strains
which cannot be bought and since the strains
bought may not be compatible with the
ecological features of this region, and
because correct diagnosis can make for good
treatment and can prevent later complications
caused by these superantigenic enterotoxins,
it is very important to develop a standard fast
method for detection of enterotoxin-
producing strains. Furthermore, the
emergence, in recent years, of
Staphylococcus bacteria which are resistant
to methicillin and its relationship with the
increased potential of toxigenicity have
created worries [29, 30] because the variety
of diseases caused by enterotoxins has made
it necessary to develop new methods of
detecting them and of treating related
illnesses [31, 32]. Some countries have
developed standard methods for detecting
each and every strain which produces
enterotoxins and have identified the accurate
criteria for detecting such strains in food and
clinical specimens. For instance, American
Type Culture Collection (ATCC), which is a
center for collecting and storing bacteria in
the US, has developed standard methods for
detecting all groups of bacteria. In a similar
fashion, Marr et al (1993) studied the
features of various types of enterotoxin C and
reported the 240 amino acids for each of
them. They showed that the sequence of the
first 10 amino acids of their enterotoxins
were ESQPDPTPDE and the last 10 amino
acids IEVHLTTKNG [33]. In fact, their gene
sequence contains about 720 base pairs.
Other researches have reported a fragment of
820 base pairs. There are yet other researches
which have chosen parts of the toxin for
detection purposes. For instance, some have
developed a primer which multiplies a 102bp
fragment or one that multiplies a 283bp
fragment. Another study yet involves
developing a primer which multiplies a
490bp fragment. As can be seen, none of the
reported fragments can truly represent a type
of enterotoxin C.
In this research, a primer was developed that
multiplied a 1223bp fragment in order to
trace and develop a standard method of
detecting the entC gene. In fact, the part
starting from the beginning of the peptide
signal and 250bp after the gene was
considered. In this way, the 1223bp fragment
was multiplied. As shown in Figure 4, the
bases 92-1057 were readable in the
sequencing machine. Although a comparison
of the results with the reference gene reveals
mismatches in 4 bases only, the translated
sequence demonstrated that the first 10
amino acids started from number 65 and
continued up to number 304, and that there
was a mismatch in one amino acid only. That
is, as depicted in Figure 5, in number 208,
alanine amino acid has replaced valine,
which points to a new sequence which is local
to this region.
Due to the importance of the pathogenicity of
Staphylococcus aureus enterotoxins,
Dow
nloa
ded
from
mili
tary
med
j.ir
at 1
5:49
+04
30 o
n S
unda
y A
pril
12th
202
0
Standardizing Molecular Detection and Sequencing of entC Gene of Staphylococcus Aureus
Ir J Military Medicine Vol. 14, No. 3, Autumn 2012
researches are continually done on
standardizing the new methods of detecting
them. For example, Fischer et al developed
the quantitative method of real-time immuno-
PCR using standard strains of the ATCC in
order to detect enterotoxins A and B [34].
They were successful because of their access
to the standard strains of the ATCC. Also,
Veras et al (2008) detected enterotoxin C by
developing a 283bp fragment.
Since access to existing standard world
strains is limited and geographical variations
may affect the type of features attributed to
the standard strains in other regions,
identifying the necessary standards for
detecting local strains of Staphylococcus
aureus producing enterotoxins (including
entC) is unavoidable. Since genetic
variations have been reported in various
strains of Staphylococcus aureus [35], using
a reference gene model and by developing a
proper primer, a method was developed for
identifying the entC1-producing strains of
Staphylococcus aureus. This is because
relying on coagulase-positivity feature of the
Staphylococcus bacteria in clinical
specimens is not sufficient. As shown in
Figure 6, in spite of the presence of the entC
gene in them, the strains are different in terms
of their ability to produce enterotoxin. Thus,
the question is whether a bacterium which
can produce more than one type of
enterotoxin remains unchanged in terms of its
level of pathogenicity and whether a fixed
treatment would bring about a fixed result. In
addition, some of the coagulase-negative
strains isolated from clinical or food
specimens produced various types of
enterotoxins. Although different studies have
reported different prevalence rates of
enterotoxin-producing Staphylococcus
aureus strains (5.3% to 88%), there is no
precise and reliable statistics on the incidence
rate of infections caused by such strains
because there is no standard strain available.
By standardizing a method of detecting
strains producing enterotoxin C1, this study
has partly prepared the situation for careful
epidemiological studies of clinical specimens
and food contaminations. Thus, standardized
strains are ready to be offered to other
researchers for further research.
Acknowledgements This research project was sponsored by the
Center for Applied Research on Microbial
Toxins of Baqiyatallah University of Medical
Sciences. We are grateful then for the full
support offered by Professor Mostafa Qaneie.
We would also like to express our gratitude
to Dr Mohammad Javad Soltanpour and Dr
Mohammad Rahbar for providing us with
Staphylococcus strains isolated from
patient’s infections.
References 1- Collery MM, Smyth DS, Twohig JM, Shore AC,
Coleman DC, Smyth CJ. Molecular typing of nasal
carriage isolates of Staphylococcus aureus from an
Irish university student population based on toxin gene
PCR, agr locus types and multiple locus, variable
number tandem repeat analysis. J MeC Microbiol.
2008;57: 348-358.
2- Mandell L Gerlac, Bennett E John, Dolin Raphael.
Mandell, Douglas, and Bennett’s. Principles and
practice of infectious diseases. 7th ed. Churchill
livingstone. 2010;2:2543.
3- Veras JF, Do Carmo LS, Tong LC, Shupp JW,
Cummings C, Dos Santos DA . A study of the
enterotoxigenicity of coagulase-negative and
coagulase-positive staphylococcal isolates from food
poisoning outbreaks in Minas Gerais, Brazil. Int J
Infect dis. 2008;12: 410-415.
4- Schlievert PM, Case LC: Molecular analysis of
staphylococcal superantigens. Methods Mol Biol.
2007;391:113-126.
5- Suenaga T, Suzuki H, Shibuta S, Takeuchi T,
Yoshikawa N: Detection of multiple superantigen
genes in stools of patients with Kawasaki disease. J
PeCiatr. 2009;155:266-270.
6- Van ZT, Vaneechoutte M, Holtappels G, Gevaert P,
van CP, Bachert C: Detection of enterotoxin DNA in
Staphylococcus aureus strains obtained from the
middle meatus in controls and nasal polyp patients.
Am J Rhinol. 2008; 22:223-227.
7- Kim JS, Kim HS, Song W, Cho HC, Lee KM, Kim
EC: [Molecular epidemiology of methicillin-resistant
Staphylococcus aureus isolates with toxic shock
Dow
nloa
ded
from
mili
tary
med
j.ir
at 1
5:49
+04
30 o
n S
unda
y A
pril
12th
202
0
Ataee RA. et al.
Ir J Military Medicine Vol. 14, No. 3, Autumn 2012
syndrome toxin and staphylococcal enterotoxin C
genes]. Korean J Lab MeC. 2007;27: 118-123.
8- Crass BA, Berg Coll MS: Toxin involvement in
toxic shock syndrome. J Infect Cis. 1986;153:918-926.
9- Wang X, Xu M, Zhang H, Liu J, Li X, Zhang.
Enhancement of superantigen activity and antitumor
response of staphylococcal enterotoxin C2 by site-
directed mutagenesis. Cancer Immunol Immunother.
2009, 58:677-686.
10- Xu M, Wang X, Cai Y, Zhang H, Yang H, Liu C
et al. An engineered superantigen SEC2 exhibits
promising antitumor activity and low toxicity. Cancer
Immunol Immunother. 2011;60:705-713.
11- Wan XC, Liu CP, Li M, Hong D, Li DM, Chen
HX. Staphylococcal enterotoxin C injection in
combination
with ascorbic acid promotes the differentiation of bone
marrow-derived mesenchymal stem cells into
osteoblasts in vitro. Biochem Biophys Res Commun.
2008;373:488-492.
12- Cui JC, Zhang BJ, Lin YC, Wang QK, Qian AD,
Nakane A: Protective effect of glutathione S-
transferase-fused mutant staphylococcal enterotoxin C
against Staphylococcus aureus-induced bovine
mastitis. Vet Immunol Immunopathol. 2010;135:64-
70.
13- Zaraket H, Otsuka T, Saito K, Dohmae S, Takano
T, Hi guchi W. Molecular characterization of
methicillin-resistant Staphylococcus aureus in
hospitals in Niigata, Japan: divergence and
transmission. Microbiol Immunol. 2007;51:171-176.
14- Collery MM, Smyth DS, Tumilty JJ, Twohig JM,
Smyth CJ. Associations between enterotoxin gene
cluster types egc1, egc2 and egc3, agr types,
enterotoxin and enterotoxin-like gene profiles, and
molecular typing characteristics of human nasal
carriage and animal isolates of Staphylococcus aureus.
J Med Microbiol. 2009;58:13-25.
15- Bayles KW, IanColo JJ. Genetic and molecular
analyses of the gene encoding staphylococcal
enterotoxin C. J Bacteriol. 1989;171:4799-4806.
16- Giezendanner N, Meyer B, Gort M, Muller P,
Zweifel C. Raw milk-associated Staphylococcus
aureus intoxication in children. Schweiz Arch
TierheilkC. 2009;151:329-331.
17- Beckers HJ, Van Leusden FM, Tips PD. Growth
and enterotoxin production of Staphylococcus aureus
in shrimp. J Hyg (Lond).1985;95:685-693.
18- Ataee RA, Mehrabi-Tavana A, Izadi M, Hosseini
SMJ, Ataee MH. Bacterial meningitis: a new risk
factor. JRMS. 2011; 16:207-210.
19- Zell C, Resch M, Rosenstein R, Albrecht T, Hertel
C, Gotz F. Characterization of toxin production of
coagulasenegative staphylococci isolated from food
and starter cultures. Int J FooC Microbiol.
2008;127:246-251.
20- Tomi NS, Kranke B, Aberer E. Staphylococcal
toxins in patients with psoriasis, atopic dermatitis, and
erythroderma, and in healthy control subjects. J Am
Acad Dermatol. 2005;53:67-72.
21- Malam JE, Carrick GF, Telford DR, Morris JA.
Staphylococcal toxins and sudden infant death
syndrome. J Clin Pathol. 1992;45:716-721.
22- Larsen HD, Aarestrup FM, Jensen NE.
Geographical variation in the presence of genes
encoding superantigenic exotoxins and beta-
hemolysin among Staphylococcus aureus isolated
from bovine mastitis in Europe and USA. Vet
Microbiol. 2002; 85: 61-67.
23- Limbago B, Fosheim GE, Schoonover V, Crane
CE, Nadle J, Petit S. Characterization of methicillin-
resistant Staphylococcus aureus isolates collected in
2005 and 2006 from patients with invasive disease: a
population-based analysis. J Clin Microbiol.
2009;47:1344-1351.
24- Gould IM, Girvan EK, Browning RA, MacKenzie
FM, Edwards GF. Report of a hospital neonatal unit
outbreak of community-associated methicillin-
resistant Staphylococcus aureus. Epidemiol Infect.
2009;137:1242-1248.
25- Sombrok Joseph, and Rufell W David. Molecular
Cloning. Coldspring New York. 3rd ed. 2001; Vol 1:
6.4.
26- Ifesan BO, Voravuthikunchai SP: Effect of
Eleutherine Americana Merr. extract on enzymatic
activity and enterotoxin production of Staphylococcus
aureus in broth and cooked pork. Foodborne Pathog
Dis. 2009;6:699-704.
27- Seishima M, Kato G, Shibuya Y, Matsukawa S:
Cytokine profile during the clinical course of toxic
shock syndrome. Clin Exp Dermatol. 2009;34:632-
635.
28- Hu DL, Cui JC, Omoe K, Sashinami H, Yokomizo
Y, Shinagawa K: A mutant of staphylococcal
enterotoxin C devoid of bacterial superantigenic
activity elicits a Th2 immune response for protection
against Staphylococcus aureus infection. Infect
Immun. 2005;73:174-180.
29- Schlievert PM, Strandberg KL, Lin YC, Peterson
ML, Leung DY: Secreted virulence factor comparison
between methicillin-resistant and methicillin-sensitive
Staphylococcus aureus, and its relevance to atopic
dermatitis. J Allergy Clin Immunol. 2010;125:39-49.
30- Strandberg KL, Rotschafer JH, Vetter SM,
Buonpane RA, Kranz DM, Schlievert PM:
Staphylococcal superantigens cause lethal pulmonary
disease in rabbits. J Infect Dis. 2010;202:1690-1697.
31- Varshney AK, Wang X, Cook E, Dutta K, Scharff
MD, Goger MJ. Generation, characterization, and
epitope mapping of neutralizing and protective
monoclonal antibodies against staphylococcal
Dow
nloa
ded
from
mili
tary
med
j.ir
at 1
5:49
+04
30 o
n S
unda
y A
pril
12th
202
0
Standardizing Molecular Detection and Sequencing of entC Gene of Staphylococcus Aureus
Ir J Military Medicine Vol. 14, No. 3, Autumn 2012
enterotoxin B-induced lethal shock. J Biol Chem.
2011;286:9737-9747.
32- Hallin M, De MR, Denis O, Lefort A, El GF,
Butaye P et al. Diversity of accessory genome of
human and livestock-associated ST398 methicillin
resistant Staphylococcus aureus strains. Infect Genet
Evol. 2011; 11: 290-299.
33- Marr JC, Lyon JD, Roberson JR, Lupher M, Davis
WC, Boha GA Characterization of Novel Type C
Staphylococcal Enterotoxins:Biological and
Evolutionary Implications. Infection and Immunity.
1993;61(10):4254-4262.
34- Fischer A, von Eiff C, Kuczius T, Omoe K, Peters
G and Becker K. A quantitative real-time immuno-
PCR approach for detection of staphylococcal
enterotoxins. J Mol Med. 2007;85:461–469.
35- Diep BA, Gill SR, Chang RF, Phan TH, Chen JH,
Davidson MG. Complete genome sequence of
USA300, an epidemic clone of community-acquired
meticillin-resistant Staphylococcus aureus. Lancet.
2006; 367:731-739.
36- Humphreys H, Keane CT, Hone R, Pomeroy H,
Russell RJ, Arbuthnott JP. Enterotoxin production by
Staphylococcus aureus isolates from cases of
septicaemia and from healthy carriers. J Med
Microbiol. 1989; 28: 163-172.
37- Normanno G, Corrente M, La SG, Dambrosio A,
Quaglia NC, Parisi A. Methicillin-resistant
Staphylococcus aureus (MRSA) in foods of animal
origin product in Italy. Int J Food Microbiol.
2007;117:219-222.
38- Gonano M, Hein I, Zangerl P, Rammelmayr A,
Wagner M. Phenotypic and molecular characterization
of Staphylococcus aureus strains of veterinary, dairy
and human origin. Epidemiol Infect. 2009;137:688-
699.
39- Peeva T, Gogov I. Presence of enterotoxin D in
Staphylococcus aureus strains isolated from food
products. Vet Med Nauki. 1983; 20:67-71.
Dow
nloa
ded
from
mili
tary
med
j.ir
at 1
5:49
+04
30 o
n S
unda
y A
pril
12th
202
0
Ataee RA. et al.
Ir J Military Medicine Vol. 14, No. 3, Autumn 2012
Dow
nloa
ded
from
mili
tary
med
j.ir
at 1
5:49
+04
30 o
n S
unda
y A
pril
12th
202
0