of November 21, 2014.This information is current as

to Bacterial Challenge Gene Family in ResponseSp185/333Diverse

Messages of a Single Sequence from the Single Sea Urchin Phagocytes Express

Courtney SmithAudrey J. Majeske, Matan Oren, Sandro Sacchi and L.

http://www.jimmunol.org/content/193/11/5678doi: 10.4049/jimmunol.1401681October 2014;

2014; 193:5678-5688; Prepublished online 29J Immunol 

MaterialSupplementary

1.DCSupplemental.htmlhttp://www.jimmunol.org/content/suppl/2014/10/29/jimmunol.140168

Referenceshttp://www.jimmunol.org/content/193/11/5678.full#ref-list-1

, 24 of which you can access for free at: cites 60 articlesThis article

Subscriptionshttp://jimmunol.org/subscriptions

is online at: The Journal of ImmunologyInformation about subscribing to

Permissionshttp://www.aai.org/ji/copyright.htmlSubmit copyright permission requests at:

Email Alertshttp://jimmunol.org/cgi/alerts/etocReceive free email-alerts when new articles cite this article. Sign up at:

Print ISSN: 0022-1767 Online ISSN: 1550-6606. Immunologists, Inc. All rights reserved.Copyright © 2014 by The American Association of9650 Rockville Pike, Bethesda, MD 20814-3994.The American Association of Immunologists, Inc.,

is published twice each month byThe Journal of Immunology

at George W

ashington University M

edical Center L

ibrar on Novem

ber 21, 2014http://w

ww

.jimm

unol.org/D

ownloaded from

at G

eorge Washington U

niversity Medical C

enter Librar on N

ovember 21, 2014

http://ww

w.jim

munol.org/

Dow

nloaded from

at George W

ashington University M

edical Center L

ibrar on Novem

ber 21, 2014http://w

ww

.jimm

unol.org/D

ownloaded from

at G

eorge Washington U

niversity Medical C

enter Librar on N

ovember 21, 2014

http://ww

w.jim

munol.org/

Dow

nloaded from

at George W

ashington University M

edical Center L

ibrar on Novem

ber 21, 2014http://w

ww

.jimm

unol.org/D

ownloaded from

at G

eorge Washington U

niversity Medical C

enter Librar on N

ovember 21, 2014

http://ww

w.jim

munol.org/

Dow

nloaded from

The Journal of Immunology

Single Sea Urchin Phagocytes Express Messages of a SingleSequence from the Diverse Sp185/333 Gene Family inResponse to Bacterial Challenge

Audrey J. Majeske,1,2 Matan Oren,1 Sandro Sacchi,3 and L. Courtney Smith

Immune systems in animals rely on fast and efficient responses to a wide variety of pathogens. The Sp185/333 gene family in the

purple sea urchin, Strongylocentrotus purpuratus, consists of an estimated 50 (610) members per genome that share a basic gene

structure but show high sequence diversity, primarily due to the mosaic appearance of short blocks of sequence called elements.

The genes show significantly elevated expression in three subpopulations of phagocytes responding to marine bacteria. The

encoded Sp185/333 proteins are highly diverse and have central effector functions in the immune system. In this study we report

the Sp185/333 gene expression in single sea urchin phagocytes. Sea urchins challenged with heat-killed marine bacteria resulted in

a typical increase in coelomocyte concentration within 24 h, which included an increased proportion of phagocytes expressing

Sp185/333 proteins. Phagocyte fractions enriched from coelomocytes were used in limiting dilutions to obtain samples of single

cells that were evaluated for Sp185/333 gene expression by nested RT-PCR. Amplicon sequences showed identical or nearly

identical Sp185/333 amplicon sequences in single phagocytes with matches to six known Sp185/333 element patterns, including

both common and rare element patterns. This suggested that single phagocytes show restricted expression from the Sp185/333

gene family and infers a diverse, flexible, and efficient response to pathogens. This type of expression pattern from a family of

immune response genes in single cells has not been identified previously in other invertebrates. The Journal of Immunology, 2014,

193: 5678–5688.

Immune systems in most organisms are complex and includelarge families of highly diverse immune response genes thatencode a broad array of antipathogen proteins (reviewed in

Refs. 1–5). Some examples include fibrinogen-related proteins(FREPs) in molluscs (6, 7), V region–containing chitin-bindingproteins in protochordates (8, 9), and R proteins in plants (1).Highly diverse immune response genes identified from several seaurchin species are members of the 185/333 family (10), which wasoriginally identified by changes in gene expression in coelomo-cytes from immune-challenged compared with nonchallenged

purple sea urchins (Strongylocentrotus purpuratus) (11, 12). Ofthe expressed sequence tags from those screens, 73% matchedto two previously uncharacterized sequences, DD185 (11) andEST333 (13). In S. purpuratus the gene family is called Sp185/333because it has been reported in another echinoid species (14).Individual sea urchins are estimated to have 506 10 Sp185/333

genes (reviewed in Ref. 10), which range in size from 1.2 to 2.0 kbwith two exons, of which the second contains several tandem andinterspersed repeats (15). The genes are unusual and unique be-cause optimal alignments of the second exon require the insertionof large gaps that define blocks of similar sequence called “ele-ments” (10, 16–18). There are 25–27 different elements (dependingon the alignment) that range in length from 12 to 357 nt andare variably present or absent in different genes, which result inmosaics of recognizable element patterns (15). Sequence diversitywithin the members of the gene family is evident from comparisonsamong 171 genes cloned from three individual sea urchins, whichshows that although the genes are $88% similar, none sharesidentical sequences among individuals (15). The gene sequencediversity is predicted to occur through recombination, gene con-version, deletions, duplications, and perhaps meiotic mispairing (16,19), which is typical for other gene families. Computational pre-dictions suggest extraordinarily swift recombination frequency forthe Sp185/333 genes that lies between that of V-J somatic recom-bination in the TCR a-chain and that of sea urchin histone H3genes, which do not recombine (16). Predicted gene recombinationmay be the outcome of the unique gene family structure consistingof small, tightly clustered genes that share sequences and are sur-rounded by microsatellites (19). Although all but 1 of the 171 se-quenced genes have perfect full-length open reading frames (15),half of the mRNAs encode truncated proteins due to single nucle-otide polymorphisms and small (1–2 nt) indels that result in earlystop codons or nonsense sequence leading to stop codons (20),which are likely the result of RNA editing (21). Overall, there

Department of Biological Sciences, George Washington University, Washington, DC20052

1A.J.M. and M.O. contributed equally to this work.

2Current address: Department of Biology, University of Puerto Rico at Mayag€uez,Mayag€uez, Puerto Rico.

3Current address: Institute of Obstetrics and Gynecology, Mother-Infant Department,University Hospital of Modena, Modena, Italy.

Received for publication July 2, 2014. Accepted for publication October 1, 2014.

This work was supported by National Science Foundation Grants MCB-0744999 andIOS-1146124 and by the George Washington University Columbian College Facili-tating Fund (to L.C.S.). Funding from National Institutes of Health National Centerfor Research Resources Grant S10RR025565 supported confocal microscopy at theGeorge Washington University Center for Microscopy and Image Analysis.

The sequences presented in this article have been submitted to GenBank (http://www.ncbi.nlm.nih.gov/genbank/) under accession numbers KJ408449–KJ408477.

Address correspondence and reprint requests to Dr. L. Courtney Smith, Departmentof Biological Sciences, George Washington University, 340 Lisner Hall, 2023 GStreet NW, Washington, DC 20052. E-mail address: csmith@gwu.edu

The online version of this article contains supplemental material.

Abbreviations used in this article: aCF, artificial CF; CF, coelomic fluid; CMFSW-EI,calcium and magnesium–free seawater with EDTA and imidazole; FREP, fibrinogen-related protein; gDNA, genomic DNA; PAMP, pathogen-associated molecular pattern;qRT-PCR, quantitative RT-PCR; UTR, untranslated region; wCF, whole CF.

Copyright� 2014 by TheAmericanAssociation of Immunologists, Inc. 0022-1767/14/$16.00

www.jimmunol.org/cgi/doi/10.4049/jimmunol.1401681

at George W

ashington University M

edical Center L

ibrar on Novem

ber 21, 2014http://w

ww

.jimm

unol.org/D

ownloaded from

appears to be multiple levels of immune diversification based ongene sequence diversity and RNA editing, in addition to putativeposttranslational modifications and multimerization of the enco-ded proteins (22) with possible synergistic activities among theSp185/333 proteins. The extraordinary diversity of the Sp185/333system produces a very broad array of both full-length and truncatedSp185/333 proteins in response to immune challenge (22, 23).The coelomocytes of sea urchins mediate the innate immune

response and are composed of red and colorless spherule cells,vibratile cells, and phagocytes (reviewed in Ref. 24). Types ofphagocytes are based on the structural characteristics of theactin cytoskeleton (25–27) and the overall size of the cells. Thelarge phagocytes include discoidal phagocytes that have radiallyarranged actin cables with a disc-like shape, and polygonalphagocytes that have actin cables that align across the cell,resulting in polygon-shaped cells. The small phagocytes are muchsmaller and have a perpetual filopodial morphology (23, 28).Sp185/333 genes are expressed in small and polygonal phagocytes(23) and are upregulated in response to immune challenge withpathogen-associated molecular patterns (PAMPs), including LPS,b-1,3-glucan, dsRNA, peptidoglycans, and marine bacteria (11,12, 20, 29). Immune challenge with LPS significantly increasesthe numbers of Sp185/333+ phagocytes in the coelomic fluid (CF)and in other tissues of the sea urchin, which are likely Sp185/333+

phagocytes that are thought to wander through the tissues (23, 29,30). Recent work to evaluate functions of both native andrecombinant Sp185/333 proteins shows that they bind to bacteriaand some PAMPs with high affinity (C.M. Lun, C.S. Schrankel,H.Y. Chou, S. Sacchi, and L.C. Smith, unpublished observations;H.Y. Chou and L.C. Smith, unpublished observations).Although the expression of the Sp185/333 genes has been

documented in populations of coelomocytes, expression in singlephagocytes has not been evaluated. To address this question, weemployed nested RT-PCR with samples of immune-activatedsingle phagocytes to determine the level of Sp185/333 geneexpression. We found that 70% of the single-cell samples hadSp185/333 amplicons of the same size with identical or nearlyidentical sequences. Furthermore, all samples for which there wasa near zero probability of more than one cell per sample showamplicons of identical size and sequence. These results suggestthat individual phagocytes contain Sp185/333 mRNAs of uniformsequence, which is a result that has not been identified previouslywith regard to the expression of immune response genes for anyinvertebrate. This infers an additional level of complexity for thesea urchin immune system.

Materials and MethodsSea urchins

Adult purple sea urchins, S. purpuratus, were purchased from MarinusScientific (Long Beach, CA) or the Southern California Sea UrchinCompany (Corona del Mar, CA). Animals were maintained as described,fed weekly with commercial rehydrated kelp (Quickspice), and thosechosen for the study (n = 6) were considered immunoquiescent (28, 31).

Immunological challenge

Bacterial preparation. Vibrio diazotrophicus (Gram-negative marine bac-teria; no. 33466, American Type Culture Collection) was rotated at roomtemperature for 16–21 h in 5 ml of marine broth (3.44% marine broth,0.3% yeast extract, and 0.5% proteose peptone; Difco). Bacteria were heat-killed at 95˚C for 15 m and washed three times with artificial CF (aCF; seeRef. 23) and stored for up to 5 d in aCF at 4˚C or until used.

Bacterial injections. Sea urchins were immunologically activated by one(n = 2) or three (n = 1) separate injections of 106 heat-killed V. diazo-trophicus/ml CF. The initial injection was administered at 0 h followed bya second injection at 24 h and a third injection at 48 h. The total volume ofCF per sea urchin was estimated according to Smith et al. (32). Other

animals (n = 3) received 105 Vibrio/ml CF for the first injection and 106

Vibrio/ml CF for the second injection.

Coelomocyte collection and discontinuous densitycentrifugation

Coelomocyte collection. Whole CF (wCF; CF plus cells, 0.2–0.3 ml) waswithdrawn from sea urchins into a sterile 1-ml syringe after inserting theneedle through the peristomial membrane. The syringe was preloaded with0.2–0.3 ml ice-cold calcium and magnesium–free seawater with 70 mMEDTA and 50 mM imidazole (CMFSW-EI; see Ref. 23), supplementedwith 20 mM DTT according to Hillier and Vacquier (33). Following thewCF withdrawal, the syringe was filled with additional cold CMFSW-EI to1 ml and expelled into a 1.5-ml tube on ice. Samples of wCF were col-lected before (0 h) and after (24 h) each Vibrio injection. Coelomocytescollected before injection were pelleted by centrifugation and stored inRNAlater (Ambion) at 220˚C. Samples collected after Vibrio injection(s)were held on ice until used for density gradient centrifugation (see below).Cells were counted using a TC-20 automated cell counter (Bio-Rad) ora hemocytometer.

Density gradient centrifugation. Coelomocytes from immune-activated seaurchins were separated on a discontinuous density gradient composed ofice-cold Percoll (Amersham) that had been predialyzed using SnakeSkindialysis tubing (3500 m.w. cutoff; Thermo Scientific) against CMFSW-EI at4˚C overnight, followed by the addition of 20 mM DTT. Percoll layers of2.5, 20, 40, and 70% were generated by underlayering 2 ml increasingconcentration into a 12-ml glass round-bottom culture tube according topublished methods (34). A top layer (0.5 ml) of 2.5% Percoll served toseparate the molecules in the wCF from the cells after separation. Coe-lomocytes (#2 3 106 or a maximum of 0.5 ml) were gently overlayeredusing a Pasteur pipette and the gradient was centrifuged in a swingingbucket rotor (Eppendorf, model 5804R) at 250 3 g for 15 m at 4˚C witha soft start and no brake. Cells were collected from each layer plus thosepelleted to the bottom and diluted to 12 ml with fresh, ice-cold CMFSW-EIplus DTT, pelleted again, and resuspended in 0.2 ml fresh CMFSW-EI.Differential cell counts were done with a hemocytometer to identify en-richment of different cell types in each fraction. Dead cells were identifiedby 1.5 mM propidium iodide (Sigma-Aldrich) exclusion as visualized in anAxioplan fluorescence microscope (Carl Zeiss Microscopy).

Coelomocyte processing for immunofluorescent microscopy

Fractionated coelomocytes (either 5 3 104 phagocytes, 105 vibratile cells,or 105 red spherule cells) were spun onto poly-L-lysine slides (Erie Sci-entific) followed by fixing and processing for immunofluorescenceaccording to Brockton et al. (23). Briefly, fixed cells were incubated witha mix of three rabbit anti-Sp185/333 Abs (anti–185-66, -68, and -71 di-luted 1:4000 in blocking buffer; 2% normal goat serum, 1% BSA in PBS)plus mouse monoclonal anti-human actin (diluted 1:600 in blocking buffer;MP Biomedicals). Secondary Abs were a mixture of goat anti-rabbit Igconjugated to Alexa Fluor 568 (1:400 dilution; Invitrogen) and donkeyanti-mouse Ig conjugated to Alexa Fluor 488 (1:200 dilution; Invitrogen).Cells were washed and mounted in ProLong Gold Antifade with DAPI(Invitrogen). Primary Abs were replaced with an equal volume of blockingbuffer for the negative controls. Images were captured on an Axioplanfluorescence microscope (Carl Zeiss Microscopy) with a black-and-whiteCCD camera (Hitachi), to which false color was added using the OlympusMicroSuite B3SV program, or an LSM 710 confocal microscope (CarlZeiss Microscopy).

Limiting dilutions

Concentrations of fractionated coelomocytes were estimated with a TC-20automated cell counter (Bio-Rad), followed by serial dilutions with ice-cold CMFSW-EI to a final estimated cell concentration of 1 cell/ml, whichwas defined as 13, followed by further dilutions of 23, 43, and 103with fresh CMFSW-EI. Single-cell samples in lysis buffer (see below) wereheld at 270˚C until processed for cDNA synthesis and nested RT-PCR.Undiluted cell fractions were pelleted and stored in RNAlater (Ambion)at 220˚C until cDNA synthesis, which was used for RT-PCR and quan-titative RT-PCR (qRT-PCR; see below).

Polymerase chain reaction

Sample preparation and reverse transcription. Total RNA from undilutedcell fractions was extracted using an RNeasy Micro kit (Qiagen) accordingto the manufacturer’s protocols, including an on-column treatment withDNAse I. Total RNA from unfractionated cells was reverse transcribedusing SMARTScribe reverse transcriptase (Clontech) or SuperScript IIIreverse transcriptase (Invitrogen) with random hexamer primers (Operon)

The Journal of Immunology 5679

at George W

ashington University M

edical Center L

ibrar on Novem

ber 21, 2014http://w

ww

.jimm

unol.org/D

ownloaded from

according to the manufacturers’ instructions. cDNA from single-cellsamples were generated using the SuperScript III CellsDirect cDNA syn-thesis kit (Invitrogen) according to the manufacturer.

qRT-PCR. qRT-PCR was carried out on cDNAs from cells from three seaurchins collected before and 24 h after challenge with heat-killed Vibrio,and that were isolated from the 20 and 40% Percoll fractions. PCR reac-tions used 1 ml of the reverse transcription reaction (diluted 103) with theSp185/333 primers F5 and 39 untranslated region (UTR), or the SpL8primers SL8 and ASL8 (Supplemental Table I), and evaluated with AB-solute SYBR Green fluorescein (Thermo Fisher). SpL8 expression servedas the housekeeping control. The qRT-PCR reactions were performed intriplicate in the iCycler iQ (Bio-Rad) with the following program: 95˚C for12 min, then 40 cycles of 95˚C for 15 s and 59˚C for 45 s. qRT-PCR resultswere calculated based on the relative gene expression ratio (R), using theequation 22ΔΔCP (PerkinElmer) under the assumption that Etarget = Eref = 2,where Etarget is represented by the Sp185/333 target sequence and Eref isrepresented by the SpL8 reference sequence (35).

Single-cell nested RT-PCR. Single-cell samples were analyzed by nestedPCR to amplify Sp185/333 and SpL8 cDNAs. The first round of PCR in-cluded 2 mM each external primer (Supplemental Table I), 0.2 mM eachdeoxynucleotide, 13 company supplied buffer, 0.025 U TaKaRa ExTaqDNA polymerase (Clontech), plus 1 ml reverse transcriptase reaction(cDNA template) in a total of 20 ml. Molecular-grade water was used asused in place of the template for the negative control. For the positivecontrol reactions, the cDNA clone EST219 (GenBank accession numberR62029; http://www.ncbi.nlm.nih.gov/genbank) (13) served as the SpL8template for the external and internal SpL8 primers. Reactions were per-formed in either an iCycler IQ in nonquantitative mode (Bio-Rad), a PTC-200 Peltier thermal cycler (MJ Research), or a T100 thermal cycler (Bio-Rad). The cycling program was 94˚C for 1 min followed by 30 cycles of94˚C for 30 s, 57˚C (external 59UTR and 39UTR primers) or 54˚C (externalSpL8 primers) for 1 min, 72˚C for 30 s, with a final extension of 72˚C for 2min and a 4˚C hold. Nested PCR reactions included the identical reagentconcentrations plus 2 ml amplicons from the first round of PCR. Boththe SpL8 and Sp185/333 internal primers were designed with a higherannealing temperature to avoid amplification by the external primers car-ried over from the first PCR reaction in the nested reaction. When externalprimers were tested at the higher annealing temperature used for the in-ternal primers, they did not amplify known cDNAs (not shown). Thenested cycling program to amplify either Sp185/333 or SpL8 ampliconswas 94˚C for 1 min followed by 25 or 30 cycles of 94˚C for 30 s, 62˚Cfor 1 min, 72˚C for 30 s, with a final extension of 72˚C for 2 min and a4˚C hold. To identify Sp185/333 or SpL8 template contamination of thereagents or primers during the preparation of the nested PCR, 2 ml firstround PCR negative control was reamplified using the internal primers(Supplemental Fig. 1). Equal volumes of amplified cDNAs were loadedand electrophoresed through 0.8–1% agarose (Promega) in 0.53 TAEbuffer (0.04 M Tris base, 0.02 M glacial acetic acid, 1 mM EDTA).Amplicons were visualized with ethidium bromide, and images werecaptured on a DC120 digital camera (Eastman Kodak) with DigitalScience1D software version 3.0.0 (Eastman Kodak).

Detection of contaminating genomic DNA. Templates for PCR were eitherSp185/333 nested amplicons (1 ml) from single-cell samples or a clonedSp185/333 gene (10 ng, clone 2-073, GenBank accession numberEF607742.1) (15), which served as the positive control. Reactions of 20 mlincluded 0.2 mM LF and R2 primers (Supplemental Table I) and 10 mlGoTaq Green ready mix (Promega). The cycling program was 94˚C for30 s, 62˚C for 40 s, 72˚C for 90 s, and 72˚C for 5 min. Amplicons wereevaluated by gel electrophoresis.

Evaluation of primer characteristics. Plasmids used to evaluate theannealing characteristics of the internal primers were isolated using thestandard alkaline lysis method (36), diluted either 200- or 40,000-fold inwater, and 1–3 ml were used as templates in PCR of 10–20 ml. Reactionconditions replicated those used for the nested single-cell RT-PCR reac-tions described above, including 2 mM for each primer and 30 cycles;however, rather than ExTaq, GoTaq Green ready mix (Promega) wasused according to the manufacturer’s protocol. Negative control reactionsomitted templates. Amplicons were separated by gel electrophoresisand imaged.

Amplicon sequencing

Nested PCR amplicons from a subset of single-cell samples were ream-plified using the following internal primer combinations; in5.1 + in5.2(mixed) or in5.3 with either in3.1 or in3.2 (Supplemental Table I). The PCRconditions were the same as those for nested internal PCR describedabove. Amplicons were electrophoresed through 1% agarose gel forevaluation, and the DNA concentration was evaluated with a NanoDrop

ND-1000 spectrophotometer (Thermo Fisher). Amplicons were sequenceddirectly without prior cloning (GenScript) using ether F2 and/or R9 pri-mers (Supplemental Table I). F2 and R9 primers anneal at sites that arelocated between the internal primers and amplify all known Sp185/333sequences (15, 18). Chromatograms were inspected for correct base call-ing, trimmed according to the chromatogram quality, and internal primersites were identified manually for amplicons of #1 kb. Consensussequences were constructed for those amplicons that were sequenced withboth F2 and R9 primers. The final sequences were submitted to GenBank(accession numbers KJ408449–KJ408477) and compared with the nr da-tabase on GenBank by BLASTn to identify the element patterns for theSp185/333 transcripts according to Terwilliger et al. (20). Correct openreading frames were identified for each sequence based on length andsimilarity to Sp185/333 amino acid sequences in GenBank using BLASTp.Sequences from each single-cell sample were compared with all others byglobal pairwise alignments (blosum62) with free end gaps using Geneioussoftware (version 7.0.6; Biomatters) to identify the percentage similarityamong sequences.

Statistical analysis

Statistical analysis of limiting dilutions was based on Poisson distributions.The average number of Sp185/333+ cells per sample was calculated foreach dilution using the observed probabilities to equal zero cells (noamplification) in a sample [p(x = 0)] in the equation m =2ln[p(x = 0)]. Them values were used as l in the equation p(x) = lxe2l/x! to calculatethe probability to have exactly one (x = 1) cell per sample. Based on theobserved probabilities of having either zero or one cell per sample, theprobability to have more than one cell per sample was calculated withthe equation 1 2 [p(x = 0) + p(x = 1)] = p(x . 1).

Statistical analysis was performed on data acquired from qRT-PCR andcell counts from immunostaining using statistical analysis software (SAS,version 9.1.3). Coelomocyte counts from immunostaining were obtainedbefore versus after Vibrio challenge. Statistical analyses were performedon R values and cell counts, and data were log10 transformed to approxi-mate normal overall distributions where appropriate. Statistical significancewas assessed by ANOVA in general linear models regression procedures.Experimental error was addressed by including replicate measurementsamong model parameters.

ResultsSea urchins are immune activated by V. diazotrophicus

The goal of evaluating Sp185/333 gene expression in singlephagocytes required an immune challenge that would drive theactivation of as many coelomocytes as possible with the inductionof the maximum number of Sp185/333 genes. Although seaurchins have been evaluated for immune responses to a variety ofPAMPs and uncharacterized marine bacteria (11, 12, 20, 22), mostreports of sea urchin activation have employed LPS (23, 36, 37).Consequently, a putative sea urchin pathogen, V. diazotrophicus(Vibrio), that was originally isolated from an infected green seaurchin, Strongylocentrotus droebachiensis (38), was used asthe immune challenge. Immunoquiescent sea urchins (n = 3)injected with heat-killed Vibrio showed a significant increase incoelomocytes in the CF after 24 h, which included increases inSp185/333+ phagocytes (Fig. 1A, 1B). This was in agreementwith responses to LPS (23, 29) in addition to other PAMPs(20), and therefore Vibrio was employed to activate antipathogenresponses.The phagocyte class of coelomocytes has been evaluated for

Sp185/333 proteins (23, 29); however, expression from the vi-bratile and spherule cells is not known. Consequently, we useddiscontinuous Percoll density centrifugation to separate the coelo-mocyte types and to identify the types that express Sp185/333 genesbefore proceeding to enrichment for single-cell isolation (28, 34).Differential cell counts of the fractions indicated that the polyg-onal, discoidal, and small phagocytes were present in the 20 and40% Percoll fractions (Table I). Coelomocytes from eachfraction were analyzed for Sp185/333 proteins and the threetypes of phagocytes were positive, whereas the vibratile andred spherule cells were negative (Fig. 2). Although expression

5680 PHAGOCYTES EXPRESS A SINGLE Sp185/333 MESSAGE SEQUENCE

at George W

ashington University M

edical Center L

ibrar on Novem

ber 21, 2014http://w

ww

.jimm

unol.org/D

ownloaded from

in the polygonal and small phagocytes is known (23), ex-pression in the discoidal phagocytes has not been reportedpreviously.To ensure that the immune challenge with heat-killed Vibrio

induced Sp185/333 gene expression and to verify that this wasenhanced in phagocytes as previously reported for responses toLPS (23), cell fractions from three sea urchins were evaluated forSp185/333 gene expression by qRT-PCR before and after chal-lenge. The phagocytes not only expressed Sp185/333 genes, butthe 40% Percoll fraction containing small and discoidal phag-ocytes showed increased expression 24 h after immune challengewith heat-killed Vibrio, and the polygonal and small phagocytesfrom the 20% Percoll fraction trended toward increased expres-sion (Fig. 1C, 1D). Consequently, we employed the phagocytesenriched in the 20 and 40% Percoll fractions to analyze expressionin single-cell samples.

Many single-cell samples show Sp185/333 amplicons ofa single size

To evaluate Sp185/333 gene expression in single phagocytes, cellsfrom the top two Percoll fractions were diluted to an estimated1 cell/ml (defined as 13). To improve the likelihood that serialdilutions of cells resulted in samples containing one cell, 13dilutions were diluted further by 23, 43, and 103. Samples fromeach cell fraction and dilution set were first evaluated for SpL8gene expression by two rounds of RT-PCR, which served as thepositive control to evaluate whether a given sample had containeda cell and that cDNA had been produced. SpL8 encodes the seaurchin homolog of the ribosomal L8 protein (EST219; GenBankaccession number R62029) (13). Of 214 single-cell samples thatwere analyzed from three sea urchins only 118 supported nestedRT-PCR for SpL8, indicating that ∼55% of the samples containedat least one cell (Supplemental Table II). Poisson distributionanalysis of the limiting dilutions indicated that samples diluted 43and 103 were highly likely to contain single cells (Table II).Samples that amplified SpL8 were next used in two rounds of

RT-PCR with the external and internal primers for Sp185/333sequences (Supplemental Table I). Because of the significant se-quence variability among Sp185/333 cDNAs (18, 20), severalpartially overlapping internal primers were designed for the sec-ond round of PCR that would amplify as many of the knownSp185/333 cDNA sequences as possible. The internal primerswere analyzed using a set of Sp185/333 cDNA templates of knownsequence from the hundreds that are available (18, 20), whichwere chosen based on alignments of their 59 and 39 ends with theinternal primers and the level of sequence matches or mismatches(Fig. 3). Results of the PCR showed that one to six pairs of in-ternal primers could amplify individual Sp185/333 cDNA cloneswith varying intensity, which depended on the level of sequencematch between each primer and each template in addition to thetemplate concentration, the primer pair used in the reaction (Fig.4), plus primer concentration, the number of PCR cycles, and theannealing temperature (not shown). Results ranged from multiplepairs of primers that generated amplicons of varying intensity fora particular template (clone aCF4-2441) to a single pair of primersthat generated a single amplicon for a particular template (cloneCG2-2404; Fig. 4). The two reverse primers were noted to amplifyparticular templates optimally (primer in3.1 amplified Lam6-2429; primer in3.2 amplified CG4-2404). In some cases, all for-ward primers amplified the same template (aCF4-2441), and inother cases a single forward primer amplified a particular template(primer in5.3 amplified Lam6-2429; Fig. 4). Different combina-tions of internal primers varied the production of amplicons fromparticular templates. However, amplicons of unexpected size froma given template were not observed, suggesting that primingfrom unexpected sites did not occur. These results indicated thatmultiple pairs of internal primers could variably amplify tem-plates of known sequence, a result that was based on the similarbut diverse sequences of the target cDNAs.

FIGURE 1. Immune challenge with V. diazotrophicus results in in-

creased coelomocyte concentration, increased Sp185/333+ phagocytes,

and increased Sp185/333 gene expression. Coelomocytes were collected

from three immunoquiescent sea urchins (nos. 7, 18, and 25) before

(gray) and 24 h after (black) two separate injections of heat-killed Vibrio

(105 Vibrio/ml CF followed by 106 Vibrio/ml). The timing of post-

challenge coelomocyte collection was based on results from Terwilliger

et al. (20). (A) Coelomocyte concentration (cells 3 106/ml) increases in

response to challenge. (B) The percentage of Sp185/333+ phagocytes

increases in response to challenge. (C) Polygonal and small phagocytes

enriched in the 20% Percoll fraction show increased relative Sp185/333

gene expression in response to Vibrio challenge based on qRT-PCR

analysis using SpL8 as the internal control. (D) Discoidal and small

phagocytes enriched in the 40% Percoll fraction also show significantly

increased relative Sp185/333 gene expression. Bars indicate SEM.

*p , 0.05. X, no data collected.

Table I. Different types of coelomocytes are enriched in different fractions

Percoll FractionPolygonal

Phagocytes (%)Discoidal

Phagocytes (%)Small

Phagocytes (%)VibratileCells (%)

Colorless SpheruleCells (%)

Red SpheruleCells (%)

20% 73–77 12–14 4.5–4.6 6.1–7.0 0 0.8–1.540% 8–11 70–74 5.4–7.9 4.8–11.3 0–0.23 3.7–5.170% 0.15–0.5 2.6–3.2 0 78–82 5.2–6.3 7.9–12.8Pellet 0–0.3 1.2 0 7.0–8.3 4.6–7.0 83–87

Coelomocytes from three sea urchins were fractionated before and after immune challenge with heat-killed Vibrio. Immune challenge did notchange the percentage of cell types in each of the fractions.

The Journal of Immunology 5681

at George W

ashington University M

edical Center L

ibrar on Novem

ber 21, 2014http://w

ww

.jimm

unol.org/D

ownloaded from

Next we evaluated the 118 samples that amplified SpL8 foramplification of Sp185/333 transcripts using four pairs of internalprimers. We found that only 40 samples supported amplificationwith the internal Sp185/333 primers (Supplemental Table I),which indicated that ∼34% of the cell samples contained phago-cytes that were expressing Sp185/333 genes at the time of col-lection. The remaining SpL8+ samples may have contained phago-

cytes, but only a subset of phagocytes are known to express theSp185/333 genes at a given time (23). Nested PCR showed that 33of the 40 single-cell samples had Sp185/333 amplicons of thesame size, and 4 samples produced a single amplicon from a sin-gle pair of internal primers (Fig. 5). Of the remaining samples,seven showed amplicons of different sizes, although five of thosewere samples from the 13 dilution series with a higher probabilityof more than one cell per sample (Table II). In general, 82.5% ofthe single-cell samples produced Sp185/333 amplicons of thesame size from the internal primers, suggesting that these cellsmay have contained Sp185/333 transcripts of identical sequence.A possible source of artifact for our approach was genomic DNA

(gDNA) contamination in the single-cell samples. The size range ofthe Sp185/333 mRNAs and the genes overlap even though thegenes have a single intron of ∼400 nt. Consequently, Sp185/333amplicons generated with the internal primers were evaluated ina subsequent PCR with LF and R2 primers (Supplemental Table I)that annealed to conserved regions surrounding the intron. Thetemplates employed in the reactions were a subset of Sp185/333nested amplicons from single-cell samples in addition to a clonedSp185/333 gene (clone 2-073, GenBank accession numberEF607742.1) (15), which was used as the positive control forgDNA contamination. The Sp185/333 nested amplicons from thesingle-cell samples showed a consistent fragment size of ∼120 nt,which was the expected size based on the positions of theannealing sites for the primers (Fig. 6). These were significantlysmaller than the ∼520-nt amplicon from the cloned gene, whichincluded the intron (see Supplemental Table I). This demonstratedthat gDNA did not contaminate the RNA isolated from the single-cell samples that were used for nested RT-PCR and that onlyphagocyte cDNAs served as templates for the single-cell analysis.

Amplicon sequences are nearly identical within mostsingle-cell samples

Amplicons of the same size from different pairs of internal Sp185/333primers for individual single-cell samples suggested that they couldeither be the same sequence or the same size with differentsequences. Consequently, 32 amplicons from 11 representativesamples from three sea urchins were chosen for sequencing. Theseincluded samples with one to four amplicons of the same size andother samples chosen specifically because they had amplicons ofdifferent sizes (Fig. 5; lanes with sequenced amplicons are indi-cated at the bottom of the gels). Templates from the first round ofRT-PCR were reamplified using the same set of internal primerpairs, and the resulting amplicons were sequenced directly usingF2 and/or R9 primers (Supplemental Table I), which annealed toconserved regions located between the internal primers. Most of

Table II. Poisson distribution of single Sp185/333+ cells in samples

Cell Typea DilutionbSamplesAnalyzed

Samples withSp185/333Amplicons

Ratio of Sp185/3332

Cells (F0)c

Expected AverageNo. of Sp185/333+

Cells/Sample (m)d

Probability of .1Sp185/333+

Cells/Samplee

Ratio of Sampleswith $2 Sp185/333

Amplicons

P,S 13 24 11 0.54 0.61 0.126 0.36P,S 23 18 9 0.5 0.69 0.153 0.11P,S 43 20 3 0.85 0.16 0.012 0.33P,S 103 88 12 0.86 0.14 0.009 0D,S 43 20 4 0.8 0.22 0.021 0.25D,S 103 30 1 0.97 0.03 0.00056 0

aPhagocytes were enriched in two Percoll fractions: one containing polygonal and small phagocytes (P,S), and the second containing discoidal and small phagocytes (D,S).D,S samples of 13 dilution were not analyzed. D,S samples of 23 dilution did not result in samples with Sp185/333 amplicons. Both have been omitted from this table.

bInitial cell counts established the serial dilution that resulted in an initial estimate of one cell per sample (13). The 13 samples were subsequently diluted by 23, 43, and103.

cF0 is the ratio of the Sp185/3332 cells to the total number of samples.dm = 2ln(F0).eThe probability of more than one cell per sample based on Poisson distribution.

FIGURE 2. Polygonal, discoidal, and small phagocytes express Sp185/333

proteins, whereas the vibratile cells and red spherule cells do not. Coelo-

mocytes were fractionated by density centrifugation and processed for

immunofluorescence with a mixture of Abs against Sp185/333 proteins

(red), actin (green), plus a DNA stain (DAPI; blue) according to Brockton

et al. (23). (A) Polygonal phagocyte. (B) Discoidal phagocyte. (C) Small

phagocyte. (D) Red spherule cells. (E) Vibratile cells. Arrows indicate

some of the Sp185/333+ vesicles in the polygonal (A) and discoidal (B)

phagocytes. Sp185/333+ polygonal and small phagocytes have been re-

ported previously (23) and are shown for comparisons to the other types of

coelomocytes. Images were acquired with either a confocal (A–C) or

a fluorescence (D and E) microscope. The colorless spherule cells were not

evaluated because too few were recovered from the gradients. Controls in

which the primary Abs were omitted were negative (not shown). Scale

bars, 10 mm.

5682 PHAGOCYTES EXPRESS A SINGLE Sp185/333 MESSAGE SEQUENCE

at George W

ashington University M

edical Center L

ibrar on Novem

ber 21, 2014http://w

ww

.jimm

unol.org/D

ownloaded from

the amplicons (29 of 32) returned an unambiguous sequence,which matched to Sp185/333 messages based on BLASTn

searches of the nr database on GenBank (Supplemental Table III).

Amplicons from three samples either returned ambiguous se-

quence or failed the sequencing reaction, likely due to technical

reasons (Fig. 5, indicated with an X). The amplicon derived from

single-cell sample B8 from animal 11, internal primer set 2 was

shorter (Fig. 5), showed only 70–72% nucleic acid identity and

78–82% amino acid identity compared with the longer amplicons,

and had a different element pattern (Fig. 7, Supplemental

Table III). The amplicon derived from internal primer pair 4 for

sample B8 returned ambiguous sequence, which was consistent

with the presence of mixed templates originating from two dif-

ferent Sp185/333 messages to which the sequencing primer

annealed (Fig. 5). The length of sequences ranged from 665 to

1216 nt and spanned a large part of the highly variable region

encoded by the second exon. The deduced amino acid sequences

that matched to Sp185/333 proteins by BLASTp searches were

275 to 385 aa in length (Supplemental Table III). When Sp185/333

amplicon sequences from 10 single-cell samples were compared

within samples by global pairwise alignments, amplicons from

nine samples showed 98–100% nucleotide identity and 94–100%

amino acid identity (Fig. 7). Variations among amplicon sequen-

ces from within samples may have been the result of sequencing

errors because these positions were mostly located in the terminal

10% of the sequencing passes. Ambiguous nucleotides at single

positions were consistent with RNA editing that has been pre-

dicted for the Sp185/333 system (21). Editing of mRNAs derived

from the same gene would appear as ambiguities at single posi-

tions, which were identified in a number of the sequences reported

in the present study. Previous analyses have ruled out the possi-

bilities of incorrect incorporation of nucleotides during ExTaq

polymerization of Sp185/333 sequences (15, 20) and templateswitching that could result from shared sequence among Sp185/333cDNAs or genes (see supplemental file 5 from Ref. 15). Conse-

FIGURE 3. Sp185/333 primers show matches

and mismatches with a chosen set of Sp185/333

cDNAs. The ends of Sp185/333 cDNA sequences

were aligned with the external and internal prim-

ers employed in nested RT-PCR using BioEdit

(http://www.mbio.ncsu.edu/bioedit/bioedit.html).

Those chosen for templates in PCR were based

on the level of sequence matches or mismatches

with the primers. The cDNAs were from those

reported in Terwilliger et al. (20) in which sea

urchins were challenged with either LPS, poly(CG)

RNA (CG), b-1,3-glucan (laminarin [Lam]), or

aCF prior to coelomocyte collection.

FIGURE 4. Multiple pairs of internal primers amplify individual cDNA

templates of known sequence. Forward primers (in5.1, in5.2, in5.3) and

reverse primers (in3.1, in3.2) (see Supplemental Table I) were tested in all

combinations with cDNA templates of known sequence and known ele-

ment pattern (20) (see Fig. 3). cDNA template dilutions for PCR are

shown. Stars indicate the primary amplicon expected under conditions of

0.5–1.0 mM primers and 25 cycles. Elements are blocks of sequence

identified from optimized alignments of cDNAs and/or genes that required

insertions of large artificial gaps, which separated recognizable blocks of

sequence. Element patterns are the result of a mosaic presence/absence of

different blocks of elements in the Sp185/333 cDNAs and genes. For

details, see Buckley and Smith (15) and Terwilliger et al. (18, 20). Gen-

Bank accession numbers for templates are listed in Fig. 3.

The Journal of Immunology 5683

at George W

ashington University M

edical Center L

ibrar on Novem

ber 21, 2014http://w

ww

.jimm

unol.org/D

ownloaded from

quently, we conclude that artifacts are not the source of sequencediversity reported in the present study.A possible explanation of the near identity among the amplicons

from most of the single-cell samples, besides multiple primer pairsamplifying the same target (as shown in Fig. 4), may have beenmixing or contamination among the internal primers, which wouldresult in identical amplicons. To ensure that amplicons were onlygenerated by the primers employed in a given reaction, 24 chro-matograms of unambiguous sequence and #1 kb were inspectedfor the annealing site of the internal primer. For the 19 ampliconsthat were sequenced with the F2 forward primer, the predictedinternal primer site for either in3.1 or in3.2 was identified at the 39end of the sequence. Similarly, the six sequences that were gen-erated with the R9 primer had the predicted annealing site foreither internal primer in5.1, in5.2, or in5.3. This included cases inwhich both in5.1 and in5.2 were used in the reaction and bothwere identified as ambiguous chromatogram peaks at the expectedpositions where the primers differed (not shown). All of the 24sequences had the expected internal primer annealing site at the 39

end of the sequence based on the internal primers used to generatethe amplicons. Annealing sites for primers that were not employedin the amplification reactions were not identified. This indicatedthat the amplicons from the single-cell samples were not the resultof primer contamination.The Sp185/333 genes and messages show variations in se-

quence, which is mostly based on the mosaic-like element pat-terns (15, 18, 20). BLASTp searches showed 93–100% identityto translated nucleotide sequences of known Sp185/333 elementpatterns (Supplemental Table III) (12, 15, 18, 20). The mostabundant message type had the E2 element pattern (16 sequencesfrom five single-cell samples from two animals), in agreementwith previous results for E2 being the most common messagetype (20). Other element patterns included A1-like, A6, C5, G2and G2-like, and O1 (Fig. 7, Supplemental Table III). Remark-ably, these results indicated that many individual sea urchinphagocytes expressed Sp185/333 messages of highly similar oridentical sequence that were the same length and had the sameelement pattern.

FIGURE 5. Nested RT-PCR from most single-cell samples suggests Sp185/333 messages of uniform size in each sample. (A) Animal 11. (B) Animal 17.

(C) Animal 26. Coelomocytes were collected from sea urchins 24 h after one (animals 11 and 26) or three (animal 17) injections of heat-killed V. diaz-

otrophicus (106 Vibrio/ml CF) at 0, 24, and 48 h. Single-cell samples were obtained from density centrifugation fractions containing polygonal and small

phagocytes (P,S) or discoidal and small phagocytes (D,S), and diluted to an estimate of one cell per sample (13) followed by further dilutions of 23, 43,

and 103. Each sample was evaluated for SpL8 expression by nested RT-PCR (shown at the bottom of the gels) prior to analysis of Sp185/333 expression.

Internal primer pairs for Sp185/333 expression are: 1, in5.1 + 5.2 + in3.1; 2, in5.1 + 5.2 + in3.2; 3, in5.3 + in3.1; 4, in5.3 + in3.2 (Supplemental Table I).

Four samples produced a single (s) amplicon for a single pair of internal primers and five samples have multiple (m) amplicon sizes. Lanes marked with

carrots at the bottom indicate amplicons chosen for sequencing. Lanes marked with an X indicate sequencing reactions that returned unusable data. The

single-cell sample B8, primer pair 4 from animal 11, returned ambiguous sequence, whereas the two other amplicons marked with an X failed the se-

quencing reaction for technical reasons.

5684 PHAGOCYTES EXPRESS A SINGLE Sp185/333 MESSAGE SEQUENCE

at George W

ashington University M

edical Center L

ibrar on Novem

ber 21, 2014http://w

ww

.jimm

unol.org/D

ownloaded from

Amplicon sequences among single-cell samples are bothsimilar and different

Because many of the sequences obtained from individual single-cell samples were highly similar, we evaluated whether this wasalso true for amplicon sequences that were generated from differentsingle-cell samples both within and among animals. Global pair-wise alignments of sequences from among single-cell samplesshowed that the nucleic acid identity was 67–100%, and the aminoacid identity was 54–100%, corresponding to six different elementpatterns (Fig. 7). All sequences of .98% nucleotide identityshared the same element pattern, which was not correlated withthe animal or sample from which the sequences were generated.For example, nucleotide sequences from different samples from

animals 17 and 26 that displayed the E2 element pattern were98–100% identical (Fig. 7). Alternatively, comparisons amongsequences of different element patterns either within or amonganimals resulted in ,72% nucleotide identity. These results in-dicated that sequences of shared element patterns were also ofnearly identical sequence for the three sea urchins that were an-alyzed in this study. Similarity among sequences of the same el-ement pattern was confirmed through alignment and phylogeneticanalysis that showed amplicons of the same element patternclustered into six separate clades within which the individualsequences were unresolved (not shown). The predominant ex-pression of the E2 element pattern genes after immune challengewas in agreement with previous studies and was consistent witha core set of Sp185/333 genes that appear to be shared among allsea urchins (20).

DiscussionThe Sp185/333 gene family shows swift upregulation of expres-sion in phagocytes responding to a variety of foreign challenges(11, 12, 20). The response appears to be essential for immunefunction and produces a highly diverse protein repertoire forprotecting the host from the multitudes of potentially pathogenicmicrobes present in the marine environment (39, 40). It is strikingthat the expression patterns of the Sp185/333 gene family in singlephagocytes from immune-challenged sea urchins show transcriptsof a single sequence. This increases the complexity of the Sp185/333system in the sea urchin in which sequence diversification of theimmune response is to the advantage of the host over the pathogens(10). The diversification layers include 1) sequence variations among

FIGURE 6. Amplicons from single-cell samples are not the result of

genomic DNA contamination. Amplicons from the first round of RT-PCR

were reamplified in a second round of PCR using LF and R2 primers

(Supplemental Table I). Templates were amplicons chosen from single-cell

samples from three sea urchins (nos. 11, 17, and 26) and correlate with

samples shown in Fig. 5. The template was omitted from the negative control

(2). The positive control (+) employed a cloned Sp185/333 gene (clone

2-073, GenBank accession number EF607742.1) (15) as the template to

demonstrate amplification with the intron. M, DNA standard ladder.

FIGURE 7. Most single-cell samples contain Sp185/333 cDNAs of a single sequence. Paired sequence alignments for both nucleotide and amino acid

sequences were used to compare all sequences from single-cell samples that amplified from different pairs of internal primers (1–4, see legend to Fig. 5 for

details and see Supplemental Table I). Ranges of percent identities between pairs of sequences are indicated by color at the bottom. The lower left triangular

region (below the diagonal line of black boxes) is the paired nucleic acid identities, and the upper right triangular region (above the diagonal black boxes) is

the paired amino acid identities. Percent identities of paired sequence comparisons within single-cell samples are shown numerically. The identification of

element patterns for individual sequences is based on the best GenBank match from BLASTn searches.

The Journal of Immunology 5685

at George W

ashington University M

edical Center L

ibrar on Novem

ber 21, 2014http://w

ww

.jimm

unol.org/D

ownloaded from

the Sp185/333 genes, 2) putative gene duplication, deletion, andrecombination to increase sequence diversity, 3) evidence of mRNAediting that increases the sequence diversity of the transcripts froma given gene, and 4) likely posttranslational modifications to theproteins, all of which results in a significantly broader array ofprotein isoforms in the CF than is encoded in the genes (22). Theresults reported in the present study for Sp185/333 transcripts ofa single sequence in single sea urchin phagocytes have not beenidentified previously in other invertebrates, and they add an in-triguing new layer of complexity to this system in the sea urchin.Early investigations of immunity concluded that invertebrates

rely on simple, nonspecific recognition and response proteins thatdetect and combat whole classes of pathogens (41), a paradigm thatwas derived, in part, from the limited numbers of immune genes inDrosophila and the broad categories of pathogens that theseinsects detect and to which they respond (42, 43). However, sig-nificant complexity in many invertebrate innate immune systemsis becoming the new paradigm, which in many cases is based ongenome annotation (e.g., see Refs. 44, 45). Expanded immuneresponse diversity in arthropods may be derived from the singlecopy DSCAM gene through regulated alternative splicing in he-mocytes that produce many DSCAM isotypes (46, 47) that haveimportant pathogen opsonization functions leading to augmentedphagocytosis by hemocytes (48). Somatic DNA modifications thatbroaden the sequence diversity of the FREP gene family infreshwater snails generate diversity in the encoded proteins (6),which are involved in snail protection against digenean parasitesand other pathogens (49, 50). Diversification of the FREP genes isthought to occur in individual hemocytes (51), although the ex-pression patterns in single hemocytes are not known. The notionof a simple immune system in echinoderms changed with theannotation of the purple sea urchin genome and the discovery ofmany immune genes, including large and complex gene familiessuch as those encoding TLRs and NOD-like receptors amongothers (45, 52, 53). However, little is known about the details ofhow this vast array of pathogen recognition receptors in seaurchins are expressed in coelomocytes, how they function in hostprotection, and whether they are connected to the Sp185/333 geneexpression patterns in single phagocytes. These recent advanceshave shown that invertebrate immunity is not simple, is not ho-mogeneous, and can be unexpectedly complex and sophisticated(53, 54).The best understood cases of limited expression of immune

genes in single cells include the Ig family genes in higher verte-brates that are assembled by somatic recombination (55) and thevariable lymphocyte receptor genes in lower vertebrates that areassembled by a copy choice mechanism (reviewed in Ref. 56).The animal kingdom has very few examples of restricted ex-pression of single members from multigene families in individualcells. The multiple clusters of olfactory receptor genes that encodeG protein–coupled odorant receptors is one example that showsrestricted expression from a single locus or a single allele in in-dividual olfactory sensory neurons (reviewed in Ref. 57). Anotherexample is the killer Ig-like receptor family that shows restrictedexpression in vertebrate NK cells (reviewed in Ref. 58). Perhapsthe best example of a gene family with immune response functionis the multigene IgM H chain family in nurse sharks that showsrestricted expression in individual lymphocytes (59). Expressionby members of these gene families is regulated by a wide varietyof mechanisms, including epigenetic silencing and negativefeedback to block expression, transcriptional regulation andcomplex promoters to restrict expression, chromatin remodelingby NFs, and short time windows for access by regulatory proteinsto open euchromatin. These examples indicate that limiting the

expression from large families of similar genes is likely accom-plished with multiple mechanisms acting in coordination. Com-plex expression regulation may also be in play for the Sp185/333gene family; however, it is not known how this might be ac-complished in individual phagocytes in the sea urchin.

Expression from multiple Sp185/333 genes in singlephagocytes is unlikely

An alternative explanation for our results could be that multipleSp185/333 genes are expressed at very different levels in phag-ocytes, and that the single gene with the highest expression pro-duces the only cDNAs that are amplified by nested RT-PCR. Wethink that this possibility is unlikely for the following reason.When large batches of coelomocytes are evaluated for Sp185/333gene expression, the most common element pattern encoded in themRNAs is E2 or E2.1 (81%; 491 of 608 sequenced clones) (20).Similarly, Sp185/333 amplicon sequences of the E2 element pat-tern are the most common among the sequences reported in thepresent study. mRNAs encoding other element patterns from largebatches of coelomocytes are identified much less often, such as theA type pattern that was found only once in 608 clones from seaurchins that where challenged with a variety of PAMPs (20).Consequently, if single cells express multiple genes at varyinglevels and the expression level of the A type element pattern islow, in agreement with previous results, this type of mRNA shouldbe below detection by nested RT-PCR compared with othersequences. Based on the number of amplicons that were evaluated,we would expect that no single-cell samples would be detectedwith mRNAs encoding the A type element pattern. However, 3 of20 single-cell samples have A type mRNAs, suggesting that theserare element patterns are expressed from single genes in individ-ual cells at similar levels of expression as that from other genes.This argues against genes encoding rare element patterns beingexpressed at low levels among messages from multiple genes insingle cells. Although our PCR-based approach to address thequestion of Sp185/333 gene expression in single phagocytes doesnot technically eliminate the possibility of very low levels ofmRNAs expressed from another or multiple Sp185/333 genes, thesensitivity of nested PCR and the care required to eliminate am-plification of contaminants suggest that low levels of other tran-scripts in single cells may not be present. If they are present, theymay be functionally ineffective in supporting translation intoenough additional Sp185/333 protein isoforms to have an immu-nological effect.

Advantage to the sea urchin

The innate immune system of the sea urchin must protect thisspecies from a wide range of potential pathogens that are present inhigh concentrations in the marine environment (39, 60) during thelife of the animal, which has maximum age estimates of ∼50 y(61, 62). The outcome of Sp185/333 gene expression is a broadarray of Sp185/333 proteins that are produced by the phagocytes(22, 23). Based on the number of genes and numbers of proteinisoforms that might be produced, it may be advantageous to thesea urchin to limit Sp185/333 protein production to only thoseisoforms with activities that can be effective against the pathogenor PAMP that has been detected. For example, preliminary resultsfor a recombinant Sp185/333 protein show that it binds to Vibriobut not Bacillus, and to LPS but not peptidoglycan (C.M. Lun,C.S. Schrankel, H.Y. Chou, S. Sacchi, and L.C. Smith, unpub-lished observations). Depending on the pathogen detection mech-anisms that function in phagocytes, only some of these cellsmay respond to a given challenge by activating Sp185/333 geneexpression. This notion fits with our results showing that only 40

5686 PHAGOCYTES EXPRESS A SINGLE Sp185/333 MESSAGE SEQUENCE

at George W

ashington University M

edical Center L

ibrar on Novem

ber 21, 2014http://w

ww

.jimm

unol.org/D

ownloaded from

of 118 cell samples show Sp185/333 gene expression and that onlysome phagocytes produce Sp185/333 proteins (23, 29). Specula-tion on differential expression of the Sp185/333 genes in responseto different PAMPs is based on a correlation with progressivechanges in the size range of Sp185/333 mRNAs over the course ofa response (20) and changes in the Sp185/333 protein repertoire inresponse to different challenges (22). Not only does this suggestthat different isoforms may have different functions, but that theirexpression may be limited and tailored to the specific pathogenor PAMP that is detected (22) and that expression of a singleSp185/333 sequence per phagocyte may be only one aspect ofregulating the response.Limited gene expression and the presence of a single Sp185/333

mRNA sequence in individual phagocytes infers the production ofa single Sp185/333 protein isoform per cell, given minor changesfrom possible mRNA editing (21) and putative posttranslationalmodifications. As an advantage, this may reduce or alleviate thetendency of the proteins to aggregate irreversibly while in trans-port vesicles. Aggregation has been noted when mixtures of nativeSp185/333 proteins are isolated from samples of coelomocytes(22, 23). Aggregation tends to occur more slowly for isolates ofa single recombinant Sp185/333 protein (23), and aggregation ofthe recombinant reduces activity (C.M. Lun, A. Boyd, S.D. Gillmor,and L.C. Smith, unpublished observations). Production of a limitednumber of Sp185/333 protein isoforms from individual phagocytessuggests that the proteins may function synergistically and com-binatorially when mixed upon secretion into the CF and prior toaggregation, which may expand significantly the response capa-bilities of the Sp185/333 proteins. The Sp185/333 system inthe sea urchin suggests diversity, flexibility, and efficiency for re-sponding and adjusting to the wide variety of marine pathogensthat are present in the habitat in which purple sea urchins havesurvived for millennia.

AcknowledgmentsWe are grateful to Preethi Golconda, Brian D’Allura, and Evelina Bertolotti for

laboratory assistance, to Hung-Yen Chou for phagocyte images, to Dr. Haim

Zlatokrilov for assistance with statistics, and to Drs. Sam Loker, Martin

Flajnik, and Ioannis Eleftherianos for improvements to the manuscript.

DisclosuresThe authors have no financial conflicts of interest.

References1. Joshi, R. K., and S. Nayak. 2013. Perspectives of genomic diversification and

molecular recombination towards R-gene evolution in plants. Physiol. Mol. Biol.Plants 19: 1–9.

2. Flajnik, M. F., and L. Du Pasquier. 2004. Evolution of innate and adaptive im-munity: can we draw a line? Trends Immunol. 25: 640–644.

3. Herrin, B. R., and M. D. Cooper. 2010. Alternative adaptive immunity in jawlessvertebrates. J. Immunol. 185: 1367–1374.

4. Ghosh, J., C. M. Lun, A. J. Majeske, S. Sacchi, C. S. Schrankel, and L. C. Smith.2011. Invertebrate immune diversity. Dev. Comp. Immunol. 35: 959–974.

5. Wang, J., L. Zhang, J. Li, A. Lawton-Rauh, and D. Tian. 2011. Unusual sig-natures of highly adaptable R-loci in closely-related Arabidopsis species. Gene482: 24–33.

6. Zhang, S.-M., C. M. Adema, T. B. Kepler, and E. S. Loker. 2004. Diversificationof Ig superfamily genes in an invertebrate. Science 305: 251–254.

7. Hanington, P. C., and S.-M. Zhang. 2011. The primary role of fibrinogen-related proteins in invertebrates is defense, not coagulation. J. Innate Immun.3: 17–27.

8. Dishaw, L. J., T. Ota, M. G. Mueller, J. P. Cannon, R. N. Haire, N. R. Gwatney,R. T. Litman, and G. W. Litman. 2010. The basis for haplotype complexity inVCBPs, an immune-type receptor in amphioxus. Immunogenetics 62: 623–631.

9. Dishaw, L. J., M. G. Mueller, N. Gwatney, J. P. Cannon, R. N. Haire,R. T. Litman, C. T. Amemiya, T. Ota, L. Rowen, G. Glusman, and G. W. Litman.2008. Genomic complexity of the variable region-containing chitin-bindingproteins in amphioxus. BMC Genet. 9: 78.

10. Smith, L. C. 2012. Innate immune complexity in the purple sea urchin: diversityof the Sp185/333 system. Front. Immunol. 3: 70.

11. Rast, J. P., Z. Pancer, and E. H. Davidson. 2000. New approaches towards an un-derstanding of deuterostome immunity. Curr. Top. Microbiol. Immunol. 248: 3–16.

12. Nair, S. V., H. Del Valle, P. S. Gross, D. P. Terwilliger, and L. C. Smith. 2005.Macroarray analysis of coelomocyte gene expression in response to LPS in thesea urchin. Identification of unexpected immune diversity in an invertebrate.Physiol. Genomics 22: 33–47.

13. Smith, L. C., L. Chang, R. J. Britten, and E. H. Davidson. 1996. Sea urchin genesexpressed in activated coelomocytes are identified by expressed sequence tags.Complement homologues and other putative immune response genes suggestimmune system homology within the deuterostomes. J. Immunol. 156: 593–602.

14. Dheilly, N. M., D. Birch, S. V. Nair, and D. A. Raftos. 2011. Ultrastructurallocalization of highly variable 185/333 immune response proteins in the coe-lomocytes of the sea urchin, Heliocidaris erythrogramma. Immunol. Cell Biol.89: 861–869.

15. Buckley, K. M., and L. C. Smith. 2007. Extraordinary diversity among membersof the large gene family, 185/333, from the purple sea urchin, Strongylocentrotuspurpuratus. BMC Mol. Biol. 8: 68.

16. Buckley, K. M., S. Munshaw, T. B. Kepler, and L. C. Smith. 2008. The 185/333gene family is a rapidly diversifying host-defense gene cluster in the purple seaurchin Strongylocentrotus purpuratus. J. Mol. Biol. 379: 912–928.

17. Ghosh, J., K. M. Buckley, S. V. Nair, D. A. Raftos, C. Miller, A. J. Majeske,T. Hibino, J. P. Rast, M. Roth, and L. C. Smith. 2010. Sp185/333: a novel familyof genes and proteins involved in the purple sea urchin immune response. Dev.Comp. Immunol. 34: 235–245.

18. Terwilliger, D. P., K. M. Buckley, D. Mehta, P. G. Moorjani, and L. C. Smith. 2006.Unexpected diversity displayed in cDNAs expressed by the immune cells of thepurple sea urchin, Strongylocentrotus purpuratus. Physiol. Genomics 26: 134–144.

19. Miller, C. A., K. M. Buckley, R. L. Easley, and L. C. Smith. 2010. An Sp185/333gene cluster from the purple sea urchin and putative microsatellite-mediatedgene diversification. BMC Genomics 11: 575.

20. Terwilliger, D. P., K. M. Buckley, V. Brockton, N. J. Ritter, and L. C. Smith.2007. Distinctive expression patterns of 185/333 genes in the purple sea urchin,Strongylocentrotus purpuratus: an unexpectedly diverse family of transcripts inresponse to LPS, b-1,3-glucan, and dsRNA. BMC Mol. Biol. 8: 16.

21. Buckley, K. M., D. P. Terwilliger, and L. C. Smith. 2008. Sequence variations in185/333 messages from the purple sea urchin suggest posttranscriptional mod-ifications to increase immune diversity. J. Immunol. 181: 8585–8594.

22. Dheilly, N. M., S. V. Nair, L. C. Smith, and D. A. Raftos. 2009. Highly variableimmune-response proteins (185/333) from the sea urchin, Strongylocentrotuspurpuratus: proteomic analysis identifies diversity within and between individ-uals. J. Immunol. 182: 2203–2212.

23. Brockton, V., J. H. Henson, D. A. Raftos, A. J. Majeske, Y. O. Kim, andL. C. Smith. 2008. Localization and diversity of 185/333 proteins from thepurple sea urchin—unexpected protein-size range and protein expression ina new coelomocyte type. J. Cell Sci. 121: 339–348.

24. Smith, L. C., J. Ghosh, K. M. Buckley, L. A. Clow, N. M. Dheilly, T. Haug,J. H. Henson, C. Li, C. M. Lun, A. J. Majeske, et al. 2010. Echinoderm im-munity. Adv. Exp. Med. Biol. 708: 260–301.

25. Edds, K. T. 1993. Cell biology of echinoid coelomocytes: I. Diversity andcharacterization of cell types. J. Invert. Biol. 61: 173–178.

26. Henson, J. H., D. Nesbitt, B. D. Wright, and J. M. Scholey. 1992. Immunolo-calization of kinesin in sea urchin coelomocytes. Association of kinesin withintracellular organelles. J. Cell Sci. 103: 309–320.

27. Henson, J. H., T. M. Svitkina, A. R. Burns, H. E. Hughes, K. J. MacPartland,R. Nazarian, and G. G. Borisy. 1999. Two components of actin-based retrogradeflow in sea urchin coelomocytes. Mol. Biol. Cell 10: 4075–4090.

28. Gross, P. S., L. A. Clow, and L. C. Smith. 2000. SpC3, the complement ho-mologue from the purple sea urchin, Strongylocentrotus purpuratus, is expressedin two subpopulations of the phagocytic coelomocytes. Immunogenetics 51:1034–1044.

29. Majeske, A. J., T. Oleksyk, and L. C. Smith. 2013. The Sp185/333 immuneresponse genes and proteins are expressed in cells dispersed within all majororgans of the adult purple sea urchin. Innate Immun. 19: 569–587.

30. Hyman, L. H. 1955. The Invertebrates: Echinodermata, the Coelomate Bilateria,Vol. IV. McGraw-Hill, New York.

31. Clow, L. A., P. S. Gross, C. S. Shih, and L. C. Smith. 2000. Expression of SpC3,the sea urchin complement component, in response to lipopolysaccharide. Im-munogenetics 51: 1021–1033.

32. Smith, L. C., R. J. Britten, and E. H. Davidson. 1995. Lipopolysaccharideactivates the sea urchin immune system. Dev. Comp. Immunol. 19: 217–224.

33. Hillier, B. J., and V. D. Vacquier. 2003. Amassin, an olfactomedin protein,mediates the massive intercellular adhesion of sea urchin coelomocytes. J. CellBiol. 160: 597–604.

34. Smith, L. C., R. J. Britten, and E. H. Davidson. 1992. SpCoel1: a sea urchinprofilin gene expressed specifically in coelomocytes in response to injury. Mol.Biol. Cell 3: 403–414.

35. Pfaffl, M. W. 2001. A new mathematical model for relative quantification in real-time RT-PCR. Nucleic Acids Res. 29: e45.

36. Sambrook, J., E. F. Frotsch, and T. Maniatas. 1989. Molecular Cloning: ALaboratory Manual. Cold Spring Harbor Laboratory, Cold Spring Harbor, NY.

37. Majeske, A. J., C. J. Bayne, and L. C. Smith. 2013. Aggregation of sea urchinphagocytes is augmented in vitro by lipopolysaccharide. PLoS ONE 8: e61419.

38. Guerinot, M. L., P. A. West, J. V. Lee, and R. R. Colwell. 1982. Vibrio diazo-trophicus sp. nov., a marine nitrogen-fixing bacterium. Int. J. Syst. Bacteriol. 32:350–357.

39. DeLong, E. F. 2001. Microbial seascapes revisited. Curr. Opin. Microbiol. 4:290–295.

The Journal of Immunology 5687

at George W

ashington University M

edical Center L

ibrar on Novem

ber 21, 2014http://w

ww

.jimm

unol.org/D

ownloaded from

40. Massana, R., L. Guillou, B. Dıez, and C. Pedros-Alio. 2002. Unveiling theorganisms behind novel eukaryotic ribosomal DNA sequences from the ocean.Appl. Environ. Microbiol. 68: 4554–4558.

41. Smith, L. C., and E. H. Davidson. 1992. The echinoid immune system and thephylogenetic occurrence of immune mechanisms in deuterostomes. Immunol.Today 13: 356–362.

42. Ferrandon, D., J. L. Imler, C. Hetru, and J. A. Hoffmann. 2007. The Drosophilasystemic immune response: sensing and signalling during bacterial and fungalinfections. Nat. Rev. Immunol. 7: 862–874.

43. Ganesan, S., K. Aggarwal, N. Paquette, and N. Silverman. 2011. NF-kB/Relproteins and the humoral immune responses of Drosophila melanogaster.Curr. Top. Microbiol. Immunol. 349: 25–60.

44. Huang, S., S. Yuan, L. Guo, Y. Yu, J. Li, T. Wu, T. Liu, M. Yang, K. Wu, H. Liu,et al. 2008. Genomic analysis of the immune gene repertoire of amphioxus revealsextraordinary innate complexity and diversity. Genome Res. 18: 1112–1126.

45. Buckley, K. M., and J. P. Rast. 2012. Dynamic evolution of Toll-like receptormultigene families in echinoderms. Front. Immunol. 3: 136.

46. Wang, X., G. Li, Y. Yang, W. Wang, W. Zhang, H. Pan, P. Zhang, Y. Yue, H. Lin,B. Liu, et al. 2012. An RNA architectural locus control region involved in Dscammutually exclusive splicing. Nat. Commun. 3: 1255.

47. Kreahling, J. M., and B. R. Graveley. 2005. The iStem, a long-range RNAsecondary structure element required for efficient exon inclusion in the Dro-sophila Dscam pre-mRNA. Mol. Cell. Biol. 25: 10251–10260.

48. Dong, Y., H. E. Taylor, and G. Dimopoulos. 2006. AgDscam, a hypervariableimmunoglobulin domain-containing receptor of the Anopheles gambiae innateimmune system. PLoS Biol. 4: e229.

49. Zhang, S. M., Y. Zeng, and E. S. Loker. 2008. Expression profiling and bindingproperties of fibrinogen-related proteins (FREPs), plasma proteins from theschistosome snail host Biomphalaria glabrata. Innate Immun 14: 175–189.

50. Adema, C. M., L. A. Hertel, R. D. Miller, and E. S. Loker. 1997. A family offibrinogen-related proteins that precipitates parasite-derived molecules is producedby an invertebrate after infection. Proc. Natl. Acad. Sci. USA 94: 8691–8696.

51. Hanington, P. C., M. A. Forys, J. W. Dragoo, S.-M. Zhang, C. M. Adema, andE. S. Loker. 2010. Role for a somatically diversified lectin in resistance of aninvertebrate to parasite infection. Proc. Natl. Acad. Sci. USA 107: 21087–21092.

52. Hibino, T., M. Loza-Coll, C. Messier, A. J. Majeske, A. H. Cohen,D. P. Terwilliger, K. M. Buckley, V. Brockton, S. V. Nair, K. Berney, et al. 2006.The immune gene repertoire encoded in the purple sea urchin genome. Dev. Biol.300: 349–365.

53. Rast, J. P., L. C. Smith, M. Loza-Coll, T. Hibino, and G. W. Litman. 2006.Genomic insights into the immune system of the sea urchin. Science 314: 952–956.

54. Loker, E. S., C. M. Adema, S.-M. Zhang, and T. B. Kepler. 2004. Invertebrateimmune systems—not homogeneous, not simple, not well understood. Immunol.Rev. 198: 10–24.

55. Tonegawa, S. 1983. Somatic generation of antibody diversity. Nature 302: 575–581.

56. Boehm, T., N. McCurley, Y. Sutoh, M. Schorpp, M. Kasahara, and M. D. Cooper.2012. VLR-based adaptive immunity. Annu. Rev. Immunol. 30: 203–220.

57. Rodriguez, I. 2013. Singular expression of olfactory receptor genes. Cell 155:274–277.

58. Cichocki, F., J. S. Miller, and S. K. Anderson. 2011. Killer immunoglobulin-likereceptor transcriptional regulation: a fascinating dance of multiple promoters. J.Innate Immun. 3: 242–248.

59. Malecek, K., V. Lee, W. Feng, J. L. Huang, M. F. Flajnik, Y. Ohta, and E. Hsu.2008. Immunoglobulin heavy chain exclusion in the shark. PLoS Biol. 6: e157.

60. Massana, R., A. E. Murray, C. M. Preston, and E. F. DeLong. 1997. Verticaldistribution and phylogenetic characterization of marine planktonic Archaea inthe Santa Barbara Channel. Appl. Environ. Microbiol. 63: 50–56.

61. Ebert, T. A. 1967. Negative growth and longevity in the purple sea urchinStrongylocentrotus purpuratus (Stimpson). Science 157: 557–558.

62. Ebert, T. 2010. Demographic patterns of the purple sea urchin Strongylocentrotuspurpuratus along a latitudinal gradient, 1985–1987. Mar. Ecol. Prog. Ser. 406:105–120.

5688 PHAGOCYTES EXPRESS A SINGLE Sp185/333 MESSAGE SEQUENCE

at George W

ashington University M

edical Center L

ibrar on Novem

ber 21, 2014http://w

ww

.jimm

unol.org/D

ownloaded from

Supplemental Fig. I. Negative control reactions for nested RT-PCR.

Templates were omitted in preliminary reactions to evaluate the level of DNA

contamination in any of the reagents that would support PCR. Water replaced

the template for the nested RT-PCR, which was normally 1-2 ml of the

amplicons generated by the external Sp185/333 primers (not shown). The

negative nested PCR control was amplified with the four pairs of internal

primers (1-4, see legend to Fig. 5). A similar set of reactions was carried out

using water as the template with the external SpL8 primers (not shown)

followed by nested PCR with the internal SpL8 (L8) primers. The negative

controls demonstrated that no contaminant templates were present that would

produce false positive amplicons when analyzing cDNA templates from single

cell samples. When contaminants were identified in the negative control

reactions, the reagents were not used to amplify single cell cDNAs. One

example of a set of nested negative controls is shown. Size standards (M, kB)

are shown to the right. The ladder was run on the same gel, and in formatting

the image, the marker lane was moved to the left by five lanes while

maintaining the orientation with the wells.

2.0

1.0

0.5

0.2

1 2 3 4 L8 M

Supplemental Table I. Primers used in nested RT-PCR, qPCR and sequencing Primer Sequence

3 Annealing

Temperature

Sp185/333

External

Primers1

5’UTR

3’UTR

YTDTAGCATCGCAGAKACCT

WAATTCTACACCTCRGCGAC 55oC

Sp185/333

Internal

Primers2

in5.1

in5.2

in5.3

in3.1

in3.2

AGAAGACCTATTACTAYCATGGAG

AGAGACCTATTACTAYCATGGTG

AKACCTTACWAACATGGAGGTG

CGACCACATTGAYGTCTTCTT

ACATCATTGATCGCGATCTCG

62oC

SpL8 External

Primers

SpL8F

SpL8R

GCACGAGGTCACCAT

ACTCCTTCCAACTAAATCAAATG 54

oC

SpL8 Internal

Primers

SpL8Flong

SpL8Rlong

CAGCGTAAGGGAGCGGGAAGCGTCTT

GTTTGCCGCAGAAGATGAACTGTCCCGTGTA 62

oC

Sp185/333

Intron

Identification

LF

R2

TSTGGCTGYTCTTGCTATCTC

CATTCCACCRGGCCTTCCTC 62oC

Sequencing

Primers

F2

R9

AAGMGATTWCAATGAACKRCGAG

CTTHARGTGGTGAARATGTCG 55

oC

qPCR primers F5

SL8F

ASL8

GGAACYGARGAMGGATCTC

CACAACAAGCACAGGAAGGGA

AGCGTAGTCGATGGATCGGAGT

59oC

1External primers to amplify Sp185/333 cDNAs were designed based on the Sp185/333 EST

sequences from Nair et al. (13). 2Internal primers for Sp185/333 sequences were designed based on the Sp185/333 cDNA

sequences from Terwilliger et al. (20). 3See Terwilliger et al. (20) for details of primers that amplify Sp185/333 sequences. IUPAC

nucleotide code is used here to designate degenerate positions.

Sp185/333 primer positions

The positions of the primers used to generate the Sp185/333 amplicons from single cell

samples are shown on a prepresentative gene. The gene structure also indicates the amplicon

generated from LF to R2 from contaminating gDNA (see Fig. 6).

Supplemental Table II. Summary of single cell nested RT-PCR results

Animal

Dilutions

for cell

samples1

Cell

Type2

Samples

analyzed

Samples

that

amplifed

SpL84

SpL8+ samples

that amplified

Sp185/333

11

1X P, S 8 6 4

2X P, S 4 4 2

4X P, S 8 8 1

10X P, S 10 3 0

1X D, S nd3 nd nd

2X D, S 4

4 0

4X D, S 8 8 1

10X D, S 10 2 1

17

1X P, S 8 8 4

2X P, S 8 8 3

4X P, S 8 8 2

10X P, S 391 19 10

1X D, S nd nd nd

2X D, S 4 4 0

4X D, S 85 4 2

10X D, S 10 0 0

26

1X P, S 8 8 3

2X P, S 6 6 4

4X P, S 4 4 0

10X P, S 391 6 2

1X D, S nd nd nd

2X D, S 6 5 0

4X D, S 45 3 1

10X D, S 10 0 0

Totals 1X P, S 24 22 11

2X P, S 18 18 9

4X P, S 20 20 3

10X P, S 881 28 12

1X D, S nd nd 0

2X D, S 14 13 0

4X D, S 205 15 4

10X D, S 30 2 1

Overall 214 118 40 1Initial cell counts established an initial estimate of 1 cell/sample based on serial dilutions.

Subsequent dilutions more likely resulted in a single cell per sample (see Table II). 2P, Polygonal phagocytes; S, Small phagocytes; D; Discoidal phagocytes

3nd, not done or no data collected

4SpL8 is a homologue of human ribosomal L8.

5Includes the two samples for which SpL8 amplification failed, but did amplify Sp185/333 (see

Fig. 5; animal 17, sample F3; animal 26, sample H7).

Supplemental Table III. Single cell messages match known Sp185/333 element patterns

1Sample names are taken from Fig. 5 and denote in order: animal number, cell sample number or letter/number,

internal nested primer set (1-4; see legend to Fig. 5). 2Sequencing primers are listed in Supplemental Table I. Consensus sequence was generated from amplicons

sequenced with both primers F2 and R9. 3Element patterns for cDNAs are reported in Terwilliger et al. (18, 20), and element patterns for genes are reported

in Buckley and Smith (15). 4Clone name and GenBank accession number of the closest BLASTp match.

5The amplicon sequence shows a block of 5 to 12 amino acids that is not present in the best match.

aa, amino acid

Sample1

GenBank

accession

number

Sequencing

Primers2

Nucleotide

Length

aa

Length

% Query

aa cover

Element

pattern3

GenBank Best

match4

% aa

identity to

best protein

match

17-5-1 KJ408449 F2+R9 951 275 100 E2 2-2414, ABK88455 100

17-5-2 KJ408450 F2+R9 848 271 100 E2 Sp0120, ABA19533 99

17-5-3 KJ408451 F2+R9 934 268 99 E2 2-2414, ABK88455 99

17-5-4 KJ408452 F2+R9 884 218 100 E2 8-2413, ABK88416 99

17-6-1 KJ408453 F2+R9 850 282 98 E2 Sp0120, ABA19533 99

17-9-2 KJ408454 F2 776 247 98 E2 9-1508, ABK88605 99

17-9-3 KJ408455 F2 798 248 100 E2 2-2413, ABK88674 97

17-9-4 KJ408456 F2 781 247 98 E2 9-1508, ABK88605 99

17-A10-1 KJ408457 F2 776 247 99 E2 9-1508, ABK88605 99

17-A10-2 KJ408458 F2 775 245 98 E2 1-2436, ABK88816 98

17-A10-3 KJ408459 F2 798 246 99 E2 9-1508, ABK88605 99

17-A10-4 KJ408460 F2 782 245 98 E2 6-2414, ABK88674 96

17-E6-3 KJ408461 F2+R9 1190 359 100 G2 10-010, ABR22323 98

17-E6-4 KJ408462 F2+R9 1182 385 95 G2-like5 10-010, ABR22323 96

17-D8-1 KJ408463 F2 813 271 95 A6 9-1525, ABK88577 100

17-D8-2 KJ408464 F2 883 294 88 A6 9-1525, ABK88577 100

17-D8-3 KJ408465 F2 910 291 88 A6 9-1525, ABK88577 99

17-D8-4 KJ408466 F2 909 300 86 A6 9-1525, ABK88577 99

11-6-3 KJ408467 F2+R9 706 216 90 A1-like5 2-034, ABR22410 96

11-6-4 KJ408468 F2+R9 731 169 100 A1-like5 2-034, ABR22410 95

11-B8-1 KJ408469 F2 740 235 97 A6 9-1525, ABK88577 97

11-B8-2 KJ408470 F2 632 76 98 O1 Sp0126, ABA19611 93

11-B8-3 KJ408471 F2 606 199 92 A6 9-1525, ABK88577 100

26-H6-1 KJ408472 F2 774 256 98 C5 4-1536, ABR22474 99

26-H6-2 KJ408473 F2 755 251 98 C5 4-1536, ABR22474 99

26-7-1 KJ408474 F2 820 251 98 E2 2-2413, ABK88674 99

26-7-2 KJ408475 F2 723 251 98 E2 2-2413, ABK88674 99

26-7-3 KJ408476 F2 761 253 97 E2 2-2414, ABK88455 100

26-7-4 KJ408477 F2 783 251 98 E2 2-2413, ABK88674 99