Standardizing Molecular Detection of the entC Gene …militarymedj.ir/article-1-936-en.pdfStandardizing Molecular Detection and Sequencing of entC Gene of Staphylococcus Aureus Ir

Iranian Journal of Military Medicine Vol. 14, No. 3, Autumn 2012; 235 - 248

*Correspondant author: Ataee RA. Please, direct all correspondence to [email protected].

Standardizing Molecular Detection of the entC Gene of Staphylococcus

Aureus Isolated from Human Infections and Sequencing it

Ataee RA.*1 PhD, Kamali M.3 PhD, Ranjbar R.4 PhD, Karami A.4 PhD, Ghorbani M.2 MSc

1Department of Microbiology and Applied Microbiology Research Center, Baqiyatallah University of Medical

Sciences, Tehran, Iran 2 Applied Microbiology Research Center, Baqiyatallah University of Medical Sciences, Tehran, Iran 3 Nanothechnology Research Center, Baqiyatallah University of Medical Sciences, Tehran, Iran 4 Molecular Biology Research Center, Baqiyatallah University of Medical Sciences, Tehran, Iran

Abstract

Aims: The goal of this research is standardizing molecular detection of the entC gene of

Staphylococcus aureus isolated from human infections and determining its sequence.

Methods: At first, the primer was prepared using the standard gene in the gene bank. Then, the

molecular PCR method was set up to identify the entC gene in the Staphylococcus aureus bacteria

extracted from human specimens (300 strains). The PCR product was sequenced and compared

with the standard gene. Also, the ability of all entC gene carrier strains to produce enterotoxin C

was tested using an ELISA kit.

Results: The results showed that the molecular technique of PCR had been well set up with various

primers, because, the first and second primer pairs easily amplified a 102bp and a 1223bp

fragment, respectively. A comparison of the sequence of the 1223bp fragment with the reference

gene showed 99% compliance. The translated form shows a difference in position 218 only where

alanine had replaced valine. The results of the ELISA test for assessing the toxigenicity of all the

strains carrying the entC gene showed that 37% of the strains contained the gene.

Conclusion: Not only coagulase positive Staphylococcus aureus strains but also coagulase

negative strains produce superantigenic enterotoxins. This research provides a simple and fast

method of detecting toxigenicity of the Staphylococcus aureus bacteria and a method of

standardizing detection of enterotoxin C-producing strains, because the detection of superantigenic

enterotoxins can be a very valuable help intreating patients infected with them and preventing

further complications.

Keywords: Standardization, Staphylococcus Aureus, entC, PCR

Introduction Staphylococcus aureus is the most common

opportunistic pathogenic organism which is

reportedly found in 30% of healthy carriers

and which produces toxin in 50% of the

isolated human strains [1, 2]. In recent years,

the toxigenicity of Staphylococcus aureus has

attracted the attention of scientists for

different reasons. A)some coagulase negative

strains, too, have been able to generate

enterotoxins causing food poisoning [3].

This has reduced the validity of the coagulase

test in determining the toxigenicity of

Staphylococcus aureus. B)all toxins

generated by these bacteria show a

superantigenic activity which can make for

various effects on the host [4]. C) this type of

bacteria is reported to have connections to

non-digestive diseases [5, 6]. D) researches

have shown that the Staphylococcus bacteria

which produce toxic shock syndrome toxins

always creates enterotoxin C [7, 8].E),

According to some researches,

Dow

nloa

ded

from

mili

tary

med

j.ir

at 1

5:49

+04

30 o

n S

unda

y A

pril

12th

202

0

http://militarymedj.ir/article-1-936-en.html

Ataee RA. et al.

Ir J Military Medicine Vol. 14, No. 3, Autumn 2012

Staphylococcus enterotoxins can be used as

an antineoplastic drug [8-10] and as an

accelerating agent in treating broken bones of

animals [11]. Although the prevalence of the

toxigenic strains of this type of bacteria has

not been precisely specified, according to

many reports, these bacteria have been

isolated from dairy products [12] and

different infections [13]. So far, 20 types of

Staphylococcus aureus antigenic

enterotoxins have been introduced and

named [14]. Enterotoxin C is one of the five

most widespread enterotoxins involved in

food poisoning and the toxic shock

syndrome. It has also been suggested that

Staphylococcus enterotoxin C (SEC) has a

role in deteriorating infection in experimental

animal models. This toxin has three biotypes:

SEC1, SEC2 and SEC3.(A sentence missed

here) Staphylococcus enterotoxins are

notorious for causing food poisoning in vitro,

which means eating contaminated food can

result into food poisoning. This fact reveals

that these Enterotoxins are resistant to

digestive enzymes. Although the

superantigenic mechanism of these

enterotoxins and their function in the

digestive system are known, exactly how

they affect the other parts of the body is not

yet clear. It is believed that the SEC-coding

gene is located on the plasmid carrying the

antibiotic-resistant gene [15], which accounts

for its possible prevalence and dissemination.

This is why enterotoxin C is the most

widespread food-poisoning agent in dairy

products after SEC. Although the

relationship between entC and entA is not yet

clear, some of the strains producing entC

generate other enterotoxins as well as the

toxin responsible for the toxic shock

syndrome at the same time. This is why food

poisoning epidemies are common [16].

Because of the widespread distribution of

Staphylococcus bacteria in nature and their

ability to produce different types of

enterotoxins, all sorts of food are exposed to

contamination with enterotoxins. Even

aquatics such as shrimps have been reported

to be contaminated with Staphylococcus

enterotoxins [17]. It should be noted that

enterotoxins are not only created by

coagulase-positive Staphylococcus bacteria

but, as recent studies have shown, also by

coagulase-negative ones…. [18, 19].

Although the role of enterotoxins in causing

non-digestive diseases is not clear, the

presence of Staphylococcus enterotoxins

genes has been reported in patients suffering

from atopic dermatitis, psoriasis and

erythema [20], which reveals the possible

role of enterotoxins in some diseases. Malam

et al (1992) have referred to the sudden death

of babies as a result of accumulation of

Staphylococcus enterotoxins in kidnies [21].

It is worth noting that the sequence of the

Enterotoxins- coding genes vary in different

geographical areas [22]. Yet, it is not clear

whether or not this variation in the gene

sequence causes changes in the sequence of

amino acids and specific antibodies. In any

case, since identifying pathogenic

Staphylococcus aureus depends on coagulase

tests, and because coagulase-negative

Staphylococci can produce superantigenic

enterotoxins, the detection of the toxigenicity

of these bacteria while carrying out coagulase

tests can be of great help in providing the

accurate diagnosis and preventing further

complications. Accordingly, it is

unavoidably necessary to standardize the

detection of enterotoxin-producing strains,

especially for epidemiological studies. In

addition, it has been reported that there is a

relationship between the ability to produce

enterotoxins and resistance to methicillin [23,

24], but it is not yet clear whether resistance

to methicillin makes for the induction of

enterotoxins or vice versa. In view of the

above explanations, the aim of this study is to

standardize the method for detecting the SEC

gene isolated from clinical specimens.

Dow

nloa

ded

from

mili

tary

med

j.ir

at 1

5:49

+04

30 o

n S

unda

y A

pril

12th

202

0


Standardizing Molecular Detection and Sequencing of entC Gene of Staphylococcus Aureus


Methods Materials: The molecular material needed

for this research was purchased from an

Iranian company called Sinagene, which is a

provider of Fermentase products in Iran. The

culture media were bought from Arya Vajd

Company, which sells German Merck in Iran.

The PCR product extraction kit (DNA

Extraction; Cat. No. K- 3032, Lot No. 10032)

was bought from Takapoozist, which sells

Bioneer products in Iran. The kit for

detecting enterotoxins was purchased from

Rocket International, providing the r-

Biofarm products.

Methods: In this experimental research, a

method was set up for detecting enterotoxin

C (entC) genes in Staphylococcus aureus

strains isolated from patients. Three hundred

strains of Staphylococcus aureus strains

isolated from clinical specimens were studied

and the strains bearing entC genes were

examined with RIDASCREEN SET

A,B,C,D,E: Art. No.: R4101 in terms of

producing enterotoxin C. Also, using

immunoblot analysis and monospecific

polyclonal antibodies (Rb PAb

Staphylococcus enterotoxin C 500 Ug

(1mg/ml), Ab 15897, Abcam) the existence

of enterotoxin C was confirmed.

Criteria for choosing bacterial strains were as

follows. The bacteria isolated from the

culture of infected specimens with gram-

positive cocci in grape-like clusters, positive

catalase, positive coagulase, positive DNase

and ability to grow in mannitol salt agar

media were included in this research. Thus,

300 strains of Staphylococcus aureus studied

were isolated from superficial infections,

blood, stool, throat culture, urine and spinal

fluid. In order to preserve the strains, 20%

glycerol was added to their 18-hour culture

and they were kept in a freezer at a

temperature of -20 degree Celsius.

Bacteria culture and genome

extraction:The genomes were extracted

using a slightly-changed slating-out method

[25]. The colonies of each bacterium were

separately inoculated into LB culture media

and after 24 hours of incubation, 1ml of it was

put in 2ml sterile tubes and centrifuged for 10

minutes at g x 5000. The supernatant fluid

was discarded and the remaining part was

added to and completely mixed with the

cellular sediment of a 400μl STE buffer

solution. 125μl of a 2% SDS solution and

250μl of a 3-molar sodium stat solution were

added to it and inverted for 10 times to

complete mixing. The material was then

centrifuged for 5 minutes at g x 5000. At this

point, the genome entered the supernatant

fluid. This fluid was then transferred into a

sterile tube where, after adding 750μl of cold

isopropanol (or absolute ethanol) to it, the

materials were slowly mixed and the mixture

was kept in the freezer at -20 degrees for one

hour and sometimes overnight. Then, the

solution was centrifuged for 5 minutes at g x

12000 and 4 degrees Celsius, and then the

supernatant fluid was discarded. The

sediments were completely dried and 750μl

of cold 70% ethanol was added to it and after

being frozen for 1 hour at -20 degrees Celsius

was centrifuged for 5 minutes at g x 12000

and 4 degrees Celsius. Again, the supernatant

fluid was discarded and the sediment was

thoroughly dried. Fifty μl of a TE buffer

solution was added to the sediment and the

product was kept at 35 degrees Celsius for 45

minutes. Then, the DNA concentration was

measured using a NanoDrop unit. One μl of

the resulted genome solution was put as a

template in special PCR tubes and frozen at -

20 degrees Celsius. Whenever necessary,

each of the tubes was taken out of the freezer

and after preparing gradients, were used for

PCR purposes.

Primers: Two pairs of primers were utilized

in this research. After studying many articles,

one pair of primers, which had been

frequently used by researchers and had the

sequence of

Dow

nloa

ded

from

mili

tary

med

j.ir

at 1

5:49

+04

30 o

n S

unda

y A

pril

12th

202

0


Ataee RA. et al.


F1: 5TGTATGTATGGAGGTGTAAC-3

and R1: 5-

AATTGTGTTTCTTTTATTTTCATAA,

was chosen [17]. Using the sequence of the

reference entC gene, the other pair was

taken from the Gene Bank: AB084256.1 and

designed as the specific pair using the Alel

ID software and with the sequence

F2: 5-GGAATGTTGGATGAAGGAG-3

and R2: 5-

TATGGACACAATGATACTGG-3. These

pairs were then synthesized by Sina-Gene

Company. According to bioinformatics

analyses, the primer pair of F1 and R1

multiplied a 102bp fragment and the primer

pair of F2 and R2 multiplied a bp

1223fragment.

Polymerase chain reaction:A polymerase

chain reaction was done to multiply the

bp102 fragment based on the protocol given

in Table 1.

Table 1) Conditions of Carrying of the PCR for Detecting the Complete entC Gene with a 102bp in Staphylococcus

Strains Isolated from Clinical Specimens

Master Mix PCR Condition reaction

Reagents Reagents Step Condition

reaction Time

D.D. Water 18.6μl Denaturation primal 95 C 3 min

Template DNA 15 ng/0.5μl

Buffer 1X 15 ng/0.5μl Denaturation 94 C 30 sec

MgCl2 1 mM/1μl Annealing 53 C 30 sec / 35 cycles

dNTP 0.2 mM each/0.7 μl Elongation 72 C 5 min

F1- Primer 0.3 mM/1 μl Final Extension

R1- Primer 0.3 mM/1μl

Incubation 4 5 min Taq enzyme 2 unit/0.3μl

Total 25

Table 2) Conditions of Carrying of the PCR for Identifying the Complete entC Gene with a 1223bp in

Staphylococcus Strains Isolated from Clinical Specimens

Master Mix PCR Condition reaction

Reagents Reagents Step Condition

reaction Time

D.D. Water 16.9μl Denaturation primal 95 C 4 min

Template DNA 15 ng/1μl

Buffer 1X 2.5μl Denaturation 94 C 40 sec / 35 cycles

MgCl2 1 mM/1.5μl Annealing 60 C 40 sec / 35 cycles

dNTP 0.5 mM, each 0.7μl Elongation 72 C

6 sec / 35cycles

10min / 1 cycle F1- Primer 0.3 mM/1 μl Final Extension

R1- Primer 0.3 mM/1μl

Incubation 4 5 min Taq enzyme 2 unit/0.4μl

Total 25

Dow

nloa

ded

from

mili

tary

med

j.ir

at 1

5:49

+04

30 o

n S

unda

y A

pril

12th

202

0




Figure 2) The process of detection and purification of a portion of an entC gene in the localized Staphylococcus

aureus bacteria for the purpose of sequencing. Picture A, which depicts wells 1, 2, 3, 9, 11, 13, 14 and 15, reveals

that in well 8, the standard molecular weight is 50bp. Picture B shows wells 5 and 6 of the 102bp fragment, where

well 8 is the standard molecular mass of the 100bp fragment. Picture C shows wells 1-6 of the optimized conditions

of the PCR, where well 8 is the standard molecular mass of the 100bp fragment. Picture D is a depiction of wells 1-5

and a repetition of well 5 of the purification of the 102bp fragment. Well 7 is the standard molecular mass of 50bp.

In order to optimize the PCR conditions, a

temperature gradient (of 46-56 C),

magnesium chloride concentration gradient

(of 5.1 – 8.0 mM) and a template

concentration gradient (of 10 -100 ng/ml of

the extracted genome) were utilized. This

reaction was carried out using the Thermal

Cycler, C1000 manufactured by Bio-RAD.

The PCR product was electrophoresed with

agarose gel of 1 -1.5%, stained with ethidium

Figure 1 . The left picture depicts measuring the concentration of the DNA extracted from Staphylococcus

aureus bacteria. Concentration ranges 2-10 and 3-10 were used at templates. The right picture (A) shows

the electrophoresis of 2-3μl of the genome extracted from the specimens using the salting out method

(wells 1-5) and picture B shows the extraction of the genome with the Genome DNA Extraction kit of

Bioneer company (wells 1-4).

Dow

nloa

ded

from

mili

tary

med

j.ir

at 1

5:49

+04

30 o

n S

unda

y A

pril

12th

202

0


Ataee RA. et al.


bromide and examined under ultraviolet light

(of a Gel Doc). In order to determine the

sequence, the certain band was purified using

a PCR product extraction kit and was sent to

an Iranian company called Nasl-e Omid.

Since it is possible for the part making up the

bp102 fragment to be shared by other

enterotoxins, primers F2 and R2 were

designed and used which multiplied complete

entC genes and the bp1223 fragment. In fact,

the PCR was run to multiply the bp1223

fragment based on the protocol given in

Table 2. A temperature gradient (of 53 – 62.9

C), a magnesium chloride concentration

gradient (of 1 -2 mM)

and a template concentration (of 10 – 100 ng/l

of the extracted genome) were used.

Detection of toxigenecity: All the strains

which were confirmed as carrying the entC

gene using the molecular PCR method were

inducted into the BHI-broth culture medium

and centrifuged after 24 hours of incubation.

The supernatant fluid was then checked for

the presence of entC using an ELISA kit.

Also, as a quality control process, the

toxigenicity of the non-entC-carrying strains

were tested using ELISA. In order to carry

out the ELISA test, a specific kit of detecting

5 most widespread enterotoxins of

Staphylococcus aureus (RIDASCREEN SET

A,B,C,D,E: Art. No.: R41011), manufactured

by the German company of r-Biofarm was

used and the company instructions were

followed.

Results The results of phenotype testing on all strains

confirmed that they were all Staphylococcus

aureus bacteria, and thus 300 strains were

included in the study. The results of

extracting the genomes of all the strains using

a slightly-changed salting out method were

comparable to those of commercial kits.

Figure 1 shows the concentration

measurement and electrophoresis of the

genome extracted from the Staphylococcus

aureus bacteria.

The results of optimizing the multiplication

of a portion of an entC gene are shown in

Figure 2. Picture A depicts the PCR with a

temperature gradient (of 46-56 C) and an

Mgcl2 gradient (of 5.1-8.0 mM). The

multiplication of the entC in non-optimum

conditions generated a band in the 102bp

area. In picture B, by producing optimum

temperature conditions (a gradient of 47-57

C), the PCR product made a strong band in

the 102bp area in wells 5 and 6. In picture C,

using the optimum temperature conditions

(51.9 C) an optimum (2 millimolar)

concentration of MgCl2 and the primers, the

chosen bands were amplified and the other

bands were eliminated. Picture D depicts the

purification of the PCR product and its

preparation for sending to be sequenced.

Since previous researches have reported the

entC gene to be 613-1095bp long, tracing the

102bp fragment in various strains of

Staphylococcus might not properly represent

entC. Accordingly, and based on the existing

sequence in the gene bank, primers were

designed which could multiply a 1223bp

fragment with 128 bases more than the given

sequence (Figure A3). By providing the

optimum conditions, as Table 2 reveals, the

PCR came to be the 1223bp fragment. Picture

B in Figure 3 shows the purified PCR product

which was prepared to be sent for

sequencing.

The entC sequencing results:A comparison

of the gene sequencing of this research with

the entC gene of the gene bank (GeneBank:

X05815.1) is given in Figure 3. As shown in

the Figure, in base 104, amino acid A has

replaced T; in base 636, amino acid G has

replaced A; in base 659, amino acid C has

replaced T; in base 980, amino acid T and in

base 1049 amino acid G have been replaced.

In this research, primers were used which had

multiplied a fragment of about 1223bp. A

comparison of the PCR product sequencing

Dow

nloa

ded

from

mili

tary

med

j.ir

at 1

5:49

+04

30 o

n S

unda

y A

pril

12th

202

0




reveals that bases 91-1056 match and there is

no match in 6 sequences only, while the

translated sequences showed a mismatch in

one amino acid only (Figure 4).

The results of ELISA test for confirming

the production of enterotoxin C:The results

of ELISA testing on the strains with and

without entC are shown in Figure 6. As

shown, columns 9 and 10 include the strains

that produced enterotoxin C only. Columns 1,

2, 4 and 6 show the strains which produced

enterotoxin A only. Columns 3 and 7 are

populated by the strains which produced no

enterotoxins at all. Column 8 concerns the

strains that produced a little of enterotoxins B

and C and much enterotoxin E. Columns 11

gives the strains that produced much

enterotoxin A but little of enterotoxins D and

E. Column 12 contains the strains that

produced enterotoxins C and E. The PCR

with the strains studied in columns 8, 9, 10

and 12 confirms the existence of entC in

them. In this picture, rows F and G are

negative controls and row H is a positive

control related to the standard enterotoxin (2-

10 ng/ml) in the ELISA kit.

The results of studying 300 strains of

Staphylococcus aureus using the molecular

PCR showed that 37% of the strains

contained the entC gene. But ELISA revealed

that only 11% of the strains produced the

entC gene exclusively while the remaining

26% of the strains generated enterotoxin C as

well as other types of enterotoxins. In Figure

6, columns 3 and 7 contain strains of

Staphylococcus that produced none of the 5

most widespread types of enterotoxins.

Columns 1, 2, 4 and 6, however, include the

strains that produced enterotoxin A without

being carriers of the entC gene. Both the

ELISA kit and immunoblotting confirmed

that the strains containing the entC gene

produced enterotoxin.

Discussion In this research, the existence of the entC

gene in Staphylococcus strains and their

ability to make enterotoxin were confirmed

using both an ELISA kit with the sensitivity

of RICASCREEN SET A, B, C, D, E (0.2

ng/ml) and immunoblot analysis (Figure 6).

Figure 3) The optimized conditions of the complete entC

gene in Staphylococcus aureus strains. In picture A, wells

1-12 show the multiplied 1223bp fragment. Well 14 is the

standard molecular weight of 1kb. Picture B shows wells

1-6 of preparing the PCR product for sequencing. Well 7

is the standard molecular weight of 1kb.

Dow

nloa

ded

from

mili

tary

med

j.ir

at 1

5:49

+04

30 o

n S

unda

y A

pril

12th

202

0


Ataee RA. et al.


Figure 2) A comparison of the sequence provided by this study and the standard Staphylococcus aureus

of the gene bank coded X.5815.1

Dow

nloa

ded

from

mili

tary

med

j.ir

at 1

5:49

+04

30 o

n S

unda

y A

pril

12th

202

0




Figure 3) A comparison of the amino acid sequence obtained in this study with the translated sequence of the

standard gene of entC1 reveals that, of amino acids 46-321, there is only one mismatch in amino acid 218.

Figure 4) The results of the ELISA reaction with the pre-provided in the kit of RICASCREEN

SET A,B,C,C,E manufactured by the German company of r-Biofarm. The ELISA test was carried

out following the instructions provided by the manufacturing company and the plate picture was

scanned. This picture depicts the undersurface of the plate.

Dow

nloa

ded

from

mili

tary

med

j.ir

at 1

5:49

+04

30 o

n S

unda

y A

pril

12th

202

0


Ataee RA. et al.


Only 11% of the entC-carrying strains

produced enterotoxin C only, while other

strains produced not only enterotoxin C but

also other types of enterotoxins. The reason

for this is not completely clear and it is not

possible to say exactly why one bacterial

strain can make more than one type of

enterotoxin. The ability to produce multiple

types of enterotoxins, however, has been

reported by other researchers, too. As Ifesan

et al showed in 2009, some Staphylococcus

aureus strains generated more than one type

of enterotoxin [26]. Many studies have been,

or are being, carried out to gain a precise

knowledge of the role of enterotoxins, of the

mechanism of their functioning and of their

specific receptors. Perhaps one of the reasons

for these intensive researches on the role of

enterotoxins of Staphylococcus aureus [27] is

the provocation of various types of cytokines

including IL-1 and TNF-α [28].

Since these poisons are involved in causing

various diseases and detecting them is

possible only by means of standard strains

which cannot be bought and since the strains

bought may not be compatible with the

ecological features of this region, and

because correct diagnosis can make for good

treatment and can prevent later complications

caused by these superantigenic enterotoxins,

it is very important to develop a standard fast

method for detection of enterotoxin-

producing strains. Furthermore, the

emergence, in recent years, of

Staphylococcus bacteria which are resistant

to methicillin and its relationship with the

increased potential of toxigenicity have

created worries [29, 30] because the variety

of diseases caused by enterotoxins has made

it necessary to develop new methods of

detecting them and of treating related

illnesses [31, 32]. Some countries have

developed standard methods for detecting

each and every strain which produces

enterotoxins and have identified the accurate

criteria for detecting such strains in food and

clinical specimens. For instance, American

Type Culture Collection (ATCC), which is a

center for collecting and storing bacteria in

the US, has developed standard methods for

detecting all groups of bacteria. In a similar

fashion, Marr et al (1993) studied the

features of various types of enterotoxin C and

reported the 240 amino acids for each of

them. They showed that the sequence of the

first 10 amino acids of their enterotoxins

were ESQPDPTPDE and the last 10 amino

acids IEVHLTTKNG [33]. In fact, their gene

sequence contains about 720 base pairs.

Other researches have reported a fragment of

820 base pairs. There are yet other researches

which have chosen parts of the toxin for

detection purposes. For instance, some have

developed a primer which multiplies a 102bp

fragment or one that multiplies a 283bp

fragment. Another study yet involves

developing a primer which multiplies a

490bp fragment. As can be seen, none of the

reported fragments can truly represent a type

of enterotoxin C.

In this research, a primer was developed that

multiplied a 1223bp fragment in order to

trace and develop a standard method of

detecting the entC gene. In fact, the part

starting from the beginning of the peptide

signal and 250bp after the gene was

considered. In this way, the 1223bp fragment

was multiplied. As shown in Figure 4, the

bases 92-1057 were readable in the

sequencing machine. Although a comparison

of the results with the reference gene reveals

mismatches in 4 bases only, the translated

sequence demonstrated that the first 10

amino acids started from number 65 and

continued up to number 304, and that there

was a mismatch in one amino acid only. That

is, as depicted in Figure 5, in number 208,

alanine amino acid has replaced valine,

which points to a new sequence which is local

to this region.

Due to the importance of the pathogenicity of

Staphylococcus aureus enterotoxins,

Dow

nloa

ded

from

mili

tary

med

j.ir

at 1

5:49

+04

30 o

n S

unda

y A

pril

12th

202

0




researches are continually done on

standardizing the new methods of detecting

them. For example, Fischer et al developed

the quantitative method of real-time immuno-

PCR using standard strains of the ATCC in

order to detect enterotoxins A and B [34].

They were successful because of their access

to the standard strains of the ATCC. Also,

Veras et al (2008) detected enterotoxin C by

developing a 283bp fragment.

Since access to existing standard world

strains is limited and geographical variations

may affect the type of features attributed to

the standard strains in other regions,

identifying the necessary standards for

detecting local strains of Staphylococcus

aureus producing enterotoxins (including

entC) is unavoidable. Since genetic

variations have been reported in various

strains of Staphylococcus aureus [35], using

a reference gene model and by developing a

proper primer, a method was developed for

identifying the entC1-producing strains of

Staphylococcus aureus. This is because

relying on coagulase-positivity feature of the

Staphylococcus bacteria in clinical

specimens is not sufficient. As shown in

Figure 6, in spite of the presence of the entC

gene in them, the strains are different in terms

of their ability to produce enterotoxin. Thus,

the question is whether a bacterium which

can produce more than one type of

enterotoxin remains unchanged in terms of its

level of pathogenicity and whether a fixed

treatment would bring about a fixed result. In

addition, some of the coagulase-negative

strains isolated from clinical or food

specimens produced various types of

enterotoxins. Although different studies have

reported different prevalence rates of

enterotoxin-producing Staphylococcus

aureus strains (5.3% to 88%), there is no

precise and reliable statistics on the incidence

rate of infections caused by such strains

because there is no standard strain available.

By standardizing a method of detecting

strains producing enterotoxin C1, this study

has partly prepared the situation for careful

epidemiological studies of clinical specimens

and food contaminations. Thus, standardized

strains are ready to be offered to other

researchers for further research.

Acknowledgements This research project was sponsored by the

Center for Applied Research on Microbial

Toxins of Baqiyatallah University of Medical

Sciences. We are grateful then for the full

support offered by Professor Mostafa Qaneie.

We would also like to express our gratitude

to Dr Mohammad Javad Soltanpour and Dr

Mohammad Rahbar for providing us with

Staphylococcus strains isolated from

patient’s infections.

References 1- Collery MM, Smyth DS, Twohig JM, Shore AC,

Coleman DC, Smyth CJ. Molecular typing of nasal

carriage isolates of Staphylococcus aureus from an

Irish university student population based on toxin gene

PCR, agr locus types and multiple locus, variable

number tandem repeat analysis. J MeC Microbiol.

2008;57: 348-358.

2- Mandell L Gerlac, Bennett E John, Dolin Raphael.

Mandell, Douglas, and Bennett’s. Principles and

practice of infectious diseases. 7th ed. Churchill

livingstone. 2010;2:2543.

3- Veras JF, Do Carmo LS, Tong LC, Shupp JW,

Cummings C, Dos Santos DA . A study of the

enterotoxigenicity of coagulase-negative and

coagulase-positive staphylococcal isolates from food

poisoning outbreaks in Minas Gerais, Brazil. Int J

Infect dis. 2008;12: 410-415.

4- Schlievert PM, Case LC: Molecular analysis of

staphylococcal superantigens. Methods Mol Biol.

2007;391:113-126.

5- Suenaga T, Suzuki H, Shibuta S, Takeuchi T,

Yoshikawa N: Detection of multiple superantigen

genes in stools of patients with Kawasaki disease. J

PeCiatr. 2009;155:266-270.

6- Van ZT, Vaneechoutte M, Holtappels G, Gevaert P,

van CP, Bachert C: Detection of enterotoxin DNA in

Staphylococcus aureus strains obtained from the

middle meatus in controls and nasal polyp patients.

Am J Rhinol. 2008; 22:223-227.

7- Kim JS, Kim HS, Song W, Cho HC, Lee KM, Kim

EC: [Molecular epidemiology of methicillin-resistant

Staphylococcus aureus isolates with toxic shock

Dow

nloa

ded

from

mili

tary

med

j.ir

at 1

5:49

+04

30 o

n S

unda

y A

pril

12th

202

0


Ataee RA. et al.


syndrome toxin and staphylococcal enterotoxin C

genes]. Korean J Lab MeC. 2007;27: 118-123.

8- Crass BA, Berg Coll MS: Toxin involvement in

toxic shock syndrome. J Infect Cis. 1986;153:918-926.

9- Wang X, Xu M, Zhang H, Liu J, Li X, Zhang.

Enhancement of superantigen activity and antitumor

response of staphylococcal enterotoxin C2 by site-

directed mutagenesis. Cancer Immunol Immunother.

2009, 58:677-686.

10- Xu M, Wang X, Cai Y, Zhang H, Yang H, Liu C

et al. An engineered superantigen SEC2 exhibits

promising antitumor activity and low toxicity. Cancer

Immunol Immunother. 2011;60:705-713.

11- Wan XC, Liu CP, Li M, Hong D, Li DM, Chen

HX. Staphylococcal enterotoxin C injection in

combination

with ascorbic acid promotes the differentiation of bone

marrow-derived mesenchymal stem cells into

osteoblasts in vitro. Biochem Biophys Res Commun.

2008;373:488-492.

12- Cui JC, Zhang BJ, Lin YC, Wang QK, Qian AD,

Nakane A: Protective effect of glutathione S-

transferase-fused mutant staphylococcal enterotoxin C

against Staphylococcus aureus-induced bovine

mastitis. Vet Immunol Immunopathol. 2010;135:64-

70.

13- Zaraket H, Otsuka T, Saito K, Dohmae S, Takano

T, Hi guchi W. Molecular characterization of

methicillin-resistant Staphylococcus aureus in

hospitals in Niigata, Japan: divergence and

transmission. Microbiol Immunol. 2007;51:171-176.

14- Collery MM, Smyth DS, Tumilty JJ, Twohig JM,

Smyth CJ. Associations between enterotoxin gene

cluster types egc1, egc2 and egc3, agr types,

enterotoxin and enterotoxin-like gene profiles, and

molecular typing characteristics of human nasal

carriage and animal isolates of Staphylococcus aureus.

J Med Microbiol. 2009;58:13-25.

15- Bayles KW, IanColo JJ. Genetic and molecular

analyses of the gene encoding staphylococcal

enterotoxin C. J Bacteriol. 1989;171:4799-4806.

16- Giezendanner N, Meyer B, Gort M, Muller P,

Zweifel C. Raw milk-associated Staphylococcus

aureus intoxication in children. Schweiz Arch

TierheilkC. 2009;151:329-331.

17- Beckers HJ, Van Leusden FM, Tips PD. Growth

and enterotoxin production of Staphylococcus aureus

in shrimp. J Hyg (Lond).1985;95:685-693.

18- Ataee RA, Mehrabi-Tavana A, Izadi M, Hosseini

SMJ, Ataee MH. Bacterial meningitis: a new risk

factor. JRMS. 2011; 16:207-210.

19- Zell C, Resch M, Rosenstein R, Albrecht T, Hertel

C, Gotz F. Characterization of toxin production of

coagulasenegative staphylococci isolated from food

and starter cultures. Int J FooC Microbiol.

2008;127:246-251.

20- Tomi NS, Kranke B, Aberer E. Staphylococcal

toxins in patients with psoriasis, atopic dermatitis, and

erythroderma, and in healthy control subjects. J Am

Acad Dermatol. 2005;53:67-72.

21- Malam JE, Carrick GF, Telford DR, Morris JA.

Staphylococcal toxins and sudden infant death

syndrome. J Clin Pathol. 1992;45:716-721.

22- Larsen HD, Aarestrup FM, Jensen NE.

Geographical variation in the presence of genes

encoding superantigenic exotoxins and beta-

hemolysin among Staphylococcus aureus isolated

from bovine mastitis in Europe and USA. Vet

Microbiol. 2002; 85: 61-67.

23- Limbago B, Fosheim GE, Schoonover V, Crane

CE, Nadle J, Petit S. Characterization of methicillin-

resistant Staphylococcus aureus isolates collected in

2005 and 2006 from patients with invasive disease: a

population-based analysis. J Clin Microbiol.

2009;47:1344-1351.

24- Gould IM, Girvan EK, Browning RA, MacKenzie

FM, Edwards GF. Report of a hospital neonatal unit

outbreak of community-associated methicillin-

resistant Staphylococcus aureus. Epidemiol Infect.

2009;137:1242-1248.

25- Sombrok Joseph, and Rufell W David. Molecular

Cloning. Coldspring New York. 3rd ed. 2001; Vol 1:

6.4.

26- Ifesan BO, Voravuthikunchai SP: Effect of

Eleutherine Americana Merr. extract on enzymatic

activity and enterotoxin production of Staphylococcus

aureus in broth and cooked pork. Foodborne Pathog

Dis. 2009;6:699-704.

27- Seishima M, Kato G, Shibuya Y, Matsukawa S:

Cytokine profile during the clinical course of toxic

shock syndrome. Clin Exp Dermatol. 2009;34:632-

635.

28- Hu DL, Cui JC, Omoe K, Sashinami H, Yokomizo

Y, Shinagawa K: A mutant of staphylococcal

enterotoxin C devoid of bacterial superantigenic

activity elicits a Th2 immune response for protection

against Staphylococcus aureus infection. Infect

Immun. 2005;73:174-180.

29- Schlievert PM, Strandberg KL, Lin YC, Peterson

ML, Leung DY: Secreted virulence factor comparison

between methicillin-resistant and methicillin-sensitive

Staphylococcus aureus, and its relevance to atopic

dermatitis. J Allergy Clin Immunol. 2010;125:39-49.

30- Strandberg KL, Rotschafer JH, Vetter SM,

Buonpane RA, Kranz DM, Schlievert PM:

Staphylococcal superantigens cause lethal pulmonary

disease in rabbits. J Infect Dis. 2010;202:1690-1697.

31- Varshney AK, Wang X, Cook E, Dutta K, Scharff

MD, Goger MJ. Generation, characterization, and

epitope mapping of neutralizing and protective

monoclonal antibodies against staphylococcal

Dow

nloa

ded

from

mili

tary

med

j.ir

at 1

5:49

+04

30 o

n S

unda

y A

pril

12th

202

0




enterotoxin B-induced lethal shock. J Biol Chem.

2011;286:9737-9747.

32- Hallin M, De MR, Denis O, Lefort A, El GF,

Butaye P et al. Diversity of accessory genome of

human and livestock-associated ST398 methicillin

resistant Staphylococcus aureus strains. Infect Genet

Evol. 2011; 11: 290-299.

33- Marr JC, Lyon JD, Roberson JR, Lupher M, Davis

WC, Boha GA Characterization of Novel Type C

Staphylococcal Enterotoxins:Biological and

Evolutionary Implications. Infection and Immunity.

1993;61(10):4254-4262.

34- Fischer A, von Eiff C, Kuczius T, Omoe K, Peters

G and Becker K. A quantitative real-time immuno-

PCR approach for detection of staphylococcal

enterotoxins. J Mol Med. 2007;85:461–469.

35- Diep BA, Gill SR, Chang RF, Phan TH, Chen JH,

Davidson MG. Complete genome sequence of

USA300, an epidemic clone of community-acquired

meticillin-resistant Staphylococcus aureus. Lancet.

2006; 367:731-739.

36- Humphreys H, Keane CT, Hone R, Pomeroy H,

Russell RJ, Arbuthnott JP. Enterotoxin production by

Staphylococcus aureus isolates from cases of

septicaemia and from healthy carriers. J Med

Microbiol. 1989; 28: 163-172.

37- Normanno G, Corrente M, La SG, Dambrosio A,

Quaglia NC, Parisi A. Methicillin-resistant

Staphylococcus aureus (MRSA) in foods of animal

origin product in Italy. Int J Food Microbiol.

2007;117:219-222.

38- Gonano M, Hein I, Zangerl P, Rammelmayr A,

Wagner M. Phenotypic and molecular characterization

of Staphylococcus aureus strains of veterinary, dairy

and human origin. Epidemiol Infect. 2009;137:688-

699.

39- Peeva T, Gogov I. Presence of enterotoxin D in

Staphylococcus aureus strains isolated from food

products. Vet Med Nauki. 1983; 20:67-71.

Dow

nloa

ded

from

mili

tary

med

j.ir

at 1

5:49

+04

30 o

n S

unda

y A

pril

12th

202

0


Ataee RA. et al.


Dow

nloa

ded

from

mili

tary

med

j.ir

at 1

5:49

+04

30 o

n S

unda

y A

pril

12th

202

0


Documents

Standardizing Molecular Detection of the entC Gene …militarymedj.ir/article-1-936-en.pdfStandardizing Molecular Detection and Sequencing of entC Gene of Staphylococcus Aureus Ir