Silencing of Gene Expression in Culturedsun-lab.med.nyu.edu/files/sun-lab/attachments/CPCB... · 2010-08-24 · Silencing of Gene Expression in Cultured Cells 27.1.2 Supplement 47

UNIT 27.1Silencing of Gene Expression in CulturedCells Using Small Interfering RNAs

Kumi Sakurai,1 Pritsana Chomchan,1 and John J. Rossi1

1Beckman Research Institute of City of Hope, Duarte, California

ABSTRACT

The discovery of RNA interference (RNAi) and related small RNA–mediated regulatorypathways has significantly altered the understanding of gene regulation in eukaryoticcells. In the RNAi pathway, small interfering RNAs (siRNAs) ∼21 to 23 nucleotides inlength serve as the regulatory molecules that guide and induce sequence-specific genesilencing. The use of siRNA-mediated silencing as a tool for investigating gene functionis well established in cultured mammalian cells. This unit provides basic approaches toexplore the field of RNAi, and hopes to address the importance of optimizing transfectionconditions after empirical determinations in order to understand various degrees ofsilencing efficiency. Curr. Protoc. Cell Biol. 47:27.1.1-27.1.28. C© 2010 by John Wiley& Sons, Inc.

Keywords: RNAi � small silencing RNAs � gene silencing � transfection �

mammalian cell culture

INTRODUCTION

Since the first demonstration of RNA interference in cultured mammalian cells in 2001(Elbashir et al., 2001a), small interfering RNA (siRNA)–mediated sequence-specificgene silencing has been widely used as a tool for investigating gene function, and hasinitiated a new wave of reverse genetics in mammalian systems. The siRNA-mediatedsilencing provides fast, target-specific down-regulation of gene expression. The extentto which one can successfully carry out the silencing for determination of gene functiondepends on the potency of siRNAs, transfection conditions, duration of analysis, andscreening methods. This unit describes design of siRNAs, transfection of siRNAs intocultured cells, and testing and validation of gene knockdown.

The silencing efficiency is based on degree of susceptibility of target transcripts to siRNA-mediated RNA-induced silencing complex (RISC) activity. It is important to designmultiple siRNAs and screen for siRNAs that are highly potent in silencing a given gene.There are several online siRNA design programs available, providing predicted siRNAsequences and opportunities to explore and compare the siRNA sequences generated bydifferent design methods. Once several siRNA sequences with high prediction scores areobtained (Basic Protocol 1), one should carefully design and evaluate siRNA transfectionconditions (Basic Protocol 2).

Transfection of mammalian cells typically utilizes reagents that enhance the uptake ofnucleic acids (e.g., plasmid DNA or siRNAs) by cultured cells. Transfection methodscommonly used are: (1) cationic liposomes—a complex of the genetic materials and/orsiRNAs with a cationic lipid—inducing fusion with the cell plasma membrane; (2)electroporation via destabilization of the cell plasma membrane; and (3) calcium phos-phate/nucleic acid precipitate uptake. In this unit, we describe the use of liposomes todeliver siRNAs to cultured mammalian cells for silencing gene expression.

Current Protocols in Cell Biology 27.1.1-27.1.28, June 2010Published online June 2010 in Wiley Interscience (www.interscience.wiley.com).DOI: 10.1002/0471143030.cb2701s47Copyright C© 2010 John Wiley & Sons, Inc.

RNA-BasedMethods in CellBiology

27.1.1

Supplement 47

Silencing of GeneExpression in

Cultured Cells

27.1.2

Supplement 47 Current Protocols in Cell Biology

As previously mentioned, it is desirable to test several siRNAs against a given gene andscreen for efficacy. Target-site screening is tricky, but necessary to validate and observeoutcomes that accurately reflect the effect of siRNAs. Currently, screening heavily relieson experimental observations such as monitoring phenotypic changes, detection ofchanges in reporter protein expression (e.g., fluorescence for GFP-target fusion proteins),RT-PCR (Support Protocol 1), or western blot analysis (Support Protocol 2). As funda-mental processes for the validation of the siRNA-mediated silencing, we describe RNAisolation and protein collection following transfections. In addition, a dual-reporter sys-tem can be used for rapid and reliable screening for siRNA sequences (Support Protocol3). The psiCHECK-2 vector system (Promega) incorporates expression of a fluorescentreporter protein (e.g., Renilla luciferase) and a control fluorescent protein (e.g., fireflyluciferase) from a single vector, enabling one to evaluate the efficiency of siRNAs bycomparing expression levels of reporter proteins. Support Protocols 4 and 5 are intendedto supplement Basic Protocol 1 when a siRNA is obtained in single-stranded format.

STRATEGIC PLANNING

siRNA Design Algorithms

The sequence of an siRNA can be by far the most important determinant of silencingefficiency. The identification and selection of highly potent siRNA sequences against agiven gene prior to any experimental determinations can be overwhelming. To facilitatethe designing process, there are several databases that archive siRNA sequences testedin mammalian RNAi experiments (Chalk et al., 2005; Shah et al., 2007; Ren et al.,2009). Validated siRNAs can also be found in commercial resources such as the StealthRNAi siRNAs from Invitrogen, the Silencer validated siRNA from Ambion, and HPvalidated siRNAs from Qiagen. These vendors and Dharmacon also provide predesignedsiRNAs and custom design services, making siRNA designing easier and providing agood starting point. However, many, if not most, siRNA-mediated RNAi assays requireexperimental validation for optimization of conditions to meet specific aims.

NOTE: Throughout the protocols, RNA-handling techniques (APPENDIX 2A) should bepracticed and aseptic cell culture conditions should be maintained to avoid accidentalintroduction of nucleases, cross-contamination of samples, and potential loss of cellculture.

BASICPROTOCOL 1

DESIGN OF 21-NUCLEOTIDE-LONG siRNA (21-MER)

If no matches are found for a given gene of interest in the literature and available siRNAdatabases, siRNAs can be designed using Web-based siRNA design programs. Thereare several siRNA selection algorithms to help predict siRNA sequences for effectivesilencing. Users need to provide the target messenger RNA sequence and are able tocreate some user-defined design criteria such as thermodynamic stability and AU/GCbase pair contents that will influence the overall efficiency of predicted siRNAs. Eachalgorithm has a unique emphasis on design features, but fundamentally most of thealgorithms provide siRNA sequences with scores or ranks for users to further analyzefor specificity and select candidate siRNAs that meet their needs. Some algorithms arespecialized in determining off-target effects of predicted siRNA sequences (Chalk andSonnhammer, 2008; Gong et al., 2008) to reduce unwanted side effects. Once selected,siRNAs can be synthesized in-house or obtained from several siRNA-licensed vendorssuch as Ambion, Dharmacon, and Qiagen.

While many of the siRNA design algorithms provide siRNAs in the form of 19 basepairs with 2 nucleotide overhangs at the 3′ end on each strand, siRNAs can be generatedby processing longer double-stranded RNAs (dsRNAs) by the RNase III Dicer enzyme.


27.1.3

Current Protocols in Cell Biology Supplement 47

One may find the use of such dsRNAs for target gene silencing advantageous, sincetransfecting 25- to 27-nt siRNAs showed improved silencing efficiency (Rose et al.,2005). Hannon and colleagues also reported similar observations with short hairpinRNAs with 29-bp stems (Siolas et al., 2005). These observations together with otherssuggest that the Dicer processing of its substrates results in better programming of RISC(Elbashir et al., 2001c; Liu et al., 2003; Gregory et al., 2005).

While the 21-nt siRNAs often show a wide range of potency (Amarzguioui et al., 2003;Reynolds et al., 2004; Ui-Tei et al., 2004), transforming a 21-nt siRNA to a 27-ntDicer substrate siRNA may improve the silencing efficiency. Furthermore, the struc-tural modification that mimic secondary structure of existing Dicer substrates (e.g.,pre-microRNAs) will introduce the defined polarity of Dicer processing, leading topreferential incorporation of the desired guide strand (Rose et al., 2005). Alternatively,D-siRNA sequences can be selected using an algorithm that provides fully automatedD-siRNA designs using the mRNA target sequence (RNAi Design; Owczarzy et al.,2008; http://www.idtdna.com/Scitools/Applications/RNAi/RNAi.aspx).

Materials

Gene of interestWeb-based siRNA design program (e.g., Table 27.1.1)Web-based specificity program (e.g., SpecificityServer; Table 27.1.1)

Design siRNA1. Obtain the most updated mRNA sequence of the gene of interest from the UCSC

Genome Browser (http://genome.ucsc.edu/cgi-bin/hgGateway).

2. Use an online siRNA design program to enter the mRNA sequence. To increasethe chances of designing highly potent siRNAs, include the 5′ and 3′ untranslatedregions (UTRs) in the inquiry as well. Follow the Web site instructions to furtherdefine the siRNAs.

Examples of Web-based siRNA design tools are listed in Table 27.1.1.

3. Analyze the target sequence of the candidate siRNAs for specificity using availableWeb servers (e.g., SpecificityServer). Utilize several online siRNA design tools tocompare and select up to five candidate siRNAs with high prediction scores.

Design Dicer substrate siRNA (D-siRNA)4. Obtain a 21-nt siRNA sequence using the Web-based siRNA design tools.

An example of a sequence is shown in step 5.

Table 27.1.1 List of Web-Based siRNA Design Tools

Tools URLs

siRNA Target Finder http://www.ambion.com/techlib/misc/siRNAfinder.html/

BLOCK-IT RNAi Designer http://rnaidesigner.invitrogen.com/rnaiexpress/

GeneAssist siRNA Workflow Builder http://www5.appliedbiosystems.com/tools/sirna/

siDESIGN Center http://www.dharmacon.com/DesignCenter/DesignCenterPage.aspx

siRNA Target Designer http://www.promega.com/siRNADesigner/

SpecificityServer http://informatics-eskitis.griffith.edu.au/SpecificityServer/


Cultured Cells

27.1.4


5. Extend the sequence of the sense strand to 25 nt and antisense strand to 27 nt, makingone end of the duplex blunt-ended with 2 deoxy 3′ terminal end to block the Dicerentry.

An example of a target sequence and siRNA are shown below.

Target5′-AAGCUGACCCUGAAGUUCAUCUGCACCACCGGC-3′

siRNASense: ACCCUGAAGUUCAUCUGCACCAntisense: ACUGGGACUUCAAGUAGACGUD-siRNASense: ACCCUGAAGUUCAUCUGCACCACCGAntisense: ACUGGGACUUCAAGUAGACGUGGUGGC

6. Exchange the last two ribonucleotides of the sense strand to corresponding deoxyri-bonucleotides.

For instance, change the ribonucleotides to dCdG (shown in lowercase below) if the lasttwo sequences are CG.

Sense: ACCCUGAAGUUCAUCUGCACCACcgAntisense: ACUGGGACUUCAAGUAGACGUGGUGGC

7. Once selected, synthesize siRNAs in-house or obtain from several siRNA-licensedvendors such as Ambion, Dharmacon, and Qiagen.

When an siRNA is obtained in single-stranded format, the sense and antisense strandsneed to be annealed, and the integrity and quality of annealed double-stranded RNA needto be determined. These procedures are described in Support Protocols 4 and 5.

BASICPROTOCOL 2

DETERMINING OPTIMAL TRANSFECTION CONDITIONS

In order to set up experiments with the designed siRNAs, several experimental conditionsneed to be optimized. First, it is important to determine the optimal cell density at the timeof transfection. Transfection efficiency varies based on the cell density and concentrationsof siRNAs, in addition to variations in transfection reagents used in the reaction. Second,optimal siRNA-lipid concentrations should be determined while screening for potentsiRNAs to verify the most effective siRNA duplexes and the lowest concentration thatresults in efficient silencing of target gene without toxicity. Finally, it is recommendedto empirically determine which reagent works best for your cell line. A variety ofproprietary transfection reagents are available, and the efficiency of siRNA delivery to aparticular cell line will slightly differ among the reagents. In this protocol, we describea transfection procedure using Lipofectamine 2000 reagent (Invitrogen), which showedhigh transfection efficiency with commonly used mammalian cell lines (e.g., HEK293,HeLa, and HCT116 cells).

Procedures described here are for adherent cells grown in monolayer. For suspensioncells, the same procedures will apply, except that detaching cells from the surface ofculture dishes is not necessary. Otherwise, deviations in the procedures will be notedaccordingly.

For successful gene silencing by transfecting mammalian cells with siRNAs, it is stronglyrecommended to determine the optimal cell density of your cell line, and optimal siRNAconcentrations, before your experiments. To find an optimal cell density, perform transfec-tions with at least two different levels of confluency. In accordance with the recommended


27.1.5


Table 27.1.2 Recommended Percent Confluence for Transfection

Cell types Source Recommended % confluencea,b

HEK293 Human embryonic kidney 90%

HeLa Human cervical carcinoma 70%-80%

HCT116 Human colon carcinoma 50%

A549 Human lung carcinoma 60%

D3 Mouse embryonic stem cells Transfect cells at the time of plating

3T3L1 Mouse fibroblast 60%-70%aThe listed cell densities are for 16 to 24 hr incubation. Adjust the seeding cell density so that cells reachconfluency at the end of incubation if a longer interval between transfection and harvesting cells is necessary.bInformation also found at Invitrogen Web site http://www.invitrogen.com.

Table 27.1.3 Reagent Mixes for Transfection with Six Different Concentrations ofsiRNAs (12-well plates)

siRNA finalconc. (nM)a siRNA per well (ng)b Stuffer DNA

plasmid (ng)cTotal nucleic acid

amount (μg)

0 0 (μg) 1100 1.1

1.0 1 pmol (13.37 ng) 1087 1.1

5.0 5 pmol (66.85 ng) 1033 1.1

25 25 pmol (334.3 ng) 765.7 1.1

50 50 pmol (668.5 ng) 431.5 1.1

75 75 pmol (1003 ng) 97.21 1.1asiRNA concentrations were calculated for the final volume of 1 ml per well of a 12-well plate.bsiRNA (ng) was calculated with a dsRNA, mol. wt. = 1.34 × 104 g/mol.cAny cloning vectors not containing eukaryotic promoters (e.g., pBluescript, pCR2.1, etc) can be usedto adjust the total amount of nucleic acid.

percent confluence of adherent cells shown in Table 27.1.2, seed the cells in multiple-wellplates at a minimum of two different densities 1 day prior to transfection.

In this protocol, 75% seeding density is used to plate four 12-well plates to perform atransfection with two siRNAs, an irrelevant siRNA as a negative control, and a Cy3-labeled siRNA as a positive control, at six different concentrations for an assay period of24 hr. It is strongly recommended to perform another round of transfection with adjustedcell density to optimize the transfection conditions for your experiment. Cells with shorterdoubling times should be seeded at a lower density so that cells reach confluency at theend of the assay period (e.g. HCT116, ∼16 hr; HEK293, ∼22 to 24 hr; HeLa, ∼ 24 hr).Within a well of a 12-well plate, you should be able to collect sufficient amounts of totalRNA and proteins for your silencing analyses (Support Protocols 1 to 3). If the targetgene expression is relatively low, consider plating in 6-well plates instead.

When you are analyzing gene function by knocking down gene expression with siRNAtransfection, it is strongly recommended to verify the highly potent siRNA duplexesamong siRNAs that you designed, and to identify the lowest concentration that results inefficient silencing of the target gene and is least toxic to cell culture. Procedures describedbelow refer to transfection of cells seeded on four 12-well plates to determine optimalcell density for transfection with two siRNAs against the same target transcript. Whenmore than two siRNAs are designed, adjust the number of plates to have enough wellsfor experimental determinations. To find optimal siRNA concentrations, one should testat least six different concentrations (e.g., 0, 1, 5, 25, 50, and 75 nM) in duplicate for


Cultured Cells

27.1.6


step 1: preparation

of siRNA/DNA mix

step 2: preparation

of LipofectamineTM

2000 solution

step 3: liposome

formation

step 4: transfection

tube: 1 2 3 4 5 6

5 min

incubation

20 min

incubation

tubes from

step 1:

tube

siRNA (nM):

stuffer DNA (μg):

total vol (μl):

220 μl per tube

200 μl per tube

1 2 3 4 5 6

1

2

3

4

5

6

1 4

2 5

63

0 1.0 5.0 25 50 752.42 2.39 2.27 1.69 0.95 0.21220 220 220 220 220 220

Figure 27.1.1 Transfection of mammalian cells with siRNAs. Stepwise description of transfectionof mammalian cells seeded onto a 12-well plate a day prior to transfection is shown above. Afterchoosing five different concentrations of siRNAs to transfect the cells, mix siRNA and stufferDNA in the Opti-MEM (or a serum-free medium) to bring the volume to 220 μl (step 1). Next,prepare the proper amount of Lipofectamine 2000 solution (two tubes of 720 μl for six tubes ofsiRNA/DNA mixes, step 2). After 5 min incubation, add 220 μl of Lipofectamine 2000 solution toeach siRNA/DNA mix (step 3). Incubate for 20 min to let liposome formation, then add 200 μl ofthe liposome solution to transfect the cells (step 4). Transfection reagent preparations should bedone in a tissue culture hood.

each siRNA as a starting point. Also, the use of a fluorescent dye–labeled siRNA as atransfection control (e.g., FITC, Cy3) will help visualize the transfection efficiency atdifferent concentrations of an siRNA. See below for reagents contained in each trans-fection reaction (Table 27.1.3). A brief summary of the procedure is also shown inFigure 27.1.1.

NOTE: It is desirable to use early-passage-number cells if available. The effects varyamong cell lines; however, passage number of the cells at the time of transfection mayhave impact on the efficiency of liposome uptake and may result in cellular toxicity.


27.1.7


NOTE: In the case of transfection with suspension cells, adjust the cell numbers accord-ingly.

NOTE: Transfection reagent preparations should be done in a tissue culture hood.

NOTE: The use of stuffer DNA plasmid will adjust the final amounts of nucleic acid to beconsistent throughout the experiment; hence, maintaining the volume of Lipofectamine2000 used in the reaction. We have often observed inconsistency in knockdown levels oftarget genes that result from varying the volume of cationic lipid solution for delivery ofdifferent concentrations of an siRNA. Hence, maintaining the volume of Lipofectamine2000 throughout the experiment will not only prevent variation in transfection efficienciesamong the six siRNA concentrations, but also will rectify cellular toxicity, which maybe caused by the different amounts of cationic lipid used in the reaction. Any cloningvectors not containing eukaryotic promoters, such as pBluescript and pCR2.1, can beused as a stuffer DNA plasmid to adjust the total amount of nucleic acid.

Materials

Mammalian cell line cultured in the appropriate growth medium in 10-cm2 dishesCalcium- and magnesium-free Dulbecco’s phosphate-buffered saline (CMF-DPBS;

Cellgro, cat. no. 21-031 CV, or see APPENDIX 2A), 37◦C1× trypsin/EDTA solution (e.g., Invitrogen; also see UNIT 1.1), 37◦CComplete DMEM with 10% (v/v) FBS (see recipe), 37◦CComplete DMEM with 10% (v/v) FBS (see recipe), without antibiotics, 37◦CTrypan blue staining solution (UNIT 1.1)10 μM siRNA working solution (Basic Protocol 1)10 μM irrelevant siRNA as a negative control10 μM fluorescent dye (e.g., Cy3 or FITC)–labeled siRNA as a transfection control250 ng/μl stuffer DNA plasmid (e.g., pBluescript, pCR2.1; Clontech, Invitrogen)Opti-MEM I (a reduced-serum medium from Invitrogen), or serum-free growth

mediumLipofectamine 2000 (Invitrogen)

MicroscopeHemacytometer with coverslip (Figure 1.1.1)12-well tissue culture platesStandard microscope and UV lamp or fluorescence microscope

Additional reagents and equipment for basic cell culture techniques includingtrypsinization and counting viable cells on a hemacytometer by trypan blueexclusion (UNIT 1.1)

NOTE: All solutions and equipment coming into contact with living cells must be sterile,and aseptic technique should be used accordingly.

NOTE: All cell culture incubations should be carried out in a 37◦C, 5% CO2 humidifiedincubator.

Seed cultured cells 1 day prior to transfection1. For adherent cells grown at subconfluency on 10-cm2 dishes, rinse with 5 ml 1

CFM-DPBS and add 2 ml of 1× trypsin/EDTA solution per dish to detach cells fromsurface.

This will be enough to cover the monolayer culture.

In order to seed four 12-well plates at 75% cell confluency, prepare two 10-cm2 dishes ofcells at ∼80% confluency.

UNIT 1.1 includes protocols for basic cell culture techniques including trypsinization.


Cultured Cells

27.1.8


2. After 2 min incubation at 37◦C, gently tap bottom of dish to dislodge cells. Alsocheck culture under a microscope to see that cells are detached from the surface.

The cells should look rounded up.

For cells grown in suspension, skip steps 1 and 2. First centrifuge the cell culture 5 minat 200× g, room temperature, aspirate medium, and follow steps 3 to 9.

3. Gently resuspend cells by adding ∼5 ml of complete DMEM/10% FBS and pipettingup and down.

The addition of the serum-containing medium will inhibit further trypsin digestion.

4. Transfer the cell suspension to a sterile 50-ml centrifuge tube, and centrifuge for3 min at 200 × g room temperature.

5. Aspirate medium and resuspend the cells with 10 ml complete DMEM/10% FBSwithout antibiotics, so that maximum cell count will be ∼50 cells per 1 mm2 .

If cells on a 10-cm dish are below 80% confluency, lower the volume of medium to adjustthe maximum cell count to ∼50 cells per 1 mm2.

6. Add 10 μl of trypan blue staining solution and a 10-μl aliquot of cell suspension toa 1.5-ml microcentrifuge tube. Mix thoroughly and dispense 10 μl of the mix gentlyto edge of hemacytometer counting chamber by placing the tip of pipet under thecoverslip.

UNIT 1.1 includes a protocol for viable cell counting using trypan blue and a hemacy-tometer.

7. Count cells under a microscope and calculate cell numbers as follows (also seeUNIT 1.1):

Cell numbers (cells/ml) = average count per square × 2 × 104

Total cells = cell numbers (cells/ml) × volume of medium used to dilute cellswhere 2 is the dilution factor, and 104 is the volume correction factor.

8. Determine cell viability by counting total number of viable (unstained) cells.

% viable cells = [number of unstained cells/total number of cells] × 100

To plate cells at 75% seeding density on four 12-well plates, you will need a total of∼1.5 × 107 viable cells.

9. Plate cells at a seeding density of 3.0 × 105 cells (initial 75% confluence) in 0.8 mlmedium into wells of four 12-well plates. Make sure to distribute cells uniformlyacross the well to ensure even uptake of liposomes.

On the day of transfection (i.e., the next day), cells with slow doubling time will reach∼85% to 90% confluency. After the transfection efficiency is determined, scale up ordown the seeding density and perform another round of transfection.

For different cell lines, the numbers of cells at seeding should be adjusted so that theywill reach confluency at harvesting. For instance, seed 4.0 × 105 HEK293 cells to obtain90% confluency for a 24-hr assay period. Also refer to Table 27.1.2 for the recommended% confluency at transfection for different cell lines so that the optimal seeding densitycan be empirically determined.

10. Incubate the cells at 37◦C, 5% CO2 for subsequent transfection.

Do not add antibiotics to the medium during transfection. If complete DMEM/10% FBS isused to seed cells, exchange the medium to complete DMEM/10% FBS without antibioticsonce the cells are attached to wells, or at the latest 4 to 6 hr prior to transfection.


27.1.9


Prepare siRNA/DNA mixes11. Prepare 40 μl of 1 μM siRNA by diluting 4 μl of the 10 μM siRNA working

solution in 36 μl of Opti-MEM I (or serum-free medium) so that there are twodifferent concentrations for a given siRNA. Using the same technique, prepare 1 μMsolutions for three other siRNAs—the second siRNA to be tested, one Cy3-labeledsiRNA, and one irrelevant control siRNA.

It is recommended that you use serum-free medium to dilute siRNAs, to prevent potentialreduction in transfection efficiency.

It is not necessary to perform annealing (Support Protocol 4 and 5) if the siRNA isobtained in the double-stranded form. If the siRNA is purchased based on the match in theliterature and available siRNA databases, it will be still ideal to determine the transfectionefficiency (Support Protocols 1 to 3) to evaluate technical skills/conditions.

One can interpret an irrelevant siRNA control as an siRNA whose sequence cannot befound in the system that the investigator tests with. An irrelevant/control siRNA canbe purchased from several siRNA-licensed vendors such as Ambion, Dharmacon, andQiagen. The sequences of such control siRNAs may not be available, for proprietaryreasons.

For the fluorescently labeled siRNA, in an ideal experimental setting, one should obtainthe same siRNA that was designed in Basic Protocol 1, but with a fluorescent label.This can be done by custom ordering from the vendor. However, synthesizing the fluores-cently labeled siRNA for each siRNA designed in Basic Protocol 1 is not cost-effective.Instead, one can purchase a fluorescently labeled control siRNA from vendors such asInvitrogen.

12. Prepare six 1.7-μl microcentrifuge tubes with proper labeling (0, 1, 5, 25, 50, 75 nM)for each siRNA, add each reagent as described in Table 27.1.3, and bring the finalvolume to 100 μl per tube with Opti-MEM I. Mix gently.

It is strongly recommended to perform transfection in duplicate.

From this point forward, volumes of reagents are calculated for duplicate reactions andshown on the right-hand side of Table 27.1.4 and Figure 27.1.1.

Table 27.1.4 Reagent Mixes for 0, 1, 5, 25, 50, and 75 nM of siRNA (12-well plates)

Per well For 2.2x

siRNA per wellb siRNA perwell

TubessiRNA finalconc. (nM)a

1 μM(μl)

10 μM(μl)

Stuffer DNAplasmid (ng)c

Total volumeper well (μl)

1 μM(μl)

10 μM(μl)

Stuffer DNAplasmid (ng)

Total volumeper well (μl)d

1 0 – – 1100 100 – – 2420 220

2 1.0 2.0 – 1087 100 4.4 – 2391 220

3 5.0 10.0 – 1033 100 22.0 – 2273 220

4 25 – 5.0 765.7 100 – 11.0 1685 220

5 50 – 10.0 431.5 100 – 22.0 949.3 220

6 75 – 15.0 97.2 100 – 33.0 213.8 220asiRNA concentrations were calculated for the total volume of 1 ml per well of a 12-well plate.bsiRNA (ng) was calculated with a dsRNA, mol. wt. = 1.34 × 104 g/mol.cAny cloning vectors not containing eukaryotic promoters (e.g., pBluescript, pCR2.1, etc) can be used to adjust the total amount of nucleic acid.dThe 220 μl of siRNA/DNA mixes contains a 0.2× volume excess to the actual volume for a well. (220 μl = 100 μl × 1.2 × 2 wells).


Cultured Cells

27.1.10


75 nm

50 nm

25 nm

5 nm

1 nm

Figure 27.1.2 Detection of Cy3-labeled siRNA uptake by HEK293 cells. After 24 hr incubation,the transfection efficiency of 0, 1, 5, 25, 50, and 75 nM Cy3-labeled siRNAs were observedunder a microscope with a UV lamp. Excitation wavelength of Cy3 is ∼550 nm and emissionwavelength is ∼570 nm. Representative results are shown. For the color version of this figure goto http://www.currentprotocols.com/protocol/cb2701.


27.1.11


Prepare Lipofectamine 2000 solution13. Mix Lipofectamine 2000 gently and microcentrifuge briefly to bring the solution to

the bottom of the tube.

14. Dilute 2.0 μl Lipofectamine in 100 μl Opti-MEM I per well. For six differentconcentrations of a siRNA (for 12 wells), prepare 1440 μl of Lipofectamine 2000solution in two tubes (=14.4 μl Lipofectamine 2000 in 720 μl Opti-MEM I per tube).Prepare three more sets for other siRNA/DNA mixes (total of eight tubes) (step 2,Fig. 27.1.1).

The 1440 μl of Lipofectamine 2000 solution contains a 0.091× volume excess of thevolume for six tubes of the siRNA/DNA mixes (tubes 1 to 6 in the table; 1440 μl =220 μl× 1.091 × 6 siRNA/DNA mixes).

15. Mix gently and incubate for 5 min at room temperature.

Form liposomes16. Prepare DNA-siRNA-lipid complex (liposome) by adding 220 μl of the Lipofec-

tamine 2000 solution to 220 μl of the siRNA/DNA mix. Mix gently and incubate for20 min at room temperature for liposome formation (step 3, Fig. 27.1.1).

Transfect cells17. Add 200 μl of the liposome solution dropwise to each well containing cells and

0.8 ml medium (step 4, Fig. 27.1.1). Mix gently by rocking the plate back and forth,left to right several times.

18. Incubate the cells at 37◦C, 5% CO2 until cells are ready for harvesting.

Generally the assay period is 24 to 48 hr.

19. At the end of incubation, observe transfection efficiency with the Cy3-labeled siRNAunder a microscope with a UV lamp or fluorescence microscope.

The excitation wavelength of Cy3 is ∼550 nm and the emission wavelength is ∼570 nm.Representative results are shown in Figure 27.1.2.

Under some experimental conditions (e.g., multiple cycles of transfection for a prolongedassay period), growth medium may be replaced after 4 to 6 hr of incubation without lossof transfection activity; this helps to reduce cellular toxicity.

After 24 hr transfection, one can perform one of following procedures to estimate/measuretransfection efficiency (should include a positive control for Cy3 fluorescence detection);approaches are listed in order from estimations to accurate measurements:

Visual observation: Observe Cy3 fluorescence cells under a microscope with a UVlamp/fluorescence microscope and compare and estimate a ratio Cy3 fluorescence cellsto total cells.

Counting cell numbers: In a visual field under the microscope, count Cy3 fluorescencecell numbers and total cell numbers, and take a ratio. Transfection efficiency = Cy3fluorescing cells/total cells.

FACS analysis: Count cell numbers of negative control cells, positive control cells, andtransfected cells, and take a ratio. Transfection efficiency = Cy3 fluorescing cells/totalcells).

20. Once you optimize the transfection conditions, perform your experiment with themost potent siRNAs at an optimal cell density and siRNA concentration and usingLipofectamine 2000 at least three times for validating the reproducibility.

Once the potent siRNAs are evaluated on 12-well plates, we run scaled-up experimentson 6-well plates to obtain sufficient samples for subsequent analyses.

21. Assess the results of transfection by PCR (Support Protocol 1), immunoblotting(Support Protocol 2), or a dual-reporter system (Support Protocol 3).


Cultured Cells

27.1.12


SUPPORTPROTOCOL 1

ASSESSING siRNA TRANSFECTION EFFICIENCY BY RT-PCR

The importance of detection of target transcript levels after siRNA treatment is often over-looked. Potentially, the target gene might express a protein with a long half-life; therefore,the effect of the siRNA treatment may not be apparent by immunoblot analyses (describedin Support Protocol 2). Thus, following a short period of time post-transfection, it is rec-ommended to validate the effect of designed siRNAs at the transcript level. The efficiencyof down-regulation of target gene expression by siRNAs can be determined by real-timequantitative RT-PCR (qRT-PCR) or end-point RT-PCR reactions. Here, we describethe isolation of total RNA from siRNA-treated cells, and cDNA preparation, in detail.Reagents available for RNA extraction are RNA STAT-60 (TEL-TEST, INC.) or TRIzol(Invitrogen), and procedures for both reagents are very similar. In this protocol, we willdescribe the use of RNA STAT-60 in total RNA isolation.

Materials

siRNA-treated cells on 12-well plates (Basic Protocol 2)RNA STAT-60 (Tel-Test, Inc., http://www.tel-test.com/) at 4◦CChloroform75% ethanol made with nuclease-free or diethylpyrocarbonate (DEPC)-treated

H2O (see APPENDIX 2A fro DEPC treatment)Nuclease-free or DEPC-treated water (APPENDIX 2A)2 U/μl DNase I (RNase-free) and 10× DNase buffer (Ambion)1 U/μl RNase inhibitor (RNasin, Promega)Random hexamer primers [or oligo(dT)12-18]10 mM dNTP mix(10 mM dATP, dCTP, dGTP, and dTTP)5× first-strand buffer (Invitrogen)0.1 M DTTMMLV reverse transcriptase (Invitrogen)Forward and reverse PCR primersiQ SYBR Green Supermix (for real time qPCR; BioRad)

Refrigerated centrifugeNanoDrop 1000 (Thermo Fisher Scientific) or UV/Vis spectrophotometerPCR tubes65◦ and 80◦C water baths or heating block

Additional reagents and equipment for spectrophotometric determination of RNAconcentration (APPENDIX 3D), standard PCR (Kramer and Coen, 2001), andreal-time qPCR (Bookout et al., 2006)

Collect total RNA from siRNA treated cell culture1. At the end of siRNA treatment (Basic Protocol 2), aspirate medium from the cell

culture.

Do not wash cells with CMF-DPBS, since this may result in RNA degradation.

For cells grown in suspension, centrifuge the suspension and collect the cell pellet.

2. Lyse the cells by directly adding RNA STAT-60 (1 ml/2.5 to 5 × 106 cells; e.g.,300 μl of RNA STAT-60 per well on a 12-well plate) and pipetting up and downwith a 200-μl pipet tip until the viscosity disappears.

If the viscosity persists, add 50-μl increments of RNA STAT-60 until the lysate becomestransparent. It is critical to lyse cells thoroughly to extract RNA of high quality.

3. Transfer the lysate to a 1.7-ml microcentrifuge tube.

In the case of collecting lysates from a 10-cm dish, use a 2.0-ml microcentrifuge tube oraliquot the lysate into multiple tubes. However, aliquotting into multiple tubes may causeRNA extraction efficiency to vary among tubes.


27.1.13


Extract RNA4. Let the lysate stand for 5 min at room temperature to let nucleoprotein complexes

dissociate.

5. Add 0.2 vol of chloroform to the RNA STAT-60 (i.e., 0.2 ml of chloroform to the1 ml of RNA STAT-60 solution).

6. Cap tightly and vortex for 15 sec. Let it stand for 2 to 3 min at room temperature.

7. Centrifuge 15 min at 12,000 ×g, 4◦C.

8. Transfer the upper aqueous phase to a 1.7-ml microcentrifuge tube.

The volume of the aqueous phase will be ∼0.6 vol of RNA STAT-60 used for cell lysis.

DNA and proteins remain in the interphase and organic phase. While you are pipettingout the aqueous phase, be careful not to disturb the white debris.

Precipitate RNA9. Add 0.5 volume of isopropanol (with respect to the volume of RNA STAT-60 used,

i.e., 150 μl of isopropanol when 300 μl of RNA STAT-60 is used). Mix by pipettingup and down and let stand 5 min at room temperature.

10. Centrifuge 10 min at 12,000 × g, 4◦C.

You will see RNA precipitated as a white pellet at the bottom of the tube.

11. Discard supernatant, and add 1 vol of 75% ethanol made with DEPC-treated waterto wash the RNA pellet. Mix by inverting the tube a couple of times.

12. Centrifuge 5 min at 7500 × g, 4◦C.

13. Carefully discard supernatant and air-dry the RNA pellet.

It is important to avoid drying the pellet completely, since that will reduce its solubility.

14. Dissolve the RNA pellet in nuclease-free water (or DEPC-treated water) so that theconcentration of total RNA will be around 1 to 2 μg/μl.

Generally, you will obtain about 5 to 10 μg of total RNA from 0.4 × 106 cells.

Adding 15 μl of nuclease-free water to the RNA pellet will be enough to dissolve the RNApellet.

15. Measure the concentration and check the quality of the total RNA using a NanoDropassay or a spectrophotometer with UV lamp.

APPENDIX 3D includes protocols for spectrophotometric determination of RNA con-centration.

The quality of the RNA can be estimated by measuring absorbance at 260 nm and 280nm and take a ratio 260/280 for purity. In general, a ratio ≥1.8 is considered to be goodquality for real-time PCR analysis (with 2.0 being the highest).

Treat with DNase I16. For a 15-μl reaction, mix the following reagents in a PCR tube at room temperature

(15 μl total volume). Prepare two tubes per sample so that one tube will be used forreverse transcription (RT) negative control.

4.0 μl 0.5 μg/μl total RNA1.5 μl 10× DNase buffer1.0 μl 2 U/μl RNase-free DNase I0.5 μl 1 U/μl RNase inhibitor8.0 μl RNase-free water (or DEPC-treated water).


Cultured Cells

27.1.14


17. Mix, then microcentrifuge briefly to bring the mixture to the bottom of the tube.Incubate the reaction mix at 37◦C for 60 min.

18. Heat-inactivate the DNase I by incubating the reaction mix at 80◦C for 10 min.Immediately place the tube on ice and leave it for 3 min.

19. Centrifuge the tube briefly to bring the solution to the bottom of the tube.

20. Store the reaction mix at −20◦C if necessary.

si A si B

10 nM siRNAs

si IR

Norm

aliz

ed r

ela

tive G

ene

A/H

RP

T e

xpre

ssio

n (

%)

120

100

80

60

40

20

0

No

rma

lize

d r

ela

tive

pro

tein

leve

l o

f G

en

e A

/tu

bu

lin(%

)

si A si B

10 nM siRNAs

si IR

120

100

80

60

40

20

0

tubulin

A antibody

si A si B si IR

A

B

Figure 27.1.3 Effects of siRNA target gene down-regulation. (A) Determination of siRNA silenc-ing efficiency by real-time qRT-PCR. Silencing of Gene A by si A or si B (10 nM) was determinedwith qRT-PCR. An irrelevant siRNA, si IR, was used as a negative control and used to normalizethe Gene A expression level. The expression levels of the gene A was also analyzed relative toHRPT expression level set as 100%. The effects of siRNAs were determined in three independenttransfections, and qRT-PCR reactions were performed in duplicate. (B) Determination of siRNAsilencing efficiency by immunoblot analyses. Silencing of a gene A by si A or si B (10 nM) wasdetermined at protein level. Quantification of protein expression levels are shown. An irrelevantsiRNA, si IR, was used as a negative control and used to normalize the Gene A expression level.The expression levels of the Gene A was also analyzed relative to tubulin expression level set as100%. The effects of siRNAs were determined in three independent transfections, and immunoblotanalyses were performed independently.


27.1.15


Synthesize cDNA21. Add following reagents to the 15-μl DNase I reaction mix in PCR tubes (18 μl total

volume):

2.0 μl 50 ng/μl random hexamers1.0 μl 10 mM dNTP mix.

22. Incubate the reaction mix at 65◦C for 5 min. In the meantime, prepare the solutiondescribed in step 23. After 5 min incubation, immediately place tubes on ice.

23. Add the following reagents to the 18-μl reaction mix (27 μl total volume). For RTnegative control, add 1.0 μl of DEPC-treated water in place of the MMLV-RT.

5.0 μl 5× first-strand buffer2.5 μl 0.1 M DTT0.5 μl 1 U/μl RNase inhibitor1.0 μl MMLV-RT.

24. Incubate the 27-μl cDNA synthesis mix at 27◦C for 10 min and 37◦C for 50 min.

25. Heat-inactivate MMLV-RT by incubating the synthesis mix at 70◦C for 15 min.Immediately place on ice and add 173 μl DEPC-treated water to bring the finalvolume to 200 μl.

Perform PCR26. Perform either end-point PCR (standard PCR, e.g., Kramer and Coen, 2001, with

determination of reaction product on a gel) or real-time qPCR (Bookout et al., 2006)to enable one to determine the gene silencing levels after siRNA treatment. In a PCRreaction, use 10 μl of synthesized cDNA to assess target RNA levels.

Representative qRT-PCR results are shown in Figure 27.1.3A.

SUPPORTPROTOCOL 2

ASSESSING siRNA TRANSFECTION EFFICIENCY BY IMMUNOBLOTTING

Protein levels of target genes after siRNA treatments are often determined to validatethe effects of designed siRNAs. To fully describe the effect of siRNA on protein levels,it is important to know the half-life of the target protein. With a protein that has along half-life, you may adjust the length of incubation with siRNAs and/or numbers oftransfections during the assay period or perform multiple cycles of transfection for along-term assay to see the effects of siRNAs at the protein level. Here, we describe celllysis for collecting total proteins for further analysis. Refer to UNIT 6.2 for immunoblottingprocedures. Prepare total protein from siRNA-treated cells for determination of the effectsof transfection experiments, and mock-treated cells as a control for protein detection.

Materials

siRNA-treated cell culture in 12-well plate (Basic Protocol 2)Mock-treated cell cultureCalcium- and magnesium-free Dulbecco’s phosphate-buffered saline (CMF-DPBS;

Cellgro, cat. no. 21-031 CV, or see APPENDIX 2A), 4◦CRIPA buffer (see recipe) with freshly added 1× protease inhibitor cocktail (Roche),

ice coldEnd-over-end rotator (e.g., Labquake from Thermo Scientific)

Additional reagents and equipment for Bradford protein assay (APPENDIX 3H) andimmunoblotting (UNIT 6.2)


Cultured Cells

27.1.16


Lyse cells1. At the end of siRNA treatment (Basic Protocol 2), aspirate medium from the cell

culture. Wash cells once with 0.5 ml ice-cold CMF-DPBS. Keep the plate on ice.Also perform this and all subsequent steps on a mock-transfected culture as a control.

For cells grown in suspension, collect the cell suspension, centrifuge 5 min at 200 × g,4◦C, and collect cell pellet. Wash the pellet with 1 ml ice-cold CMF-DPBS, and centrifugeagain at 4◦C.

2. Lyse the cells by directly adding ice-cold RIPA buffer with freshly added 1× proteaseinhibitor cocktail (1 ml per 2–5 × 106 cells, e.g., 300 μl per well on a 12-well plate).Let it sit ∼ 2 min on ice so that the cells detach from the surface.

3. Collect cells with a pipettor and 1000-μl pipet tip by tilting the plate on ice, andtransfer to a cold 1.7-ml microcentrifuge tube.

It is critical to keep cells on ice to prevent protein degradation.

If necessary, use a scraper to collect cells. Adding more RIPA buffer may lower totalprotein concentrations.

4. Incubate the cells for 15 min at 4◦C with gentle agitation on an end-over-end rotator.

5. Microcentrifuge 15 min at 14,000 rpm, 4◦C, and transfer supernatant to a new, cold1.7-ml tube.

6. Measure total protein concentration with Bradford assay (APPENDIX 3H), and aliquotthe lysate into several tubes at ∼50 or 100 μl/tube to avoid multiple freeze-thawcycles. Store the aliquots at −80◦C. 7. Perform immunoblotting (UNIT 6.2).

Representative results are shown in Figure 27.1.3B.

SUPPORTPROTOCOL 3

ASSESSING siRNA TRANSFECTION EFFICIENCY BY A DUAL-REPORTERASSAY SYSTEM

Prevalidation of siRNA potency and optimization of transfection efficiency can be per-formed by developing reporter genes fused to a target gene. For instance, green fluo-rescent protein (GFP) fluorescence in cell culture can be quantified by flow cytometry,or a FLAG epitope tag can be used to detect the change in protein expression levelsby immunoblot analysis. However, the former method requires that a FACS facilitybe readily available, and the latter tends to be time consuming. Conversely, a dual-luciferase reporter assay system by Promega accelerates the identification of potentsiRNAs among designed siRNAs in 24 to 48 hr by detecting changes in expressionof a reporter gene. With this system, the transfection of the dual-luciferase reportervectors (psiCHECK vectors, Promega), carrying the target sequence, into mammaliancell lines leads to expression of the target sequence fused to the reporter gene, whichis translated into the functional Renilla luciferase (http://www.promega.com). The cat-alytic activity of Renilla luciferase measured by bioluminescent reactions is used todetermine how effective siRNAs initiate RNAi by observing reductions in the enzymaticactivity.

Simultaneous transfection of two plasmids, one expressing a target gene and anotherexpressing a control protein, can provide evaluation of siRNA potency by normaliz-ing expression levels of the reporter protein to the control protein at time of transfec-tion. However, results may vary from transfection to transfection due to inconsistenttransfection efficiencies between the reporter and control plasmids. The psiCHECK-2(Fig. 27.1.4, Promega) contains an additional internal control reporter gene that improvesthe reproducibility and that enables evaluating well-to-well variation of transfection(http://www.promega.com). The Renilla luciferase is expressed from the vector


27.1.17


psiCheck2-GFP-sense6524 bp

hFluc

SV40late polyA

HSV-TK prom

intron1

AmpR hRluc

SV40prom

I-Rluc-3F primer

GFPfragment, sensesynth poly A

S1 siRNA site

T7

Figure 27.1.4 A reporter plasmid psiCHECK-2 (Promega) containing a target site GFP S1. Areporter plasmid psiCHECK2-GFP-sense was prepared by cloning a PCR fragment that containsthe target sequence complementary to siRNAs into the multiple cloning region of the psiCHECK-2(S1 siRNA site). The psiCHECK-2 contains an additional internal control reporter gene, fireflyluciferase (hluc+), which is used to normalize the Renilla luciferase activity. Depending on ex-perimental settings, the siRNAs can be either cotransfected or transfected sequentially. Smallinterfering RNA silencing efficiency was evaluated by measuring the activities of firefly and Renillaluciferases sequentially from a single sample using a luminometer (http://www.promega.com).

containing the target gene sequence cloned into the multiple cloning site located inthe 3′ untranslated region (UTR) of a humanized Renilla luciferase (hRluc) reporter gene(http://www.promega.com). The firefly luciferase (hluc+) expressed from the same vec-tor is used to normalize the Renilla luciferase activity, serving as the baseline response(http://www.promega.com). Depending on experimental settings, the siRNAs can be ei-ther cotransfected or transfected sequentially. In this protocol, cotransfection of siRNAsand the psiCHECK-2 vector is described in detail.

Prepare a reporter plasmid by cloning a PCR fragment that contains the target sequencecomplementary to siRNAs into the multiple cloning region of the psiCHECK-2 (S1siRNA site, Fig. 27.1.4). The efficiency of siRNA silencing is evaluated by measuringthe activities of firefly and Renilla luciferases sequentially from a single sample usinga manual luminometer or a luminometer with one or two reagent injectors. Promegaprovides the Dual-Luciferase Reporter Assay system, containing reagents necessary forcell lysis and measuring Renilla and firefly luciferase activities. Refer to the manu-facturer’s protocol for more information (http://www.promega.com).

In this section, we describe cotransfection of mammalian cell culture with psiCHECK-2reporter plasmid containing a target sequence and siRNAs for validation of the mosteffective siRNA duplexes among siRNAs, and the lowest concentration that resultsin efficient silencing. To find optimal siRNA concentrations, one should test at leastsix different concentrations (e.g., 0, 0.05, 0.5, 1.0, 20, and 45 nM) for each siRNAwith a constant amount of the reporter plasmid as a starting point. The procedure de-scribed here refers to transfection of cells seeded in 48-well plates at two differentlevels of confluence (one at 75% and another at 90% confluency) with the reporterplasmid in addition to the siRNAs. See below for the summary of compositions fortransfection reaction mixes shown in Table 27.1.5. Transfection procedures deviatingfrom the previous section (with 12-well plates) are emphasized in this section (see theflow chart in Fig. 27.1.5). Once the conditions are optimized, you may perform transfec-tion in a different format (e.g., 6- or 12-well plates) to accommodate your subsequent


Cultured Cells

27.1.18


Table 27.1.5 Transfection Reaction Mixes for Six Different siRNA Concentrations (48-WellPlates)

siRNA finalconc. (nM)a

siRNA per well(ng)b

psiCHECK reporterplasmid (ng)

Stuffer DNAplasmidc

Total nucleic acidamount (ng)

0 0 (0 ng) 40 120.00 160

0.05 10 fmol (0.134 ng) 40 119.87 160

0.5 100 fmol (1.34 ng) 40 118.66 160

1.0 200 fmol (2.67 ng) 40 117.30 160

20 4 pmol (53.5 ng) 40 66.50 160

45 9 pmol (120 ng) 40 0 160asiRNA concentrations were calculated for the total volume of 200 μl per well of a 48-well plate.bsiRNA (ng) was calculated with a dsRNA, mol. wt. = 1.34 × 104 g/mol.cAny cloning vectors not containing eukaryotic promoters (e.g., pBluescript, pCR2.1, etc) can be used to adjust the totalamount of nucleic acid.

experimental procedures (e.g., when collecting total proteins for immunoblot analysesor isolating total RNA for qRT-PCR, seed cells in 6- or 12-well plates while keeping theoptimal percent confluency and optimal siRNA concentrations consistent at the time oftransfection).

NOTE: Transfection reagent preparations should be carried out in a tissue culture hood.

Materials

10 μM siRNA working solution (Basic Protocol 1)10 μM irrelevant siRNA as negative controlpsiCHECK-2 vector with target cloned into the MCS (psiYTC)Stuffer DNA plasmid (see Basic Protocol 2)Opti-MEM I (a reduced-serum medium from Invitrogen), or serum-free growth

mediumLipofectamine 2000 (Invitrogen)Mammalian cells seeded in two 48-well platesComplete medium with 10% FBS (e.g., complete DMEM/10% FBS; see recipe),

without antibiotics, 37◦CDual-Luciferase Reporter Assay System (Promega)

Orbital shakerLuminometer (e.g., Veritas Microplate Luminometer)

NOTE: All solutions and equipment coming into contact with living cells must be sterile,and aseptic technique should be used accordingly.

NOTE: All cell culture incubations should be carried out in a 37◦C, 5% CO2 humidifiedincubator.

Prepare DNA master mixes1. Prepare six tubes properly labeled (0, 0.05, 0.5, 1.0, 20, 45 nM) for each corre-

sponding siRNA mix, add each reagent as described in Table 27.1.6 and step 1 inFig. 27.1.5, and bring the final volume to 16 μl per well with Opti-MEM I. Mixgently.

It is strongly recommended to perform transfections in duplicate. From this point forward,volumes of reagents are calculated for duplicate transfections.


27.1.19


step 1: preparation

of DNA mix

step 2: preparation

of siRNA mixes

step 3: preparation of

siRNA/DNA mix

70.4 μl of D6 per tube

step 6: transfection

tube: D1 D2 D3 D4 D5

5 min

incubation

20 min

incubation

psiYTC (ng):

stuffer DNA (ng):

total vol (μl):

88 μl per tube

40 μl per well

1 2 3 4 5 6

1 42 5 63

576 576 576 576 576 576

1728 1726 1709 1689 957.6 0

230.4 230.4 230.4 230.4 230.4 230.4

step 4: preparationof LipofectamineTM

2000 solution

D6

step 5: liposome

fomation

siRNA-B siRNA-C

75% 90%seeding density:

si-RNA

siRNA-B

siRNA-C

1 42 5 63

1 42 5 63

1 42 5 63

1 42 5 63

1 42 5 63

1 2 3 4 5 61 2 3 4 5 6SiRNA-A

si-RNA

siRNA-B

siRNA-C

siRNA-BSiRNA-A

siRNA (nM):total vol (μl):

tube:

1 2 3 4 5 6

1 2 3 4 5 6

1 2 3 4 5 6 1 2 3 4 5 6siRNA-C

0 0.05 0.5 1.0 20 4517.6 17.6 17.6 17.6 17.6 17.6

Figure 27.1.5 Transfection of mammalian cells with psiCHECK2-GFP-sense and siRNAs (48-well plates).Stepwise procedures of transfection of mammalian cells seeded at two different cell densities (75% and 90%)a day prior to transfection are shown. After choosing five different concentrations of siRNAs (0 to 45 nM) totransfect the cells, prepare DNA master mixes and siRNA mixes separately in the Opti-MEM (or a serum-freemedium) as indicated (steps 1 and 2). Next, add 70.4 μl of D1 to tubes containing 0 nM of siRNAs A, B, or C(tubes A1, B1, and C1). Repeat with D2 to D6 to prepare siRNA/DNA mixes (step 3). Prepare proper amountof Lipofectamine 2000 solution (three tubes of 576 μl for six tubes of siRNA/DNA mixes, step 4). After 5 minincubation, add 88 μl of Lipofectamine 2000 solution to each siRNA/DNA mix (step 5). Incubate for 20 min toallow liposome formation, then add 40 μl of the liposome solution to two wells on the 75% seeding densityplate and two wells on the 90% seeding density plate (step 6). Transfection reagent preparations should bedone in a tissue culture hood.


Cultured Cells

27.1.20


Table 27.1.6 DNA Master Mixes for 0, 0.05, 0.5, 1.0, 20, and 45 nM siRNAs for Dual ReporterAssays

Per well For 14.4×

TubeFor siRNAfinal conc.

(nM)a

psiYTCreporterplasmid

(ng)b

StufferDNA

plasmid(ng)c

Totalvolumeper well

(μl)


(ng)b

StufferDNA

plasmid(ng)c

Totalvolume perwell (μl)

D1 0 40 120.00 16 576 1728 230.4

D2 0.05 40 119.87 16 576 1726 230.4

D3 0.5 40 118.66 16 576 1709 230.4

D4 1.0 40 117.30 16 576 1689 230.4

D5 20 40 66.50 16 576 957.6 230.4

D6 45 40 0 16 576 0 230.4asiRNA concentrations were calculated for the total volume of 200 μl per well of a 48-well plate.bThe optimal amount of psiCHECK-2 vector with your target site (psiYTC) should also be experimentally determined.Here an example of 40 ng of psiYTC is used.cAny cloning vectors not containing eukaryotic promoters (e.g., pBluescript, pCR2.1, etc) can be used to adjust the totalamount of nucleic acid.

Table 27.1.7 siRNA Mixes for Six Different siRNA Concentrations

Per well For 14.4×

TubeFor siRNAfinal conc.

(nM)a


(ng)b

StufferDNA

plasmid(ng)c

Totalvolumeper well

(μl)


(ng)b

StufferDNA

plasmid(ng)c

Totalvolume perwell (μl)

D1 0 40 120.00 16 576 1728 230.4

D2 0.05 40 119.87 16 576 1726 230.4

D3 0.5 40 118.66 16 576 1709 230.4

D4 1.0 40 117.30 16 576 1689 230.4

D5 20 40 66.50 16 576 957.6 230.4

D6 45 40 0 16 576 0 230.4asiRNA concentrations were calculated for the total volume of 200 μl per well of a 48-well plate.

2. For three siRNAs—two test siRNAs and an irrelevant siRNA—and two 48-wellplates with different cell densities, prepare 230.4 μl (14.4× volume) of DNA mastermix per tube.

The 230.4 μl of DNA master mix per tube contains 0.091× volume excess of the volumeof the DNA mix added per siRNA mix tube (230.4 μl = 17.6 μl × 1.091 × 4 wells ×3siRNA concentrations).

Prepare siRNA mixes3. Prepare 20 μl of 0.1 and 1 μM siRNA by diluting 2 μl of the 10 μM siRNA

working solution in 18 μl of Opti-MEM I and 2 μl of the 1 μM siRNA solutionin 18 μl of Opti-MEM I so that you have three different concentrations for eachsiRNA.

4. Prepare three sets of six tubes properly labeled (0, 0.05, 0.5, 1.0, 20, 45 nM) for aset per siRNA, add reagents to each tube as described in Table 27.1.7 and step 2 in


27.1.21


Fig. 27.1.5, and bring the final volume with Opti-MEM I to 17.6 μl per well. Mixgently.

To perform transfections in duplicate, and since the cells are seeded in two 48-well plateswith different cell densities, prepare 17.6 μl (4.4 × volume) of siRNA mix for 4 wells.

The 17.6 μl of siRNA/DNA mix per tube contains 0.1× volume excess of the actual volumeof siRNA mix used for a well (17.6 μl = 4.0 μl × 1.1 × 4 wells).

Prepare siRNA/DNA mixes5. Add 70.4 μl of DNA master mixes to corresponding siRNA mixes [i.e., add 70.4 μl

of the DNA master mix for 45 nM siRNA (tube D6) to tubes containing 17.6 μlof 45 nM siRNA-A, siRNA-B, and irrelevant siRNA (siRNA-C) so that the totalvolume now is 88 μl per tube]. Add other DNA master mixes for 0, 0.05, 0.5, 1, and20 nM to corresponding siRNA mix tubes (step 3 in Fig. 27.1.5).

Prepare Lipofectamine 2000 solution6. Mix Lipofectamine 2000 gently and centrifuge briefly to bring the solution to the

bottom.

7. Dilute 0.5 μl in 20 μl Opti-MEM I per well.

For six different concentrations of an siRNA at four wells per concentration, prepare 576μl of Lipofectamine 2000 solution (=14.4 μl Lipofectamine 2000 in 576 μl Opti-MEM I)for 24 wells (=6 siRNA concentrations × duplicate × 2 plates). Prepare two more tubesof the Lipofectamine 2000 solution for other siRNAs as well (total of three tubes; step 4,Fig. 27.1.5).

The 576 μl of Lipofectamine 2000 solution contains 0.091× volume excess of the volumeof the Lipofectamine 2000 solution to be added to the siRNA/DNA mix per tube (576 μl= 88 μl × 1.091 × 6 siRNA concentrations).

8. Mix gently and incubate for 5 min at room temperature.

Form liposomes9. Prepare DNA/siRNA/lipid complex (liposome) by adding 88 μl of the Lipofectamine

2000 solution to 88 μl of the siRNA/DNA mix. Mix gently and incubate for 20 minat room temperature for liposome formation (step 5, Fig. 27.1.5).

Transfect cells10. Add 40 μl of the liposome solution drop-wise to each well containing cells and

160 μl medium (step 6, Fig. 27.1.5A). Mix gently by rocking the plate back andforth, and left to right several times.

11. Incubate the cells at 37◦C, 5% CO2 until cells are ready for harvesting.

Generally the cells are harvested at 24 to 48 hr.

Lyse cells12. Prepare ∼8 ml of 1× passive lysis buffer from 5× passive lysis buffer stock,

which is part of the Dual-Luciferase Reporter Assay System (Promega) for 96 wells(=75 μl/well × 48 wells × 2 plates + extra).

13. Add 75 μl per well and shake the culture plates on an orbital shaker for 15 min atroom temperature.

The rocking motion will ensure covering the cells evenly and completely with the 1×passive lysis buffer.

14. Immediately proceed to dual-luciferase assays (using kit from Promega and lumi-nometer) or store samples at −80◦C.


Cultured Cells

27.1.22


1.2

1.0

0.8

0.6

0.4

0.2

0.0

No

rma

lize

d F

Lu

c/R

Lu

c

0 nM 0.05 nM 0.5 nM 1.0 nM 20 nM 45 nM

siRNA-A siRNA-B

Figure 27.1.6 Determination of transfection efficiency by the dual-luciferase assays. The ef-ficiency of siRNA silencing was evaluated by measuring the activities of firefly and Renilla lu-ciferases. The relative luminescence units were normalized to the negative control (0 nM) set as100%. Results showed concentration dependent silencing efficiency of the two siRNAs A andB. Once an optimal concentration of a siRNA is determined, perform your experiment with thehighly potent siRNA(s) at optimal cell density and concentrations at least three times to assessreproducibility.

15. Once you optimize the transfection conditions, perform your experiment with themost potent siRNAs at optimal cell density and concentrations at least three times toassess reproducibility.

Representative results are shown in Figure 27.1.6.

SUPPORTPROTOCOL 4

ANNEALING SINGLE-STRANDED OLIGOS FOR A DOUBLE-STRANDEDRNA

Depending upon the purpose of the experiments (e.g., siRNA structural modifications,chemical modifications on siRNA strands, etc), you may obtain siRNAs as single-stranded RNA oligos or duplex siRNAs. When single-stranded oligos are obtained, youshould anneal equal amounts of each single-stranded oligo to generate a double-strandedRNA.

NOTE: Gloves and plastic ware (no glass) should be used to avoid RNA degradation andcross-contamination of samples.

Materials

Lyophilized single-stranded sense and antisense oligos (Basic Protocol 1)RNase-free (e.g., DEPC-treated) H2O or TE buffer (APPENDIX 2A)10× annealing buffer (see recipe)Nuclease-free (e.g., DEPC-treated) H2O

95◦C heat blockNanoDrop 1000 (Thermo Fisher Scientific) or UV/Vis spectrophotometer

Additional reagents and equipment for spectrophotometric determination of RNAconcentration (APPENDIX 3D)


27.1.23


Prepare for annealing1. Dissolve the single-stranded RNA oligos in nuclease-free water or TE buffer to a

final concentration of 100 μM. Make sure the oligos are completely dissolved. Placethem on ice.

It is recommended to measure actual concentrations of single-stranded oligos after dis-solving by measuring A260 with a NanoDrop or a spectrophotometer with UV lamp(APPENDIX 3D) and assess the purity of your RNA oligos before use.

Anneal the oligos2. For a 50-μl total volume reaction, mix the following reagents in a 1.7-ml sterile

microcentrifuge tube at room temperature to generate a 25 μM dsRNA solution.

12.5 μl 100 μM sense RNA oligo12.5 μl 100 μM antisense RNA oligo5 μl 10× annealing bufferNuclease-free H2O for 50 μl.

3. Incubate the reaction mix at 95◦C for 4 min.

4. Microcentrifuge the tube briefly to bring the solution to the tube bottom, and removethe heat block from the heat source and set on your lab benchtop.

Protect the surface of the bench top from heat by placing an insulator between the heatblock and the bench top.

5. Place the tube back in the heat block to slowly cool to room temperature by allowingthe heat block to reach ambient temperature.

This will gradually anneal the single-stranded oligos to dsRNA. It will take about 1.5 to2 hr to reach room temperature.

6. Briefly mix and centrifuge the solution and place on ice.

7. Dilute the dsRNA to 10 μM with RNase-free water and use as a working solution.Store the remaining sample up to 6 months at −20◦C or 2 to 3 years at −80◦C as themaster stock.

Double-stranded siRNA is diluted in RNase-free water for short-term storage or 1×RNase-free siRNA buffer (100 mM potassium acetate, 30 mM HEPES, pH 7.5) for long-term storage. The siRNA buffer can also be purchased from various vendors.

It is strongly recommended to verify the quality of the annealed dsRNA using polyacry-lamide gel electrophoresis (see Support Protocol 5).

SUPPORTPROTOCOL 5

CHECKING THE INTEGRITY OF dsRNAs

Before proceeding to transfection, it is strongly recommended to verify the integrity ofthe dsRNA annealed above using non-denaturing polyacrylamide gel electrophoresis.The presence of free single-stranded oligos will not only reduce the amount of siR-NAs used in the transfection but also, more significantly, it will affect the silencingefficiency.

Materials

10× TBE buffer (APPENDIX 2A)40% (w/v) 19:1 acrylamide:bisacrylamide (AC:BC) solutionTEMED10% (w/v) ammonium persulfate (APS) solutionAnnealed dsRNAs (Support Protocol 4)4× native gel loading dye (see recipe)10 mg/ml ethidium bromide solution


Cultured Cells

27.1.24


14 × 16–cm gel electrophoresis apparatusPower supplyFlat gel loading tipsUV lamp

NOTE: When a minigel is used, adjust the volume and time of gel running.

Prepare gel apparatus1. Assemble a glass plate sandwich on a clean surface. Make sure the plates are properly

aligned with spacers to avoid leakage.

2. Prepare 35 ml of 8% polyacrylamide nondenaturing solution by mixing the following:

24.5 ml Milli-Q water3.5 ml 10× TBE buffer7 ml 40% (w/v) AC:BC15 μl TEMED.

3. Add 150 μl of 10% APS solution to the gel solution and mix quickly, but thoroughly,by swirling and avoid foaming.

To avoid polymerization while casting the gel, make sure to prepare the solution at roomtemperature.

4. Working quickly, fill the gel mold (without the comb) to 1 mm below the top ofthe smaller piece of glass using a disposable transfer pipet. Hold the tip of the pipetagainst the large piece of glass and at the end of the glass so the solution fills alongthe spacer. Insert the comb to its fully seated position. Allow gel to polymerize 10to 15 min.

This will cause some of the solution to overflow. Add more if necessary.

5. Assemble the 8% nondenaturing polyacrylamide gel into the running apparatus andpre-run for ∼0.5 hr at 200 V.

6. Prepare dsRNA samples by diluting part of the 10 μM working solution to a finalconcentration of 1 μM.

7. In a 1.7-ml tube, mix 1 μl of 10 μM dsRNA with 2 μl 1× TBE buffer and 1 μl 4×native gel loading dye. In another tube, mix 1 μl of 1 μM dsRNA with 2 μl 1× TBEand 1 μl 4× native gel dye.

Run and analyze the gel8. Load samples at the bottom of the wells with flat gel loading tips.

9. Run the gel for 1.5 to 2 hr at 200 V.

10. Disassemble the gel and stain with 0.4 μg/ml ethidium bromide solution (preparedfrom 10 mg/ml stock) for 20 min.

11. Visualize dsRNA samples under a UV lamp.

You should avoid leaving the gel in the stain solution too long because RNA samples willdiffuse out from the gel and may no longer be detectable under the UV lamp.

You should see results similar to those shown in Figure 27.1.7 when you perform nonde-naturing polyacrylamide gel analysis.When the annealing is successful, you should seea detectable higher-molecular-weight band, which represents annealed dsRNA, and noremaining single-stranded oligo, which is seen as a lower-molecular-weight band, notshown in the figure.


27.1.25


dsRNA

1 pm

ol

10 p

mol

Figure 27.1.7 Verification of dsRNA integrity. The integrity of double-stranded RNAs was deter-mined by gel electrophoresis. Either 1 pmol or 10 pmol of a 21-nt long dsRNA were loaded on a8% non-denaturing polyacrylamide gel. Successful dsRNA annealing should result in a detectablehigher-molecular-weight band and no remaining single-stranded oligo as a low-molecular-weightband, which was not detected in the gel.

REAGENTS AND SOLUTIONSUse deionized, distilled water in all recipes and protocol steps. For common stock solutions, seeAPPENDIX 2A; for suppliers, see SUPPLIERS APPENDIX.

Annealing buffer, 10×100 mM Tris·Cl, pH 8.0 (APPENDIX 2A)1.5 M NaClStore up to 2 to 3 years at 4◦C

Complete DMEM/10% (v/v) FBS

Dulbecco’s modified Eagle medium, high-glucose formulation supplemented with:10% (v/v) FBS2 mM L-glutamine1 mM sodium pyruvate100 U/ml penicillin100 μg/ml streptomycinStore up to 3 months at 4◦C

For complete DMEM/10% FBS without antibiotics, omit adding penicillin and strepto-mycin.

Native gel loading dye, 4×0.1% (w/v) bromphenol blue0.1% (w/v) xylene cyanol FF0.1% (w/v) Orange G1 mM EDTA10 mM Tris·Cl, pH 7.5 (APPENDIX 2A)40% (v/v) glycerolStore up to 2 to 3 years at 4◦C (or long-term at −20◦C)


Cultured Cells

27.1.26


RIPA buffer

150 mM NaCl50 mM Tris·Cl, pH 8.0 (APPENDIX 2A)1% (v/v) NP-400.25% (v/v) sodium deoxycholate0.1% (w/v) SDS1× protease inhibitor cocktail (Roche), added freshAdjust pH to 8.0Store up to 1 year at 4◦C

COMMENTARY

Background InformationThe mechanism of RNA interference

(RNAi) was first described in detail inCaenorhabditis elegans by Andrew Fire andCraig C. Mello (Fire et al., 1998), who latershared the Nobel Prize in Physiology orMedicine in 2006. Soon after, approximately21 nucleotide-long small interfering RNAs(siRNAs) were shown to mediate sequence-specific gene silencing mammalian cells andDrosophila (Zamore et al., 2000; Elbashiret al., 2001b). The selective and immediateeffect of RNAi on the gene silencing withinliving cells made it a valuable tool for investi-gating gene function and initiated a new waveof reverse genetics.

The RNAi pathway is found in many eu-karyotes including plants and animals. It isa small RNA–mediated gene silencing pro-cess controlled by the RNA induced silenc-ing complex (RISC) activity at the post-transcriptional level. In living cells, smallRNAs have been shown to participate in: (1)regulating gene expression, (2) maintaininggenome integrity, (3) controlling cell growth,differentiation, and cellular metabolism, and(4) defending from viral invasion. Biochemi-cal analysis of the RNAi pathway led us to re-alize that introducing double-stranded RNAs(dsRNAs) with sequences complementary totarget transcripts can elicit an RNAi response,demonstrating the versatility of the process incells.

RNAi can be described as having at leasttwo well defined steps: the initiation step,where the ribonuclease (RNase) III enzymeDicer processes dsRNAs into 21- to 22-nucleotide (nt)–long duplexes (Bernstein et al.,2001), and the effector step, in which Arg-onaute 2 (Ago 2), a core endonuclease of theRISC, executes RNAi (Liu et al., 2004; Meis-ter et al., 2004; Rivas et al., 2005). With ex-ogenously introduced 21-nt siRNAs, the Dicerprocessing step is skipped and directly incor-porated into RISC, where Ago2 carries out

cleavage of the target transcript. Conversely,dsRNAs longer than 25 bp can be used to trig-ger RNAi response by undergoing Dicer pro-cessing. It is apparent that not only siRNA se-quences that recruit RISC to target transcripts,but also incorporation of siRNAs into RISC,become critical determinants for the RNAi ef-ficiency.

The protocol presented here describes ba-sic approaches that one can use as a startingpoint. It is important to optimize transfectionconditions after empirical determinations.

Critical Parameters

siRNA sequencesIt is common to observe various degrees of

silencing efficiency among designed siRNAs.This could simply be due to insufficient in-corporation of siRNA into RISC, or it couldbe due to poor interaction between the siRNAand target transcript that might form secondarystructure, making RISC inaccessible to the tar-get sequence. To find target sequences thatare readily accessible, it is advisable to de-sign multiple siRNAs targeting different sitesand assay the siRNAs at several concentra-tions. Some poorly designed siRNAs can stillelicit RNAi when they are used in extremelyhigh concentrations, a potential cause of cellu-lar toxicity. In this protocol, 75 nM of siRNAsare included as an example to determine thegene-silencing efficiency. If designed siRNAsshow some knockdown effects only at higherconcentrations, you may consider redesigningsiRNAs for the abovementioned reasons. Alsothere are siRNA design algorithms that con-sider the secondary structure of target tran-scripts (Ding et al., 2004; Yiu et al., 2005),e.g., siRNA Site selector (Heale et al., 2005;http://www1.infosci.coh.org/hpcdispatcher/).

Although an siRNA is designed against aspecific target mRNA site, it can cause silenc-ing of unspecific genes, termed off-target ef-fects. If a sequence match is found between


27.1.27


a guide strand and an mRNA in the 3′ UTRs,the first 6 to 7 nucleotides of the guide strandcan lead to translational inhibition via themicroRNA-mediated pathway. Each strand ofthe siRNA has the potential to be assembledinto RISC as a guide, so that it doubles thechance of creating off-target effects. If this issuspected, the psiCHECK-2 vector with thetarget sequence inserted in the antisense ori-entation can be used for the assessment.

Design of Dicer substrate siRNAs (D-siRNAs; Rose et al., 2005) described in thisunit emanated from ideas of (1) inducing Dicerprocessing to increase the possibility of assem-bly into RISC, and (2) reducing a likelihoodof passenger-strand incorporation by introduc-ing structural asymmetry. However, it is diffi-cult to completely eliminate all the potentialoff-targets. There are chemical and structuralmodifications such as 2′ O-methyl at a fewpositions that reduce the off-target effects.

Transfection conditionsIn this protocol, the use of Lipofectamine

2000 has been described as a transfectionreagent. Certain cell types may not achievehigh levels of transfection efficiency with thisreagent. If so, there are several other transfec-tion reagents available from Invitrogen (e.g.,Lipofectamine RNAiMax) and Mirus (e.g.,TransIT-siQUEST reagent), to name a few. Itis also important to adjust the seeding densityfor optimization of the transfection condition.

Validations of siRNA silencing efficiencyTo validate the silencing efficiency of the

designed siRNAs, it is critical to assess thelevel of the target mRNA, since there couldbe a lag between degradation of mRNA andactual reduction in protein level. If necessary,you may need to perform multiple cycles oftransfection to observe effects of siRNAs atthe protein level. It is also strongly recom-mended to perform validations on both mRNAand protein levels (Support Protocols 1 and 2,respectively).

Anticipated ResultsWell designed siRNA-mediated silencing

of a given gene of interest can result in greaterthan 95%, if not 100%, reduction in the mRNAand protein levels.

Time ConsiderationsSynthesis of siRNA from ordering to re-

ceiving may take ∼1 week, while annealingand verification take ∼4.5 to 5 hr. Seedingcells in multiple-well plates takes ∼1 hr, and

transfection reagent preparation and transfec-tion takes ∼1.5 hr. Time for maintaining cul-tured cells varies. For dual-luciferase reporterassays, allow ∼1.5 hr from cell lysis to biolu-minescence measurements.

For RT-PCR, it will take ∼1 hr for RNAextraction, ∼1 hr for DNase treatment, ∼1.5hr for cDNA synthesis, and ∼2.5 hr for real-time PCR. For immunoblotting, time consider-ations are ∼1 hr for preparation of SDS-PAGEgel, ∼1.5 to 3 hr for electrophoresis, ∼2 hr forprotein transfer, and ∼4 to 5 hr for blocking aPVDF membrane and antibody incubation.

The total time required to identify a validsiRNA for a gene can be ∼ 2 weeks.

Literature CitedAmarzguioui, M., Holen, T., Babaie, E., and Prydz,

H. 2003. Tolerance for mutations and chemicalmodifications in a siRNA. Nucleic Acids Res.31:589-595.

Bernstein, E., Caudy, A.A., Hammond, S.M., andHannon, G.J. 2001. Role for a bidentate ribonu-clease in the initiation step of RNA interference.Nature 409:363-366.

Bookout, A.L., Cummins, C.L., Kramer, M.F.Pesola, J.M., and Mangelsdorf, D.J. 2006.High-throughput real-time quantitative reversetranscription PCR. Curr. Protoc. Mol. Biol.73:15.8.1-15.8.28.

Chalk, A.M. and Sonnhammer, E.L. 2008. siRNAspecificity searching incorporating mismatchtolerance data. Bioinformatics 24:1316-1317.

Chalk, A.M., Warfinge, R.E., Georgii-Hemming,P., and Sonnhammer, E.L. 2005. siRNAdb: Adatabase of siRNA sequences. Nucleic AcidsRes. 33:D131-134.

Ding, Y., Chan, C.Y., and Lawrence, C.E. 2004.Sfold web server for statistical folding and ra-tional design of nucleic acids. Nucleic Acids Res.32:W135-141.

Elbashir, S.M., Harborth, J., Lendeckel, W., Yalcin,A., Weber, K., and Tuschl, T. 2001a. Duplexes of21-nucleotide RNAs mediate RNA interferencein cultured mammalian cells. Nature 411:494-498.

Elbashir, S.M., Lendeckel, W., and Tuschl, T.2001b. RNA interference is mediated by 21-and 22-nucleotide RNAs. Genes Dev. 15:188-200.

Elbashir, S.M., Martinez, J., Patkaniowska, A.,Lendeckel, W., and Tuschl, T. 2001c. Func-tional anatomy of siRNAs for mediating effi-cient RNAi in Drosophila melanogaster embryolysate. EMBO J. 20:6877-6888.

Fire, A., Xu, S., Montgomery, M.K., Kostas, S.A.,Driver, S.E., and Mello, C.C. 1998. Potentand specific genetic interference by double-stranded RNA in Caenorhabditis elegans.Nature 391:806-811.

Gong, W., Ren, Y., Zhou, H., Wang, Y., Kang,S., and Li, T. 2008. siDRM: An effective and


Cultured Cells

27.1.28


generally applicable online siRNA design tool.Bioinformatics 24:2405-2406.

Gregory, R.I., Chendrimada, T.P., Cooch, N., andShiekhattar, R. 2005. Human RISC couples mi-croRNA biogenesis and posttranscriptional genesilencing. Cell 123:631-640.

Heale, B.S., Soifer, H.S., Bowers, C., and Rossi,J.J. 2005. siRNA target site secondary structurepredictions using local stable substructures. Nu-cleic Acids Res. 33:e30.

Kramer, M.F. and Coen, D.M. 2001. Enzymaticamplification of DNA by PCR: Standard proce-dures and optimization. Curr. Protoc. Mol. Biol.15.1.1-15.1.14.

Liu, J., Carmell, M.A., Rivas, F.V., Marsden, C.G.,Thomson, J.M., Song, J.J., Hammond, S.M.,Joshua-Tor, L., and Hannon, G.J. 2004. Arg-onaute2 is the catalytic engine of mammalianRNAi. Science 305:1437-1441.

Liu, Q., Rand, T.A., Kalidas, S., Du, F., Kim, H.E.,Smith, D.P., and Wang, X. 2003. R2D2, a bridgebetween the initiation and effector steps of theDrosophila RNAi pathway. Science 301:1921-1925.

Meister, G., Landthaler, M., Patkaniowska, A.,Dorsett, Y., Teng, G., and Tuschl, T. 2004. Hu-man Argonaute2 mediates RNA cleavage tar-geted by miRNAs and siRNAs. Molec. Cell15:185-197.

Owczarzy, R., Tataurov, A.V., Wu, Y., Manthey,J.A., McQuisten, K.A., Almabrazi, H.G.,Pedersen, K.F., Lin, Y., Garretson, J.,McEntaggart, N.O., Sailor, C.A., Dawson, R.B.,and Peek, A.S. 2008. IDT SciTools: A suite foranalysis and design of nucleic acid oligomers.Nucleic Acids Res. 36:W163-W169.

Ren, Y., Gong, W., Zhou, H., Wang, Y., Xiao,F., and Li, T. 2009. siRecords: A database ofmammalian RNAi experiments and efficacies.Nucleic Acids Res. 37:D146-D149.

Reynolds, A., Leake, D., Boese, Q., Scaringe, S.,Marshall, W.S., and Khvorova, A. 2004. Ratio-nal siRNA design for RNA interference. Nat.Biotechnol. 22:326-330.

Rivas, F.V., Tolia, N.H., Song, J.J., Aragon, J.P.,Liu, J., Hannon, G.J., and Joshua-Tor, L. 2005.Purified Argonaute2 and an siRNA form recom-

binant human RISC. Nat. Struct. Molec. Biol.12:340-349.

Rose, S.D., Kim, D.H., Amarzguioui, M., Heidel,J.D., Collingwood, M.A., Davis, M.E., Rossi,J.J., and Behlke, M.A. 2005. Functional polar-ity is introduced by Dicer processing of shortsubstrate RNAs. Nucleic Acids Res. 33:4140-4156.

Shah, J.K., Garner, H.R., White, M.A., Shames,D.S., and Minna, J.D. 2007. sIR: siRNA Infor-mation Resource, a web-based tool for siRNAsequence design and analysis and an open accesssiRNA database. BMC Bioinformatics 8:178.

Siolas, D., Lerner, C., Burchard, J., Ge, W., Linsley,P.S., Paddison, P.J., Hannon, G.J., and Cleary,M.A. 2005. Synthetic shRNAs as potent RNAitriggers. Nat. Biotechnol. 23:227-231.

Ui-Tei, K., Naito, Y., Takahashi, F., Haraguchi, T.,Ohki-Hamazaki, H., Juni, A., Ueda, R., andSaigo, K. 2004. Guidelines for the selectionof highly effective siRNA sequences for mam-malian and chick RNA interference. NucleicAcids Res. 32:936-948.

Yiu, S.M., Wong, P.W., Lam, T.W., Mui, Y.C.,Kung, H.F., Lin, M., and Cheung, Y.T. 2005.Filtering of ineffective siRNAs and improvedsiRNA design tool. Bioinformatics 21:144-151.

Zamore, P.D., Tuschl, T., Sharp, P.A., and Bartel,D.P. 2000. RNAi: Double-stranded RNA directsthe ATP-dependent cleavage of mRNA at 21 to23 nucleotide intervals. Cell 101:25-33.

Internet Resourceshttp://genome.ucsc.edu/cgi-bin/hgGatewaySource for mRNA sequences of genes.

http://www.idtdna.com/Scitools/Applications/RNAi/RNAi.aspx

Site for assistance with RNAi design.

http://www1.infosci.coh.org/hpcdispatcher/Home of RNAi Site selector which considers sec-ondary structure of target transcripts.

http://www.invitrogen.comCell-type specific transfection protocols for stealthRNAi and siRNA.

http://www.promega.com/paguide/chap8.htmProtocols and applications guide.

Documents

Silencing of Gene Expression in Culturedsun-lab.med.nyu.edu/files/sun-lab/attachments/CPCB... · 2010-08-24 · Silencing of Gene Expression in Cultured Cells 27.1.2 Supplement 47