Small GTPase Rac1: Structure, Localization, and Expression of the Human Gene

Sa

PC*†‡

R

ipechTipgesstRcamdGst

ct

occa

dA

OSP

Biochemical and Biophysical Research Communications 277, 741–751 (2000)

doi:10.1006/bbrc.2000.3743, available online at http://www.idealibrary.com on

mall GTPase Rac1: Structure, Localization,nd Expression of the Human Gene

aulo Matos,* Jennifer Skaug,† Barbara Marques,* Sebastian Beck,* Fatima Verıssimo,*hristian Gespach,‡ Maria Guida Boavida,* Stephen W. Scherer,† and Peter Jordan*,1

Centre for Human Genetics, National Institute of Health ‘Dr. Ricardo Jorge,’ 1649-016 Lisbon, Portugal;Department of Genetics, Hospital for Sick Children, Toronto, Ontario, Canada; andINSERM Unit 482, St. Antoine Hospital, Paris, France

eceived August 9, 2000

aitp

btnrfohccRfclmHwiHtjca(

swGNidzaAf

Rac1 is a member of the Rho family of small GTPasesnvolved in signal transduction pathways that controlroliferation, adhesion, and migration of cells duringmbryonic development and invasiveness of tumorells. Here we present the complete structure of theuman RAC1 gene and characterize its expression.he gene comprises 7 exons over a length of 29 kb and

s localized to chromosome 7p22. The GC-rich generomoter shows characteristics of a housekeepingene and Northern blot studies revealed ubiquitousxpression of two rac1 transcripts, 1.2 and 2.5 kb inize. The two transcripts are expressed in tissue-pecific ratios, reflecting competition between two al-ernative polyadenylation sites. The RAC1 but notAC2 gene contains an additional exon 3b that is in-luded by alternative splicing into the variant Rac1b,constitutively active mutant which induces the for-ation of lamellipodia in fibroblasts. These data in-

icate that the RAC1 gene encodes two signalingTPases. The gene structure reported here will enable

tudies on the regulation of RAC1 expression duringumorigenesis and development. © 2000 Academic Press

Key Words: small GTPase Rac1; signal transduction;olorectal cancer; alternative splicing; polyadenyla-ion; chromosome 7; housekeeping gene.

The Ras oncogene is the archetype of the superfamilyf GTPases that are molecular switches in importantellular processes including signal transduction, vesi-le trafficking and nuclear protein import (Macara etl., 1996). These small GTPases are regulated through

The nucleotide sequence for the human RAC1 gene has beeneposited in the GenBank/EBI data bank under Accession No.J132695.

1 To whom correspondence should be addressed at Laboratorio dencobiologia, Centro de Genetica Humana, Instituto Nacional deaude ‘Dr. Ricardo Jorge,’ Avendia Padre Cruz, 1649-016 Lisbon,ortugal. Fax: 1351-21-7590441. E-mail: [email protected].

741

cycle of GDP/GTP exchange in which binding of GTPnduces a conformational change enabling them to ac-ivate downstream effectors until a GTPase-activatingrotein (GAP) terminates this interaction.One subfamily, the Rho-GTPases, has various mem-

ers including Rho, Rac and Cdc42 (Zohn et al., 1998)hat were initially described as regulators of the orga-ization of the actin cytoskeleton (Hall, 1998). Rho waseported to regulate stress fiber and focal adhesionormation, whereas Rac and Cdc42 induced formationf lamellipodia and filopodia, respectively. Recent workas concluded that the signal transduction pathwaysontrolled by these small GTPases cooperate to controlell movement versus cell adhesion. In fibroblasts,ac1 is essential for the protrusion of lamellipodia and

or forward movement. Cdc42 is required to maintainell polarity, which includes the localization of lamel-ipodial activity to the leading edge. Rho is required to

aintain cell adhesion during movement (Nobes andall, 1999). In addition, signaling via these GTPaseas shown to be involved in the development of the

nvasive phenotype of tumor cells (Keely et al., 1997;ordijk et al., 1997; Shaw et al., 1997). In addition to

he control of actin filament organization and adhesionunction formation, RhoA, Cdc42, and Rac stimulateell proliferation (Olson et al., 1995; Moore et al., 1997)nd activate the JNK/SAPK protein kinase cascadesee Zohn et al., 1998, for a recent review).

Three different human Rac GTPase cDNAs were de-cribed. Rac1 and Rac3 are found widely expressedhereas Rac2 is a hematopoietic lineage-specificTPase that regulates superoxide generation via theADPH oxidase in phagocytes. In addition, to the ex-

stence of three genes, alternative splicing was recentlyescribed in case of Rac1 (Jordan et al., 1999; Schnel-er et al., 2000) resulting in a variant with a 19-amino-cid insertion behind the so-called switch II region.lthough Rac GTPases are being intensely studied

rom the functional point of view, the structure of their

0006-291X/00 $35.00Copyright © 2000 by Academic PressAll rights of reproduction in any form reserved.

go(cR1(

tgmaflssai

M

amcd7(irawtre9rgf(aZBl

3lBpHta

mkr(tiEa

wu

treated with 0.1 mg/ml pepsin at pH 2, then fixed in 1% formalde-haka5hwNdf0irM

i(srTi

ws(tkfbta2ct

rgpiwwiaa29mLwapa

R

I

kca1Dc

Vol. 277, No. 3, 2000 BIOCHEMICAL AND BIOPHYSICAL RESEARCH COMMUNICATIONS

enes is only known for RAC2 with 6 coding exons plusne noncoding exon over a total of 18 kb genomic DNACourjal et al., 1997). The RAC2 gene was assigned tohromosome 22q12 by FISH (Courjal et al., 1997), andAC3 to chromosome 17qter by FISH (Courjal et al.,997) and to 17q23–25 by radiation hybrid mappingHaataja et al., 1997).

Here we describe the complete structure for the mosthoroughly studied rac GTPase, the human RAC1ene. The 29 kb gene contains 7 coding exons, its pro-oter shows characteristics of a housekeeping gene

nd the ubiquitous expression of two transcripts re-ects tissue-specific competition of polyadenylationignals within the 39-untranslated region. Alternativeplicing yields the variant Rac1b and a constitutivelyctive Rac1b mutant affects actin cytoskeleton dynam-cs in transfected fibroblasts.

ATERIALS AND METHODS

PCR cloning and sequencing of Rac1 introns. Genomic DNA fromhealthy lab volunteer (100 ng) was amplified according to theanufacturer’s instructions by Taq polymerase (Perkin Elmer) in 35

ycles of 94°C for 20 s, 60°C for 30 s, 72°C for 3 min with an initialenaturation of 3 min at 94°C and a final extension of 10 min at2°C. Intron 3b (1.4 kb) was amplified using primers racEx3a–f59-cctcccggggcaaagacaagcc) and racEx4-r (59-cattttcaaatgatgcaggactc),ntron 4 (1.7 kb) with primers racEx4-f (cctgcatcatttgaaaatgtccg) andacEx5-r (59-cactaggatgatgggagtgt). All products were gel-purifiednd subcloned using the Topo-TA-cloning kit (Invitrogen). Intron 3as amplified using PFU-turbo polymerase (Stratagene) according

o the manufacturer’s instructions from 100 ng DNA in a nested PCReaction. Using an initial denaturation at 94°C for 1 min, a finalxtension at 72°C for 10 min the first reaction was for 30 cycles of4°C for 20 s, 58°C for 30 s, 72°C for 4 min 30 s) using primersacEx3-s1 (59-agctggacaagaagattatgaca) and racInt3b-r (59-ggagga-tctccatatctgcatct) followed by a second PCR with 35 cycles of 94°Cor 20 s, 60°C for 30 s, 72°C for 4 min using primers racEx3-f59-gattatgacagattacgccccc) and racEx3a–r (59-ggcttgtctttgccccggg-gg). The 4.3-kb product was gel-purified and subcloned using theeroBlunt kit (Invitrogen). Positive colonies were sequenced with theigDye-terminator cycle sequencing kit (Perkin Elmer) and ana-

yzed on the ABI Prism 377 automated DNA sequencer.

Screening of genomic BAC clone library. Subcloned introns 3 andb were amplified by PCR as probes, gel-purified and radioactivelyabeled by random priming for screening segment I of the genomicAC library RPCI-11 (see http:/chori.org/BACPAC). Both intronicrobes hybridized to the same 4 BAC clones (H_NH0018I01,_NH0085A20, H_NH0141E08, H_NH0161G05) and also labeled

he same fragments when EcoRI-digested DNA from these BACs wasnalyzed by Southern blotting.

Somatic cell hybrid screening. DNA isolated from a panel ofouse cell hybrids containing one human chromosome each were a

ind gift of Dr. Rocchi, Bari, Italy, (http://bioserver.uniba.it/fish/occhi). 100 ng DNA were amplified with intronic primers racInt3-f59-ggtagcgtggagtgtttcagt) and racInt3b–r (59-ggaggagtctccatatctgca-ct) in 35 cycles of 94°C for 20 s, 60°C for 30 s, 72°C for 45 s after annitial denaturation at 94°C for 2 min by Taq polymerase (Perkinlmer). Human and mouse DNA served as positive and negativemplification controls, respectively.

Fluorescence in situ hybridization (FISH). Metaphase spreadsere prepared from peripheral blood lymphocytes of healthy individ-als according to standard cytogenetic techniques. Slides were pre-

742

yde–phosphate-buffered saline before dehydration through an eth-nol series. Probes were digoxigenin-labeled using a nick-translationit (Gibco-BRL), denatured simultaneously with chromosomal DNAt 80°C for 5 min in hybridization buffer (50% formamide, 23 SSC,0 mM phosphate buffer, pH 7, 10% dextran sulfate) and thenybridized for 16 h at 40°C in a humid chamber. Posthybridizationashes were 3 3 5 min in 0.053 SSC followed by 5 min in 0.15 MaHCO3 containing 0.1% Tween 20 and 0.45% BSA, all at 40°C. Theigoxigenin-labeled probe was stained with anti-digoxigenin–Fabragments conjugated to rhodamine (Roche), washed 3 3 5 min in.15 M NaHCO3 containing 0.1% Tween 20, the slides then mountedn Vectashield (Vector Lab.) and analyzed on a Zeiss axiophot fluo-escence microscope with a cooled CCD camera controlled by theacProbe software (PSI).

Rapid amplification of cDNA ends. Rac1 39 ends were amplifiedn a nested reaction from either a human colon Marathon cDNAClontech) or a l-UniZap heart cDNA library (Stratagene). The gene-pecific primers were racEx5-f (59-ggtatcctgaggtgcggcaccactgt) andac503-f (59-cagcgaggcctcaagacagt). Products were subcloned usingopo-TA cloning system (Invitrogen) and positive colonies automat-

cally sequenced as above.

Northern blot analysis. A human multiple tissue Northern blotas purchased from Clontech and hybridized according to its in-

tructions with a rac1 cDNA probe radiolabeled by random primingMultiprime labeling kit, Amersham–Pharmacia). Alternatively, to-al RNA was extracted from the colorectal cell line SW480 (RNeasy-it, Qiagen) and 10 mg separated in a 1% agarose gel in Mops/ormaldehyde buffer, transferred overnight to a Hybond-N mem-rane (Amersham–Pharmacia) in 203 SSC by capillary force andhen fixed by UV irradiation (0.12 J). A 1 kb 39-UTR probe wasmplified from 50 ng BAC 85A20 DNA by PCR in 30 cycles (94°C for0 s, 60°C for 30 s, 72°C for 60 s) using primers rac3utr-f1 (59-ctg-agttaggaggtgcagacact) and rac3utr-r2 (59-ctccacaattctgcaactgtca),hen radiolabeled and hybridized as above.

Immunofluorescence labeling of cells. For indirect immunofluo-escence NIH-3T3 mouse fibroblasts were grown on 10 3 10-mmlass coverslips in DMEM/10% calf serum, transfected withcDNA3-Myc-Rac1bQ61L using the Effectene reagent (Qiagen) andncubated for 16 h in DMEM/0.5% serum. Coverslips were thenashed twice in phosphate-buffered saline (PBS), immediately fixedith 3.7% formaldehyde (freshly prepared from paraformaldehyde)

n PBS for 10 min at room temperature, and subsequently perme-bilized with 0.5% Triton X-100 in PBS for 15 min at room temper-ture. Cells were washed 3 3 5 min in PBS containing 0.05% Tween0 (PBS-T), incubated for 1 h in PBS-T containing anti-c-myc mAbE10 (Roche, 1:40), washed 33 and incubated for 30 min with anti-ouse antibody conjugated to fluorescein (Jackson Immunoresearchaboratories) and Phalloidin-TRITC (Sigma, 0.2 mg/ml). Coverslipsere washed 33, mounted in VectaShield (Vector Laboratories, UK),nd sealed with nail polish. Slides were observed with a Zeiss Axio-hot microscope; images were recorded with a cooled CCD camerand processed with Adobe Photoshop software.

ESULTS AND DISCUSSION

dentification of the Human RAC1 Gene

Rac2 is a lymphocyte-specific homolog of Rac1 ofnown gene structure. Primers designed in the Rac1oding sequences corresponding to Rac2 exons allowedmplification of intron 3 with 4.3 kb, intron 3b with.4 kb, and intron 4 with 1.7 kb directly genomicNA. An intron 3 and 3b probe identified 4 BAC

lones (H_NH0018I01, H_NH0085A20, H_NH0141E08,

HtTwfAg

wDdrEtAtiRwi(ea

iaa

C

Rs3hbpG(lntstFc

wTsYaspmsp

tmSRaX

vRtdA1gtpwzcffaimgsca1ehnc(

E

liFsAaqcHFnasibfqw


_NH0161G05) from the library RPCI-11 that con-ained the RAC1 gene between intron 2 and the 39 end.he missing 59 sequences of the human RAC1 geneere assembled in silico with unordered sequences

rom human BAC H_NH0425P05 (Accession No.C009412.3 on April 21, 2000) containing the completeene.One interesting difference was noted in intron 3here a 2.3-kb insertion was found in the BAC-clonedNA that was absent from our sequence, obtainedirectly from human genomic DNA. Closer inspectionevealed that the insert contained part of a humanST sequence flanked by two AluY repeats. In addi-

ion, the insertion target site was also bordered by oneluSp and one AluY element. To distinguish whether

his difference reflected a genetic polymorphism or anndividual event in the male donor DNA used forPCI-11 library preparation, an insert specific PCRas designed and demonstrated presence of the Alu

nsert in genomic DNA from 10 normal individualsdata not shown). This indicates that a polymorphismxists in intron 3 of the RAC1 gene that originates fromn Alu-mediated recombination event during evolution.The complete nucleotide sequence of the RAC1 gene,

ncluding indication of the Alu-insertion site, is avail-ble under Accession No. AJ132695, the offical HUGOnd GDB nomenclature of the gene is RAC1 (Fig. 1).

hromosomal Localization of the RAC1 Gene

The sequence information obtained for the humanAC1 gene enabled its stepwise localization to chromo-ome 7p22. First, a primer pair was designed in introns

and 3b to screen by PCR a panel of somatic cellybrid DNAs (kind gift of Dr. Rocchi, Italy; http://ioserver.uniba.it/fish/rocchi). The expected 530 bproduct was obtained in only one sample, cloneM10791A, which corresponded to chromosome 7

data not shown). Independently, a second researcherabeled the subcloned intron 3, 3b and 4 probes byick-translation with digoxigenin and hybridized themo normal metaphase chromosome preparations. Sub-equent fluorescence in situ hybridization (FISH) de-ected two clear signals at location 7p22 (see Fig. 2).ISH analysis was then repeated with the above BAClones and yielded exactly the same result.

To further refine the mapping of the RAC1 geneithin the 7p22 band, primers were designed from the7-end sequence of BAC NH0141E08 and used tocreen by PCR YAC clones localized to that region.AC CEPH855A06 (alias yWSS3236) was positivend spans the loci PMS2, D7S481, sWSS2233 andWSS660. Finally, following assembly of the com-lete nucleotide sequence of the RAC1 gene two STSarkers were localized within its 39-UTR, namely

WSS2233 and sWSS2749. This precisely defines theosition of the RAC1 gene within 7p22 and localizes it

743

o the close centromeric vicinity of the PMS2 gene (seeap and table under genome.nhgri.nih.gov/chr7/YAC-TS/CONTIGC/fig5_table1.html). In addition to theAC1 locus a database search revealed the existence ofprocessed rac1 pseudogene of about 1 kb size on chrq26.2–27.2 (Accession No. AL022576).In contrast to the Ki- and Ha-ras oncogene, no acti-

ating point mutations have been so far reported forac1 or any of the Rho-GTPase family members. On

he other hand, activation of Rac1 signaling has beenetected in invasive cancer cells (Klemke et al., 1998;nand-Apte et al., 1997; Keely et al., 1997; Shaw et al.,997; Hordijk et al., 1997; Michiels et al., 1995) sug-esting that upstream signaling pathways can targethis GTPase family of proteins. Furthermore, overex-ression of Rac1, but also of RhoA and Cdc42 proteinsere found in breast, colon, and lung tumors (Schnel-

er et al., 2000; Fritz et al., 1999), but the functionalonsequences of the accumulation of the wild-typeorms of Rho-like GTPases has not been investigated soar. It is therefore interesting to note that chromosomalbnormalities involving 7p22 are frequently reportedn malignancies and the related genomic imbalances

ight result in overexpression of genes from that re-ion, including rac1. Abnormalities in 7p22 were de-cribed in Ewing’s sarcoma (Jeon et al., 1995), ovarianarcinoma (Thompson et al., 1994), colorectal (Bardi etl., 1995) and gastric adenocarcinoma (Rao et al.,995), pancreatic tumors (Bardi et al., 1993), periph-ral nerve sheath tumors (Mertens et al., 1995) orepatoblastoma (Nagata et al., 1999). Increased copyumber of 7p22 was reported for oral squamous cellarcinoma (Gebhardt et al., 1998) and endometriosisGogusev et al., 1999).

xon/Intron Structure of the Human RAC1 Gene

The RAC1 gene consists of 7 coding exons over aength of 27 kb (29.5 kb with insert in intron 3) withntron sizes varying from 0.3 to 12.4 kb, as detailed inig. 1A. All exon–intron boundaries follow the majorplice junction motifs with GT at the splice donor andG at the splice acceptor site (Fig. 1D). The lengthsnd positions of the exons within the rac1 coding se-uence are identical to those described for rac2, thusonfirming close evolutionary relation of both genes.owever, both genes are different in size (compareigs. 1B and 1C) and contain one specific exon each,ot found in the other gene. The RAC1 gene contains,s hypothesized previously (Jordan et al., 1999), amall additional exon 3b included by alternative splic-ng into the variant cDNA Rac1b. No such variant haseen described for either Rac2 or Rac3, yet. However,ollowing the recent publication of the complete se-uence from chromosome 22 (Dunham et al., 1999) weere able to analyze the RAC2 intron 3 sequence in

dAeot

ccHiN

aCmleu


etail (the RAC2 gene is part of BAC RP1-151B14,ccession No. Z82188). Neither was any additionalxon predicted by computer programs, nor does anypen reading frame exist within the 806 nt intron 3hat would correspond to a Rac1b-homolog exon 3b. We

FIG. 1. Structure of the human rac1 gene. (A) Diagram of the gend their size is given below in base pairs. Connecting lines betweenlones from which the sequence was assembled are given as solid liarked as boxes. (C) Scale diagram of the RAC2 gene with exons ma

ines indicate the exon-encoded peptide sequence and the bottom linesxon sequence; lowercase letters, intronic sequence). Splice cleavagender the Accession No. AJ132695.

744

an therefore conclude that the RAC2 gene does notontain a splice variant with an additional exon 3b.owever, the RAC2 gene contains a terminal, noncod-

ng exon that will be described in more detail with theorthern blot data below.

al organization. The boxes containing the numbers represent exonsboxes represent introns and their size is indicated in kilobase pairs.below the scheme. (B) Scale diagram of the RAC1 gene with exonsd as boxes. (D) Sequence details of the exon/intron borders. The topresent nucleotide sequences flanking the splice sites (capital letters,

tes are indicated by a slash. The complete nt sequence is available

nertwonesrkerepsi

T

lcsAshAstpttasiGitAilaea

mtimnehloRusdtc(

GlTatapos

aSc


he Rac1 59-Untranslated Region

Analysis of Rac1 ESTs from the database revealed ateast four different transcription initiation sites at nu-leotide positions 2174, 2190, 2201 and 2321 (Acces-ion Nos. AA043952, AA148226, AL135483, andW328068, respectively). All attempts to amplify theseites by 59-RACE were negative, probably due to theigh GC content of the sequence upstream of the startTG. The presence of various transcription initiationites is frequent in genes with TATA-less promoters ofhe housekeeping gene type. The human RAC1 generomoter was located within 485 bp upstream of theranslation start codon ATG (i.e., 164 nt upstream ofhe first transcription initiation site) and is flanked by300 bp AluSq repeat element. The promoter displays

everal characteristics typical for housekeeping genes:t lacks both a TATA-box and a CCAAT-box, it is veryC-rich (74.2%) and contains a CpG island surround-

ng the transcription initiation sites. The island ex-ends from about 500 nt upstream of the start codonTG until about 300 nt into intron 1 (Fig. 3). CpG

slands typically show an open chromatin structure,ow in histone H1 and rich in acetylated histones (Tazind Bird, 1990; McArthur and Thomas, 1996). Duringarly embryonic development most DNA is unmethyl-ted, but after embryo implantation a wave of de novo

FIG. 2. Chromosomal localization of the RAC1 gene. Fluorescencrrows and zoom). Metaphase spreads were prepared from normaubcloned RAC1 introns 3, 3b, and 4 (total size 7.5 kb) were digoonjugated to rhodamine.

745

ethylation modifies most of the genome, excludinghe majority of CpG islands associated with housekeep-ng genes. This genomic methylation pattern is broadly

aintained during the life of the organism by mainte-ance methylation, and generally correlates with genexpression (Siegfried et al., 1999). Sp1 binding sitesave been identified as an important element in estab-

ishing and/or maintaining the methylation-free statef CpG islands and four of them are present in theAC1 promoter. While most CpG islands are normallynmethylated, island methylation can occur and is as-ociated with silencing of the corresponding gene, e.g.,uring imprinting of genes like igf2 (Li et al., 1993) orumorigenesis (Momparler and Bovenzi, 2000), as re-ently shown for the mismatch repair gene hMLH1Herman et al., 1998).

One of the most common regulatory elements withinC-rich promoter sequences are the GC box, the re-

ated CACC box and binding sites for the factor SP1.hey are widely distributed in promoters, enhancersnd locus control regions of housekeeping as well asissue-specific genes. Two GC boxes, 1 CACCC motifnd 4 SP1-binding sites were identified in the RAC1romoter. Recent discoveries have shown that Sp1 isnly one member of a family of three zinc-finger tran-cription factors that bind to and act through these

situ hybridization mapped the RAC1 gene to chromosome 7p22 (seeripheral blood lymphocytes using routine cytogenetic procedures.nin-labeled by nick-translation and stained with anti-digoxigenin

e inl pexige

eS

soe1AmtAttzmgFptvesnosac

cv

T

aakiesTsr

taHthssTcPp

tT


lements (Cook et al., 1999; Philipsen and Suske, 1999;uske, 1999).Housekeeping genes can still be subjected to tran-

criptional regulation by additional factors, as previ-usly shown for a number of other genes with promot-rs of this class (Kelner et al., 2000; Janssens et al.,999; Perrin and Foster, 1997; Harrison et al., 1996).ccordingly, the RAC1 promoter contains consensusotifs for binding of the transcription factors E2F-2,

he jun/fos-containing homo- or heteromeric complexesP1, AP2, AP4 and for the oncogene ETS-1. In addi-

ion, five consensus motifs were found for Ikaros2, andwo for MZF1. Ikaros proteins are lymphoid-restrictedinc finger transcription factors that are consideredaster regulators of lymphocyte differentiation (Geor-

opoulos et al., 1994; Klug et al., 1998). Myeloid Zincinger gene1 (MZF1) is expressed in hematopoieticrogenitors committed to the myeloid lineage. Theseranscription factors are specific for hematopoietic de-elopment and might thus indicate a role of RAC1 genexpression in these events. Interestingly, recent re-earch indicates a fundamental role of the guanineucleotide exchange factor Vav in T- and B-cell devel-pment (reviewed by Cantrell, 1998). Vav is expressedpecifically in hematopoietic cells where it selectivelyctivates Rac1 signaling. The organization of the actinytoskeleton was found to be essential during receptor

FIG. 3. Sequence and features of the RAC1 gene promoter. Thranscription initiation sites are bold capital letters, and underlineransFac database.

746

lustering required for lymphocytes activation (re-iewed by Penninger and Crabtree, 1999).

he RAC1 Gene Is Ubiquitously Expressed

Expression of the RAC1 gene was determined usinghuman multiple tissue Northern blot hybridized withrac1 cDNA probe. As one would expect from a house-eeping gene promoter, specific signals were detectedn all 12 tissues concerned, as shown in Fig. 4B. How-ver, expression levels varied significantly between tis-ues, being strongest in heart, placenta, and kidney.his indicates that ubiquitous RAC1 expression can beubjected to additional tissue-specific transcriptionalegulation.The human RAC1 gene was found expressed in all 12

issues as two transcripts of 1.2 and 2.5 kb in size, ingreement with previous reports (Didsbury et al., 1989;aataja et al., 1997). In addition, the ratio of both

ranscripts varied according to the tissue. For example,uman brain contains predominantly the 2.5 kb tran-cript whereas peripheral blood lymphocytes expresslightly more of the 1.2 kb than of the 2.5 kb transcript.he presence of two rac1 transcripts of different sizeould indicate competing polyadenylation signals.olyadenylation requires three sequence elements: aoly(A) signal (AAUAAA, or less frequently AUUAAA),

ranslated sequence of exon 1 is given in capital letters, the threere recognition motifs for transcription factors identified from the

e td a

p(p3SwvtDapp


FIG. 4. Expression of the human RAC1 gene. (A) A human multiple tissue Northern blot (Clontech) was hybridized with a rac1 cDNArobe (b-actin as loading and quality control). Tissues were brain (1), heart (2), skeletal muscle (3), colon (4), thymus (5), spleen (6), kidney7), liver (8), small intestine (9), placenta (19), lung (11), and peripheral blood lymphocytes (12). Note the ubiquitous rac1 expression, theresence of two transcripts of 1.2 kb and 2.5 kb in size, and the tissue-specific transcript ratios. (B) Sequence and features of the9-untranslated region of the human RAC1 gene. Shown are exon 6 (capital letters), the two polyadenylation sites (bold) and two knownTS-markers, namely sWSS2749 (underlined by traces) and sWSS2233 (underlined). Furthermore, an A-rich stretch was marked bold thatas frequently identified as putative polyA-tail due to annealing of oligo-dT primers during in vitro cDNA synthesis. Below is given a close-upiew of the conserved sequence motifs around both polyadenylation signals. The capital letters in each line indicate first the polyA-signal,hen the (G)T-rich element. Pre-mRNA cleavage points, as deduced from EST-clones and 39-RACE experiments, are indicated by arrows. (C)istinction of both rac1 transcripts by Northern blot. Total RNA was isolated from SW480 colorectal cell line and 10 mg separated in a 1%garose gel, transferred to a nylon membrane, and hybridized with either radioactively labelled Rac1 coding sequence (probe 1, cds) or withrobe 2 amplified by PCR from the 39-UTR sequence inbetween the polyadenylation signals pA1 and pA2 (probe 2). Note that the 39-UTRrobe hybridized only to the 2.5 kb transcript.

747

tsodagpacreRsm

coas(wtslapcs2

ctrRsci


he poorly defined cleavage site at 11–23 nt down-tream, and finally a GU- or U-rich region for bindingf the cleavage stimulation factor (CStF) at 10–30 ntownstream of the cleavage site (Edwalds-Gilbert etl., 1997; Barabino and Keller, 1999). Inspection of theenomic sequence from the 39-UTR revealed two sucholyadenylation consensus signals at 319 nt (ATTAAA)nd at 1518 nt (AATAAA) downstream of the stopodon (Fig. 4A). Both signals revealed a T-rich or GT-ich element around 30 bp downstream (Fig. 4A). Tovaluate whether they were functional in vivo, theAC1 39-end sequence was compared by databaseearches to ESTs and, moreover, determined experi-entally by 39-RACE experiments using the human

FIG. 5. Alternative splicing of Rac1 transcripts. (A) Ethidium bolorectal cell lines HT29 and SW480, and from the breast cancerranscribed with oligo-dT primers followed by amplification of Rac1 uacTaaEco (59-ggaattcttacaacagcaggcattttctcttcc) in 30 cycles of 94°Cac1 product, the second product of about 640 bp in HT29, ZR75.1taining of actin in transfected NIH-3T3 fibroblasts. A constitutivelyloned into a pcDNA3-myc-tagged expression vector, transfected intommunofluorescence. Note the induction of lamellipodia formation b

748

olon Marathon cDNA system (Clontech). The majorityf 39-end sequences isolated for RAC1 resulted fromnnealing of the cDNA synthesis primer to an A-richequence stretch at 56 nt downstream of the stop codonFig. 4A). Since no conserved polyadenylation signalas present these clones are likely to reflect artefac-

ual annealing of oligo-dT primers in vitro, the initialtep in first strand cDNA synthesis required for cDNAibrary construction or RT-PCR. Eventually, a largemount of EST clones exist that do not reflect the trueoly(A) tail of the mature rac1 mRNA. A second set oflones revealed polyadenylation at 16 or at 18 nt down-tream of the AUUAAA-signal, and a third set at 12 or1 nt downstream of the AAUAAA-signal (Fig. 4A).

ide stained agarose gel showing Rac1 RT-PCR products from thell lines T47D, ZR75.1 and MCF7. Total RNA (3 mg) was reverseg the primers racBamATG (59-ggggatcccaggccatcaagtgtgtggtgg) and30 s, 61°C for 30 s, 72°C for 1 min. Note beside the expected 591 bp

d T47D cells corresponding to Rac1b (10). (B) Immunofluorescenceive Rac1b-Q61L and a dominant negative Rac1b-T17N mutant wereroblasts and the cells stained for actin and the c-myc epitope tag byctive Rac1b-Q61L.

romce

sinforanactfib

y a

Tbtpwpttrimlvg

asHohZba(nmsragbsa

A

wibRpawpipesc7Te

pwR

msoifacvlcpaThswf

gsGncRtMgecpiitemRialpwm

A

JsGT

R

A


hese data provided evidence for in vivo utilization ofoth polyA signals. In order to finally demonstrate thathe presence of two rac1 transcripts was due to com-etition between both signals, Northern blot analysisas repeated with a probe hybridizing in-between botholy(A) signals. This probe did only label the 2.5 kbranscript (Fig. 4C). We conclude that the primary rac1ranscript contains a continuous 1.5 kb 39-non codingegion in which two polyadenylation sites are compet-ng in a tissue-dependent ratio to give rise to two

essenger RNAs of 1.2 and 2.5 kb in size. Transcriptength can reflect differences in mRNA stability in-olved in regulation of gene expression of a particularene in a given tissue (Edwalds-Gilbert et al., 1997).In contrast to two rac1 transcripts, Northern blot

nalysis of the RAC2 gene had previously revealed aingle 1.45 kb transcript (Didsbury et al., 1989;aataja et al., 1997). Following the recent publication

f the complete sequence from chromosome 22 (Dun-am et al., 1999) containing the RAC2 gene (Ac nb:82188) we analyzed the 39-UTR sequence and foundy comparison with ESTs that the RAC2 gene contains631 bp intron 6 followed by a seventh noncoding exon

Fig. 1C) containing the consensus polyadenylation sig-al “AATAAA.” This exon contributes 768 nts to theRNA and is thus longer than the entire rac2 coding

equence, explaining the size of 1.4 kb found for theac2 transcript. The presence of a 39 noncoding exon isnother major difference between the RAC1 and RAC2ene structures. The RAC1 gene shows no such exonut a continuous 39 untranslated region of 1.5 kb inize that contains two different, competing polyadenyl-tion signals.

lternative Splicing of the Rac1 Transcript

The expression profile of the human Rac1 GTPaseas further determined by reverse transcription-PCR

n two colorectal cell lines, HT29 and SW480 and threereast cancer lines T47D, ZR75.1 and MCF7. TotalNA was isolated, reverse transcribed using oligo-dTrimers and then amplified with rac1-specific primers,s described (Jordan et al., 1999). When the productsere separated by agarose gel electrophoresis, the ex-ected 590 bp product of the Rac1 cDNA was detectedn all samples (see Fig. 5A). In addition, a secondroduct of 640 bp was detected in HT29, ZR75.1 andspecially in T47D cells. This 640 bp product corre-ponded to the recently described splice variant Rac1bontaining additional 57 nucleotides between codons5 and 76 (Jordan et al., 1999; Schnelzer et al., 2000).he small difference in size was not detected by North-rn blotting.An interesting question is whether Rac1b has the

otential to participate in signal transduction path-ays. To elucidate this possibility a classical feature ofac1-signaling was investigated, the induction of la-

749

ellipodia formation in fibroblasts. To this end a con-titutively active Rac1b-Q61L mutant was raised byverlap extension PCR (Pogulis et al., 1996), subclonednto a Myc-tagged expression vector, transiently trans-ected into NIH-3T3 mouse fibroblasts and cells werenalyzed by immunofluorescence (Fig. 5B). The actinytoskeleton was labeled by phalloidin and clearly re-ealed that transfected NIH-3T3 cells, identified byabeling for the myc-tag, had formed lamellipodia. Inontrast, nontransfected cells at the vicinity of myc-tagositive cells, or cells transfected with a dominant neg-tive mutant Rac1b-T17N were devoid of lamellipodia.ogether with the in vitro demonstration that Rac1bas GTPase activity (Schnelzer et al., 2000), these datauggest participation of Rac1b in cell signaling path-ays, with the additional 19-amino-acid loop as plat-

orm for interaction with other signaling elements.From this result we conclude that the RAC1 gene

ives rise through alternative splicing to two tran-cripts and that transfection of corresponding activeTPase mutant cDNAs affects actin cytoskeleton dy-amics. Alternative splicing of pre-messenger RNA is aommon phenomenon mediated by the interaction ofNA-binding proteins with specific splice site recogni-

ion elements (reviewed by Chabot, 1996; Cooper andattox, 1997). The extent of alternative splicing of a

iven transcript is thought to reflect the tissue-specificxpression profile of such RNA-binding proteins. A re-ent report demonstrated how signal transductionathways can change the alternative splicing patternn a cell: the p38-MAP kinase phosphorylates the splic-ng factor hnRNP A1 leading to its cytoplasmic seques-ration and a subsequent shift in nuclear splicingvents (van der Houven van Oordt et al., 2000). Suchechanisms could be responsible for the differentac1b levels observed in the five cell lines, but also for

ts increased expression in colorectal tumors (Jordan etl., 1999). The present description of the structure,ocalization and expression of the human RAC1 generovides the molecular basis to study in more detailhether and how RAC1 expression is involved in tu-origenesis and development.

CKNOWLEDGMENTS

We thank Sonia Pedro for running the automated ABI sequencer,o-Anne Herbrick for technical advice, and Dr. Rocchi, Bari, Italy, forending somatic cell hybrid DNAs. This work was supported byrant Praxis/SAU/14136/98 from the Fundacao para a Ciencia eecnologia, Portugal.

EFERENCES

nand-Apte, B., Zetter, B. R., Viswanathan, A., Qiu, R. G., Chen, J.,Ruggieri, R., and Symons, M. (1997) Platelet-derived growthfactor and fibronectin-stimulated migration are differentiallyregulated by the rac and extracellular signal-regulated kinasepathways. J. Biol. Chem. 272, 30688–30692.

Barabino, S. M. L., and Keller, W. (1999) Last but not least: Regu-

B

B

C

C

C

C

C

D

D

E

F

G

G

G

H

H

H

H

H

J

(1999) Functional analysis of the promoter region of the human

J

J

K

K

K

K

L

M

M

M

M

M

M

N

N

O

P

P


lated poly(A) tail formation. Cell 99, 9–11.ardi, G., Johansson, B., Pandis, N., Mandahl, N., Bak-Jensen, E.,

Andren-Sandberg, A., Mitelman, F., and Heim, S. (1993) Karyo-typic abnormalities in tumours of the pancreas. Br. J. Cancer67, 106–112.

ardi, G., Sukhikh, T., Pandis, N., Fenger, C., Kronborg, O., andHeim, S. (1995) Karyotypic characterization of colorectal ade-nocarcinomas. Genes Chromosome Cancer 12, 97–109.

antrell, D. (1998) A coordinating role for Vav? Curr. Biol. 8, R535–538.

habot, B. (1996) Directing alternative splicing: Cast and scenarios.Trends Genet. 12, 472–478.

ook, T., Gebelein, B., and Urrutia, R. (1999) Sp1 and its likes:Biochemical and functional predictions for a growing family ofzinc finger transcription factors. Ann. N. Y. Acad. Sci. 880,94–102.

ooper, T. A., and Mattox, W. (1997) The regulation of splice-siteselection, and its role in human disease. Am. J. Hum. Genet. 61,259–266.

ourjal, F., Chuchana, P., Theillet, C., and Fort, P. (1997) Structureand chromosomal assignment to 22q12 and 17qter of the ras-related rac2 and rac3 human genes. Genomics 44, 242–246.

idsbury, J., Weber, R. F., Bokoch, G. M., Evans, T., and Snyder-man, R. (1989) Rac, a novel ras-related family of proteins thatare botulinum toxin substrates. J. Biol. Chem. 264, 16378–16382.

unham, I., Shimizu, N., Roe, A., Chissoe, S., et al. (1999) The DNAsequence of human chromosome 22. Nature 402, 489–495.

dwalds-Gilbert, G., Veraldi, K. L., and Milcarek, C. (1997) Alter-native poly(A) site selection in complex transcription units:Means to an end? Nucleic Acids Res. 25, 2547–2561.

ritz, G., Just, I., and Kaina, B. (1999) Rho GTPases are over-expressed in human tumors. Int. J. Cancer 81, 682–687.

ebhart, E., Liehr, T., Wolff, E., Ries, J., Fiedler, W., Steininger, H.,Koscielny, S., and Girod, S. (1998) Pattern of genomic imbal-ances in oral squamous cell carcinomas with and without anincreased copy number of 11q13. Int. J. Oncol. 12, 1151–1155.

eorgopoulos, K., Bigby, M., Wang, J. H., Molnar, A., Wu, P.,Winandy, S., and Sharpe, A. (1994) The Ikaros gene is requiredfor the development of all lymphoid lineages. Cell 79, 143–156.

ogusev, J., Bouquet de Joliniere, J., Telvi, L., Doussau, M., duManoir, S., Stojkoski, A., and Levardon, M. (1999) Detection ofDNA copy number changes in human endometriosis by compar-ative genomic hybridization. Hum. Genet. 105, 444–451.

all, A. (1998) Small GTP binding proteins and the regulation of theactin cytoskeleton. Science 279, 509–514.

aataja, L., Groffen, J., and Heisterkamp, N. (1997) Characteriza-tion of Rac3, a novel member of the Rho family. J. Biol. Chem.272, 20384–20388.

arrison, D. G., Sayegh, H., Ohara, Y., Inoue, N., and Venema, R. V.(1996) Regulation of expression of the endothelial cell nitricoxide synthase. Clin. Exp. Pharmacol. Physiol. 23, 251–255.

erman, J. G., Umar, A., Polyak, K., Graff, J. R., Ahuja, N., Issa,J. P., Markowitz, S., Willson, J. K., Hamilton, S. R., Kinzler,K. W., Kane, M. F., Kolodner, R. D., Vogelstein, B., Kunkel,T. A., and Baylin, S. B. (1998) Incidence and functional conse-quences of hMLH1 promoter hypermethylation in colorectalcarcinoma. Proc. Natl. Acad. Sci. USA 95, 6870–6875.

ordijk, P. L., ten Klooster, J. P., van der Kammen, R. A., Michiels,F., Oomen, L. C. J. M., and Collard, J. G. (1997) Inhibition ofinvasion of epithelial cells by Tiam1-rac signaling. Science 278,1464–1466.

anssens, V., van Hoof, C., de Baere, I., Merlevede, W., and Goris, J.

750

phosphotyrosine phosphatase activator gene: Yin Yang 1 isessential for core promoter activity. Biochem. J. 344, 755–763.

eon, I. S., Davis, J. N., Braun, B. S., Sublett, J. E., Roussel, M. F.,Denny, C. T., and Shapiro, D. N. (1995) A variant Ewing’ssarcoma translocation (7;22) fuses the EWS gene to the ETSgene ETV1. Oncogene 10, 1229–1234.

ordan, P., Brazao, R., Boavida, M. G., Gespach, C., and Chastre, E.(1999) Cloning of a novel human Rac1b splice variant withincreased expression in colorectal tumors. Oncogene 18, 6835–6839.

eely, P. J., Westwick, J. K., Whitehea, I. P., Der, C. J., and Parise,L. V. (1997) Cdc42 and rac1 induce integrin-mediated cell mo-tility and invasiveness through PI(3)K. Nature 390, 632–636.

elner, M. J., Bagnell, R. D., Montoya, M. A., Estes, L. A., Forsberg,L., and Morgenstern, R. (2000) Structural organization of themicrosomal glutathione S-transferase gene (MGST1) on chro-mosome 12p13.1–13.2. Identification of the correct promoterregion and demonstration of transcriptional regulation in re-sponse to oxidative stress. J. Biol. Chem. 275, 13000–13006.

lemke, R. L., Leng, J., Molander, R., Brooks, P. C., and Vuori, K.(1998) CAS/Crk coupling serves as a “Molecular Switch” forinduction of cell migration. J. Cell Biol. 140, 961–972.

lug, C. A., Morrison, S. J., Masek, M., Hahm, K., Smale, S. T., andWeissman, I. L. (1998) Hematopoietic stem cells and lymphoidprogenitors express different Ikaros isoforms, and Ikaros islocalized to heterochromatin in immature lymphocytes. Proc.Natl. Acad. Sci. USA 95, 657–662.

i, E., Beard, C., and Jaenisch, R. (1993) Role for DNA methylationin genomic imprinting. Nature 366, 362–365.

acara, I. G., Lounsbury, K. M., Richards, S. A., McKiernan, C., andBar-Sagi, D. (1996) The Ras superfamily of GTPases. FASEB J.10, 625–630.

cArthur, M., and Thomas, J. O. (1996) A preference of histone H1for methylated DNA. EMBO J. 15, 1705–1714.

ertens, F., Rydholm, A., Bauer, H. F., Limon, J., Nedoszytko, B.,Szadowska, A., Willen, H., Heim, S., Mitelman, F., and Man-dahl, N. (1995) Cytogenetic findings in malignant peripheralnerve sheath tumors. Int. J. Cancer 61, 793–798.

ichiels, F., Habets, G. G., Stam, J. C., van der Kammen, R. A., andCollard, J. G. (1995) A role for rac in Tiam1-induced membraneruffling and invasion. Nature 375, 338–340.

omparler, R. L., and Bovenzi, V. (2000) DNA methylation andcancer. J. Cell Physiol. 183, 145–154.

oore, K. A., Sethi, R., Doanes, A. M., Johnson, T. M., Pracyk, J. B.,Kirby, M., Irani, K., Goldschmidt-Clermont, P. J., and Finkel, T.(1997) Rac1 is required for cell proliferation and G2/M progres-sion. Biochem. J. 326, 17–20.

agata, T., Mugishima, H., Shichino, H., Suzuki, T., Chin, M., Ko-shinaga, S., Inoue, M., and Harada, K. (1999) Karyotypic anal-yses of hepatoblastoma. Report of two cases and review of theliterature suggesting chromosomal loci responsible for thepathogenesis of this disease. Cancer Genet. Cytogenet. 114, 42–50.

obes, C. D., and Hall, A. (1999) Rho GTPases control polarity,protrusion, and adhesion during cell movement. J. Cell Biol.144, 1235–1244.

lson, M. F., Ashworth, A., and Hall, A. (1995) An essential role forrho, rac and cdc42 GTPases in cell cycle progression throughG1. Science 269, 1270–1272.

enninger, J. M., and Crabtree, G. R. (1999) The actin cytoskeletonand lymphocyte activation. Cell 96, 9–12.

errin, S., and Foster, J. A. (1997) Developmental regulation ofelastin gene expression. Crit. Rev. Eukaryot. Gene Express. 7,1–10.

Philipsen, S., and Suske, G. (1999) A tale of three fingers: The family

P

R

S

S

S

Cedar, H. (1999) DNA methylation represses transcription in

S

T

T

v

Z


of mammalian Sp/XKLF transcription factors. Nucleic AcidsRes. 27, 2991–3000.

ogulis, R. J., Vallejo, A. N., and Pease, L. R. (1996) In vitro recom-bination and mutagenesis by overlap extension PCR. MethodsMol. Biol. 57, 167–176.

ao, P. H., Mathew, S., Kelsen, D. P., and Chaganti, R. S. (1995)Cytogenetics of gastric and esophageal adenocarcinomas. 3qdeletion as a possible primary chromosomal change. CancerGenet. Cytogenet. 81, 139–143.

chnelzer, A., Prechtel, D., Knaus, U., Dehne, K., Gerhard, M.,Graeff, H., Harbeck, N., Schmitt, M., and Lengyel, E. (2000)Rac1 in human breast cancer: overexpression, mutation analy-sis, and characterization of a new isoform, Rac1b. Oncogene 19,3013–3020.

haw, L. M., Rabinovitz, I., Wang, H. H-F., Toker, A., and Mercurio,A. M. (1997) Activation of phosphoinositide 3-OH kinase by thea6b4 integrin promotes carcinoma invasion. Cell 91, 949–960.

iegfried, Z., Eden, S., Mendelsohn, M., Feng, X., Tsuberi, B. Z., and

751

vivo. Nat. Genet. 22, 203–206.uske, G. (1999) The Sp-family of transcription factors. Gene 238,

291–300.azi, J., and Bird, A. (1990) Alternative chromatin structure at CpG

islands. Cell 60, 909–920.hompson, F. H., Emerson, J., Alberts, D., Liu, Y., Guan, X. Y.,

Burgess, A., Fox, S., Taetle, R., Weinstein, R., Makar, R., et al.(1994) Clonal chromosome abnormalities in 54 cases of ovariancarcinoma. Cancer Genet. Cytogenet. 73, 33–45.

an der Houven van Oordt, W., Diaz-Meco, M. T., Lozano, J.,Krainer, A. R., Moscat, J., and Caceres, J. F. (2000) The MKK(3/6)-p38-signaling cascade alters the subcellular distribution ofhnRNP A1 and modulates alternative splicing regulation.J. Cell Biol. 149, 307–316.

ohn, I. M., Campbell, S. L., Khosravi-Far, R., Rossman, K. L., andDer, C. J. (1998) Rho family proteins and ras transformation:The RHOad less traveled gets congested. Oncogene 17, 1415–1438.

Documents

Small GTPase Rac1: Structure, Localization, and Expression of the Human Gene