SNP’s: Which SNP’s: Which Method is Best Method is Best for Your Study?for Your Study?

SNP Detection Methods SNP Detection Methods available in theavailable in the

DNA Analysis Facility DNA Analysis Facility

SequenceSequence SNaPshotSNaPshot Allelic Discrimination AssayAllelic Discrimination Assay DHLPCDHLPC SNPlexSNPlex

Joint RG Study

Unfortunately, little information is available regarding the specific advantages and limitations of even the most routinely used mutation detection techniques. The primary goal is to compare operational parameters for the most popular mutation/polymorphism screening methods.

In the first year of this joint proposal, we will conduct a pilot study engaging only members of the participating research groups: DSRG, FARG and NARG.

This pilot study will allow us to refine the survey design and prepare a broader based study for year 2 directed at the greater scientific community.

Sequencing MethodologySequencing Methodology

Your Lab:Your Lab: gDNA extractiongDNA extraction PCR amplification of region of interestPCR amplification of region of interest

DNA Analysis FacilityDNA Analysis FacilityCycle Sequence Reaction Sequence Run

Sequencing: Data Sequencing: Data AnalysisAnalysisTYMS SNP: TYMS SNP:

AAGTTTTTACACTTT(C/T)ATTTCTCTGTGAAGTTTTTACACTTT(C/T)ATTTCTCTGTGGCTGCT

Sequencing: Data Sequencing: Data AnalysisAnalysis

Observed Mixed Ratios of Observed Mixed Ratios of Heterozygous peaksHeterozygous peaks

Sequence Data AnalysisSequence Data AnalysisConfirmed Mixed Ratios of Confirmed Mixed Ratios of

Heterozygous peaksHeterozygous peaks

Joint RG Data: Joint RG Data: SequencingSequencing

Sample Sample ##

ForwardForward ReverseReverse

11 GG CC

22 GG CC

33 GG CC

44 GG CC

55 G/AG/A C/TC/T

66 GG CC

77 G/AG/A C/TC/T

88 G/AG/A C/TC/T

99 GG CC

1010 G/AG/A C/TC/T

1111 G/AG/A C/TC/T

1212 G/AG/A C/TC/T

TNF

GAGGGGCATG(A/G)GGACG

G

Joint RG Data: Joint RG Data: SequencingSequencing

AR SNP: AR SNP:

Forward sequence slips on CAG Forward sequence slips on CAG repeatrepeat

Joint RG Study Joint RG Study Sequence Data ComparisonSequence Data Comparison

TYMS, MTHFR, and TNF SNP’sTYMS, MTHFR, and TNF SNP’s 32/36 calls matched the true sample identity.32/36 calls matched the true sample identity.

Of the four calls missed:Of the four calls missed: 3 calls missed the 23 calls missed the 2ndnd allele when it was at allele when it was at

5%.5%. 1 call missed the 21 call missed the 2ndnd allele when it was at allele when it was at

12.5%.12.5%.

AR SNPAR SNP 12/12 calls matched the true sample identity 12/12 calls matched the true sample identity

in Reverse direction only.in Reverse direction only.

Sequence SummarySequence Summary

SequenceSequence

MultiplexMultiplex LimitedLimited

ThroughputThroughput MediumMedium

Advantages: well established technology, easy sample preparation, and can easily get confirmation from 2nd strand.Disadvantages: Some problems with sequence context, only limited ability to multiplex SNP’s.

SNaPshot MethodologySNaPshot MethodologyYour Lab:Your Lab:

gDNA extractiongDNA extraction PCR amplificationPCR amplification Purify PCR productPurify PCR product SNaPshot ReactionSNaPshot Reaction SAP treatment SAP treatment

DNA Analysis FacilityDNA Analysis Facility Add size standard and perform Genescan Add size standard and perform Genescan

RunRun

SNaPshot AnalysisSNaPshot AnalysisLiz 120 Size StandardLiz 120 Size Standard

Joint RG Data: SNapShotJoint RG Data: SNapShot

Joint RG Study Joint RG Study SNaPshot Data ComparisonSNaPshot Data Comparison

TYMS, MTHFR, TNF and AR SNP’sTYMS, MTHFR, TNF and AR SNP’s 44/48 calls matched the true sample 44/48 calls matched the true sample

identity.identity.

Of the 4 calls missed:Of the 4 calls missed: 3 calls missed the 23 calls missed the 2ndnd allele when it was allele when it was

at 5%.at 5%. 1 call missed the 21 call missed the 2ndnd allele when it was at allele when it was at

12.5%.12.5%.

SNaPshot SummarySNaPshot Summary

SequenceSequence SNaPshotSNaPshot

MultiplexMultiplex LimitedLimited Yes, 7-10 Yes, 7-10 SNP’sSNP’s

ThroughputThroughput MediumMedium MediumMedium

Advantages: this system is designed for multiplexing and you have two options: multiplex the SNaPshot reaction or pooled separate reactions.

Disadvantages: primers need to be specifically designed, primers >30bp need to be HPLC purified, optimization of the SNaPshot reaction can take time.

Real-time qPCR MethodReal-time qPCR Method

Allelic Discrimination Assay Allelic Discrimination Assay MethodologyMethodology

Your Lab:Your Lab: gDNA extractiongDNA extraction PCR amplification with 2 dual-labelled probesPCR amplification with 2 dual-labelled probes

DNA Analysis FacilityDNA Analysis Facility Perform End point plate read and Analysis Perform End point plate read and Analysis

Allelic Discrimination Allelic Discrimination Assay:Assay:

Data AnalysisData Analysis

Joint RG DataJoint RG Data

Joint RG DataJoint RG Data

Joint RG DataJoint RG Data

Joint RG DataJoint RG Data

Joint RG DataJoint RG Data

Joint RG DataJoint RG Data

Joint RG Study Joint RG Study ADA Data ComparisonADA Data Comparison

TYMS and MTHFR (both alleles represented)TYMS and MTHFR (both alleles represented) 19/24 calls matched the true sample identity.19/24 calls matched the true sample identity.

Of the 5 calls that were missed:Of the 5 calls that were missed: 2 calls missed the 22 calls missed the 2ndnd allele when it was at 5%. allele when it was at 5%. 2 calls missed the 22 calls missed the 2ndnd allele when it was at 12.5%. allele when it was at 12.5%. 1 call missed the 21 call missed the 2ndnd allele when it was at 25%. allele when it was at 25%.

TNF and AR SNP’s (no 2TNF and AR SNP’s (no 2ndnd allele present) allele present) 16/24 calls matched the true sample identity. 16/24 calls matched the true sample identity. 8 heterozygous samples were miscalled as 8 heterozygous samples were miscalled as

homozygous.homozygous.

Allelic Discrimination Allelic Discrimination Assay:Assay:

SummarySummary

SequencSequencee

SNaPshoSNaPshott

ADAADA

MultipleMultiplexx

LimitedLimited Yes, Yes,

7-10 7-10 SNP’sSNP’s

NoNo

ThroughThroughputput

MediumMedium MediumMedium HighHigh

Advantages: ABI has a huge collection of pre-designed SNP assays so little optimization is needed.

Disadvantages: can’t multiplex.

DHPLC MethodolgyDHPLC MethodolgyYour LabYour Lab

gDNA extractiongDNA extraction Design specific primersDesign specific primers PCR amplification PCR amplification

DNA Analysis FacilityDNA Analysis FacilityRun sample on Transgenomic Wave Run sample on Transgenomic Wave

DHPLC Data AnalysisDHPLC Data Analysis

Joint RG DataJoint RG DataMTHFR SNP

Joint RG DataJoint RG DataAR SNP was unable to be

interpreted.

Joint RG Study Joint RG Study DHPLC Data ComparisonDHPLC Data Comparison

TYMS and MTHFR SNP’sTYMS and MTHFR SNP’s 19/24 calls matched the true sample identity.19/24 calls matched the true sample identity.

Of the 5 missed calls:Of the 5 missed calls: 2 calls missed the 22 calls missed the 2ndnd allele when it was at allele when it was at

5%.5%. 2 calls missed the 22 calls missed the 2ndnd allele when it was at allele when it was at

12.5%12.5% 1 sample was a low signal.1 sample was a low signal.

AR and TNF SNP’sAR and TNF SNP’s AR: all calls undeterminedAR: all calls undetermined TNF: couldn’t design suitable primersTNF: couldn’t design suitable primers

DHPLC SummaryDHPLC Summary

SequencSequencee

SNaPshotSNaPshot ADAADA DHPLCDHPLC

MuliplexMuliplex LimitedLimited Yes,Yes,

7-10 7-10 SNP’sSNP’s

NoNo NoNo

ThroughpuThroughputt

MediumMedium MediumMedium HighHigh HighHigh

Advantages: high throughput screening method

Disadvantages: can only distinguish heterozygous from homozygous with no ability to make actual base calls, some sequence parameters can make primer design difficult.

SNPlex MethodologySNPlex Methodology

SNP’s: Which Method is SNP’s: Which Method is Best for Your Study?Best for Your Study?

SequenceSequence SNaPshotSNaPshot ADAADA DHPLCDHPLC SNPlexSNPlex

MultiplexMultiplex LimitedLimited Yes,Yes,

7-10 7-10 SNP’sSNP’s

NoNo NoNo Yes,Yes,

48 SNP’s48 SNP’s

ThroughpThroughputut

MediumMedium MediumMedium HighHigh HighHigh HighHigh

How many SNP’s?How many SNP’s?How many samples?How many samples?

DNA Analysis FacilityDNA Analysis Facility

The facility provides:The facility provides: Consultations on Consultations on

assay selection.assay selection. Comprehensive Comprehensive

support for assay support for assay design.design.

Fast and inexpensive Fast and inexpensive sample processing.sample processing.

Comprehensive Comprehensive support for data support for data analysis.analysis.