Sv

JD

ARRAA

KVPPTEC

1

qtvrestDfabtPr

uts

7

(

0h

Journal of Virological Methods 189 (2013) 250– 257

Contents lists available at SciVerse ScienceDirect

Journal of Virological Methods

jou rn al hom epage: www.elsev ier .com/ locate / jv i romet

imilar concentration and extraction recoveries allow for use of turnip crinkleirus as a process control for enteroviruses in water

ennifer Gentry-Shields ∗, Jill R. Stewartepartment of Environmental Sciences and Engineering, Gillings School of Global Public Health, University of North Carolina, Chapel Hill, NC 27599-7431, USA

rticle history:eceived 28 October 2012eceived in revised form 21 February 2013ccepted 25 February 2013vailable online 4 March 2013

eywords:irus

a b s t r a c t

Enteric viruses are etiological agents of waterborne disease that may be detected using moleculartechniques such as PCR. However, processing water samples in preparation for PCR typically involvesconcentration of samples and extraction of nucleic acids, steps that have low and variable recovery effi-ciencies. This study evaluated a plant virus, turnip crinkle virus (TCV), for its ability to serve as a processcontrol for human enteroviruses during concentration and extraction procedures. Enteroviruses and TCVhave similar sizes and morphologies, and both contain single stranded, positive-sense RNA genomes.Results from the study demonstrate that the tested viruses experience similar losses during sample pro-

CRrocess controlurnip crinkle virusnterovirusoncentration efficiency

cessing. Virus recoveries averaged 0.03% for EV and 0.02% for TCV from DI water, and 0.004% for EV and0.009% for TCV from a creek sample. Surface water and wastewater samples from around the U.S. wereevaluated for the presence of TCV to ensure the virus is not present in environmental samples. All werenegative. With similar recovery efficiencies to EV, TCV may be a suitable process control for enterovirusesin environmental water samples in the U.S. Use of process controls as proposed in this study would allow

titat

better detection and quan

. Introduction

Waterborne enteric viruses have been historically difficult touantify, in part due to the relatively low densities of viruses inhe environment and the lack of cell culture systems to grow mostiruses. Modern molecular techniques such as polymerase chaineaction (PCR) now offer powerful tools for rapid detection of manynteric viruses in water. Avoiding the need for cultivation, PCR canave both time and expenses, and has the potential to be sensi-ive, inexpensive, quantitative, and amenable to automation (Santoomingo et al., 2007). Additionally, multiple assays can be per-

ormed using the same nucleic acid extractions. These extracts canlso be preserved for future analyses should more sensitive assaysecome available. However, loss during concentration and extrac-ion procedures and/or inefficient reverse transcription (RT) andCR can result in an underestimation of virus load or false negativeesults.

To ensure accurate quantitation and interpretation of molec-

lar data for RNA viruses in water matrices, controls are neededo determine the efficiency of various detection steps, includingample concentration, nucleic acid extraction, and RT-PCR (Girones

∗ Corresponding author at: 313 Schaub Hall, 400 Dan Allen Drive, Campus Box642, Raleigh, NC 27695, USA. Tel.: +1 919 515 3558; fax: +1 919 513 0014.

E-mail addresses: jen shields@ncsu.edu (J. Gentry-Shields), jill.stewart@unc.eduJ.R. Stewart).

166-0934/$ – see front matter © 2013 Elsevier B.V. All rights reserved.ttp://dx.doi.org/10.1016/j.jviromet.2013.02.013

ion methods to be employed in water quality monitoring.© 2013 Elsevier B.V. All rights reserved.

et al., 2010; Santo Domingo et al., 2007; Stewart et al., 2008; USEPA,2007; Wuertz et al., 2011). A commonly utilized exogenous con-trol recommended by the U.S. Environmental Protection Agency(USEPA) for measuring DNA extraction efficiency and PCR inhibi-tion is salmon sperm DNA (Haugland et al., 2005; USEPA, 2007);however, this DNA control may be more appropriate for bacte-rial (DNA) targets than for RNA viruses. Nucleic acid amplificationcontrols have been similarly developed to quantify the RT-PCR effi-ciency of viruses (e.g., Gregory et al., 2006, 2010; Hata et al., 2011),as well as to quantify the recovery efficiency of viral nucleic acidsduring extraction procedures (Conn et al., 2011; Dreier et al., 2005;Hata et al., 2011; Mormann et al., 2010).

Only a few studies have attempted to quantify the recoveryefficiencies of concentration procedures utilizing viral process con-trols. Da Silva et al. (2007) utilized mengovirus as a process controlfor norovirus in wastewater. Mengovirus is recommended as a con-trol for norovirus and hepatitis A virus in food matrices in Europe,but this virus is not available in the U.S. A bacteriophage of Pseu-domonas aeruginosa, PP7, has been used as a process control forviruses in water quality studies (Poma et al., 2012; Rajal et al.,2007b). However, P. aeruginosa is a common bacterium, ubiquitousin soil and water and also found on human skin. Therefore, PP7 maynot be suitable for studies involving environmental surface waters

and wastewaters. Another possible control is engineered alterna-tives, including armored RNA, which have been utilized as processcontrols in clinical and environmental samples (Beld et al., 2004;Bressler and Nolte, 2004; Drosten et al., 2001; Eisler et al., 2004).

of Viro

Thaiabtvipio

fwwiepsMlRaea2csaaatUa

2

2

2

oTa

rwcf1o5t1duvfw7wapI

J. Gentry-Shields, J.R. Stewart / Journal

he benefits of armored RNA controls include safety and stability;owever, only a limited number of armored RNA controls are avail-ble commercially, and the procedure for producing these controlss expensive and labor-intensive. Natural viruses may be a betterlternative to armored RNA controls for use as viral process controlsecause they would better mimic natural viruses during extrac-ion and concentration procedures. At present, there are no naturaliruses available in the U.S. that have been evaluated for their sim-larity to target viruses during processing and evaluated for theirresence in native samples. Yet proven viral process controls are

mperative for enhancing the detection and accurate quantitationf enteric viruses from water matrices.

The goal of this study was to evaluate turnip crinkle virus (TCV)or use as a process control when measuring enteroviruses fromater. TCV belongs to the genus Carmovirus (family Tombusviridae),hich are non-enveloped virions with a 28–35 nm diameter and an

sometric nucleocapsid (icosahedral; T = 3) similar to many humannteric viruses. These plant viruses are easier and less expensive toroliferate and quantify than armored RNA while avoiding the labafety issues inherent to working with pathogenic animal viruses.oreover, plant viruses are beneficial because of their potentially

imited spreads. TCV consists of a positive sense, single-strandedNA genome of ∼ 4 kb with reported spreads only in the U.K.nd former Yugoslavia (Hollings and Stone, 2005). The recoveryfficiency of TCV was compared to the recovery of echovirus 12,

prototypical enterovirus (e.g., Gregory et al., 2006; Rajal et al.,007b; Viau et al., 2011), during concentration and extraction pro-edures. This comparison utilized the concentration of both viraltocks in terms of genome copies before spiking to allow for moreccurate comparison of recovery efficiencies. Salmon sperm DNA,

commonly utilized DNA control, was also included. Surface waternd wastewater samples were evaluated for TCV to help confirmhat this virus does not occur naturally in water samples in the.S. These contributions are intended to improve detection andccurate quantitation of enteric viruses from water samples.

. Materials and methods

.1. Standards

.1.1. Echovirus 12 and turnip crinkle virusA stock of echovirus 12 (EV) was obtained from the laboratory

f Mark Sobsey at the University of North Carolina at Chapel Hill.he stock was quantified using a plaque assay with FRhK-4 cellsnd had a titer of 1.23 × 109 PFU/ml.

A stock of turnip crinkle virus (TCV) was obtained from the labo-atory of Steve Lommel at North Carolina State University. The virusas propagated on Nicotiana benthamiana plants under greenhouse

onditions for 7 days and was purified from leaf tissue as describedor CarMV (Lommel et al., 1982) with a few modifications. Briefly,00 g of infected leaves were homogenized in a blender with 400 mlf extraction buffer containing 0.2 M sodium acetate buffer, pH.2, 0.1% �-mercaptoethanol, and water. The extract was filteredhrough four layers of cheesecloth and centrifuged at 11,000 × g for5 min in a Sorvall GSA rotor (Thermo Scientific, Asheville, NC) thenecanted through Miracloth (Thermo Fisher Scientific Remel Prod-cts, Lenexa, KS). Four volumes of supernatant were mixed with oneolume of 40% polyethylene glycol (PEG 6000) in 1 M NaCl, stirredor 1 hr at 0 ◦C, and centrifuged at 11,000 × g for 15 min. The pelletas re-suspended in 100 ml of 20 mM sodium phosphate buffer, pH

.4–7.6, and centrifuged at 11,000 × g for 15 min. The supernatant

as purified further by two cycles of differential centrifugation

nd fractionation on linear log sucrose gradients in 20 mM sodiumhosphate, pH 7.5, for 2 hr in a 70 Ti rotor (Beckman Coulter,

nc., Indianapolis, IN) at 5 ◦C at 47 K and 52 K, respectively. After

logical Methods 189 (2013) 250– 257 251

each centrifugation, the pellet was re-suspended in 1 ml of 20 mMsodium phosphate buffer and stored at 4 ◦C overnight. The samplewas then vortexed and centrifuged at max speed (27,000 × g) for15 min. The supernatant was collected and stored at 4 ◦C overnightor until use. An absorbance at 260 nm of a 10−2 dilution of TCV wasmeasured using a NanoDrop 2000c spectrophotometer (ThermoFisher Scientific Remel Products), and the viral concentration wasdetermined using Equation 1.

Virus concentration (mg/ml) = A260 ∗ 100Virus Extinction Coefficient

(1)

The virus concentration was converted to viruses/ml using amolecular weight of 8.5*106 daltons for a final concentration of4.84 × 1015 viruses/ml.

A serial dilution was created of both EV and TCV using PCR-gradenuclease-free water and was stored at 4 ◦C.

2.1.2. Viral RNA standardsViral RNA was extracted from the EV stock using the RNeasy Mini

Kit (Qiagen, Valencia, CA). RNA was eluted into 30 �l of nuclease-free water and was reverse-transcribed using the RNA PCR CoreKit (Applied Biosystems, Foster City, CA) with random hexamersaccording to the manufacturer’s directions. The cDNA was PCRamplified with primers EchoFwd and EchoRev, targeting the 5′ non-translated region of the enterovirus genome (Table 1). The PCRmixture contained 20 �l of the reverse transcription reaction, eachprimer at a concentration of 150 nM, 2 mM of MgCl2, 8 �l of 10XPCR Buffer II, 0.5 �l of AmpliTaq DNA Polymerase, and nuclease-free water for a total reaction mixture of 100 �L (RNA PCR Core kit).The reaction mixture was assayed on an Eppendorf MasterCyclergradient (Eppendorf, Hamburg, Germany) using the following con-ditions: (i) 2 min at 95 ◦C, (iii) 35 cycles of 1 min at 95 ◦C and 1 minat 60 ◦C, and (iii) a final extension of 7 min at 72 ◦C. The double-stranded DNA product was quantified using a PicoGreen Kit (LifeTechnologies, Grand Island, NY) and a Nanodrop ND-3300 Fluores-cent Spectrophotometer (Thermo Fisher Scientific Remel Products).The quantified DNA was converted to copies/ml, assuming one RNAcopy per genome.

A solution of purified DNA plasmid containing the entire TCVgenome was obtained from the laboratory of Steve Lommel atNorth Carolina State University. The plasmid was quantified usinga PicoGreen Kit and Nanodrop ND-3300 Fluorescent Spectropho-tometer. The quantified DNA was converted to copies/ml, assumingone DNA copy per genome.

A 10-fold serial dilution was created for both EV and TCV DNA,and both were subjected to RT-qPCR using specific primers andprobes (Table 1). The RT-qPCR mixture for both viruses contained2 �l of sample, each primer at a concentration of 500 nM, each probemixture at a concentration of 120 nM, 12.5 �l of 2X RT-PCR buffer,0.3 �l of 25X RT-PCR enzyme mix, and nuclease-free water for atotal reaction mixture of 25 �l (Quantitect Probe RT-PCR kit). Thereaction mixture was subjected to a one-step assay on a CepheidSmartCycler (Sunnyvale, CA) using the following conditions: (i) RTfor 30 min at 50 ◦C, (ii) 15 min at 95 ◦C, (iii) 45 cycles of 15 s at 94 ◦Cand 1 min at 60 ◦C. All concentration standards were amplified induplicate.

2.1.3. Salmon sperm DNA standardSalmon sperm DNA (SKETA) was obtained from the laboratory

of Rachel Noble at the University of North Carolina at ChapelHill. The DNA was quantified previously at a concentration of10 �g/ml. A serial dilution of SKETA was created with nuclease-

free water and was subjected to qPCR with TaqMan primer andprobe sequences as described by Haugland et al. (2005). The qPCRmixture contained 2 �l of sample, each primer at a concentrationof 500 nM, the probe at a concentration of 120 nM, 12.5 �l of 2X

252 J. Gentry-Shields, J.R. Stewart / Journal of Virological Methods 189 (2013) 250– 257

Table 1Primer and probe identities, target genes, sequences, and amplicon lengths for RT-qPCR assays used in this study.

Primer/probe Target Sequence (5′-3′) Size (nt) Source

EV1F Enteroviruses CCCTGAATGCGGCTAAT 143 Gregory et al. (2006)EV1R TGTCACCATAAGCAGCCAEV probe [FAM]ACGGACACCCAAAGTAGTCGGTTC[BHQ-1]EchoFwd Echovirus 12 GCGTTTCGCTCCGCACAACC 509 This studyEchoRev CAGGCCAGTCTCGTGTGCCC

GTCCTTGACCCCAAT

P2ocawt

2

2a

dqccopottfiaaw(teRsS

2c

oscswov

2

cca

X

X

o

TCV-F Turnip Crinkle Virus CCTCTGACTTCTCGTCV-R CTGCTCCTCAGTTGTCV-Probe [FAM]AGGTAGTGT

CR buffer, and nuclease-free water for a total reaction mixture of5 �L (Quantitect Probe PCR kit). The reaction mixture was assayedn a Cepheid SmartCycler (Sunnyvale, CA) using the followingonditions: (i) 2 min at 50 ◦C, (ii) 15 min at 95 ◦C, (iii) 45 cycles of 1 st 95 ◦C and 1 min at 50 ◦C. A 5-point standard curve of SKETA DNAas used for quantitation. For this, SKETA DNA was diluted serially

o give a range of DNA from 20 ng to 0.1 ng of SKETA DNA per 2 �l.

.2. Viral RNA extraction experiments

.2.1. Spiking of samples with preliminary viral concentrationnd RNA extraction

Sterile 47-mm, 0.45-�m mixed cellulose filters (Type HAWP,enoted as HA; Millipore Corp., Bedford, MA) were folded intouarters and placed aseptically into four 2-ml screw-cap tubesontaining an equal mix (0.15 g/0.15 g) of 0.5 mm and 0.1 mm zir-onia/silica beads (BioSpec Products, Inc., Bartlesville, OK). One mlf Buffer RLT (Qiagen RNeasy Plant Mini Kit) modified to contain 2%olyvinylpyrrolidone-40 (Calbiochem, Bloomington, IN) and 10 �lf �-mercaptoethanol (Fisher Scientific, Pittsburgh, PA) was addedo each tube. EV was added to three of the tubes at a final concentra-ion of 1.23 × 105 PFU/ml, and TCV was added to the same tubes at anal concentration of 1.0 × 108 viruses/ml. One tube was also useds a negative extraction control. Salmon sperm DNA (SKETA) wasdded to all tubes at a concentration of 100 ng DNA/ml. Nucleic acidas extracted from all samples using a Qiagen RNeasy Plant Mini Kit

Valencia, CA) following a modified plant and fungi isolation pro-ocol as described previously (Conn et al., 2011). Nucleic acid wasluted into 100 �l nuclease-free water and stored at -80 ◦C beforeT-qPCR analysis for TCV and EV as described in Section 2.1.2. Theamples were also analyzed for SKETA with qPCR as described inection 2.1.3.

.2.2. Spiking of extraction samples with secondary viraloncentration

To estimate the stock viral concentrations of TCV and EV in termsf genome copies, a second set of triplicate extraction tubes waspiked with the recovered concentrations of EV and TCV (in genomeopies/ml) estimated using RT-qPCR in Section 2.2.1. Three 2-mlcrew-cap tubes containing an HA filter and zirconia/silica beadsere spiked with 1.23 × 108 PFU/ml of EV and 1.2 × 107 viruses/ml

f TCV. A negative extraction control (containing no TCV or EViruses) was processed alongside the three samples.

.2.3. Determination of virus stock concentrationsTo determine the concentration of each virus stock in genome

opies/ml Equations 2 and 3 were applied using the recovered con-entrations determined from spiking experiments in Sections 2.2.1nd 2.2.2.

0 ∗ Ddil = Xa (2)

b ÷ Xa = Ddiff (3)

Where X0 = the initial spiked concentration (genome copies/ml)f viruses in Section 2.2.1; Xa = the viral concentration (genome

G 109 This studyAGGGCTG[BHQ-1]

copies/ml) detected by RT-qPCR from the first spiking experimentin Section 2.2.1 and the spiked concentration in 2.2.2; Xb = theviral concentration (genome copies/ml) detected by RT-qPCR in thesecond spiking experiment in Section 2.2.2; Ddil = dilution factorbetween the spiked virus concentrations in Sections 2.2.1 and 2.2.2;Ddiff = quotient between the recovered concentrations of virusesdetected in Sections 2.2.1 and 2.2.2. Using these formulas, the initialspiking concentrations of each virus could be converted to genomecopies/ml using Equation 4.

X0 = Xb

(Ddiff ∗ Ddil)(4)

An explanation for how these formulas were applied to deter-mine the initial spiking concentration (in genome copies/ml) isgiven below.

In the first spiking experiment, EV was spiked at a concentra-tion of 1.23 × 105 PFU/ml, and TCV was spiked at a concentration of1.0 × 108 viruses/ml in triplicate. The average recovered concentra-tion for EV was 4.2 × 106 genome copies/ml (coefficient of variation,CV, 43%; n = 9), and the average recovered concentration for TCVwas 1.2 × 107 genome copies/ml (CV, 17%; n = 9; Table 2). A secondset of triplicate samples was then spiked with 4.2 × 106 PFU/ml ofEV and 1.2 × 107 viruses/ml of TCV. The average recovered viral con-centrations were 1.3 × 108 genome copies/ml of EV (CV, 74%; n = 9)and 1.0 × 106 genome copies/ml of TCV (CV, 13%; n = 9; Table 2).Using the formulas above, the initial spiking concentration of eachvirus in genome copies/ml was determined to be 1.0 × 108 genomecopies/ml for TCV (CV, 13%) and 1.3 × 108 genome copies/ml for EV(CV, 74%). For TCV, the virus concentration in genome copies/mlwas equivalent to the concentration in viruses/ml (i.e., 1.0 × 108

viruses/ml = 1.0 × 108 genome copies/ml). For EV, the concentra-tion in genome copies/ml was approximately 3-logs higher than theconcentration that had been measured in PFU/ml (i.e., 1.23 × 105

PFU/ml = 1.3 × 108 genome copies/ml).

2.3. Viral concentration experiments

2.3.1. Virus concentration in deionized waterTo determine the concentration and extraction efficiencies of

each virus without PCR inhibitors, both viruses were spiked into aset of triplicate 250-ml deionized water samples at a concentrationof 1.9 × 107 genome copies/100 ml, using the stock concentrationsestimated in section 2.2. A fourth water sample was used as anegative control. All four water samples were filtered onto 47-mm diameter, 0.45-�m pore-size HA filters using a four-placefiltration manifold and vacuum pump assembly with filter fun-nels (Millipore). Filters were transferred aseptically into sterile2-ml screw-cap tubes and the RNA was extracted immediately asdescribed in Section 2.2.1 and analyzed by RT-qPCR in triplicate asdescribed in Section 2.1.2. The total amount of virus in each sample

was calculated with Equation 5.

Number of virus gene copies = N ∗ 1VT

∗ Vel

Vex−s∗ Vs (5)

J. Gentry-Shields, J.R. Stewart / Journal of Virological Methods 189 (2013) 250– 257 253

Table 2Viral concentrations used for spiking, recovered concentrations post-spiking, percent lost (% loss), and percent recovered (% recovered) for extraction and RT-qPCR of echovirus12 (EV), turnip crinkle virus (TCV), and salmon sperm DNA (SKETA) from 3 samples. PCR assays were run in triplicate for EV and TCV and duplicate for SKETA.

Organism Replicates Spiked Concentrationa Recovered Concentrationa % Loss % Recovered

EV 9 5.5 × 109 1.3 × 108 97.6 2.4CVb 0.7EV 9 1.3 × 108 4.2 × 106 96.8 3.2CV 0.4TCV 9 1.0 × 108 1.2 × 107 87.6 12.4CV 0.2TCV 9 1.2 × 107 1.0 × 106 91.5 8.5CV 0.1SKETA 8 1.0 × 102 1.5 × 101 85.3 14.7

a(t

2

esCwiRtomcw2

2

iHefi22iea

2

deoide

deolTIw

3.1. RT-qPCR efficiency

The amplification efficiency and slopes of the echovirus 12 (EV)and turnip crinkle virus (TCV) standard curves were similar (Figs. 1a

CV

a In genome copies/ml for EV and TCV or ng DNA/ml for SKETA.b CV = coefficient of variation.

Where V (ml) represents the volume of nucleic acid templatedded to the PCR mixture (VT), of concentrate that was extractedVex-s), of eluate from the nucleic acid extraction (Vel), and of theotal sample filtered (Vs).

.3.2. Virus concentration in an environmental water sampleTo determine the concentration and extraction efficiencies of

ach virus in water likely containing PCR inhibitors, each virus waspiked into water obtained from Morgan Creek in Chapel Hill, Northarolina, USA. The water was first tested to ensure the two virusesere not present by concentrating 250 ml onto an HA filter, extract-

ng the RNA, and analyzing for the presence of target viruses usingT-qPCR as described in Section 2.3.1. Both viruses were spiked intoriplicate 250-ml environmental water samples at a concentrationf 9.7 × 107 genome copies/100 ml, using the stock volumes esti-ated in section 2.2. A fourth water sample was used as a negative

ontrol. All four water samples were concentrated, and the RNAas extracted and analyzed with RT-qPCR in triplicate as in Section

.3.1.

.3.3. TCV detection in sewageThe ability to detect TCV in wastewater was determined by spik-

ng TCV into a wastewater sample obtained from a utility in Chapelill, North Carolina, USA. The influent sample was first tested tonsure TCV was not present by concentrating 100 ml onto an HAlter, extracting the RNA, and analyzing with RT-qPCR as in Section.3.1. TCV was then spiked into 100 ml sewage at a concentration of.4 × 109 genome copies/100 ml, using the stock volume estimated

n section 2.2. The sample was concentrated, and the RNA wasxtracted immediately and analyzed using RT-qPCR in triplicates described in Section 2.3.1.

.4. TCV detection in native samples

To determine whether TCV was present in surface waters fromisperse geographic locations in the U.S., various samples werexamined for the presence of TCV. Samples of 500 ml were shippedvernight on ice from Doheny Beach in Dana Point, CA; Lake Carrolln Tampa, FL; and South Shore Beach in Milwaukee, WI. Imme-iately upon arrival, 250 ml was concentrated, and the RNA wasxtracted and analyzed for TCV as described in Section 2.3.2.

To determine whether TCV was present in sewage influent fromisperse geographic locations in the U.S., various samples werexamined for the presence of TCV. Samples of 500 ml were shippedvernight on ice from one wastewater treatment utility near Oak-

and, CA; Tampa, FL; Milwaukee, WI; Chapel Hill, NC; Raleigh, NC;ucson, AZ; Columbus, OH; and two facilities near Santa Ana, CA.mmediately upon arrival, 100 ml was concentrated, and the RNA

as extracted and analyzed for TCV as described in Section 2.3.3.

0.7

2.5. Analysis

Percent recovery (% recovery) for each sample was calculated bydividing the average recovered concentration by the initial concen-tration (in genome copies/ml). An overall % recovery for each viruswas calculated by averaging the % recovered from all samples. Per-cent loss (% loss) was calculated by subtracting the % recovery from100%.

3. Results

Fig. 1. RT-qPCR standard curves for (a) enterovirus using an echovirus 12 DNAtranscript and (b) turnip crinkle virus using a turnip crinkle virus DNA plasmid.

254 J. Gentry-Shields, J.R. Stewart / Journal of Virological Methods 189 (2013) 250– 257

Table 3Viral concentrations used for spiking, recovered concentrations post-spiking, percent lost (% loss), and percent recovered (% recovered) for concentration in deionized water,extraction, and RT-qPCR of echovirus 12 (EV) and turnip crinkle virus (TCV) from 3 samples. RT-qPCR assays were run in triplicate.

Virus Replicates Spiked Concentrationa Recovered Concentrationa % Loss % Recovered

EV 9 1.9 × 107 6.5 × 103 99.97 0.03CVb 0.4TCV 9 1.9 × 107 3.8 × 103 99.98 0.02

afifrrds

3

spTEdNf

crw

3

cvsTd

ssTe(c

sofi

TVw

CV

a In genome copies/100 ml.b CV = coefficient of variation.

nd 1b). Both standard curves showed a high linearity, with a coef-cient of determination (R2) of 0.999 for EV (Fig. 1a) and 0.993

or TCV (Fig. 1b) and amplification efficiencies of 92.6% and 97.5%,espectively. The dynamic range of the RT-qPCR assays was wide,anging from 72 to 7.2 × 108 genome copies (8 logs) for the EV stan-ard and from 20 to 2.0 × 106 genome copies (6 logs) for the TCVtandard.

.2. Viral extraction efficiency

Extraction efficiencies were similar for EV and TCV in the twoets of extraction experiments performed. In the first set of 3 sam-les, the % recovered was 3.2% for EV (n = 9) and 12.4% for TCV (n = 9;able 2). In the second set of 3 samples, the % recovered was 2.4% forV (n = 9) and 8.5% for TCV (n = 9; Table 2). The average % recoveryuring extraction was 2.8% for EV and was 10.4% for TCV (Table 2).egative extraction controls for both experiments were negative

or EV and TCV.SKETA was spiked into the first set of 3 extraction samples at a

oncentration of 100 ng DNA/ml. SKETA was found to have a higherecovery than either TCV or EV at 14.7% (n = 8; Table 2), but recoveryas within an order of magnitude of both viral recovery efficiencies.

.3. Viral concentration and extraction efficiency

TCV was determined to have a similar recovery to EV when con-entrated from a sample with no PCR inhibitors (DI water). Bothiruses were estimated to have approximately 3-log losses whenpiked at a concentration of 1.9 × 107 genome copies/100 ml (n = 9;able 3). The lowest quantifiable spiking concentration for TCV ineionized water was 4.0 × 104 genome copies/100 ml.

TCV and EV also had similar recoveries from a creek waterample. Both viruses had losses of approximately 4 logs whenpiked at a concentration of 9.7 × 107 genome copies/100 ml (n = 9;able 4). The lowest quantifiable spiking concentration of TCV in thenvironmental water sample was 1.0 × 106 genome copies/100 mlLimit of quantification = 1.0 × 102 genome copies/100 ml in thereek water sample).

The ability to detect TCV in wastewater was determined by

piking TCV at a concentration of 2.4 × 109 genome copies/100 mlf wastewater influent obtained from a wastewater treatmentacility in Chapel Hill, North Carolina. The average loss for TCVn sewage influent was 99.997% (n = 6; Table 5). The lowest

able 4iral concentrations used for spiking, recovered concentrations post-spiking, percent losater, extraction, and RT-qPCR of echovirus 12 (EV) and turnip crinkle virus (TCV) from 3

Virus Replicates Spiked Concentrationa

EV 9 9.7 × 107

CVb

TCV 9 9.7 × 107

CV

a In genome copies/100 ml.b CV = coefficient of variation.

0.4

quantifiable spiking concentration of TCV in the sewage influentsample was 1.0 × 107 genome copies/100 ml.

3.4. Presence of TCV in native water and wastewater samples

Surface water samples from several locations around the U.S.,including Doheny Beach in Dana Point, CA; Morgan Creek in ChapelHill, NC; Lake Carroll in Tampa, FL; and South Shore Beach in Mil-waukee, WI were analyzed for the presence of TCV. All surface watersamples were negative for TCV.

Wastewater influent samples from several locations around theU.S., including facilities in or near Oakland, CA; Santa Ana, CA;Tampa, FL; Milwaukee, WI; Chapel Hill, NC; Raleigh, NC; Tucson,AZ; and Columbus, OH were analyzed for the presence of TCV. Allwastewater influent samples were negative for TCV.

4. Discussion

This study presents a proof-of-concept for evaluating viralprocess controls and suggests that TCV may be utilized for stan-dardizing the detection and quantitation of enteric viruses fromenvironmental samples. The development of recovery controls hasbeen recognized as a need for providing reliable detection andquantitation of microbes when processing environmental sam-ples for water quality monitoring (e.g., Girones et al., 2010; SantoDomingo et al., 2007; Stewart et al., 2008; USEPA, 2007; Wuertzet al., 2011). Most quality control efforts, however, have beendirected toward the construction of PCR amplification efficiencycontrols or, to a lesser extent, extraction controls. Those few pub-lished controls dedicated to measuring concentration efficiency areeither not available in the U.S., have not been evaluated againsttarget viruses, or have not been evaluated for their presence innative waters. The process control evaluated in this study, TCV,was determined to have a similar recovery to EV when concen-trated from a sample with no PCR inhibitors (DI water) and in awater sample likely containing PCR inhibitors. These results indi-cate that TCV is a suitable process control for EV, and likely a suitablecontrol for other human enteroviruses as they have similar sizes,morphologies, and genomes to echovirus 12. Thus, TCV could beused to estimate enterovirus loss incurred during concentration

and extraction steps when using the methods described herein.

A surprising result of this study was the low recovery efficiencyof the concentration and extraction methods: the general recov-ery (including concentration, extraction, and reverse transcription

t (% loss), and percent recovered (% recovered) for concentration in environmental samples. RT-qPCR assays were run in triplicate.

Recovered Concentrationa % Loss % Recovered

3.6 × 103 99.996 0.0040.18.8 × 103 99.991 0.0090.2

J. Gentry-Shields, J.R. Stewart / Journal of Virological Methods 189 (2013) 250– 257 255

Table 5Viral concentration used for spiking, recovered concentration post-spiking, percent lost (% loss), and percent recovered (% recovered) for concentration in sewage influent,extraction, and RT-qPCR of turnip crinkle virus (TCV) from 2 samples. RT-qPCR assays were run in triplicate.

Virus Replicates Spiked Concentrationa Recovered Concentrationa % Loss % Recovered

TCV 6 2.4 × 109 1.7 × 105 99.997 0.003CVb 0.6

sifiprsC2LMlfHVcp(oeeDeG(HgsacVns

lcSflgfooaitNsepeptt2wbe

a In genome copies/100 ml.b CV = coefficient of variation.

teps) was 0.03% for EV and 0.02% for TCV. For comparison, datas available on virus recoveries from water matrices using variousltration methods. Methods utilizing the virus adsorption-elutionrinciple (VIRADEL) with glass-wool or electropositive filters haveeported virus recovery efficiencies of <0.0006–100% from tap andurface waters (Albinana-Gimenez et al., 2009; Bennett et al., 2010;ashdollar and Dahling, 2006; Dahling, 2002; Deboosere et al.,011; Francy et al., 2013; Hill et al., 2009; Karim et al., 2009;ambertini et al., 2008; Millen et al., 2012; Vilagines et al., 1997).ethods utilizing VIRADEL with electronegative filters are simi-

arly variable, with reported virus recoveries between 3 and >100%rom tap and surface waters (Farrah et al., 1976; Gerba et al., 1978;aramoto et al., 2009; Preston et al., 1988; Shields et al., 1985;ictoria et al., 2009). From sewage, reported virus recovery effi-iencies are 30–90% for an elution and skimmed-milk flocculationrocedure (Calgua et al., 2013) and 3.5% for adsorption-elutionFumian et al., 2010). The wide variability within these meth-ds may be due to the type of virus utilized (Albinana-Gimenezt al., 2009; Francy et al., 2013); virus quantity within a sample (Lit al., 2010); water type and quality (De Keuckelaere et al., 2013;eboosere et al., 2011; Lee et al., 2011; Lewis et al., 2000; Victoriat al., 2009; Villar et al., 2006); volume of water filtered (Albinana-imenez et al., 2009; Li et al., 2010); or method of quantification

Bofill-Mas et al., 2006; Francy et al., 2013; Millen et al., 2012).owever, a recent meta-analysis found that the specific virus tar-et may be more important than the water matrix, filter type, orample volume in predicting virus recovery efficiency (Cashdollarnd Wymer, 2013). It is possible that the low virus recovery effi-iencies in this study were due to the strains of EV and TCV utilized.iral isoelectric points, which impact charge interaction, can varyot only between types of viruses, but also between strains of theame viral type (Michen and Graule, 2010).

The low virus recoveries in this study compared to some pub-ished recoveries may also be due to the lack of a secondaryoncentration procedure or the nucleic acid extraction procedure.econdary concentration procedures include the use of organicocculation, celite, polyethylene glycol, ultrafilters, and centrifu-ation to further concentrate a water sample to a smaller volumeor detection (Cashdollar and Wymer, 2013). Variations in sec-ndary concentration procedures, if not validated separately, canbscure the effects of the primary concentration step (Cashdollarnd Wymer, 2013). A secondary concentration step was not utilizedn this study; the nucleic acids were extracted directly from the fil-er, as described previously (Conn et al., 2011; Gregory et al., 2006;oble et al., 2006). In fact, the low virus recoveries found in this

tudy may be related to the nucleic acid extraction method. Recov-ries reported in this study are much lower than the virus recoveryublished by Fuhrman et al. (2005), who estimated a general recov-ry of 51% (r2 = 0.99) from 50-ml freshwater samples using similarrocessing methods. Differences in recovery efficiencies betweenhe two studies may be due to variations in the extraction step. Inhis study, the HA filter was quartered and placed directly into a

-ml screw-cap tube for extraction according to Conn et al. (2011),hereas Fuhrman et al. (2005) placed the filter into a Whirl-Pak

ag for the addition of lysis buffer and removed the liquid for RNAxtraction. In preliminary tests, Fuhrman et al. (2005) found that

folding the filter into quarters and placing into a microcentrifugetube for extraction yielded lower recovery. This suggests that smallvariations in protocol may have large effects on virus recovery effi-ciency. The extraction efficiency results reported in this study aresimilar to those reported for mengovirus and hepatitis A virus fromserum using the RNeasy Plant Mini Kit. Costafreda et al. (2006)found RNA extraction efficiencies of 1.5–11.6% and 3.3–5.5% formengovirus and HEV, respectively. The low recoveries of virusesfrom water and the differences in recovery efficiencies betweenmatrices reaffirm the necessity of utilizing controls during all partsof the concentration and extraction process.

This study used a novel quantitation method to estimate thevirus stock concentrations and initial spiked virus concentrationsin terms of genome copies/ml. To our knowledge, only two otherstudies have reported a virus spiking concentration in genomecopies (Poma et al., 2012; Rajal et al., 2007b). While those authorsdid not report how they calculated this concentration, an ear-lier study by Rajal et al. (2007a) subjected sub-samples from pre-and post-concentration to nucleic acid extraction and RT-PCR todetermine the concentration efficiency. Use of this method toquantify spiked viral concentrations may not be appropriate forcomparison between viruses because it incorporates the extrac-tion efficiency (as estimated using Acinetobacter), and RT andPCR efficiencies into the spiking concentration estimate. Alter-nate methods for accounting for losses during extraction includesubjecting a quantified control to the same process as sam-ples before their use as a standard curve (Conn et al., 2011;Gregory et al., 2006) or utilizing whole viruses for standard curves(Costafreda et al., 2006). Nevertheless, in all these methods theincorporation of losses during extraction/lysing into the quanti-tation estimate preempts reliable comparisons of concentrationefficiencies between different viruses. Moreover, in preliminaryexperiments for this study, the use of heat-release to lyse viruseswas found to be less efficient than RNA extraction using the com-mercial kit (data not shown). The quantitation method reportedin this study allows for a relatively simple method for estimat-ing a viral stock via molecular methods and allows for a morereliable comparison of processing efficiencies between differentviruses.

For EV, the stock concentration was 3 logs higher using themolecular-based quantitation method than the culture-basedmethod. These results are not surprising, as previous studies havedemonstrated that viral quantitation using different methodscan result in drastically different estimated concentrations. Cellculture can underestimate the total number of viral particles, as itdetects only infectious viral particles, and not all viral particles areinfectious; moreover, many viruses do not grow well or at all in cellculture (Racaniello, 2007). Conversely, molecular methods quantifyboth infectious and non-infectious viruses as well as naked RNApresent in a sample, possibly leading to an overestimation of viralparticles. Molecular methods are also affected by inhibitors, whichcan reduce reverse transcription and PCR efficiencies, leading to

an underestimation of total genomes. The resulting differencein estimated concentration is referred to as the particle-to-PFUratio, and for different viruses this ratio can be anywhere from1:1 to 10,000:1 (Racaniello, 2007). Because different quantitation

2 of Viro

msa

asrt1uceaacwbiims

ateqfovwmFdptolTctos

dsigffa

oteo

5

(atidp

56 J. Gentry-Shields, J.R. Stewart / Journal

ethods can give drastically different measures of virus quantity,imilar quantitation techniques should be utilized for both spikingnd recovery concentrations, such as those utilized in this study.

The discrepancy between the two EV quantitation methods maylso be due to the presence of naked RNA present in the virustock. This seems to be supported by the fact that while the generalecoveries between TCV and EV were similar, the specific extrac-ion recoveries were more different (although they were still within

log10 of each other). However, the extraction experiments weresed to estimate the quantity of viruses used for spiking the con-entration experiments. If naked RNA had been included in thestimated viral quantifications, this value would have resulted in

significantly lower concentration efficiency for EV than for TCV,s naked RNA would not have adsorbed to the filter during con-entration experiments. Because the two concentration efficienciesere similar, this is not a likely explanation for the discrepancy

etween the two quantitation methods. Regardless, studies couldnclude RNase, which eliminates naked RNA, followed by an RNasenhibitor, before concentration and extraction experiments. This

ethod was utilized by Mormann et al. (2010) as a pretreatmenttep to allow for the exclusive detection of intact virus particles.

As opposed to the discrepancy between the EV culture-basednd molecular quantitation methods, the method used to quan-ify TCV using a spectrophotometer produced a quantity that wasquivalent to the quantity estimated by molecular methods (RT-PCR). This is surprising, as this method is not utilized commonlyor quantitation of enteric viruses, likely due to a lower densityf enteric viruses in samples (a concentration of at least 1 × 1013

iruses/ml was required for this method) than densities possibleith plant viruses. The ease of the spectrometry-based quantitationethod contributes to the usefulness of TCV as a process control.

urthermore, TCV can be grown easily in typical greenhouse con-itions and isolated with well-documented methods. This ease ofroduction and quantitation make TCV a more practical candidatehan armored RNA, which can be expensive to manufacture. More-ver, because TCV is a plant virus, it may be safer for use in theaboratory than animal viruses such as murine or porcine norovirus.he presence of plants in any lab using a plant virus as a processontrol is not recommended, and standard precautions should beaken to ensure containment and decontamination of the virus. Usef attenuated viruses may also be a possibility but was beyond thecope of this study.

This study demonstrates that TCV may serve as a control for theetection of enteroviruses from U.S. waters. No samples from out-ide the U.S. were investigated for the presence of TCV, althought is likely that TCV can serve as a positive control for a broadereographic area, as reported spreads include only the U.K. and theormer Yugoslavia. Nevertheless, environmental samples from dif-erent geographic areas should be tested for the virus before its uses a quantitative control.

TCV may also be able to serve as a process control forther enteric viruses, including norovirus or hepatitis A or E, ashese viruses have similar morphology and genome structure tonteroviruses. Additional studies are needed to compare recoveryf TCV to other waterborne enteric viruses.

. Conclusion

This study demonstrated that a plant virus, turnip crinkle virusTCV), may serve as a viral process control during concentrationnd extraction procedures used to evaluate water samples. Because

hese steps can have low recovery efficiencies, as demonstratedn this study, a recovery control is necessary for confidence inetection and quantitation of viruses from environmental sam-les. TCV, being absent from U.S. waters and wastewaters and

logical Methods 189 (2013) 250– 257

demonstrating similar recovery efficiencies to Echovirus 12, is anadvisable process control for enteroviruses and possibly other RNAviruses with similar morphologies.

Acknowledgements

The authors would like to thank Tim Sit at N.C. State Universityfor providing the turnip crinkle virus stocks and plasmids for thisstudy, as well as for his help in growing and enumerating TCV. Wewould like to thank Doug Wait at UNC for providing the titeredechovirus 12 stock, and Dr. Rachel Noble for providing the SKETAcontrol. We are very appreciative of the laboratories and utilitiesthat graciously sent us surface waters and wastewater samples totest. Funding was provided by a Hartley Corporation Grant fromSDE/Graduate Women In Science.

References

Albinana-Gimenez, N., Clemente-Cesares, P., Calgua, B., Huguet, J.M., Courtois, S.,Girones, R., 2009. Comparison of methods for concentrating human aden-oviruses, polyomavirus JC and noroviruses in source waters and drinking waterusing quantitative PCR. J. Virol. Methods 158, 104–109.

Beld, M., Minnaar, R., Weel, J., Sol, C., Damen, M., van der Avoort, H., Wertheim-vanDillen, P., van Breda, A., Bloom, R., 2004. Highly sensitive assay for detection ofenterovirus in clinical specimens by reverse transcription-PCR with an armoredRNA internal control. J. Clin. Microbiol. 42, 3059–3064.

Bennett, H.B., O’Dell, H.D., Norton, G., Shin, G., Hsu, F.C., Meschke, J.S., 2010. Evalua-tion of a novel electropositive filter for the concentration of viruses from diversewater matrices. Water Sci. Technol. 61, 317–322.

Bofill-Mas, S., Albinana-Gimenez, N., Clemente-Casares, P., Hundesa, A., Rodriguez-Manzano, J., Allard, A., Calvo, M., Girones, R., 2006. Quantification and stabilityof human adenoviruses and polyomavirus JCPyV in wastewater matrices. Appl.Environ. Microbiol. 72, 7894–7896.

Bressler, A.M., Nolte, F.S., 2004. Preclinical evaluation of two real-time, reversetranscription-PCR assays for detection of the severe acute respiratory syndromecoronavirus. J. Clin. Microbiol. 42, 987–991.

Calgua, B., Rodriguez-Manzano, J., Hundesa, A., Sunen, E., Calvo, M., Bofill-Mas, S., Girones, R., 2013. New methods for the concentration ofviruses from urban sewage using quantitative PCR. J. Virol. Methodshttp://dx.doi.org/10.1016/j.jviromet.2012.10.012

Cashdollar, J.L., Dahling, D.R., 2006. Evaluation of a method to re-use electroposi-tive cartridge filters for concentrating viruses from tap and river water. J. Virol.Methods 132, 13–17.

Cashdollar, J.L., Wymer, L., 2013. Methods for primary concentration of viruses fromwater samples: a review and meta-analysis of recent studies. J. Appl. Microbiol.,http://dx.doi.org/10.1111/jam.12143.

Conn, K.E., Habteselassie, M.Y., Blackwood, A.D., Noble, R.T., 2011. Microbial waterquality before and after the repair of a failing onsite wastewater treatmentsystem adjacent to coastal waters. J. Appl. Microbiol. 112, 214–224.

Costafreda, M.I., Bosch, A., Pinto, R.M., 2006. Development, evaluation, and stadard-ization of a real-time TaqMan reverse-transcription-PCR assay for quantificationof a hepatitis A virus in clinical and shellfish samples. Appl. Environ. Microbiol.72, 3846–3855.

da Silva, A.K., Saux, J.-C.L., Parnaudeau, S., Pommepuy, M., Elimelech, M., Guyader,F.S.L., 2007. Evaluation of removal of noroviruses during wastewater treatment,using real-time reverse transcription-PCR: Different behaviors of genogroups.Appl. Environ. Microbiol. 73, 7891–7897.

Dahling, D.R., 2002. An improved filter elution and cell culture assay procedurefor evaluating public groundwater systems for culturable enteroviruses. WaterEnviron. Res. 74, 564–568.

De Keuckelaere, A., Baert, L., Duarte, A., Stals, A., Uyttendaele, M., 2013. Evaluationof viral concentration methods from irrigation and processing water. J. Virol.Methods 187, 294–303.

Deboosere, N., Horm, S.V., Pinon, A., Gachet, J., Coldefy, C., Buchy, P., Vialette, M.,2011. Development and validation of a concentration method for the detec-tion of Influenza A Viruses from large volumes of surface water. Appl. Environ.Microbiol. 77, 3802–3808.

Dreier, J., Sto ¨rmer, M., Kleesiek, K., 2005. Use of MS2 as an internal control in viralreverse transcription-PCR assays. J. Clin. Microbiol. 43, 4551–4557.

Drosten, C., Seifried, E., Roth, W.K., 2001. TaqMan 5‘-nuclease human immunodefi-ciency virus type 1 PCR assay with phage-packaged competitive internal controlfor high-throughput blood donor screening. J. Clin. Microbiol. 39, 4302–4308.

Eisler, D.L., McNabb, A., Jorgensen, D.R., Isaac-Renton, J.L., 2004. Use of an internalpositive control in a multiplex reverse transcription-PCR to detect West Nilevirus RNA in mosquito pools. J. Clin. Microbiol. 42, 841–843.

Farrah, S.R., Gerba, C.P., Wallis, C., Melnick, J.L., 1976. Concentration of viruses fromlarge volumes of tap water using pleated membrane filters. Appl. Environ. Micro-biol. 31, 221–226.

Francy, D.S., Stelzer, E.A., Brady, A.M.G., Huitger, C., Bushon, R.N., Ip, H.S., Ware,M.W., Villegas, E.N., Gallardo, V., Lindquist, H.D.A., 2013. Comparison of filters for

of Viro

F

F

G

G

G

G

H

H

H

H

H

K

L

L

L

L

L

M

J. Gentry-Shields, J.R. Stewart / Journal

concentrating microbial indicators and pathogens in lake-water samples. Appl.Environ. Microbiol., http://dx.doi.org/10.1128/AEM.03117-12.

uhrman, J.A., Liang, X., Noble, R.T., 2005. Rapid detection of enteroviruses fromsmall volumes of natural waters by real-time RT-PCR. Appl. Environ. Microbiol.71, 4523–4530.

umian, T.M., Guimaraes, F.R., Pereira Vaz, B.J., da Silva, M.T., Muylaert, F.F., Bofill-Mas, S., Girones, R., Leite, J.P., Miagostovich, M.P., 2010. Molecular detection,quantification and characterization of human polyomavirus JC from waste waterin Rio De Janeiro, Brazil. J. Water Health 8, 438–445.

erba, C.P., Farrah, S.R., Goyal, S.M., Wallis, C., Melnick, J.L., 1978. Concentration ofenteroviruses from large volumes of tap water, treated sewage, and seawater.Appl. Environ. Microbiol. 35, 540–548.

irones, R., Ferruıs, M.A., Alonso, J.L., Rodriguez-Manzano, J., Calgua, B., de AbreuCorreˆa, A., Hundesa, A., Carratala, A., Bofill-Mas, S., 2010. Molecular detectionof pathogens in water - the pros and cons of molecular techniques. Water Res.44, 4325–4339.

regory, J.B., Litaker, R.W., Noble, R.T., 2006. Rapid one-step quantitative reversetranscriptase PCR assay with competitive internal positive control for detec-tion of enteroviruses in environmental samples. Appl. Environ. Microbiol. 72,3960–3967.

regory, J.B., Webster, L.F., Griffith, J.F., Stewart, J.R., 2010. Improved detection andquantification of norovirus from water. J. Virol. Methods 172, 38–45.

aramoto, E., Katayama, H., Utagawa, E., Ohgaki, S., 2009. Recovery of humannorovirus from water by virus concentration methods. J. Virol. Methods 160,206–209.

ata, A., Katayama, H., Kitajima, M., Visvanathan, C., Nol, C., Furumai, H., 2011. Vali-dation of internal controls for nucleic acid extraction and amplification of entericviruses in water samples. Appl. Environ. Microbiol. 77, 4336–4343.

augland, R.A., Siefring, S.C., Wymer, L.J., Brenner, K.P., Dufour, A.P., 2005. Compari-son of Enterococcus measurements in freshwater at two recreational beaches byquantitative polymerase chain reaction and membrane filter culture analysis.Water Res. 39, 559–568.

ill, V.R., Polaczyk, A.L., Kahler, A.M., Cromeans, T.L., Hahn, D., Amburgey, J.E., 2009.Comparison of hollow-fiber ultrafiltration to the USEPA VIRADEL technique andUSEPA method 1623. J. Environ. Qual. 38, 822–825.

ollings, M., Stone, O.M., 2005. Turnip Crinkle Virus., Last Accessed Jan 5, 2011http://www.dpvweb.net/dpv/showdpv.php?dpvno=109

arim, M.K., Rhodes, E.R., Brinkman, N., Wymer, L., Fout, G.S., 2009. New electropos-itive filter for concentrating enterovirus and norovirus from large volumes ofwater. Appl. Environ. Microbiol. 75, 2393–2399.

ambertini, E., Spencer, S.K., Bertz, P.D., Loge, F.J., Kiek, B.A., Borchardt, M.A., 2008.Concentration of enteroviruses, adenoviruses, and noroviruses from drinkingwater by use of glass wool filters. Appl. Environ. Microbiol. 74, 2990–2996.

ee, H., Kim, M., Paik, S.Y., Lee, C.H., Jheong, W.H., Kim, J., Ko, G., 2011. Evaluationof electropositive filtration for recovering norovirus in water. J. Water Health 9,27–36.

ewis, G.D., Molloy, S.L., Greening, G.E., Dawson, J., 2000. Influence of environmentalfactors on virus detection by RT-PCR and cell culture. J. Appl. Microbiol. 88,633–640.

i, D., Shi, H.C., Jiang, S.C., 2010. Concentration of viruses from environmental watersusing nanoalumina fiber filters. J. Microbiol. Methods 81, 33–38.

ommel, S.A., McCain, A.H., Morris, T.J., 1982. Evaluation of indirect enzyme-linkedimmunosorbent assay for the detection of plant viruses. Phytopathology 72,1018–1022.

ichen, B., Graule, T., 2010. Isoelectric points of viruses. J. Appl. Microbiol. 109,388–397.

logical Methods 189 (2013) 250– 257 257

Millen, H.T., Gonnering, J.C., Berg, R.K., Spencer, S.K., Jokela, W.E., Pearce, J.M.,Borchardt, J.S., Borchardt, M.A., 2012. Glass wool filters for concentrating water-borne viruses and agricultural zoonotic pathogens. J. Vis. Exp. 61, e3930.

Mormann, S., Dabisch, M., Becker, B., 2010. Effects of technological processes on thetenacity and inactivation of norovirus genogroup II in experimentally contami-nated foods. Appl. Environ. Microbiol. 76, 536–545.

Noble, R.T., Griffith, J.F., Blackwood, A.D., 2006. Multitiered approach using quantita-tive PCR to track sources of fecal pollution affecting Santa Monica Bay, California.Appl. Environ. Microbiol. 72, 1604–1612.

Poma, H.R., Cacciabue, D.G., Garce, B., Gonzo, E.E., Rajal, V.B., 2012. Towards a rationalstrategy for monitoring of microbiological quality of ambient waters. Sci. TotalEnviron. 433, 98–109.

Preston, D.R., Vasudevan, T.V., Bitton, G., Farrah, S.R., Morel, J.L., 1988. Novelapproach for modifying microporous filters for virus concentration from water.Appl. Environ. Microbiol. 54, 1325–1329.

Racaniello, V.R., 2007. The Viruses and Their Replication. In: Fields, B.N., Howley, P.M.(Eds.), Fields’ Virology. , fifth ed. Lippincott Williams & Wilkins, Philadelphia, PA.

Rajal, V.B., McSwain, B.S., Thompson, D.E., Leutenegger, C.M., Kildare, B.J., Wuertz, S.,2007a. Validation of hollow fiber ultrafiltration and real-time PCR using bacte-riophage PP7 as surrogate for the quantification of viruses from water samples.Water Res. 41, 1411–1422.

Rajal, V.B., McSwain, B.S., Thompson, D.E., Leutenegger, C.M., Wuertz, S., 2007b.Molecular quantitative analysis of human viruses in California stormwater.Water Res. 41, 4287–4298.

Santo Domingo, J.W., Bambic, D.G., Edge, T.A., Wuertz, S., 2007. Quo vadis sourcetracking? Towards a strategic framework for environmental monitoring of fecalpollution. Water Res. 41, 3539–3552.

Shields, P.A., Berenfeld, S.A., Farrah, S.R., 1985. Modified membrane-filter procedurefor concentration of enteroviruses from tap water. Appl. Environ. Microbiol. 49,453–455.

Stewart, J.R., Gast, R.J., Fujioka, R.S., Solo-Gabriele, H.M., Meschke, J.S., Amaral-Zettler, L.A., Castillo, E. d., Polz, M.F., Collier, T.K., Strom, M.S., Sinigalliano, C.D.,Moeller, P.D.R., Holland, A.F., 2008. The coastal environment and human health:microbial indicators, pathogens, sentinels and reservoirs. Environ. Health 7(Suppl 2), S3.

USEPA, 2007. Report of the Experts Scientific Workshop on Critical Research Needsfor the Development of New or Revised Recreational Water Quality Criteria. USEnvironmental Protection Agency, Washington, DC.

Viau, E.J., Lee, D., Boehm, A.B., 2011. Swimmer risk of gastrointestinal illness fromexposure to tropical coastal waters impacted by terrestrial dry-weather runoff.Environ. Sci. Technol. 45, 7158–7165.

Victoria, M., Guimaraes, F., Fumian, T., Ferreira, F., Vieira, C., Leite, J.P., Miagostovich,M., 2009. Evaluation of an adsorption-elution method for detection of astrovirusand norovirus in environmental waters. J. Virol. Methods 156, 73–76.

Vilagines, P., Sarrette, B., Champsaur, H., Hugues, B., Dubrou, S., Joret, J.C., Laveran,H., Lesne, J., Paquin, J.L., Delattre, J.M., Oger, C., Alame, J., Grateloup, I., Perrollet,H., Serceau, R., Sinègre, F., Vilaginès, R., 1997. Round robin investigation of glasswool method for poliovirus recovery from drinking water and sea water. WaterSci. Technol. 35, 445–449.

Villar, L.M., de Paula, V.S., Diniz-Mendes, L., Lampe, E., Gaspar, A.M.C., 2006. Eval-uation of methods used to concentrate and detect hepatitis A virus in water

samples. J. Virol. Methods 137, 169–176.

Wuertz, S., Wang, D., Reischer, G.H., Farnleitner, A.H., 2011. Library-IndependentBacterial Source Tracking Methods. In: Hagedorn, C., Blanch, A.R., Harwood,V.J. (Eds.), Microbial Source Tracking: Methods, Applications, and Case Studies.Springer, New York, NY.