ORIGINAL ARTICLE

Sodium valproate modulates immune response by alternativeactivation of monocyte-derived macrophages in systemiclupus erythematosus

Saeed Mohammadi1 & Marie Saghaeian-Jazi2 & Sima Sedighi3 & Ali Memarian4

Received: 5 July 2017 /Revised: 21 October 2017 /Accepted: 17 November 2017 /Published online: 1 December 2017# International League of Associations for Rheumatology (ILAR) 2017

AbstractThe anti-inflammatory role of macrophages in apoptotic cells (ACs) clearance is involved in Systemic Lupus Erythematosus(SLE) pathogenesis. The efferocytic capability of macrophages is altered by M1/M2 polarization. Histone deacetylase inhibitors(HDACi) are proposed to enhance the expansion of M2 macrophages. Sodium valproate (VPA) is an HDACi with different anti-inflammatory properties. Here, we aimed to investigate the effects of HDACi by VPA on the polarization of monocyte-derivedmacrophages (MDMs) and regulating the expression of anti-inflammatory cytokines in SLE. We studied the ex vivo alterationsof MDMs among 15 newly diagnosed SLE patients and 10 normal subjects followed by ACs and VPA treatments. M1/M2polarization was assessed by expression of CD86/CD163, IL1-β, IDO-1, andMRC-1 among treated and non-treatedMDMs.Wealso evaluated the production of IL-10, IL-12, TGF-β1, and TNF-α cytokines in the cell culture supernatants. CD163 wasoverexpressed upon VPA treatment, while CD86 showed no significant change. IL1-β and IDO-1 genes were significantlydownregulated, and the mRNA expression of MRC-1 was increased among VPA-treated MDMs of SLE patients. The anti-inflammatory cytokines (IL-10 and TGF-β1) were overproduced while TNF-α level was decreased in response to VPA. Thepopulation of classically activated macrophages was more prevalent among SLE patients and efferocytosis was defected. VPAcould successfully enhance the anti-inflammatory immune response through alternative activation of MDMs in SLE patients.

Keywords Histone deacetylase inhibitor . Macrophage polarization . Sodium valproate . Systemic lupus erythematosus

Introduction

Systemic lupus erythematosus (SLE) is a chronic inflammato-ry autoimmune disorder inwhich the immunological tolerance

is disrupted [1]. Numerous factors including genetic predispo-sition [2], environmental [3] and specific infectious agents [4]have been proposed to be involved in SLE initiation.However, the underlying molecular mechanisms for SLEpathogenesis still remain undiscovered. Effective immuno-suppressive pathways are needed to control the rate of im-mune complex formation and balance the immune response[5], as defective regulatory manners could lead to a lastinginflammation and so damages of vital organs [6, 7]. The ac-cumulation of apoptotic cells within the inflammatory milieuand overexpression of lupus autoantigens on the surface ofapoptotic blebs is a common phenomenon in SLE deteriora-tion [8]. Thus, an efficient apoptotic cell removal system withanti-inflammatory properties is crucial for immune regulation.

Macrophages are specialized phagocytic cells which areinvolved in immune response modulation and clearance ofapoptotic and damaged cells [9]. This removal process is nor-mally associated with the upregulation of anti-inflammatoryand downregulation of pro-inflammatory cytokines and

* Sima Sedighisimasedighy@yahoo.com

* Ali Memarianalimemarian@goums.ac.ir

1 Stem Cell Research Center, Golestan University of MedicalSciences, Gorgan, Iran

2 Biochemistry and Metabolic Disorders Research Center, GolestanUniversity of Medical Sciences, Gorgan, Iran

3 Joint, Bone and Connective tissue Research Center (JBCRC),Golestan University of Medical Sciences, Gorgan, Iran

4 Golestan Research Center of Gastroenterology and Hepatology,Golestan University of Medical Sciences, Gorgan, Iran

Clinical Rheumatology (2018) 37:719–727https://doi.org/10.1007/s10067-017-3922-0

mainly accomplished by alternatively activated (M2) macro-phages [10], which is called Befferocytosis^ [11, 12]. We pre-viously showed that alternative activation is defected amongmonocyte-derived macrophages (MDMs) of SLE patients,and subsequent deregulations in the production of immuno-regulatory cytokines could be introduced as an underlyingmechanism in SLE pathogenesis [13]. Thus, exploring effec-tive molecules on macrophage polarization could be benefi-cial for the development of gene-specific therapeutic ap-proaches in SLE patients. Various pathways have been sug-gested to be involved in the modulation of macrophage polar-ization including peroxisome proliferator-activated receptorgamma (PPAR-γ) [13, 14], Aryl hydrocarbon Receptor(AhR) [15], cAMP/CREB [16], liver X receptor (LXR),retinoic acid receptor (RAR), retinoid X receptor (RXR)[17], and glucocorticoid receptor (GR) [18]. The transcrip-tional control of genes involved in apoptotic cell recognitionand internalization, such as Cd36, Mertk, Axl, C1qa, Tgm2,and Abca1 [17], could be considered as underlyingmechanisms.

Epigenetic mechanisms which are typically mediatedby post-translational modifications have been recentlyconsidered in the regulation of macrophage polarization[19]. Histone modification is an epigenetic process bywhich the gene transcription and consequent biologicalresponses are cont ro l led . Inhibi t ion of h is tonedeacetylases (HDACs) is introduced to possess anti-inflammatory properties over immune cells [20].Previous studies suggested that histone deacetylation byspecific ligands such as Sodium valproate (VPA) could beinvolved in macrophage polarization [21]. Indoleamine 2,3-dioxygenase (IDO) which is a tryptophan metabolizingenzyme and suppressor of T lymphocyte activity isoverexpressed among SLE patients [7]. Although HDACinhibitors have been introduced as modulators of IDOfunction [22], there is no evidence indicating the role ofHDACi on IDO activity in SLE.

Moreover, there is lack of evidence highlighting the role ofHDACi by VPA on improving the immunoregulatory proper-ties of macrophages among SLE patients. Therefore, the pres-ent study was conducted to examine the ex vivo effects ofhistone deacetylation inhibition by VPA on the polarizationof MDMs and regulating the expression of anti-inflammatorycytokines among SLE patients in comparison to normalsubjects.

Materials and methods

Patients and controls

A total of 15 newly diagnosed SLE patients were enrolledfrom Rheumatology Department, Sayyad Shirazi

Educational Hospital, Gorgan, Iran. The presence and severityof disease was approved by a specialist according to clinicaland/or laboratory information. Blood samples of ten age-matched healthy donors were also used as controls. All pa-tients and control subjects were female, and an approved in-formed consent following the declaration of Helsinki [23] wassigned and taken from all participants. Each SLE patient withan active infection or inflammation history within last6 months, pregnancy, receiving anti-TNF therapies during last3 months, or taking glucocorticoids in the previousmonth wasexcluded.

Culture and differentiation of monocyte-derivedmacrophages and treatments

A total volume of 15-mL sterile whole blood was takenfrom all participants, transferred to the Cell CultureLaboratory, and peripheral blood mononuclear cells(PBMCs) were immediately isolated using Ficoll-Paquegradient centrifugation [24]. A modified attachment meth-od was used to enrich monocytes, as previously described[25]. Enriched monocytes were cultured in RPMI 1640,supplemented with 10% Fetal Bovine Serum (FBS)(Gibco, Life Technologies, USA), stimulated with humanGranulocyte-macrophage colony-stimulating factor (GM-CSF) (10 ng/ml), and also human macrophage colony-stimulating factor (M-CSF) (Biolegend, San Diego, CA,USA) (100 U/ml) for 6 days until differentiation intoMDMs. MDMs were then treated with 2 mM VPA(Sigma, USA) at the beginning of the differentiation pro-cess (Day 4). The apoptotic cells were prepared usingUVB-irradiation of Human Jurkat cells (National CellBank of Iran, Pasteur Institute, Iran) with minor modifi-cations [13]. 3–4 × 106 apoptotic cells were added toMDMs at the beginning of day 6 and incubated for 16–18 h.

ELISA cytokine assay

Commercially available ELISA kits (eBioscience, San Diego,USA) were used to evaluate the secretion level of pro-inflammatory (TNF-α, IL-12) and anti-inflammatory (IL-10and TGF-β1) cytokines in supernatant of MDM cell cultures.The results were reported as picograms of cytokines per mil-liliter. The optical density of all samples was obtained usingBiotek ELISA reader ELX800 (Biotek, USA) at the wave-length of 450 nm. M2 polarization was further quantifiedusing IL-10/IL-12 and TGF-β1/TNF-α ratios [26].

Flowcytometry

A modified method using ice-cold 5 mM EDTA was ap-plied to detach MDMs from tissue culture plates [13].

720 Clin Rheumatol (2018) 37:719–727

Flowcytometric immunophenotyping of MDMs was con-ducted by intracellular staining with FITC-conjugated an-ti-human CD68 antibody (Biolegend). We also quantifiedthe intensities of PE-conjugated anti-human CD86(Biolegend) and PerCP/Cy5.5-conjugated anti-humanCD163 (Biolegend) antibodies among CD68 positiveMDMs. The efficiency of M2 polarization was definedby determining the CD163/CD86 ratios in response toeach treatment [26]. BD Accuri flow cytometer (BDPharMingen, San Diego, CA) and BD Accuri C6 Flowanalysis software were employed to analyze samples.

RNA extraction and real time RT-PCR

Total RNA extraction from detached MDMs was conductedusing Biozol (Bioer, Hangzhou, China) according to the man-ufacturer’s protocols. One microgram of total RNA was re-verse transcribed to cDNA with random hexamer primers(Bioron, Germany) followed by DNaseІ treatment(CinnaGen, Iran). Real-time RT-PCR was conducted usingBioer Real-time PCR detection system and SYBR green mas-ter mix (Bioron). 18s ribosomal RNA (18s rRNA) was used asan internal control for gene expression normalization. Gene-specific primers which were designed and evaluated to spanexon-exon junctions are summarized in Table 1. 2-ΔCt methodwas used to calculate the mRNA expression level for eachcombination.

Statistical analysis

Data were demonstrated as means ± SE (standard error) fornormally distributed values and medians ± IQR (interquartilerange) for skewed variables. Statistical software SPSS 22.0and Graphpad Prism 5.04 were used for data analysis andpreparation of graphs. One-way ANOVA with Tukey’s posthoc test or nonparametric Kruskal-Wallis with Dunn-Bonferroni post hoc tests were used to compare the meansof multiple samples. All of the experiments were repeated intriplicates. P-values lower than 0.05 were considered as sta-tistically significant.

Results

VPA alters the expression of M1 and M2 cell surfacemarkers

In order to address the status of alternative activation in eachcombination, the expressions of M1 and M2 cell surfacemarkers (CD86 and CD163) were assessed among CD68+

macrophages using flowcytometric immunophenotyping(Fig. 1a). Macrophages of normal subjects expressed lowerlevels of CD86 in comparison to SLE patients (P < 0.0001).CD86 was significantly upregulated among Jurkat apoptoticbodies (JAB)-treated macrophages in both groups of patients(P < 0.0001) and normal subjects (P < 0.0001). VPA-treatment of SLE patient MDMs decreased the expression ofCD86 in these cells (P < 0.0001) (Fig. 1b). The expression ofCD163 was higher among MDMs of normal subjects com-pared to the patients in all combinations. CD163 was signifi-cantly overexpressed upon VPA treatment among MDMs ofSLE patients (P < 0.0001) in comparison to JAB-treated mac-rophages (Fig. 1c).

The expression of pro-inflammatory cytokines isdecreased upon VPA treatment

The immunomodulatory effects of VPA on the expressionprofile of major pro- and anti- inflammatory cytokineswere investigated by ELISA cytokine assay on the cellculture supernatants. Untreated macrophages of healthysubjects expressed higher levels of IL-10 (P < 0.001).Although JAB-induced MDMs showed decreasedamounts of IL-10, VPA treatment could successfully in-crease IL-10 level among MDMs of SLE patients (P =0.004) (Fig. 2a). The expression level of IL-12 was notaltered significantly in response to neither JAB inductionnor VPA treatment in both groups (Fig. 2b). Although theexpression of TGFβ1 was increased in response to VPA,the changes were not statistically significant in all combi-nations (Fig. 2c). The expression of TNF-α was markedlydecreased upon VPA exposure among JAB-treated MDMsof SLE patients (Fig. 2d).

Table 1 Gene specific primersused for real time RT-PCR Primer (Accession) Sequence (5′ > 3′) Tm Amplicon Size

IL1B (NM_000576) F: GGCTTATTACAGTGGCAATG 60 135 bpR: TAGTGGTGGTCGGAGATT

IDO1 (NM_002164) F: TACCATCTGCAAATCGTGACTAAGT 60 84 bpR: AAGGGTCTTCAGAGGTCTTATTCTC

MRC1 (NM_002438) F: ATGAGGCTACCCCTGCTC 61 217 bpR: TGAACGGGAATGCACAGGTT

18SrRNA (M10098) F: CAGCCACCCGAGATTGAGCA 61 252 bpR: TAGTAGCGACGGGCGGTGTG

Clin Rheumatol (2018) 37:719–727 721

Fig. 1 Flowcytometric immunophenotyping of M1 (CD86) and M2(CD163) cell surface markers Flowcytometric histogram for theexpression of CD68 among patients and normal subjects was comparedwith respective isotype controls (a-1). The expression of CD86 andCD163 among CD68+ macrophages (M1 Gate in P1) were assessedusing flowcytometry (a-1, a-2). The intensities of total positive cells forSLE patients and normal subjects are represented in quadrants (Q-LL:CD86−, CD163−; Q-LR: CD86+, CD163−; Q-UL: CD86−, CD163+; Q-UR: CD86+, CD163+) (a-2). CD86 is downregulated in macrophages ofSLE patients (b) and CD163 is overexpressed among MDMs of both

groups upon VPA treatment in comparison to JAB treated cells (c).Flowcytometry data are presented as frequency distribution histogramsshowing signal intensities on the x-axis and counts on the y-axis. One-way ANOVAwith Tukey’s post hoc test were used to compare the meansofmultiple samples. All of the experiments were repeated in triplicates foreach sample. Data of each bar demonstrates means ± SE. P values lowerthan 0.05 were considered as statistically significant. Mock, non-treatedmonocyte-derived macrophages; JAB, Jurkat apoptotic bodies; VPA,sodium valproate; SE standard error

722 Clin Rheumatol (2018) 37:719–727

The mRNA expression IL1- β, IDO-1 and MRC-1

We also evaluated the mRNA expression of IL1-β (as a majorpro-inflammatory cytokine and M1 marker), IDO-1 (as a lu-pus biomarker and M1 marker), and MRC-1 (as a main M2marker) to address the efficiency of macrophage polarizationmore precisely. SLE patients expressed higher levels of IL1-βin comparison to healthy subjects (P = 0.001). However,IL1-β was significantly downregulated among VPA-treatedMDMs (P = 0.001) (Fig. 3a), and the expression of IDO-1was higher among MDMs of SLE patients (P = 0.028). IDO-1 mRNA level decreased significantly in response to VPAtreatment in macrophages of SLE patients (P = 0.0001)(Fig. 3b), whereas JAB-treated macrophages expressed higherlevels of MRC-1 in normal subjects compared to SLE patients(P = 0.042). VPA treatment also increased the mRNA expres-sion of MRC-1 among MDMs of SLE patients (Fig. 3c).

Discussion

The accumulation of self-antigens on the surface of apoptoticblebs within the inflammatory milieu is recognized as one ofthe imminent mechanisms in SLE pathogenesis and persistentinflammation [11, 27]. Macrophages are versatile cells inside

Fig. 1 continued.

Fig. 2 ELISA cytokine assay VPA-treatedMDMs express higher levels ofIL-10 in (a). IL-12 is not altered significantly upon VPA treatmentcompared to JAB-treated macrophages (b). TGF-β1 levels areoverexpressed but not changed significantly in response to VPAtreatment (c). Macrophages of SLE patients secreted lower levels ofTNF-α in response to VPA treatment (d). One-way ANOVA withTukey’s post hoc test or Kruskal-Wallis with Dunn-Bonferroni post hoc

test was used to compare the means of multiple samples. All of theexperiments were repeated in triplicates for each sample. Data of eachbar demonstrates means ± SE for normally distributed values (TNF-α)and medians ± IQR for skewed (IL-10, IL-12, and TGF-β1) variables. Pvalues lower than 0.05 were considered as statistically significant. Mock,non-treated monocyte-derived macrophages; JAB, Jurkat apoptotic bodies;VPA, sodium valproate; SE, standard error; IQR, interquartile range

Clin Rheumatol (2018) 37:719–727 723

the innate immune system which are committed to removedying cells in the early stages of apoptosis and regulate im-mune response in an anti-inflammatory manner which iscalled Befferocytosis^ [27, 28]. This physiologic function ofmacrophages could be altered by targeting involved pathwaysincluding PPAR-γ [13, 14], AhR [15], cAMP/CREB [16],LXR, RAR, RXR [17], and GR [18]. Moreover, the transcrip-tional control of apoptotic cell recognition and internalizationgenes, such asCd36,Mertk, Axl,C1qa, Tgm2, and Abca1mayaffect efferocytosis [17, 29]. Although the phagocytic capacityof macrophages among SLE patients is shown to be not dif-ferent from healthy subjects [13], we strongly believe thatBefferocytosis^ is defected in SLE. As a consequence, an in-flammatory immune response is provoked aberrantly and thecytokine profile is deregulated [30]. According to the fact thatalternatively activated (M2) macrophages are responsible forthe immunomodulatory effects of these plastic cells [31], ex-ploring molecules and pathways with effects on macrophageplasticity could be beneficial for introducing novel therapeuticapproaches. Although current immunosuppressive therapiesincluding conventional glucocorticoids (GCs) have been

partially successful in expanding M2 subpopulation [32],long-term GC administration could be associated with irre-coverable side-effects to the vital organs [33]. Therefore, it isessential to evaluate various approaches involved in macro-phage polarization.

Inhibition of histone deacetylases (HDACs) is an epigenet-ic modification with anti-inflammatory properties over im-mune cells [20] which may elicit M2 polarization of macro-phages by specific compounds such as VPA [21]. It is an anti-epileptic drug which acts as a class I HDAC inhibitor withnegative regulatory effects on immune response [34]. Thus,we evaluated the ex vivo effects of VPA as a specific HDACion immune response and cytokine profile of MDMs throughM2 expansion in SLE patients.

While no obvious difference has been reported between theuptakes of apoptotic bodies among macrophages of SLE pa-tients in comparison to normal subjects [13], an internal defectis possibly responsible for the accumulation of apoptotic and/or necrotic cells in damaged organs of SLE patients.Flowcytometric immunophenotyping of major M1 (CD86)and M2 (CD163) cell surface markers revealed that VPA is

Fig. 3 The mRNA expression of IL1-β, IDO-1, and MRC-1 IL1-β isdownregulated in response to VPA among MDMs of SLE patients,without obvious changes in normal subjects (a). IDO-1 which isoverexpressed among JAB-induced MDMs of SLE patients is markedlydecreased upon VPA treatment (b). The mRNA expression of MRC-1was higher in normal subjects and overexpressed significantly upon VPAtreatment in patients (c). 2-ΔCt method was used to calculate the mRNAexpression level for each combination. One-way ANOVA with Tukey’s

post hoc test or Kruskal-Wallis with Dunn-Bonferroni post hoc test wasused to compare the means of multiple samples. All of the experimentswere repeated in triplicates. Data of each scattered plot demonstratesmeans ± SE for normally distributed values (IDO-1) and medians ± IQRfor skewed (IL1-β and MRC-1) variables. P values lower than 0.05 wereconsidered as statistically significant. Mock, non-treated monocyte-derived macrophages; JAB, Jurkat apoptotic bodies; VPA, sodiumvalproate; SE, standard error; IQR, interquartile range.

724 Clin Rheumatol (2018) 37:719–727

capable of reducing the overexpressed CD86 to the expectedlevel in normal subjects. Moreover, VPA treatment exertedinteresting effects on M2 expansion by increasing the expres-sion of CD163 among macrophages of SLE patients in com-parison to the JAB-treated counterparts (Fig. 1). Our findingsare in favor of the limited preclinical reports which indicatedVPA effectiveness on the phenotype and function of macro-phages and the importance of HDAC activity in immune reg-ulation [8, 21].

In order to investigate the effect of VPA treatment on re-storing the imbalanced cytokine profile, the expression of se-lected pro- and anti-inflammatory mediators was quantified.Although an increased expression of pro-inflammatory anddecreased level of anti-inflammatory cytokines was notableamong JAB-induced MDMs of SLE patients, VPA could suc-cessfully regulate the production of cytokines (Fig. 2) whichare consistent with previous reports [35, 36]. VPA as a shortchain fatty acid (SCFA) has presented anti-inflammatory andneuroprotective effects on the ischemic brain of rats by reduc-ing TNF-α and enhancing IL-10 [37, 38]. It has been alsoshown to be an effective enhancer of the cytokine-inducedexpansion of human hematopoietic stem cells [39]. Certainprevious findings implicated that VPA, as an anti-seizuredrug, is not an effective compound in reducing IL1-β and

TNF-α expression in rats [40]. However, no preclinical orclinical data was available on the effects of VPA over theexpression of IL1-β in macrophages. Our real time RT-PCRfindings showed that VPA could exert a significant downreg-ulation on the overexpressed IL1-β among JAB-treatedMDMs of SLE patients in comparison to normal subjects.IL1-β is a major inflammatory cytokine which is normallyoverexpressed in classically activated macrophages in re-sponse to LPS [12]. Thus, IL1-β downregulation is in favorof M2 polarization. The mRNA expression of MRC-1(CD206; M2 marker) [41] and IDO-1 (M1 marker) [42] wasalso measured to deeply investigate alternative activation ofmacrophages. Supported by limited previous reports [43], asignificant downregulation of IDO-1 and overexpression ofMRC-1 was demonstrated among VPA-treated MDMs inSLE patients (Fig. 3). The quantification of IL-10/IL-12,TGF-β1/TNF-α, and CD163/CD86 ratios are widely useddeterminants in alternative activation of macrophages [44].Accordingly, the inflammatory status and efficiency of polar-ization would be determined more precisely. Here, we ob-served that VPA treatment could markedly increase IL-10/IL-12, TGF-β1/TNF-α, and CD163/CD86 ratios in macro-phages of SLE patients in comparison to normal cells(Fig. 4). The obtained results in addition to the overexpressed

Fig. 4 Quantifying the efficiency of alternative activation The IL-10/IL-12 (a), TGF-β1/TNF-α (b), and CD163/CD86 (c) ratios—as widelyaccepted alternative activation determinants—were increased amongVPA-treated combinations in both groups. Kruskal-Wallis with Dunn-Bonferroni post hoc test was used to compare the means of multiple

samples. Data are demonstrated as box and whiskers and each barrepresents minimum to maximum. P values lower than 0.05 wereconsidered as statistically significant. Mock, non-treated monocyte-derived macrophages; JAB, Jurkat apoptotic bodies; VPA, sodiumvalproate

Clin Rheumatol (2018) 37:719–727 725

IL-10/IL-12, TGF-β1/TNF-α, and CD163/CD86 ratios indi-cated that VPA could possibly enhance alternatively activatedmacrophages in SLE patients.

Conclusions

Apoptotic cell removal system is disturbed among macro-phages of SLE patients, and histone modifications as a funda-mental molecular mechanism could alter the expression ofgenes involved in macrophage function. Inhibition ofHDAC by VPA among macrophages of SLE patients is asso-ciated with a notable decrease in the expression of pro-inflammatory and overexpression of anti-inflammatory cyto-kines in comparison to JAB-treated counterparts. The alterna-tive activation of macrophages is also enhanced by registeringthe upregulation and downregulation of M2 and M1 markers,respectively. As a result, we conclude that VPA-mediatedHDAC inhibition exerts immunomodulatory effects on mac-rophages of SLE patients and could be introduced as a targetof further investigation for autoimmune disorder therapies.

Acknowledgments We would like to acknowledge Dr. S Zhand, Dr.Ayyoob Khosravi, and Mrs. Haydari for their technical and scientificconsults.

Funding This article was derived from a research project funded byStudents Research Committee at Golestan University of MedicalSciences, Gorgan, Iran (Grant Code: 930618118).

Compliance with ethical standards

Ethical approval This article contains studies with human participants.The present study was approved by ethics committee, GolestanUniversity of Medical Sciences, Gorgan, Iran (Code of Ethics:1479179306194). An informed consent following the declaration ofHelsinki was signed and taken from all participants.

Disclosures None.

References

1. Feng PH (2007) Systemic lupus erythematosus. Ann N YAcad Sci1108(1):114–120

2. Mohan C, Putterman C (2015) Genetics and pathogenesis of sys-temic lupus erythematosus and lupus nephritis. Nat Rev Nephrol11(6):329–341. https://doi.org/10.1038/nrneph.2015.33

3. Mak A, Tay SH (2014) Environmental factors, toxicants and sys-temic lupus erythematosus. Int J Mol Sci 15(9):16043–16056.https://doi.org/10.3390/ijms150916043

4. Rigante D, Mazzoni MB, Esposito S (2014) The cryptic interplaybetween systemic lupus erythematosus and infections. AutoimmunRev 13(2):96–102. https://doi.org/10.1016/j.autrev.2013.09.004

5. Yildirim-Toruner C, Diamond B (2011) Current and novel thera-peutics in the treatment of systemic lupus erythematosus. J AllergyClin Immunol 127(2):303–312. https://doi.org/10.1016/j.jaci.2010.12.1087

6. Yap DYH, Lai KN (2013) The role of cytokines in the pathogenesisof systemic lupus erythematosus—from bench to bedside.Nephrology 18(4):243–255. https://doi.org/10.1111/nep.12047

7. Mohammadi S, Sedighi S, Memarian A, Yazdani Y (2017)Overexpression of interferon-γ and indoleamine 2, 3-dioxygenasein systemic lupus erythematosus: relationship with the disease ac-tivity. Lab Med 41(1):41–47

8. Ren Y, Tang J, Mok M, Chan AW, Wu A, Lau C (2003) Increasedapoptotic neutrophils and macrophages and impaired macrophagephagocytic clearance of apoptotic neutrophils in systemic lupuserythematosus. Arthritis Rheum 48(10):2888–2897. https://doi.org/10.1002/art.11237

9. Murray PJ, Allen JE, Biswas SK, Fisher EA, Gilroy DW, Goerdt S,Gordon S, Hamilton JA, Ivashkiv LB, Lawrence T (2014)Macrophage activation and polarization: nomenclature and experi-mental guidelines. Immunity 41(1):14–20. https://doi.org/10.1016/j.immuni.2014.06.008

10. Gordon S, Martinez FO (2010) Alternative activation of macro-phages: mechanism and functions. Immunity 32(5):593–604.https://doi.org/10.1016/j.immuni.2010.05.007

11. Korns D, Frasch SC, Fernandez-Boyanapalli R, Henson PM,Bratton DL (2011) Modulation of macrophage efferocytosis in in-flammation. Front Immunol 2:57. https://doi.org/10.3389/fimmu.2011.00057

12. Sica A, Mantovani A (2012) Macrophage plasticity and polariza-tion: in vivo veritas. J Clin Invest 122(3):787–795. https://doi.org/10.1172/JCI59643

13. Mohammadi S, Saghaeian-Jazi M, Sedighi S, Memarian A (2017)Immunomodulation in systemic lupus erythematosus: induction ofM2 population in monocyte-derived macrophages by pioglitazone.Lupus 26(12) : 1318–1327 . h t tps : / / do i . o rg /10 .1177 /0961203317701842

14. Odegaard JI, Ricardo-Gonzalez RR, Goforth MH, Morel CR,Subramanian V, Mukundan L, Eagle AR, Vats D, Brombacher F,Ferrante AW (2007) Macrophage-specific PPARγ controls alterna-tive activation and improves insulin resistance. Nature 447(7148):1116–1120. https://doi.org/10.1038/nature05894

15. Climaco-Arvizu S, Domínguez-Acosta O, Cabañas-Cortés MA,Rodríguez-Sosa M, Gonzalez FJ, Vega L, Elizondo G (2016) Arylhydrocarbon receptor influences nitric oxide and arginine produc-tion and alters M1/M2 macrophage polarization. Life Sci 155:76–84. https://doi.org/10.1016/j.lfs.2016.05.001

16. Montero J, Gómez-Abellán V, Arizcun M, Mulero V, Sepulcre MP(2016) Prostaglandin E 2 promotes M2 polarization of macro-phages via a cAMP/CREB signaling pathway and deactivatesgranulocytes in teleost fish. Fish Shellfish Immunol 55:632–641.https://doi.org/10.1016/j.fsi.2016.06.044

17. Röszer T (2017) Transcriptional control of apoptotic cell clearanceby macrophage nuclear receptors. Apoptosis 22(2):284–294.https://doi.org/10.1007/s10495-016-1310-x

18. Hoppstädter J, Kiemer AK (2015) Glucocorticoid-induced leucinezipper (GILZ) in immuno suppression: master regulator or bystand-er? Oncotarget 6(36):38446–38457. 10.18632/oncotarget.6197

19. Patel U, Rajasingh S, Samanta S, Cao T, Dawn B, Rajasingh J(2017)Macrophage polarization in response to epigenetic modifiersduring infection and inflammation. Drug Discov Today 22(1):186–193. https://doi.org/10.1016/j.drudis.2016.08.006

20. Takeuch O, Akira S (2011) Epigenetic control of macrophage po-larization. Eur J Immunol 41(9):2490–2493. https://doi.org/10.1002/eji.201141792

21. Wu C, Li A, Leng Y, Li Y, Kang J (2012) Histone deacetylaseinhibition by sodium valproate regulates polarization of macro-phage subsets. DNA Cell Biol 31(4):592–599. https://doi.org/10.1089/dna.2011.1401

22. Reddy P, Sun Y, Toubai T, Duran-Struuck R, Clouthier SG,Weisiger E, Maeda Y, Tawara I, Krijanovski O, Gatza E (2008)

726 Clin Rheumatol (2018) 37:719–727

Histone deacetylase inhibition modulates indoleamine 2, 3-dioxygenase–dependent DC functions and regulates experimentalgraft-versus-host disease in mice. J Clin Invest 118(7):2562–2573.https://doi.org/10.1172/JCI34712

23. AssociationWM (2013) World Medical Association Declaration ofHelsinki: ethical principles for medical research involving humansubjects. JAMA 310(20):2191

24. Memarian A, Nourizadeh M, Masoumi F, Tabrizi M, Emami AH,Alimoghaddam K, Hadjati J, Mirahmadian M, Jeddi-Tehrani M(2013) Upregulation of CD200 is associated with Foxp3+ regula-tory T cell expansion and disease progression in acute myeloidleukemia. Tumor Biol 34(1):531–542. https://doi.org/10.1007/s13277-012-0578-x

25. Saghaeian-Jazi M, Mohammadi S, Sedighi S (2016) Culture anddifferentiation of monocyte derived macrophages using human se-rum: an optimized method. Zahedan J Res Med Sci 18(6):e7362.https://doi.org/10.17795/zjrms-7362

26. Wang Y, Fu Y, Xue S, Ai A, Chen H, Lyu Q, Kuang Y (2014) TheM2 polarization of macrophage induced by fractalkine in theendometriotic milieu enhances invasiveness of endometrial stromalcells. Int J Clin Exp Pathol 7(1):194–203

27. Majai G, Kiss E, Tarr T, Zahuczky G, Hartman Z, Szegedi G, FésüsL (2014) Decreased apopto-phagocytic gene expression in the mac-rophages of systemic lupus erythematosus patients. Lupus 23(2):133–145. https://doi.org/10.1177/0961203313511557

28. Poon IK, Lucas CD, Rossi AG, Ravichandran KS (2014) Apoptoticcell clearance: basic biology and therapeutic potential. Nat RevImmunol 14(3):166–180. https://doi.org/10.1038/nri3607

29. Tsokos GC, LoMS, Reis PC, Sullivan KE (2016) New insights intothe immunopathogenesis of systemic lupus erythematosus. Nat RevRheumatol 12(12):716–730. https://doi.org/10.1038/nrrheum.2016.186

30. Vandivier RW, Henson PM, Douglas IS (2006) Burying the dead:the impact of failed apoptotic cell removal (efferocytosis) on chron-ic inflammatory lung disease. Chest J 129(6):1673–1682. https://doi.org/10.1378/chest.129.6.1673

31. Chinetti-Gbaguidi G, Staels B (2011) Macrophage polarizationin metabolic disorders: functions and regulation. Curr OpinLipidol 22(5):365–372. https://doi.org/10.1097/MOL.0b013e32834a77b4

32. Gratchev A, Kzhyshkowska J, Köthe K, Muller-Molinet I,Kannookadan S, Utikal J, Goerdt S (2006) Mφ1 and Mφ2 canbe re-polarized by Th2 or Th1 cytokines, respectively, and respondto exogenous danger signals. Immunobiology 211(6):473–486.https://doi.org/10.1016/j.imbio.2006.05.017

33. Schäcke H,DöckeW-D, Asadullah K (2002)Mechanisms involvedin the side effects of glucocorticoids. Pharmacol Ther 96(1):23–43.https://doi.org/10.1016/S0163-7258(02)00297-8

34. Kapellos TS, Iqbal AJ (2016) Epigenetic control of macrophagepolarisation and soluble mediator gene expression during inflam-mation. Mediat Inflamm 2016:1–15. https://doi.org/10.1155/2016/6591703

35. Ichiyama T, Okada K, Lipton JM, Matsubara T, Hayashi T,Furukawa S (2000) Sodium valproate inhibits production ofTNF-α and IL-6 and activation of NF-κB. Brain Res 857(1):246–251. https://doi.org/10.1016/S0006-8993(99)02439-7

36. Vinolo MA, Rodrigues HG, Nachbar RT, Curi R (2011) Regulationof inflammation by short chain fatty acids. Nutrients 3(10):858–876. https://doi.org/10.3390/nu3100858

37. Kim HJ, Rowe M, Ren M, Hong J-S, Chen P-S, Chuang D-M(2007) Histone deacetylase inhibitors exhibit anti-inflammatoryand neuroprotective effects in a rat permanent ischemic model ofstroke: multiple mechanisms of action. J Pharmacol Exp Ther321(3):892–901. https://doi.org/10.1124/jpet.107.120188

38. SinnD-I, Kim S-J, Chu K, Jung K-H, Lee S-T, Song E-C, Kim J-M,Park D-K, Lee SK, Kim M (2007) Valproic acid-mediated neuro-protection in intracerebral hemorrhage via histone deacetylase inhi-bition and transcriptional activation. Neurobiol Dis 26(2):464–472.https://doi.org/10.1016/j.nbd.2007.02.006

39. Broxmeyer HE (2014) Inhibiting HDAC for human hematopoieticstem cell expansion. J Clin Invest 124(6):2365–2368. https://doi.org/10.1172/JCI75803

40. Gómez CD, Buijs RM, Sitges M (2014) The anti-seizure drugsvinpocetine and carbamazepine, but not valproic acid, reduce in-flammatory IL-1β and TNF-α expression in rat hippocampus. JNeurochem 130(6):770–779. https://doi.org/10.1111/jnc.12784

41. Rőszer T (2015) Understanding the mysterious M2 macrophagethrough activation markers and effector mechanisms. MediatInflamm 2015:1–16. https://doi.org/10.1155/2015/816460

42. de Faudeur G, De Trez C, Muraille E, Leo O (2008) Normal devel-opment and function of dendritic cells in mice lacking IDO-1 ex-pression. Immunol Lett 118(1):21–29. https://doi.org/10.1016/j.imlet.2008.02.006

43. Wang G, Shi Y, Jiang X, Leak RK, Hu X, Wu Y, Pu H, Li W-W,Tang B, Wang Y (2015) HDAC inhibition prevents white matterinjury by modulating microglia/macrophage polarization throughthe GSK3β/PTEN/Akt axis. Proc Natl Acad Sci 112(9):2853–2858. https://doi.org/10.1073/pnas.1501441112

44. Martinez FO, Gordon S (2014) The M1 and M2 paradigm of mac-rophage activation: time for reassessment. F1000Prime Rep 6:1310.12703

Clin Rheumatol (2018) 37:719–727 727