Embed Size (px)
Citation preview
1
Site-specific recombination strategies for engineering actinomycete genomes 1 Simone Herrmann3♣, Theresa Siegl3♣, Marta Luzhetska3, Lutz Petzke3,4, Caroline Jilg3, 2 Elisabeth Welle3, Annette Erb3, Peter F. Leadlay2, Andreas Bechthold3 and Andriy 3 Luzhetskyy1* 4
1Helmholtz-Institute for Pharmaceutical Research Saarland, Campus, Building C2 3, 5 66123 Saarbrücken, Germany 6 2University of Cambridge, Department of Biochemistry, 80 Tennis Court Road, 7 Cambridge, CB2 1GA, UK 8 3Albert-Ludwigs-University of Freiburg, Department of Pharmaceutical Biology and 9 Biotechnology, Stefan-Meier-Str. 19, Freiburg 79104, Germany 10 4BASF SE, 67056 Ludwigshafen, Germany 11 12 Keywords (site-specific recombinase, genomic engineering, actinomycetes) 13 14 15 ♣Both authors contributed equally to this work. 16 17 *Corresponding author: Dr. A. Luzhetskyy 18 Helmholtz Institute for Pharmaceutical Research 19 Campus, Building C2 3, 66123 Saarbrücken, Germany 20 Email: [email protected] 21 Tel: ++49 681 30270215 22 23 24 25 26 27 28 29
Copyright © 2012, American Society for Microbiology. All Rights Reserved.Appl. Environ. Microbiol. doi:10.1128/AEM.06054-11 AEM Accepts, published online ahead of print on 13 January 2012
on February 13, 2018 by guest
http://aem.asm
.org/D
ownloaded from
2
ABSTRACT 30 The feasibility of using technologies based on site-specific recombination in 31 actinomycetes was shown several years ago. Despite their huge potential, these 32 technologies mostly have been used for simple marker removal from a chromosome. In 33 this paper, we present different site-specific recombination strategies for genome 34 engineering in several actinomycetes belonging to the genera Streptomyces, 35 Micromonospora and Saccharothrix. Two different systems based on Cre/loxP and 36 Dre/rox have been utilised for numerous applications. The activity of the Cre 37 recombinase on the heterospecific loxLE and loxRE sites was similar to its activity on 38 wild type loxP sites. Moreover, an apramycin resistance marker flanked by loxLERE sites 39 was eliminated from the Streptomyces coelicolor M145 genome at a surprisingly high 40 frequency (80%) compared to other bacteria. A synthetic gene encoding the Dre 41 recombinase was constructed and successfully expressed in actinomycetes. We developed 42 a marker-free expression method based on the combination of phage integration systems 43 and site-specific recombinases. The Cre recombinase has been used in the deletion of 44 huge genomic regions, including the phenalinolactone, monensin and lipomycin 45 biosynthetic gene clusters from S. sp. Tü6071, S. cinnamonensis A519 and S. 46 aureofaciens Tü117, respectively. Finally, we also demonstrated the site-specific 47 integration of plasmid and cosmid DNA into the chromosome of actinomycetes catalysed 48 by the Cre recombinase. We anticipate that the strategies presented here will be used 49 extensively to study the genetics of actinomycetes. 50 51 INTRODUCTION 52 Actinomycetes, including the largest genus Streptomyces, are Gram-positive bacteria with 53 a high GC content and a complex life cycle. They are the most productive bacteria with 54 respect to the synthesis of bioactive metabolites used in pharmaceutical and agricultural 55 applications (10). The spread of resistance to known antibiotics confronts scientists with 56 the urgent need to find new active compounds (4, 24). Many natural products are too 57 complex for trivial chemical synthesis. Therefore, metabolic engineering presents an 58 alternative and attractive way to manufacture novel chemical entities. Metabolic 59 engineering relies upon the modification of genes and genomes and thus requires a 60 number of reliable genome modification methods (15). Additionally, the demand for 61 functional gene characterisation has increased greatly due to extensive whole genome 62
on February 13, 2018 by guest
http://aem.asm
.org/D
ownloaded from
3
sequencing in actinomycetes. Our ability to sequence genomes greatly outpaces our 63 ability to modify them. The genetic manipulation of actinomycetes still represents a 64 serious challenge due to a lack of suitable tools and selection markers. Here, we apply 65 well-established genetic tools from other bacteria for use in actinomycetes. Site-specific 66 recombination (SSR) systems provide powerful and efficient instruments for high-67 throughput genetic analysis of bacteria in the post genomic era (19). Site-specific genome 68 recombination systems have been described for a number of bacteria (1, 3, 20, 28). 69 Typical applications of site-specific recombinases include the construction of unmarked 70 mutants (5), targeting of heterologous DNA into the chromosome (27), marker-free 71 expression of foreign genes (12), transient and timed expression of genes (31), deletion of 72 large genomic fragments (4), and in vivo cloning of genomic DNA regions among others 73 (28). Many SSR applications are based on the Cre/loxP system from the P1 phage and the 74 Flp/FRT system from yeast (3, 28). The Cre and Flp proteins are bidirectional tyrosine 75 recombinases catalysing reciprocal SSR of DNA at 34-bp target sites (loxP and FRT, 76 respectively), which results in either excision or inversion depending on whether the 77 target sites are located as direct or inverted repeats. Both recombinases are relatively 78 context independent since they do not require any host cofactors or accessory proteins 79 (33). Both Flp and Cre recombinases have been successfully expressed in actinomycetes. 80 In 2006, successful expression of the Cre recombinase in Streptomyces coelicolor A(3)2 81 was reported (16). The use of this system was limited, probably because the cre gene was 82 introduced into streptomycetes on the native phage itself, which is not a widely used 83 method of gene expression in streptomycetes. We have subsequently reported the 84 successful expression of two synthetic genes encoding the Cre and Flp recombinases. 85 These constructs were used to delete resistance markers in members of the Streptomyces 86 and Saccharothrix genera (7, 8). The native Flp encoding gene was also expressed in 87 streptomycetes, though at lower efficiency (40). 88 In this study, we show that heterotypic lox sites in actinomycetes cannot be used for the 89 construction of multiple mutations, since the Cre recombinase has a high affinity for the 90 doubly mutated loxLERE site. Instead, we have efficiently expressed another recombinase 91 called Dre, which recognises a different target site called rox and thus provides an 92 additional tool for marker removal. Dre recombinase was first described by Sauer and 93 McDermott (2004) in the P1-like transducing bacteriophage D6 isolated from Salmonella 94 oranienburg. The genes encoding Dre and Cre recombinase share only 39% sequence 95
on February 13, 2018 by guest
http://aem.asm
.org/D
ownloaded from
4
similarity. Using transfection of mammalian CHO cells, Sauer and McDermott (2004) 96 could show that Dre recombinase catalyzes site-specific DNA recombination recognizing 97 rox sites, whereas Cre recombinase is not able to recognize rox sites, which are distinct 98 from loxP sites. Using the Cre and Dre recombinases, we developed a marker-free 99 expression system based on the VWB and φC31 integration-proficient vectors from 100 which antibiotic resistance markers, integrase genes and the remaining plasmid backbone 101 can be evicted after integration of the desired sequences into the chromosome. 102 Additionally, we describe a novel strategy for Cre/loxP-mediated deletion of large 103 genomic fragments, which requires only two single crossovers. The system has been 104 validated by the successful deletion of the three large gene clusters for phenalinolactone, 105 lipomycin and monensin biosynthesis. Finally, we were able to integrate foreign DNA 106 into the streptomycetes chromosome using the Cre recombinase. These methods for 107 genome manipulation further expand the molecular genetics toolbox for actinomycetes 108 and provide new opportunities for functional gene characterisation. 109 110 MATERIALS AND METHODS 111 Strains and media 112 S. lividans TK24, S. sp. Tü6071, S. coelicolor M145, Micromonospora Tü6368, 113 S. cinnamonensis A519, and S. aureofaciens Tü117 (13) were used as hosts for 114 expression of the codon optimized synthetic cre(a) and dre(a) genes encoding Cre and 115 Dre recombinase, respectively. The Escherichia coli strain DH5α was used for cloning, 116 and the strain ET12567/pUZ8002 was used to drive the conjugative transfer of non-117 methylated DNA from E. coli to the actinomycete recipient as previously described (9, 118 22). Cultivation of the E. coli strains was performed as previously described (26). 119 Streptomyces strains were grown on mannitol soy flour agar plates (MS agar), HA agar 120 plates, and ABB13 plates. ABB13 medium contained the following components (in 121 grams per litre): Bacto Soytone, 5; soluble starch, 5; CaCO3, 3; MOPS buffer, 2.1, and 122 Bacto Agar, 20. After autoclaving, 1.0 ml of a filter-sterilised 1.0% (wt/vol) stock 123 solution of thiamine HCl and 1.0 ml of 1.2% (wt/vol) FeSO4 x 7 H2O were added. Liquid 124 growth was performed in tryptone soy broth (TSB) (17). Apramycin, spectinomycin, and 125 hygromycin were added to the medium to final concentrations of 50 μg/mL, 100 μg/mL 126 and 150 μg/mL, respectively. 127
on February 13, 2018 by guest
http://aem.asm
.org/D
ownloaded from
5
Plasmid construction 128 The plasmids used in this work are displayed in Table 1. The plasmids were verified by 129 restriction endonuclease mapping. 130 Comparison of the in vivo efficiency of Cre-mediated recombination of different lox 131 pairs. pLERE. The synthetic vector pLERE contains two loxLE sites and two loxRE sites 132 in addition to an ampicillin resistance gene and was ordered from GENEART 133 (Regensburg, Germany). Different plasmids based on this vector were constructed to 134 determine the recognition efficiency of mutated lox sites. pINTRE. An apramycin 135 resistance gene was amplified from vector pMOD3-aac using EcoRI (marked in italics) 136 containing primers AG1 5’-ACGTACCGAATTCGGTTCATGTGCAGCTCCATCAGC 137 and aac-r 5’-ACGTACGAATTCATGAGCTCAGCCAATCGACTGG. Ligation of this 138 fragment into MunI digested pLERE resulted in an apramycin resistance gene flanked by 139 two loxRE sites. The two redundant loxLE sites were removed by XbaI/NheI digestion 140 and subsequent religation of the plasmid. A 3.4 kb NheI/XbaI restriction fragment of 141 pSET152 containing oriT, the attP site, and the integrase gene was ligated into the SpeI-142 digested plasmid to produce pINTRE. pINTLE and pINTLERE were constructed in a 143 similar manner, but an apramycin resistance gene was flanked by loxLE (pINTLE) and 144 loxLE plus loxRE (pINLERE). pALCRE. The synthetic gene cre(a) was subcloned from 145 pUWLCRE into pAL1 using HindIII/BamHI digest to produce pALCRE. 146 Dre recombinase, pALDRE, and pUWLDRE. The synthetic gene dre(a) was 147 synthesised by GenScript (Piscataway, NJ, U.S.A.) and cloned via HindIII/BamHI digest 148 into pAL1 and pUWLoriT to produce pALDRE and pUWLDRE, respectively. 149 pINTROX. The apramycin resistance cassette aac(3’)IV was amplified from pIJ773 150 using the primers roxF 5’- 151 AAGCTTTAACTTTAAATAATGCCAATTATTTAAAGTTATTTCATGAGCTCAGC152 CAATCGAC and roxR 5’- 153 GAATCCTAACTTTAAATAATTGGCATTATTTAAAGTTAATTCCGGGGATCCGT154 CGACC (rox sites underlined) and cloned into pIJ2925 (1) to produce pIJrAmr. The 155 phage φC31 integrase gene and an attP site were digested from pSET152 using PstI and 156 SphI and cloned into pIJrAmr to produce pINTROX. 157 Marker-free expression. pTOS (Fig. 1). The first plasmid is based on the vector 158 pSOK804 (29), which uses the phage VWB integration system. The original plasmid 159
on February 13, 2018 by guest
http://aem.asm
.org/D
ownloaded from
6
attachment site (attP) was substituted with a synthesised DNA fragment consisting of the 160 same attP site now flanked by rox sites and six unique restriction sites via BamHI/SphI 161 digestion to produce pTOS. pTES (Fig. 2). The second plasmid is based on the vector 162 pSET152 (1), which uses the phage φC31 integration system. The attP site of pSET152 163 overlaps the integrase promoter, which is not suitable for our application. Destruction of 164 this attP site was accomplished by deleting two thymines in the core sequence through 165 site-directed mutagenesis PCR, which leaves the integrase promoter functional and 166 creates pSETdel2T. While previous work has shown deletion of a single T in the TTT 167 core sequence cannot promote recombination (32), we still obtained apramycin resistant 168 exconjugants. A synthesised DNA fragment consisting of an unmutated attP site, a tfd 169 terminator, the strong promoter ermE, five unique restriction sites and a second tfd 170 terminator all bordered by two loxP sites was digested by SnaBI (order: SnaBI-loxP-attP-171 tfd-rpsL-ermE-polylinker-tfd-loxP-SnaBI). This DNA fragment was blunt end ligated 172 between the two PvuII restriction sites flanking the original polylinker of pSETdel2T to 173 produce pTES. 174 Plasmids for the lipomycin gene cluster deletion. pIJloxP-lipbeg. The polylinker of 175 pUC18 was amplified by PCR using the primers laclox-f 5’ - 176 CTGTCGAGATCTATAACTTCGTATAGCATACATTATACGAAGTTATCTGGCTTA177 ACTATGCGGCAT and laclox-r 5’ - 178 CTGTCGAGATCTATAACTTCGTATAATGTATGCTATACGAAGTTATGGAAACA179 GCTATGACCATGA containing loxP sites (underlined) and BglII restriction sites 180 (marked in italics). This 428 bp PCR fragment was cloned into plasmid pIJ2601 (30) to 181 produce pIJloxP. A 2911 bp PCR fragment homologous to the 5’ end of the α-lipomycin 182 cluster from S. aureofaciens Tü117 was amplified using the primers lipbegin-f 5’ - 183 CTGTCGAAGCTTATTACCCTGTTATCCCTACGATCTGGACCCGGTTGTTGAG 184 (HindIII restriction site marked in italics) and lipbegin-r 5’ - 185 CTGTCGGAATTCTGGTCGGCCGTGTAGTAGTCCT (EcoRI restriction site marked in 186 italics) and cloned via HindIII/EcoRI digestion into pIJloxP to give rise to pIJloxP-lipbeg. 187 pBeloBAC2601-lipend. To obtain the BAC vector pBeloBAC2601-lipend, a 2064 bp 188 PCR fragment homologous to the 3’ end of the α-lipomycin cluster from S. aureofaciens 189 Tü117 was amplified using the primers lipend-f 5’ - 190 CTGTCGGACTGCAGATCCGCATGCCGTACTGCGTG (SphI restriction site marked 191 in italics) and lipend-r 5’ - CTGTCGAAGCTTGGACTCCACCGCGCAGAAACC 192
on February 13, 2018 by guest
http://aem.asm
.org/D
ownloaded from
7
(HindIII restriction site marked in italics) and cloned via HindIII/SphI digestion into 193 pBeloBAC2601 (30). Plasmids for the monensin gene cluster deletion. pMStart2-194 loxP-hyg. Homologous regions of the monensin biosynthetic gene cluster were amplified 195 from cosmids Cos2 and Cos11 (24). A 1.6 kb PCR fragment was amplified from Cos2 196 using the primers MonStart-F 5´ - GCTCCGAATTCCCTCGACGGAG and MonStart-R 197 5´ - GGCCAGAATTCTGCGGTGCACG, which introduced EcoRI sites at both ends of 198 the fragment (marked in italics). This fragment contained the complete monAI gene (806 199 bp) and the beginning of the monAIX gene (460 bp) and was ligated into EcoRI-digested 200 pUC19 (38) to produce pMStart. A second PCR fragment (1.4 kb) was amplified from 201 pIJ774 using the primers 2loxPapra-F 5´ - 202 TACTGCACGGCGAGCACCTCGACGCCGGGCGCGAGCAGCATTCCGGGGATCC203 GTCGACC and 2loxPapra-R 5´ - 204 CGAAGCAGCTCCAGCCTACACGCGGGCGGTTCGGCGAGTTACTACTTCGGGC205 TCTCCGG. It consisted of an apramycin resistance gene and one origin of transfer 206 flanked by two loxP sites. The homologous regions of monAIX produced the ends of the 207 fragment. This fragment was introduced into pMStart using the RedET recombination 208 system. A hygromycin resistance gene was excised from pIJ10700 by XmnI/HindIII 209 digestion. The ends were blunted using the Klenow fragment (New England Biolabs, 210 Ipswich, USA), and the fragment was cloned into SpeI-digested pMStart to produce 211 pMStart-2loxP-hyg. pMEnd-loxP. A 1.6 kb PCR fragment containing monD was 212 amplified from Cos11 using the primers MonEnd-F 5´ - 213 CGGTGACAAGCTTGAGGTATTCC (HindIII site marked in italics) and MonEnd-R 5´ - 214 CGCACATGTGCAGAGGGAAG (PciI site marked in italics) and cloned into pUC19 via 215 HindIII/PciI digestion. A second PCR fragment was amplified from pIJ774 using the 216 primers loxPapra-F 5´ - ATTGTAAGCTTGAGCTGCTTC and loxPapra-R 5´ - 217 TATGAGGATCCCGCC, which introduced a HindIII site and a BamHI site, respectively 218 (marked in italics). This fragment contained an apramycin resistance gene, the origin of 219 transfer and one loxP site and was ligated into the intermediate plasmid to produce the 220 final plasmid, pMEnd-loxP. Plasmids for the phenalinolactone gene cluster deletion. 221 pIJloxPbegin. The homologous region was PCR amplified from the cosmid 3-1O12 222 using PfuI polymerase and the primers BG1 (5´-GCCAAGCTTGAGCCGGGCAACCC-223 3´) and BG2 (5´-TACGAATTCACGAATCGCTGCTCGACGC-3´), which introduced a 224 HindIII site and an EcoRI site (marked in italics), respectively, at the ends of the 225
on February 13, 2018 by guest
http://aem.asm
.org/D
ownloaded from
8
fragment. This 2.2 kb fragment was ligated between two loxP sites of the digested vector 226 pIJloxP. pIJloxPend. The homologous region for the second plasmid was also amplified 227 by PfuI polymerase from the cosmid 3-1O12 template. The primers EN1 (5´- 228 GCCAAGCTTCGCCGCGTTCTGGAACG-3´) and EN2 (5´- 229 ACGCTGCAGTCAGACGAACTTGTGCC-3´) introduced a HindIII site and a PstI site 230 (marked in italics), respectively, at the ends of the fragment. After HindIII/PstI digestion, 231 the 2.4 kb fragment was ligated into HindIII/PstI-digested pIJloxP vector to produce 232 pIJloxPend. 233 Cluster deletion procedure. The relevant actinomycetes strain contained two loxP sites 234 as direct repeats flanking the region of interest. The plasmid pALCRE was introduced 235 into the respective mutant strain by conjugation and successful exconjugants were 236 obtained by their ability to grow on hygromycin supplemented MS-plates. Exconjugants 237 were grown in liquid culture supplemented with hygromycin but without apramycin until 238 stationary phase. At this point expression of the artificial Cre recombinase gene was 239 induced by adding 5.0 µg/ml thiostrepton to the liquid culture and subsequent incubation 240 for ten hours. This procedure of growth to the stationary phase followed by induction was 241 repeated six times to assure that the recombination event takes place. Subsequently, the 242 culture was cultivated twice at 37°C to counterselect for the temperature sensitive 243 replicon of pALCRE and thereby promote loss of the plasmid. The culture was diluted 244 onto HA plates to obtain single colonies. Those colonies were replica-patched onto HA 245 plates without antibiotics and HA plates with apramycin. The growth of colonies only in 246 broth without apramycin indicated that the region of interest had been excised from the 247 chromosome to leave a single loxP site. One of these colonies was randomly chosen for 248 the following experiments. 249 Cluster complementation. The φC31 based cosmid 3-1O12 was conjugated into the 250 deletion mutant S. sp. Tü6071/Δpla-loxP and integrated into the attB site of the mutant 251 chromosome. In the case of the two further deletion mutants S. cinnamonensis 252 A519/Δmon-loxP and S. aureofaciens Tü117loxP2Δlip no complementing cosmids were 253 available to restore the production of the respective metabolite. 254 255 RESULTS 256
on February 13, 2018 by guest
http://aem.asm
.org/D
ownloaded from
9
Introducing a novel Dre recombinase for actinomycetes. Cre recombinase has low 257 affinity for the double-mutant loxLERE site, which is generated by Cre-mediated 258 recombination between loxLE and loxRE together with a wild-type loxP site (21). We 259 compared the in vivo Cre-mediated recombination efficiencies of different lox pairs in S. 260 coelicolor M145. The Cre-mediated excision efficiency of an apramycin resistance gene 261 flanked by loxLE and loxRE mutant sites was 100%. Surprisingly, an apramycin 262 resistance gene flanked by loxLERE double mutated sites was excised in 80% of the 263 clones, which was unexpected considering the reported low affinity of the Cre 264 recombinase for loxLERE sites. Thus, the loxLERE site remaining in the chromosome 265 may have a significant effect on subsequent manipulations involving Cre recombinase in 266 actinomycetes. 267 Considering the high activity of Cre on the doubly mutated site loxLERE, we have 268 expressed a new Dre recombinase that recognises completely different target sequences 269 called rox sites. The synthetic dre(a) gene was optimised for expression in GC rich 270 organisms and was cloned into pUWLoriT and pAL1 to yield pUWLDRE and pALDRE, 271 respectively. To test the activity of Dre recombinase, the plasmid pINTROX carrying the 272 integration system of the phage φC31 and an apramycin resistance gene flanked by rox 273 sites was constructed and integrated into the genome of S. coelicolor M145. After the 274 transformation of pUWLHDRE and pALDRE into S. coelicolor exconjugants containing 275 pINTROX, the strains were subjected to the same procedure used to test Cre activity. All 276 300 clones tested for resistance to apramycin showed sensitivity to the antibiotic. This 277 experiment demonstrated the successful expression of the synthetic dre(a) gene and offers 278 another efficient tool for resistance marker removal in actinomycetes. The Dre/rox system 279 was proven to be effective with the same high efficiency of 100% in Micromonospora sp. 280 Tü6368, Saccharothrix espanaensis, S. coelicolor T3456-20, and S. lividans TK24. 281 Marker-free expression system in actinomycetes. Integrative plasmids have been 282 successfully used in the genetic engineering of streptomycetes. Using components of 283 phage integration systems such as attachment sites and integrases, genes of interest can be 284 easily integrated into the corresponding attachment site in a streptomycete genome. 285 However, integration of the entire plasmid, including a resistance marker and an integrase 286 gene with its strong promoter, might lead to polar effects on neighbouring genes in the 287 chromosome. Additionally, there are only a limited number of selection markers available 288 in streptomycetes. We developed a method by combining phage integration systems and 289
on February 13, 2018 by guest
http://aem.asm
.org/D
ownloaded from
10
recombinases where only the genes of interest remain in the genome, as shown in Figure 290 3. Through the integration of target sites (loxP sites in the case of the Cre recombinase, 291 rox sites in the case of the Dre recombinase) flanking the gene of interest and the phage 292 attachment site (attP), we are able to delete the plasmid backbone, which is redundant 293 after integration, by expressing the required site-specific recombinase. For this purpose, 294 we constructed two plasmids using different phage integration systems and target sites, 295 which allow us to integrate genes of interest marker-free into two different sites in the 296 streptomycetes chromosome. VWB-based plasmid pTOS. The plasmid pTOS (Fig. 1) 297 uses the VWB phage integration system with an attP site flanked by rox sites. It was 298 inserted into S. lividans TK24 and S. coelicolor M145 by intergeneric conjugation with 299 the frequency around of 10-4. The S. lividans TK24 strain containing pTOS was again 300 conjugated with the plasmid pUWLDre encoding the Dre recombinase. The resulting 301 exconjugants were grown in antibiotic-free TSB medium to saturation and diluted on 302 TSB plates with and without apramycin. One hundred percent of the cells were 303 apramycin sensitive, which demonstrated that the Dre recombinase efficiently removed 304 the backbone of the plasmid, including the apramycin resistance conferring gene between 305 the rox sites. Using this system we integrated two genes of interest (goi1 and goi2) into 306 the chromosome of S. lividans TK24 and proved the successful excision of the plasmid 307 backbone by Dre recombinase by PCR and following sequence analysis of the PCR 308 fragment. φC31-based plasmid pTES. The plasmid pTES (Fig. 2) uses the φC31 phage 309 integration system with an attP site flanked by loxP sites. After the conjugation of the S. 310 lividans TK24 strain containing pTES with the plasmid pALCre encoding the Cre 311 recombinase, 99% of the 3000 tested resulting exconjugants were immediately apramycin 312 sensitive. 313 Generation of large-scale deletions. The overall strategy for the construction of large 314 deletions relies on a combination of homologous and site-specific recombination, with the 315 latter mediated by the Cre/loxP system (Fig. 4). First, a homologous region (1.0 to 2.5 kb) 316 flanking the 5’ end of the targeted regions is cloned between two loxP sites on a suicide 317 vector and inserted via homologous recombination by a single crossover into the recipient 318 chromosome to form a cointegrate. The relative orientation of the loxP sites with respect 319 to the homologous fragment was chosen in a way that it would form direct repeats 320 flanking the entire suicide vector allowing subsequent excision of the vector sequences, 321 including the resistance marker. Only one loxP site was left at the 5’ end of the targeted 322
on February 13, 2018 by guest
http://aem.asm
.org/D
ownloaded from
11
region as a result of Cre expression. The second homologous region flanking the 3’ end 323 of the targeted regions was cloned adjacent to one loxP site on a suicide vector in such a 324 way that the entire target region, including the suicide vector, was flanked by two loxP 325 sites after insertion. After Cre expression, the region between the two loxP sites was 326 excised. 327 Deletion of the phenalinolactone biosynthetic gene cluster from S. sp. Tü6071. The 328 biosynthetic gene cluster of the antibiotic diterpenoid phenalinolactone consists of 42 kb 329 which encode 35 open reading frames. To delete 38 kb of the phenalinolactone 330 biosynthetic gene cluster in the genome the above mentioned strategy was used. The 331 suicide plasmid pIJloxPbegin was integrated at the 5´ end of the phenalinolactone cluster 332 by a single crossover to obtain S. sp. Tü6071/2loxPapra. The two inserted loxP sites 333 flanking the plasmid backbone were used as target sites for Cre recombinase. The 334 deletion of the plasmid core was accomplished as described in the Methods section. The 335 frequency of the plasmid excision via Cre was approximately 50 fold higher in 336 comparison to the plasmid removal via homologous recombination. The resulting mutant 337 was named S. sp. Tü6071/loxP. The second vector pIJloxPend was introduced into S. sp. 338 Tü6071/loxP by conjugation. By means of a single crossover, the plasmid integrated into 339 the 3´end of the phenalinolactone cluster to give S. sp. Tü6071/2loxP. Positive 340 exconjugants were identified by their resistance to apramycin. One of those exconjugants 341 was randomly chosen and used for further experiments. The second excision step was 342 performed as described in the Methods section. The resulting mutant strain was named S. 343 sp. Tü6071/Δpla-loxP. Excision of the biosynthetic gene cluster was confirmed by PCR 344 and following sequence analysis of the PCR fragment. The production of 345 phenalinolactone could be restored by φC31 based integration of the cosmid 3-1O12. 346 However, a phenalinolactone yield of only 4% relative to the wild type level was obtained 347 (Fig. 5). 348 349 Deletion of the lipomycine biosynthetic gene cluster from S. aureofaciens Tü117. The 350 identical strategy was used to remove 67 kb of the α-lipomycin biosynthetic gene cluster 351 from the chromosome using plasmids pIJloxP-lipbeg and pBeloBAC2601-lipend. The 352 acyclic polyene antibiotic α-lipomycin is produced by S. aureofaciens Tü117. Its 353 biosynthetic gene cluster (lip gene cluster) is encoded on 74 kb, divided in 28 open 354
on February 13, 2018 by guest
http://aem.asm
.org/D
ownloaded from
12
reading frames (2). Excision of the biosynthetic gene cluster was confirmed by PCR and 355 HPLC analysis. 356 The frequencies of the deletion of both gene clusters (67 kb in the case of lipomycin, 38 357 kb in the case of phenalinolactone), as well as a resistance gene (aac(3´)IV 800 bp) were 358 all the same showing that the length of DNA between two loxP sites is irrelevant for the 359 Cre recombinase. 360 361 Deletion of the monensin biosynthetic gene cluster from S. cinnamonensis A519. The 362 deletion of the monensin biosynthetic gene cluster was our first effort of directed cluster 363 deletion. Although this procedure works quite well it is more labour intensive than the 364 strategy which was used for the deletions of the other clusters and is depicted in figure 4. 365 The biosynthetic gene cluster of the polyether antibiotic monensin comprises 97 kb. To 366 delete 83 kb of the cluster from the genome, a slightly different approach was used. 367 Instead of two different inactivation constructs, two plasmids based on the same vector 368 were used. This resulted in the need for one double crossover and one single crossover 369 instead of two single crossovers to avoid the integration of the second plasmid into the 370 first integrated plasmid. Therefore the plasmid pMStart2-loxP-hyg was placed at the 371 5´end of the monensin cluster by a double crossover, integrating an apramycin resistance 372 cassette flanked by two loxP sites. To remove the apramycin resistance gene the cre(a) 373 expression plasmid pALCRE was introduced into S. cinnamonensis A519/2loxPapra by 374 conjugation. The following steps are described in the Methods section. The resulting 375 mutant was named S. cinnamonensis A519/loxP. The second vector, pMEnd-loxP, was 376 introduced into S. cinnamonensis A519/loxP by conjugation. The plasmid integrated into 377 the 3’ end of the monensin gene cluster via a single crossover to give S. cinnamonensis 378 A519/2loxP. The procedure monensin biosynthetic gene cluster removal from the 379 chromosome is described in the Methods section. The resulting mutant strain was named 380 S. cinnamonensis A519/Δmon-loxP. Excision of the biosynthetic gene cluster was 381 confirmed by PCR, sequencing analysis, and the loss of antibiotic production. 382 383 Insertion of a plasmid into the streptomycete chromosome using the Cre/loxP 384 system. Heterologous expression is commonly based on phage integration systems. We 385 have performed here a Cre-mediated integration to insert a single copy of foreign DNA 386 into a predetermined locus within a genome. The Cre/loxP-system can be used to remove 387
on February 13, 2018 by guest
http://aem.asm
.org/D
ownloaded from
13
the biosynthetic gene cluster of a natural product from the chromosome as well as to 388 integrate desired DNA sequences into the same position. This system allows the 389 expression of a mutated gene cluster responsible for the natural product biosynthesis 390 under the same conditions as the native one. To prove the integration activity of Cre 391 recombinase a simple plasmid of 5 kb (pMEnd-loxP) and the deletion mutant S. sp. 392 Tü6071/Δpla-loxP, both containing one loxP site, were used. The cre(a) expression 393 plasmid pALCRE was introduced into S. sp. Tü6071/Δpla-loxP by conjugation. The 394 resulting exconjugants were picked from the plate and grown in TSB medium containing 395 hygromycin. The expression of the artificial recombinase gene by the tipA promoter was 396 induced by adding 5 µg/µL thiostrepton to the liquid culture. After 6 h, the plasmid 397 pMEnd-loxP was introduced by conjugation. The exconjugants were grown in TSB 398 medium containing apramycin and plated onto ABB13 plates also containing apramycin 399 to obtain single colonies. Growth of colonies in broth with apramycin demonstrated the 400 successful insertion of plasmid pMEnd-loxP in the chromosome. The integration was 401 confirmed by PCR and sequence analysis. 402 403 DISCUSSION 404 The use of site-specific recombinases for genomic engineering is no longer novel. They 405 have been employed in many different eukaryotic and prokaryotic systems. Although the 406 site-specific recombinase systems are extremely efficient and easy to use, their true 407 potential in streptomycetes genetics has not been fully exploited. 408 Construction of unmarked mutants. Gene replacement strategies most often result in 409 the introduction of a selectable marker into the genome, which remains in the 410 chromosome permanently. The number of consecutive deletions of additional genes in the 411 same strain may be limited by the number of available resistance genes (17). 412 Additionally, the presence of the resistance gene may result in polar effects on the 413 expression of genes located upstream and downstream. The expression of selectable 414 markers may also influence bacterial fitness. Such obstacles could be overcome if the 415 resistance markers are eliminated after mutant selection, which can be achieved via SSR. 416 Therefore, removal of a selectable marker from the genome using SSR has been 417 frequently used in plants, mouse cell lines, and yeast and recently in actinomycetes (3, 8, 418 23, 28). In a typical application, Cre and Flp are employed to delete a resistance marker, 419
on February 13, 2018 by guest
http://aem.asm
.org/D
ownloaded from
14
which was previously inserted in the chromosome after targeted gene inactivation. Flp 420 and Cre mediated excision of the antibiotic resistance cassette leaves a “scar” in the 421 chromosome and generates a single target FRT or loxP site. The length of this scar is 422 usually less than 50 bp. Upon excision of the antibiotic resistance cassette from the 423 chromosome, the FRT and loxP sites left behind in the chromosome do not exert polar 424 transcriptional effects. Marker rescue and reuse offers a simple and efficient way to 425 introduce multiple gene deletions. However, consecutive deletions of additional genes in 426 the same strain may be limited because of undesired DNA rearrangements generated by 427 the multiple target sites left after each excision. To minimise genetic instability, different 428 heterotypic lox sites containing mutations within the inverted repeats (loxLE and loxRE) 429 have been used for plants, chicken cell lines, and bacteria (3,21). Recombination of loxLE 430 and loxRE results in a double mutant loxLERE site, which is a poor substrate for Cre. 431 Generation of this site allows for repeated gene deletions in a single genetic background. 432 Surprisingly, Cre could very efficiently remove an apramycin resistance cassette flanked 433 by loxLERE from the chromosomes of actinomycetes. Thus, the risk of undesired 434 chromosomal rearrangements in actinomycetes is still very high if Cre is used in 435 combination with loxLE and loxRE. The successful functional expression of a Dre 436 recombinase encoding gene reported in this study increases our ability to construct 437 marker-free multi-mutant strains. Dre recognises rox sites, which differ notably from the 438 previously reported FRT and loxP sites in actinomycetes. This characteristic makes Dre 439 an ideal partner for Flp and Cre in performing multiple mutations in a single genetic 440 background. Additionally, the xis and int genes from the pSAM2 plasmid could be used 441 to remove antibiotic resistance markers from the chromosomes of streptomycetes (25). 442 Therefore, at least four consecutive resistance marker deletions can be performed in 443 actinomycetes in a single genomic background using Cre, Flp, Dre, and xis and int from 444 pSAM2. 445 Generation of the marker-free expression system. The other important part of 446 Streptomyces genome engineering strategies is the stable integration of desired genetic 447 traits into the chromosome. The integration of regulatory elements, gene fusions, and 448 complementation of gene deletions is generally achieved using plasmids carrying a phage 449 integrase gene (int) and the corresponding phage attachment site (attP). Commonly used 450 integration vectors based upon the Streptomyces phages φC31 and VWB integrate within 451 a chromosome condensation protein encoding gene and the arginine tRNA gene, 452
on February 13, 2018 by guest
http://aem.asm
.org/D
ownloaded from
15
respectively. The other system based on the phage φBT1 has gained popularity as well in 453 the last years (9). However, it is cumbersome to create multiple, stable, unmarked 454 chromosomal integrations in actinomycetes using currently available vectors. For 455 example, these methods usually necessitate antibiotic selection and thus leave behind a 456 selection marker as well as additional unnecessary delivery vehicle sequences, such as an 457 int gene and an E. coli origin of replication. Permanent expression of the int gene might 458 also lead to an unstable construct (30). Therefore, the φC31- and VWB-based vectors, 459 which are able to integrate at a specific attB site into the chromosome, were engineered to 460 remove unwanted delivery vehicle DNA, the phage integrase and the antibiotic selection 461 marker. Removal of the φC31 integrase gene together with an apramycin resistance 462 marker from the pTES vector is performed by Cre recombinase, while Dre recombinase 463 deletes the VWB integrase gene together with the apramycin resistance marker from the 464 pTOS plasmid. Successful removal is easily identified by the loss of the backbone 465 reporter gene and was observed in almost 100% of the tested clones. These pTES and 466 pTOS vectors enable the engineering of stable recombinant actinomycetes strains devoid 467 of any selection marker. Furthermore, pTES is already equipped with the strong promoter 468 ermE for overexpression of target genes. Additionally, the polylinker of pTES is 469 protected from transcriptional interference by two tfd terminators. The ability to create 470 multiple, stable, unmarked integrations, to express several genes simultaneously or to 471 increase overall expression by increasing copy number will be beneficial in many 472 applications. 473 474 Generation of large-scale deletions. The third important strategy for genome 475 engineering described here is the generation of large-scale deletions by the Cre/loxP 476 system in streptomycetes. It has been applied in several studies to create large-scale 477 deletions in Corynebacterium glutamicum (34, 35), Bacillus subtilis (37), S. avermitilis 478 (18), and E. coli (39). Our method has been specifically designed for actinomycetes by 479 the modification of a pair of conjugative suicide vectors (pKC1132 and pBeloBAC11) for 480 the introduction of loxP sites. The specific advantage of our strategy is that it works with 481 single crossovers, which are usually easier to obtain than double-crossover events. In the 482 examples shown, we observed single insertion frequencies between 2.0 x 10-4 and 483 1.0 x 10-7. The subsequent Cre-mediated deletion of the target fragment could usually be 484 detected immediately in exconjugants, even without induction of the Cre encoding 485
on February 13, 2018 by guest
http://aem.asm
.org/D
ownloaded from
16
recombinase gene. Precise excision of the target fragments was obtained in almost 100% 486 of the tested clones. The total time requirement to generate a large scale deletion using 487 this method depended on the Streptomyces strain but could be achieved within 2 to 3 488 months in our case. This is generally faster and more efficient than using conventional 489 allelic replacement techniques since the physical distance between recognition sites does 490 not appear to limit the capacity of the recombinase. We have demonstrated the usefulness 491 of this method in the construction of three deletions spanning the α-lipomycin, 492 phenalinolactone and monensin biosynthetic gene clusters in S. aureofaciens Tü117, S. 493 sp. Tü6071 and S. cinnamonensis A519, respectively. As expected, all three deletion 494 mutants cannot produce the corresponding antibiotic. The successful complementation of 495 phenalinolactone production by introduction of the corresponding gene cluster presents 496 opportunities to modify a cosmid directly in E. coli and perform gene deletion using 497 mutated cosmids for complementation. However, the yield of phenalinolactone after 498 complementation of the mutant with the cosmid must be improved. In addition to a 499 systematic functional analysis of biosynthetic gene clusters, this method could be utilised 500 for targeted deletion of genomic regions that are not required for growth and contain a 501 large number of repeats and transposons that cause instability of the chromosomal DNA 502 in actinomycetes. This would result in genetically stable host strains for the synthesis of 503 natural products. 504 505 Cre-mediated DNA integration. In genomic engineering, the ability to insert a gene of 506 interest into a certain location is very desirable. Various factors appear to affect the 507 expression and stability of heterologous genes. The most prominent of these factors is the 508 genomic location of gene integration (positional effect). Surrounding genomic elements 509 may cause the heterologous expression of a gene to be increased, decreased or 510 misregulated (36). The site-specific integration of vectors into actinomycetes 511 chromosomes does not provide much flexibility, since only a few different integrative 512 systems are available. Thus, the integration can only occur at fixed positions that are not 513 always optimal for target gene expression. Here, we were able to perform a Cre-mediated 514 integration to insert a single copy of foreign DNA into predetermined loci within a 515 genome. In summary, we have used the Dre and Cre recombinases in the construction of 516 unmarked multiple mutations, marker-free expression of target genes, large-scale 517 deletions, and chromosomal integration of biosynthetic gene clusters in different genera 518
on February 13, 2018 by guest
http://aem.asm
.org/D
ownloaded from
17
of actinomycetes. We expect that these techniques will find a broad application in 519 actinomycete genetics and will facilitate functional studies of the large number of newly 520 sequenced genes. 521 522 523 524 FUNDING 525 This work was partly funded by a BMBF grant (GenomikPlus) and a grant from DFG 526 (Lu1524/2-1), both to AL. 527 Fig. 1 Plasmid map of pTOS. aac(3’)IV apramycin resistance conferring gene, attP 528 attachment site for integration, ColE1ori origin of replication in E. coli, int (VWB) 529 integrase of phage VWB, intp integrase promoter, rox recognition site for Dre 530 recombinase, oriT origin of plasmid transfer. 531 Fig. 2 Plasmid map of pTES. aac(3’)IV apramycin resistance conferring gene, attP 532 attachment site for integration, ColE1ori origin of replication in E. coli, ermEp ermE 533 promoter, int (phiC31) integrase of phage phiC31, intp integrase promoter, loxP 534 recognition site for Cre recombinase, oriT origin of plasmid transfer, tfd phage fd 535 terminator. 536 Fig. 3 Schematic diagram depicting the mechanism of marker-free integration of a gene 537 of interest (goi) into the streptomycetes genome. (A) The integrase gene (int) on the 538 plasmid is under the control of the native phage promoter and its product catalyses the 539 integration of the plasmid between the attachment site on the plasmid (attP) and the 540 attachment site on the bacterial chromosome (attB). (B) Selection for the integration of 541 the plasmid into the genome is provided by the apramycin resistance conferring gene 542 (aac(3’)IV). (C) Expression of Dre recombinase will result in the deletion of the plasmid 543 sequence between the rox sites, thus removing the marker and leaving behind only the 544 gene of interest and one rox site in the genome. (D) Dre and Cre recombinase recognition 545 sequences rox and loxP site, respectively. 546 Fig. 4 Schematic diagram depicting the steps for deleting large gene clusters from the 547 streptomycetes chromosome. Initially, a suicide plasmid carrying two recognition sites 548 (rs) flanking a region homologous to the 5’ end of the cluster is introduced into the 549
on February 13, 2018 by guest
http://aem.asm
.org/D
ownloaded from
18
chromosome by a single crossover. Mutants are identified by selecting for antibiotic 550 resistance that is conferred by a gene (R) on the newly integrated plasmid. Expression of 551 the site-specific recombinase leads to excision of the plasmid backbone, including the 552 resistance marker, and leaves one rs at the 5’ end of the cluster. A second suicide plasmid 553 carrying one rs and a region homologous to the 3’ end of the cluster is integrated into the 554 chromosome by means of single crossover. Mutants can again be selected by the 555 resistance marker (R). Expression of the site-specific recombinase finally leads to 556 excision of the entire cluster and loss of the resistance marker, leaving in its place only 557 one rs “scar” in the chromosome. 558 Fig. 5 Deletion and reconstruction of phenalinolactone A (PL A) and D (PL D) 559 production. (A) Analysis of PL production of the wildtype strain S. sp. Tü6071 and the 560 deletion mutant S. sp. Tü6071/Δpla-loxP by LC-chromatography. (B) Characteristic UV-561 spectrum of PL D measured in the complementation mutant S. sp. Tü6071/Δpla-loxP + 562 Cos 3-O12 and the wildtype. (C) The extracted mass of m/z = 714 u/e [M-H]- and m/z = 563 698 u/e [M-H]- represents the negative ion of PL A and PL D detected during the MS-564 chromatography of the complementation mutant. These masses were not present in the 565 deletion mutant. 566
567 REFERENCES 568 1. Bierman, M., R. Logan, K. O'Brien, E. T. Seno, R. N. Rao, and B. E. Schoner. 569
1992. Plasmid cloning vectors for the conjugal transfer of DNA from Escherichia 570 coli to Streptomyces spp. Gene 116:43-49. 571
2. Bihlmaier, C., E. Welle, C. Hofmann, K. Welzel, A. Vente, E. Breitling, M. 572 Muller, S. Glaser, and A. Bechthold. 2006. Biosynthetic gene cluster for the 573 polyenoyltetramic acid alpha-lipomycin. Antimicrob. Agents Chemother. 50:2113-574 2121. 575
3. Branda, C. S. and S. M. Dymecki. 2004. Talking about a revolution: The impact 576 of site-specific recombinases on genetic analyses in mice. Dev. Cell 6:7-28. 577
4. Campo, N., M. L. Deveran-Mingot, K. Leenhouts, P. Ritzenthaler, and B. P. 578 Le. 2002. Cre-loxP recombination system for large genome rearrangements in 579 Lactococcus lactis. Appl. Environ. Microbiol. 68:2359-2367. 580
5. Cherepanov, P. P. and W. Wackernagel. 1995. Gene disruption in Escherichia 581 coli: TcR and KmR cassettes with the option of Flp-catalyzed excision of the 582 antibiotic-resistance determinant. Gene 158:9-14. 583
on February 13, 2018 by guest
http://aem.asm
.org/D
ownloaded from
19
6. Durr, C., H. J. Schnell, A. Luzhetskyy, R. Murillo, M. Weber, K. Welzel, A. 584 Vente, and A. Bechthold. 2006. Biosynthesis of the terpene phenalinolactone in 585 Streptomyces sp. Tu6071: analysis of the gene cluster and generation of derivatives. 586 Chem. Biol. 13:365-377. 587
7. Fedoryshyn, M., L. Petzke, E. Welle, A. Bechthold, and A. Luzhetskyy. 2008. 588 Marker removal from actinomycetes genome using Flp recombinase. Gene 419:43-589 47. 590
8. Fedoryshyn, M., E. Welle, A. Bechthold, and A. Luzhetskyy. 2008. Functional 591 expression of the Cre recombinase in actinomycetes. Appl. Microbiol. Biotechnol. 592 78:1065-1070. 593
9. Flett, F., V. Mersinias, and C. P. Smith. 1997. High efficiency intergeneric 594 conjugal transfer of plasmid DNA from Escherichia coli to methyl DNA-restricting 595 streptomycetes. FEMS Microbiol. Lett. 155:223-229. 596
10. Ganesan, A. 2008. The impact of natural products upon modern drug discovery. 597 Curr. Opin. Chem. Biol. 12:306-317. 598
11. Gust, B., G. L. Challis, K. Fowler, T. Kieser, and K. F. Chater. 2003. PCR-599 targeted Streptomyces gene replacement identifies a protein domain needed for 600 biosynthesis of the sesquiterpene soil odor geosmin. Proc. Natl. Acad. Sci. U. S. A 601 100:1541-1546. 602
12. Hoang, T. T., A. J. Kutchma, A. Becher, and H. P. Schweizer. 2000. Integration-603 proficient plasmids for Pseudomonas aeruginosa: site-specific integration and use 604 for engineering of reporter and expression strains. Plasmid 43:59-72. 605
13. Hütter, R. 1967. Systematik der Streptomyceten. Basel (Swiss), New York. 606 14. Janssen, G. R. and M. J. Bibb. 1993. Derivatives of pUC18 that have BglII sites 607
flanking a modified multiple cloning site and that retain the ability to identify 608 recombinant clones by visual screening of Escherichia coli colonies. Gene 124:133-609 134. 610
15. Keasling, J. D. 2010. Manufacturing molecules through metabolic engineering. 611 Science 330:1355-1358. 612
16. Khodakaramian, G., S. Lissenden, B. Gust, L. Moir, P. A. Hoskisson, K. F. 613 Chater, and M. C. Smith. 2006. Expression of Cre recombinase during transient 614 phage infection permits efficient marker removal in Streptomyces. Nucleic Acids 615 Res. 34:e20. 616
17. Kieser, T., M. J. Bibb, M. J. Buttner, K. F. Chater, and D. A. Hopwood. 2000. 617 Practical Streptomyces genetics. John Innes Foundation, Norwich, United Kingdom. 618
18. Komatsu, M., T. Uchiyama, S. Omura, D. E. Cane, and H. Ikeda. 2010. 619 Genome-minimized Streptomyces host for the heterologous expression of secondary 620 metabolism. Proc. Natl. Acad. Sci. U. S. A 107:2646-2651. 621
on February 13, 2018 by guest
http://aem.asm
.org/D
ownloaded from
20
19. Kuhn, R. and R. M. Torres. 2002. Cre/loxP recombination system and gene 622 targeting. Methods Mol. Biol. 180:175-204. 623
20. Kuhstoss, S., M. A. Richardson, and R. N. Rao. 1991. Plasmid cloning vectors 624 that integrate site-specifically in Streptomyces spp. Gene 97:143-146. 625
21. Leibig, M., B. Krismer, M. Kolb, A. Friede, F. Gotz, and R. Bertram. 2008. 626 Marker removal in staphylococci via Cre recombinase and different lox sites. Appl. 627 Environ. Microbiol. 74:1316-1323. 628
22. Luzhetskyy, A., M. Fedoryshyn, O. Gromyko, B. Ostash, Y. Rebets, A. 629 Bechthold, and V. Fedorenko. 2006. IncP plasmids are most effective in 630 mediating conjugation between Escherichia coli and streptomycetes. Genetika 631 42:595-601. 632
23. Marx, C. J. and M. E. Lidstrom. 2002. Broad-host-range Cre-lox system for 633 antibiotic marker recycling in Gram-negative bacteria. Biotechniques 33:1062-634 1067. 635
24. Oliynyk, M., C. B. Stark, A. Bhatt, M. A. Jones, Z. A. Hughes-Thomas, C. 636 Wilkinson, Z. Oliynyk, Y. Demydchuk, J. Staunton, and P. F. Leadlay. 2003. 637 Analysis of the biosynthetic gene cluster for the polyether antibiotic monensin in 638 Streptomyces cinnamonensis and evidence for the role of monB and monC genes in 639 oxidative cyclization. Mol. Microbiol. 49:1179-1190. 640
25. Raynal, A., F. Karray, K. Tuphile, E. Darbon-Rongère, and J. L. Pernodet. 641 2006. Excisable cassettes: new tools for functional analysis of Streptomyces 642 genomes. Appl. Environ. Microbiol. 72:4839-4844. 643
26. Sambrook, J., E. F. Fritsch, and T. Maniatis. 1989. Molecular Cloning: A 644 Laboratory Manual. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, 645 NY. 646
27. Sauer, B. and N. Henderson. 1990. Targeted insertion of exogenous DNA into the 647 eukaryotic genome by the Cre recombinase. New Biol. 2:441-449. 648
28. Schweizer, H. P. 2003. Applications of the Saccharomyces cerevisiae Flp-FRT 649 system in bacterial genetics. J. Mol. Microbiol. Biotechnol. 5:67-77. 650
29. Sekurova, O. N., T. Brautaset, H. Sletta, S. E. Borgos, M. O. Jakobsen, T. E. 651 Ellingsen, A. R. Strom, S. Valla, and S. B. Zotchev. 2004. In vivo analysis of the 652 regulatory genes in the nystatin biosynthetic gene cluster of Streptomyces noursei 653 ATCC 11455 reveals their differential control over antibiotic biosynthesis. J. 654 Bacteriol. 186:1345-1354. 655
30. Siegl, T., L. Petzke, E. Welle, and A. Luzhetskyy. 2010. I-SceI endonuclease: a 656 new tool for DNA repair studies and genetic manipulations in streptomycetes. Appl. 657 Microbiol. Biotechnol. 87:1525-1532. 658
31. Slauch, J. M. and A. Camilli. 2000. IVET and RIVET: use of gene fusions to 659 identify bacterial virulence factors specifically induced in host tissues. Methods 660 Enzymol. 326:73-96. 661
on February 13, 2018 by guest
http://aem.asm
.org/D
ownloaded from
21
32. Smith, M. C., R. Till, K. Brady, P. Soultanas, H. Thorpe, and M. C. Smith. 662 2004. Synapsis and DNA cleavage in phiC31 integrase-mediated site-specific 663 recombination. Nucleic Acids Res. 32:2607-2617. 664
33. Stark, W. M., M. R. Boocock, and D. J. Sherratt. 1992. Catalysis by site-specific 665 recombinases. Trends Genet. 8:432-439. 666
34. Suzuki, N., H. Nonaka, Y. Tsuge, M. Inui, and H. Yukawa. 2005. New multiple-667 deletion method for the Corynebacterium glutamicum genome, using a mutant lox 668 sequence. Appl. Environ. Microbiol. 71:8472-8480. 669
35. Suzuki, N., H. Nonaka, Y. Tsuge, S. Okayama, M. Inui, and H. Yukawa. 2005. 670 Multiple large segment deletion method for Corynebacterium glutamicum. Appl. 671 Microbiol. Biotechnol. 69:151-161. 672
36. Wilson, C., H. J. Bellen, and W. J. Gehring. 1990. Position effects on eukaryotic 673 gene expression. Annu. Rev. Cell Biol. 6:679-714. 674
37. Yan, X., H. J. Yu, Q. Hong, and S. P. Li. 2008. Cre/lox system and PCR-based 675 genome engineering in Bacillus subtilis. Appl. Environ. Microbiol. 74:5556-5562. 676
38. Yanisch-Perron, C., J. Vieira, and J. Messing. 1985. Improved M13 phage 677 cloning vectors and host strains: nucleotide sequences of the M13mp18 and pUC19 678 vectors. Gene 33:103-119. 679
39. Yu, B. J., B. H. Sung, M. D. Koob, C. H. Lee, J. H. Lee, W. S. Lee, M. S. Kim, 680 and S. C. Kim. 2002. Minimization of the Escherichia coli genome using a Tn5-681 targeted Cre/loxP excision system. Nat. Biotechnol. 20:1018-1023. 682
40. Zelyas, N., K. Tahlan, and S. E. Jensen. 2009. Use of the native flp gene to 683 generate in-frame unmarked mutations in Streptomyces spp. Gene 443:48-54. 684
685 Table 1 Plasmids used in this work 686 Plasmid Description Reference or source
pAL1 Replicative vector for actinomycetes; oriT, pSG5rep,
oripUC18, tsr, hph, tipA (7)
pALDRE pAL1 derivative with the dre gene under a tipA promoter This work
pALCRE pAL1 derivative with the cre gene under a tipA promoter This work
pUWLoriT Replicative vector for actinomycetes; pIJ101 replicon, oriT,
tsr, bla, ermE (1)
pUWLDRE pUWLoriT derivative with the dre gene under an ermE
promoter This work
on February 13, 2018 by guest
http://aem.asm
.org/D
ownloaded from
22
pUWLCre pUWLoriT derivative with the cre gene under an ermE
promoter (8)
pINTROX Integrative vector for actinomycetes; oriT, int, and attP
(φC31), aac(3’)IV is flanked by rox sites This work
pIJ2925 Cloning vector containing bla and lacZ (14)
pIJrAmr Derivative of pIJ2925 containing aac(3’)IV flanked by two
rox sites This work
pIJ773 pBSK derivative containing aac(3’)IV flanked by two FRT
sites (11)
pUC19 Cloning vector containing bla and lacZ (38)
pMEnd-loxP pUC19 derivative, oriT, aac(3’)IV, and loxP site This work
pMStart2-loxP-hyg pUC19 derivative, oriT and aac(3’)IV flanked by two loxP
sites, hph This work
pIJloxPbegin pIJloxP derivative with a fragment homologous to the 5’ end
of the α-phenalinolactone cluster This work
pIJloxPend pIJloxP derivative with a fragment homologous to the 3’ end
of the α-lipomycin cluster This work
cosmid 3-1O12 pOJ436 derived cosmid containing the deleted part of the
phenalinolacton gene cluster (6)
pMODTM3 Customised Tn5 transposon construction vector Epicentre; Madison,
USA
pMOD3-acc pMODTM3 derivative containing aac(3’)IV This work
pLERE Cloning vector containing amp, two loxLE sites, and two
loxRE sites
GENEART,
Regensburg
pINT pLERE derivative with aac(3’)IV flanked by two loxP sites This work
pINTRE pLERE derivative with aac(3’)IV flanked by two loxRE sites This work
pINTLE pLERE derivative with aac(3’)IV flanked by two loxLE sites This work
pINTLERE pLERE derivative with aac(3’)IV flanked by one loxLE site This work
on February 13, 2018 by guest
http://aem.asm
.org/D
ownloaded from
23
and one loxRE site
pINTLERE2 pLERE derivative with aac(3’)IV flanked by two loxLE sites
and two loxRE sites This work
pIJ2601 pIJ2925 derivative containing aac(3’)IV and modified lacZ (30)
pIJloxP pIJ2601 derivative containing aac(3’)IV, modified lacZ and
two loxP sites This work
pIJloxP-lipbeg pIJloxP derivative with a fragment homologous to the 5’ end
of the α-lipomycin cluster This work
pBeloBAC2601 BAC cloning vector containing aac(3’)IV flanked by one
loxP site (30)
pBeloBAC2601-
lipend
pBeloBAC2601 derivative with a fragment homologous to
the 3’ end of the α-lipomycin cluster This work
pSOK804 Integrative vector for actinomycetes; oriT, int, and attP
(VWB), aac(3’)IV (29)
pTOS pSOK804 derivative; attP flanked by rox sites This work
pSET152 Integrative vector for actinomycetes; oriT, int, and attP
(φC31), aac(3’)IV (1)
pTES pSET152 derivative; attP flanked by loxP sites, ermE
promoter flanked by tfd terminator sequences This work
aac(3´)IV apramycin resistance conferring gene, amp ampicillin resistance conferring 687 gene, attP attachment site on plasmid for phage integration, bla carbenicillin/ampicillin 688 resistance conferring gene, cre gene encoding Cre recombinase, dre gene encoding Dre 689 recombinase, ermE constitutive promoter in streptomycetes, FRT recognition site for FLP 690 recombinase, hph hygromycin resistance conferring gene, lacZ gene encoding β-691 galactosidase for blue/white selection, loxP recognition site for Cre recombinase, int 692 phage integrase gene, oripUC18 origin of replication in E. coli, oriT origin of transfer, 693 pSG5rep a temperature sensitive replicon in streptomycetes, rox recognition site for Dre 694 recombinase, rpsL a constitutive promoter in streptomycetes, tfd phage terminator 695 sequence, tipA thiostrepton-inducible promoter, tsr thiostreptone resistance conferring 696 gene 697
on February 13, 2018 by guest
http://aem.asm
.org/D
ownloaded from
