49

Spawned naming of related techniques: Southern blot (DNA) Northern blot (RNA) Western blot (Protein) Eastern blot (???)

Embed Size (px)

Citation preview

Page 1: Spawned naming of related techniques: Southern blot (DNA) Northern blot (RNA) Western blot (Protein) Eastern blot (???)
Page 2: Spawned naming of related techniques: Southern blot (DNA) Northern blot (RNA) Western blot (Protein) Eastern blot (???)
Page 3: Spawned naming of related techniques: Southern blot (DNA) Northern blot (RNA) Western blot (Protein) Eastern blot (???)
Page 4: Spawned naming of related techniques: Southern blot (DNA) Northern blot (RNA) Western blot (Protein) Eastern blot (???)
Page 5: Spawned naming of related techniques: Southern blot (DNA) Northern blot (RNA) Western blot (Protein) Eastern blot (???)

Spawned naming of related techniques:

Southern blot(DNA)

Northern blot(RNA)

Western blot(Protein)

Eastern blot(???)

Page 6: Spawned naming of related techniques: Southern blot (DNA) Northern blot (RNA) Western blot (Protein) Eastern blot (???)

Arabidopsis thaliana 2 copies of gene X

Page 7: Spawned naming of related techniques: Southern blot (DNA) Northern blot (RNA) Western blot (Protein) Eastern blot (???)

Capsella rubella ? copies of gene X

extract

DNA

Page 8: Spawned naming of related techniques: Southern blot (DNA) Northern blot (RNA) Western blot (Protein) Eastern blot (???)

EcoR I EcoR I EcoR I EcoR I

Page 9: Spawned naming of related techniques: Southern blot (DNA) Northern blot (RNA) Western blot (Protein) Eastern blot (???)
Page 10: Spawned naming of related techniques: Southern blot (DNA) Northern blot (RNA) Western blot (Protein) Eastern blot (???)

_ +

Page 11: Spawned naming of related techniques: Southern blot (DNA) Northern blot (RNA) Western blot (Protein) Eastern blot (???)

_ +

Page 12: Spawned naming of related techniques: Southern blot (DNA) Northern blot (RNA) Western blot (Protein) Eastern blot (???)
Page 13: Spawned naming of related techniques: Southern blot (DNA) Northern blot (RNA) Western blot (Protein) Eastern blot (???)

Immobilize DNA onto a permanent substrate

‘Membrane’paper-like matrixnylon or nitrocelluloseusually has a slight positive charge

Page 14: Spawned naming of related techniques: Southern blot (DNA) Northern blot (RNA) Western blot (Protein) Eastern blot (???)

T G A A TC

A C AT T G

• Eliminate hydrogen bonds with sodium hydroxide (NaOH)

Page 15: Spawned naming of related techniques: Southern blot (DNA) Northern blot (RNA) Western blot (Protein) Eastern blot (???)

• Two methods for transferring DNA to a membrane– capillary– electrophoretic

Page 16: Spawned naming of related techniques: Southern blot (DNA) Northern blot (RNA) Western blot (Protein) Eastern blot (???)
Page 17: Spawned naming of related techniques: Southern blot (DNA) Northern blot (RNA) Western blot (Protein) Eastern blot (???)

Immobilize DNA onto a permanent substrate

Identify DNA sequence (gene) of interest

Page 18: Spawned naming of related techniques: Southern blot (DNA) Northern blot (RNA) Western blot (Protein) Eastern blot (???)
Page 19: Spawned naming of related techniques: Southern blot (DNA) Northern blot (RNA) Western blot (Protein) Eastern blot (???)

Prehybridization bufferscontain ‘blocking reagents’that occupy available binding sites on the membrane

Page 20: Spawned naming of related techniques: Southern blot (DNA) Northern blot (RNA) Western blot (Protein) Eastern blot (???)
Page 21: Spawned naming of related techniques: Southern blot (DNA) Northern blot (RNA) Western blot (Protein) Eastern blot (???)
Page 22: Spawned naming of related techniques: Southern blot (DNA) Northern blot (RNA) Western blot (Protein) Eastern blot (???)
Page 23: Spawned naming of related techniques: Southern blot (DNA) Northern blot (RNA) Western blot (Protein) Eastern blot (???)
Page 24: Spawned naming of related techniques: Southern blot (DNA) Northern blot (RNA) Western blot (Protein) Eastern blot (???)
Page 25: Spawned naming of related techniques: Southern blot (DNA) Northern blot (RNA) Western blot (Protein) Eastern blot (???)
Page 26: Spawned naming of related techniques: Southern blot (DNA) Northern blot (RNA) Western blot (Protein) Eastern blot (???)
Page 27: Spawned naming of related techniques: Southern blot (DNA) Northern blot (RNA) Western blot (Protein) Eastern blot (???)
Page 28: Spawned naming of related techniques: Southern blot (DNA) Northern blot (RNA) Western blot (Protein) Eastern blot (???)

DIG-labeled probes emitting minute amounts of light (chemiluminescence)

32P-labeled probes emitting ß-particles

Page 29: Spawned naming of related techniques: Southern blot (DNA) Northern blot (RNA) Western blot (Protein) Eastern blot (???)

DIG-labeled probes emitting minute amounts of light (chemiluminescence)

32P-labeled probes emitting ß-particles

Autoradiography film can detect this radiation

Page 30: Spawned naming of related techniques: Southern blot (DNA) Northern blot (RNA) Western blot (Protein) Eastern blot (???)
Page 31: Spawned naming of related techniques: Southern blot (DNA) Northern blot (RNA) Western blot (Protein) Eastern blot (???)

How many copies of ‘Gene X’ does Capsella rubella possess?

Capsella rubella

3

Page 32: Spawned naming of related techniques: Southern blot (DNA) Northern blot (RNA) Western blot (Protein) Eastern blot (???)

DNA fingerprintingRFLP or VNTRs

Dot or slot blot

Colony or plaque lifts

Microarray analysis

Page 33: Spawned naming of related techniques: Southern blot (DNA) Northern blot (RNA) Western blot (Protein) Eastern blot (???)

DNA fingerprintingRFLP or VNTRs

Dot or slot blot

Colony or plaque lifts

Microarray analysis

Page 34: Spawned naming of related techniques: Southern blot (DNA) Northern blot (RNA) Western blot (Protein) Eastern blot (???)

DNA fingerprintingRFLP or VNTRs

Dot or slot blot

Colony or plaque lifts

Gene expression

Page 35: Spawned naming of related techniques: Southern blot (DNA) Northern blot (RNA) Western blot (Protein) Eastern blot (???)

DNA fingerprintingRFLP or VNTRs

Dot or slot blot

Colony or plaque lifts

Gene expression

Page 36: Spawned naming of related techniques: Southern blot (DNA) Northern blot (RNA) Western blot (Protein) Eastern blot (???)

Northern blots allow investigators to determine the molecular weight of an mRNA and to measure relative amounts of the mRNA present in different samples.

RNA (either total RNA or just mRNA) is separated by gel electrophoresis, usually an agarose gel. Because there are so many different RNA molecules on the gel, it usually appears as a smear rather than discrete bands.

The RNA is transferred to a sheet of special blotting paper called nitrocellulose, though other types of paper, or membranes, can be used. The RNA molecules retain the same pattern of separation they had on the gel.

The blot is incubated with a probe which is single-stranded DNA. This probe will form base pairs with its complementary RNA sequence and bind to form a double-stranded RNA-DNA molecule. The probe cannot be seen but it is either radioactive or has an enzyme bound to it (e.g. alkaline phosphatase or horseradish peroxidase).

The location of the probe is revealed by incubating it with a colorless substrate that the attached enzyme converts to a colored product that can be seen or gives off light which will expose X-ray film. If the probe was labeled with radioactivity, it can expose X-ray film directly.

Page 37: Spawned naming of related techniques: Southern blot (DNA) Northern blot (RNA) Western blot (Protein) Eastern blot (???)
Page 38: Spawned naming of related techniques: Southern blot (DNA) Northern blot (RNA) Western blot (Protein) Eastern blot (???)

Electrophoresis of RNA through gel

Transfer of RNA to solid support Nylon or nitrocellulose

Intensity of hybridization signal Approximately equal

to amount of RNA

– +

gel

Page 39: Spawned naming of related techniques: Southern blot (DNA) Northern blot (RNA) Western blot (Protein) Eastern blot (???)

Example of using of oligo probes for detection of PLMV

336 b

PLMV A1

PLMV A2

PLMV A35´- GCCGTATCTCAACGCCTCAT - 3´

A

AA

A

AU

DIG

U

DIG

AA

Page 40: Spawned naming of related techniques: Southern blot (DNA) Northern blot (RNA) Western blot (Protein) Eastern blot (???)
Page 41: Spawned naming of related techniques: Southern blot (DNA) Northern blot (RNA) Western blot (Protein) Eastern blot (???)
Page 42: Spawned naming of related techniques: Southern blot (DNA) Northern blot (RNA) Western blot (Protein) Eastern blot (???)

Application of 5- end labeled probe for detection of BVQ in situ

Fluo

5´- GAGCAAACGTACTTCATTTCG – 3´

Prehybridization Hybridization Washing

Page 43: Spawned naming of related techniques: Southern blot (DNA) Northern blot (RNA) Western blot (Protein) Eastern blot (???)
Page 44: Spawned naming of related techniques: Southern blot (DNA) Northern blot (RNA) Western blot (Protein) Eastern blot (???)
Page 45: Spawned naming of related techniques: Southern blot (DNA) Northern blot (RNA) Western blot (Protein) Eastern blot (???)
Page 46: Spawned naming of related techniques: Southern blot (DNA) Northern blot (RNA) Western blot (Protein) Eastern blot (???)
Page 47: Spawned naming of related techniques: Southern blot (DNA) Northern blot (RNA) Western blot (Protein) Eastern blot (???)
Page 48: Spawned naming of related techniques: Southern blot (DNA) Northern blot (RNA) Western blot (Protein) Eastern blot (???)
Page 49: Spawned naming of related techniques: Southern blot (DNA) Northern blot (RNA) Western blot (Protein) Eastern blot (???)