SignalTransductionTriggeredbyIrontoInducetheNuclear ... · ml 1 ampicillin and incubated at 37 °C with constant shaking until an A 600 of 0.6 was reached. Expression of the recombi-nant

Signal Transduction Triggered by Iron to Induce the NuclearImportation of a Myb3 Transcription Factor in the ParasiticProtozoan Trichomonas vaginalis*

Received for publication, July 24, 2014, and in revised form, August 27, 2014 Published, JBC Papers in Press, September 2, 2014, DOI 10.1074/jbc.M114.599498

Hong-Ming Hsu‡, Yu Lee‡, Pang-Hung Hsu§, Hsing-Wei Liu‡, Chien-Hsin Chu‡, Ya-Wen Chou¶, Yet-Ran Chen¶,Shu-Hui Chen�, and Jung-Hsiang Tai‡1

From the ‡Division of Infectious Diseases, Institute of Biomedical Sciences and ¶Research Center of Agriculture and Biotechnology,Academia Sinica, Taipei 11529, Taiwan, the §Department of Bioscience and Biotechnology, National Taiwan Ocean University,Keelun 20224, Taiwan, and the �Department of Chemistry, National Chen Kung University, Tainan 70101, Taiwan

Background: Iron induces the immediate nuclear influx of Myb3 in T. vaginalis.Results: Iron triggered a cAMP-mediated signaling that resulted in the phosphorylation and ubiquitination of Myb3 to accel-erate its nuclear influx.Conclusion: Iron triggers signal transduction to activate a rapid nuclear influx of Myb3.Significance: This work revealed a novel role of iron in poorly studied signal transduction in the parasite.

Iron was previously shown to induce rapid nuclear transloca-tion of a Myb3 transcription factor in the protozoan parasite,Trichomonas vaginalis. In the present study, iron was found toinduce a transient increase in cellular cAMP, followed by thenuclear influx of Myb3, whereas the latter was also induced by8-bromo-cyclic AMP. Iron-inducible cAMP production andnuclear influx of Myb3 were inhibited by suramin and SQ22536,respective inhibitors of the G� subunit of heterotrimeric G pro-teins and adenylyl cyclases. In contrast, the nuclear influx ofMyb3 induced by iron or 8-bromo-cAMP was delayed or inhib-ited, respectively, by H89, the inhibitor of protein kinase A.Using liquid chromatography-coupled tandem mass spectrom-etry, Thr156 and Lys143 in Myb3 were found to be phosphory-lated and ubiquitinated, respectively. These modifications wereinduced by iron and inhibited by H89, as shown by immunopre-cipitation-coupled Western blotting. Iron-inducible ubiquiti-nation and nuclear influx were aborted in T156A and K143R,but T156D was constitutively ubiquitinated and persistentlylocalized to the nucleus. Myb3 was phosphorylated in vitro bythe catalytic subunit of a T. vaginalis protein kinase A, TvPKAc.A transient interaction between TvPKAc and Myb3 and thephosphorylation of both proteins were induced in the parasiteshortly after iron or 8-bromo-cAMP treatment. Together, theseobservations suggest that iron may induce production of cAMPand activation of TvPKAc, which then induces the phosphory-lation of Myb3 and subsequent ubiquitination for acceleratednuclear influx. It is conceivable that iron probably exerts a muchbroader impact on the physiology of the parasite than previouslythought to encounter environmental changes.

With an estimated �275 million annual new cases world-wide (1), trichomoniasis caused by the infection of the proto-

zoan parasite, Trichomonas vaginalis, in humans is the mostprevalent but neglected sexually transmitted disease of nonviralorigin (2, 3). Trichomoniasis during pregnancy can cause pre-term delivery, abortion, low birth weight, or stillbirth, but inmost cases the infection is asymptomatic or manifests only mildsymptoms (4, 5). Although the disease can be effectively andinexpensively cured with drug treatments, trichomoniasis mayhave a much greater impact on public health because it is a riskfactor in transmission of human immunodeficiency virus andhuman papillomaviruses (6, 7) and promotes progressive typesof cervical and prostate cancers (8 –10).

T. vaginalis persistently colonizes human urogenital tractswithout an alternate cyst stage to survive outside the humanhost and has to encounter challenges from immune surveil-lance; fluctuating levels of oxygen, iron, and hormones; andcompetition from indigenous microflora in host environments(5, 11). Among these variables, iron has been shown to exertversatile roles in growth and virulence expression of the para-site (12). Iron is an essential element for virtually all organisms.Both ferrous (Fe2�) and ferric (Fe3�) ions exert profound cel-lular effects through myriad iron-binding proteins (13). Theinfluence of the ferrous versus ferric status in these proteinsmay provide a way for cells to sense intracellular oxidativestress and cause them to relay signals that elicit downstreamcellular responses (14). They also react with oxygen and hydro-gen peroxide and generate reactive oxygen species that can becytotoxic (15). Living in a low oxygen environment, iron over-loading is a lesser problem but might still be cytotoxic toT. vaginalis because hydrogen peroxide can be generatedlocally when the host immune cells encounter microbial patho-gens (16). To meet the requirement for iron and avoid its cyto-toxicity, cells often exploit specific iron-binding proteins, suchas the transcription factors Fur and Aft1p in Escherichia coliand Saccharomyces cerevisiae, respectively, and the RNA-bind-ing protein IRP1 and its upstream regulator FBLX5 in mamma-lians, to sense the level of intracellular iron and regulate theexpression of genes involved in iron homeostasis (17–20).

* This work was supported by National Science Council Grant NSC102-2320-B-001-003 and Institute of Biomedical Sciences (IBMS), Academia Sinica.

1 To whom correspondence should be addressed. Tel.: 886-2-26523934; Fax:886-2-27858847; E-mail: [email protected].

THE JOURNAL OF BIOLOGICAL CHEMISTRY VOL. 289, NO. 42, pp. 29334 –29349, October 17, 2014© 2014 by The American Society for Biochemistry and Molecular Biology, Inc. Published in the U.S.A.

29334 JOURNAL OF BIOLOGICAL CHEMISTRY VOLUME 289 • NUMBER 42 • OCTOBER 17, 2014

by guest on September 23, 2020

http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

Interestingly, Salmonella typhimurium has evolved an unusualsystem, the PmrB/PmrA two-component system, to sense theextracellular ferric ion and activate transcription of PmrA tar-get genes for growth in iron-rich environments (21). In thesesystems, physiological responses to iron overloading are oftenmonitored a few h or longer post-repletion.

How iron homeostasis is maintained in T. vaginalis remainselusive, yet iron overloading is beneficial to the parasite andinduces the expression of genes involved in nutrient acquisi-tion, energy metabolism, cytoadherence, and immune evasionin sustaining cell growth and survival (12, 22, 23). Studies ontranscription regulation of an iron-inducible ap65-1 gene in theparasite showed that upon overnight exposure, iron could exertdifferential effects on three transcription factors, Myb1, Myb2,and Myb3, which are not iron-binding proteins, at the levels ofgene expression, nuclear translocation, and promoter entry(24 –26). In contrast, iron was recently shown to induce anuclear influx of Myb3 in T. vaginalis within several min (27),implying that the parasite might elicit immediate cellularresponses right after a sudden iron overload. With an estimated46000–60000 protein genes and a vast array of �900 proteinkinase genes in the genome of T. vaginalis (28, 29), the signal trans-duction network might be crucial for the unicellular parasite toquickly adapt to and thrive in the ever-changing host environ-ments. Given its complex proteome and kinome, the study of rapidcellular responses of the parasite upon environmental stimuli andhost-parasite interactions can be challenging.

In this report, the mechanism underlying the iron-induciblenuclear influx of Myb3 was studied. We found that iron mighttrigger a G�-mediated signal transduction pathway that relaysthe upstream signal to the production of cAMP and activatesprotein kinase A (PKA), which induces phosphorylation andubiquitination of Myb3 in accelerating its nuclear influx. As aninitial study on signal transduction in T. vaginalis, our workprovides a useful model to decipher signaling moleculesinvolved in the regulatory network and to reveal the physiolog-ical relevance of iron overloading to the parasite.

MATERIALS AND METHODS

Cultures—T. vaginalis T1 cells were maintained in TYI-S-33medium supplemented with 10% calf serum (30). Iron repletionand depletion were achieved with the addition of ferrousammonium sulfate at concentrations specified throughout and50 �M 2,2�-dipyridyl, respectively, in growth medium. Serum

starvation was achieved by transferring a 1-ml overnight cul-ture into a 13-ml TYI-S33 medium.

DNA Transfection and Selection of Stable Transfectants—Plasmids were electroporated into T. vaginalis, and transfec-tants were selected by paromomycin and cloned as described(30).

Inhibitors and Activators of Signal Transduction—Cellsdepleted of iron were treated with suramin (31), SQ22536 (32),H89 (33), and KT5823 (34), the respective inhibitors of G�,adenylyl cyclases, PKA, and protein kinase G, for 30 min priorto iron repletion at concentrations specified throughout. Insome experiments, iron-depleted cells were stimulated with 50�M 8-bromo-cAMP.

Oligonucleotides—Sequences of the oligonucleotides used inthe present study are listed in Table 1 unless otherwise reportedelsewhere (26, 27).

Plasmid Construction—The HA-Myb3 expression plasmid,pAP65–2.1-ha-myb3, was obtained from a previous study (27).To produce a point mutation in HA-Myb3, a 5�-DNA fragmentwas amplified by polymerase chain reaction (PCR) frompAP65–2.1-ha-myb3 using a primer pair, tub90f and Myb3-(XnX�)-3� (where X indicates the amino acid to be mutated, nindicates the location of the residue, and X� is the mutatedresidue), and a 3�- DNA fragment was amplified by PCR using aprimer pair, Myb3-(XnX�)-5� and SP6. Gel-purified PCR prod-ucts were mixed, denatured, and annealed for a second PCRusing a primer pair, tub90f and SP6. The PCR product digestedby BglII and NsiI was cloned into a BglII/NsiI restricted pAP65-2.1.ha-Myb3 backbone (27) to generate pAP65-2.1-ha-myb3-T156A, pAP65-2.1-ha-myb3-T156D, and pAP65-2.1-ha-myb3-K143R.

The coding sequence of the TvPKAc (accession numberTVAG_177140; Fig. 8)2 gene was amplified from T. vaginalisgenomic DNA by PCR using a primer pair, BamHI-TvPKAc-5�and XhoI-TvPKAc-3�. Gel-purified PCR product digested byBamHI and XhoI was cloned into a pET6H backbone restrictedby BamHI and XhoI to generate pET6H/TvPKAc.

Expression and Purification of Recombinant Proteins—pET6H/TvPKAc, pET30/Myb2 (25), and pET28b/Myb3 (26)each transformed into E. coli BL21 (DE3). A colony from eachtransformation was inoculated into LB broth containing 50 �g

2 H. M. Hsu and J. H. Tai, unpublished data.

TABLE 1Sequences of oligonucleotides used in this study

Name Sequence (5�–3�)

pAP65–2.1-ha-myb3-T156A plasmid constructMyb3-(T156A)-5� GAGGATTTCAGCTAATTCAAATCACAAAGAGATCCTTMyb3-(T156A)-3� ATTTGAATTAGCTGAAATCCTCTTTGAAATGGA

pAP65–2.1-ha-myb3-T156D plasmid constructMyb3-(T156D)-5� GAGGATTTCAGACAATTCAAATCACAAAGAGATCCTTMyb3-(T156D)-3� ATTTGAATTGTCTGAAATCCTCTTTGAAATGGA

pAP65–2.1-ha-myb3-K143R plasmid constructMyb3-(K143R)-5� ATCAGAAATAGATGGAATTCATCCATTTCAMyb3-(K143R)-3� ATTTCTGATGGCATTGTCTGTACGGCC

pET6H/TvPKAc plasmid constructBamHI-TvPKAc-5� AGGATCCATGTACAAGAATCTCTCTTTGGATCXhoI-TvPKAc-3� ACTCGAGTTAATAATTTTCAAACTTGATCTTCTTC

Iron-activated Signal Transduction in T. vaginalis

OCTOBER 17, 2014 • VOLUME 289 • NUMBER 42 JOURNAL OF BIOLOGICAL CHEMISTRY 29335


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

ml�1 ampicillin and incubated at 37 °C with constant shakinguntil an A600 of �0.6 was reached. Expression of the recombi-nant protein was induced with 0.4 mM isopropyl 1-thio-�-D-galactopyranoside for 2 h and purified using a His-bind nickelcolumn as described by the supplier (Novagen).

Antibody Production—Purified His-TvPKAc was used toimmunize rats and mice following a standard protocol (35), andantisera were collected and purified by protein A-affinity chro-matography as described by the supplier (Sigma).

Immunofluorescence Assay (IFA)3—Cells on a slide werefixed in methanol at �20 °C for 30 min. Sequential immunore-actions were performed using a mouse monoclonal anti-he-magglutinin (HA) antibody (HA-7; Sigma) (300� or 1000�, asspecified throughout) and FITC-conjugated anti-mouse IgG(Jackson Immunoresearch) (200�). Nuclei were stained byDAPI. Fluorescent images were recorded by confocal micros-copy and cell morphology by phase-contrast microscopy(LSM700, Zeiss). Relative intensity of fluorescence detected inthe nucleus in a total of 300 cells randomly selected from fivemicroscopic fields was quantified by Metamorph software(Molecular Devices).

Cellular Fractionation—Cell lysates were fractionated intocytosolic and nuclear fractions using a cellular fractionation kit,NE-PERTM as prescribed by the supplier (Pierce).

Immunoprecipitation (IP)—Agarose bead-conjugated mouseanti-HA antibody (Sigma) was added to protein samples, andreactions were incubated at 4 °C for 2 h with constant agitation.Agarose beads recovered from low speed centrifugation werewashed three times in PBS containing 0.1% Triton X-100 for 10min, and proteins were eluted with 50 �l of 50 mM acidic glycine(pH 2.8) and immediately neutralized with 3 �l of 1 M Tris base(pH 9.0). The elution was repeated three times, and eluateswere combined.

Western Blotting—Proteins were separated by SDS-PAGE in12% gel. The gel was stained by SyproRuby as described by thesupplier (Invitrogen) or blotted to a polyvinylidene difluoridemembrane, IMMOBILON-P (Millipore), by a semidry elec-troblotter. Sequential immunoreactions were performed, andthe ECL system was used for signal detection as instructed bythe supplier (Pierce). The chemiluminescence signal wasrecorded at multiple exposures by an image acquisition system(LAS-3000, Fujifilm), and the intensities of each band in thelinear range of detection from three separate experiments weredigitized and quantified by Metamorph software (MolecularDevices). Reaction conditions for antibodies from commercialsources, including mouse anti-�-tubulin (5000�) (DM1A;Sigma), rat anti-HA (2000�) (3F10; Roche Applied Science),rabbit anti-acetylhistone H3K9 (3000�; Upstate Biotechnol-ogy, Inc.), rabbit anti-ubiquitin (1000�; Santa Cruz Biotech-nology, Inc.), rabbit anti-phospho-(Ser/Thr)PKA substrate(1000�; Cell Signaling), rabbit anti-PKA� (catalytic subunit)(phospho-Thr197) (3000�; Abcam), mouse anti-phospho-Thr/

Pro101 (2000�; Cell Signaling), and anti-His6 (5000�; Clon-tech) were performed as described by suppliers. Myb1, Myb2,Myb3, TvCyP1, TvHsp70-1, and TvPKAc were detected bymouse anti-Myb1 (1000�) (24), rabbit anti-Myb2 (2000�)(25), rabbit anti-Myb3 (2000�) (26), rat anti-TvCyP1 (3000�)(27), rat anti-TvHsp70-1 (5000�) (36), and rat anti-TvPKAc(1000�), respectively.

Detection of Intracellular Reactive Oxygen Stress—Cells har-vested at post-iron repletion time intervals were washed in PBSthree times, resuspended in PBS containing 1% BSA, and incu-bated with 5 �M acetyl ester of 5-(and 6)-chloromethyl-2�,7�-dichlorodihydrofluorescein diacetate (CM-H2DCFDA) (Molecu-lar Probes) at 37 °C in the dark for 30 min with constantagitation. Cells were washed in PBS three times, and fluores-cence was recorded by confocal microscopy.

Detection of Cellular cAMP—A total of 5 � 107 T. vaginaliscells were resuspended in 1 ml of ice-cold 6% TCA with vigor-ous vortexing for 1 min. Supernatants were recovered by cen-trifugation at 10,000 g at 4 °C for 15 min and extracted with 1 mlof water-saturated ether four times to collect the aqueousphase. Samples were dried in a speed vacuum and dissolved indistilled water, and cAMP was detected by liquid chromatogra-phy-coupled tandem mass spectrometry (LC-MS/MS). Theassay was performed with a UPLC system (ACQUITY UPLC,Waters, Milford, MA) coupled to a hybrid Q-TOF mass spec-trometer (Synapt HDMS G1, Waters, Manchester, UK). For theUPLC system, the mobile phase A was 2% acetonitrile in water,and B was 100% acetonitrile. The sample was separated onlinewith a hybrid-phase column (ACQUITY UPLC HSS T3, 1.7�m, 2.1 � 150 mm) at a flow rate of 0.45 ml/min using a 6-min2–99% acetonitrile/water gradient. The temperature of the sep-aration column was maintained at 40 °C. For the MS analysis,the LC column was coupled online to the LockSpray electros-pray ion source of the hybrid Q-TOF mass spectrometer, and0.035 ppm sulfadimethoxine was continuously infused to theLockSpray emitter with a flow rate of 40 �l/min. The MS wasswitched to acquire the reference sulfadimethoxine signal fromthe LockSpray emitter every 6 s for mass error correction. Theelectrospray ionization voltage was �2.5 kV, with a cone volt-age of 40 V. The cone and desolvation gas flows were 50 and 800liters/h, respectively. The source and desolvation temperatureswere 80 and 250 °C, respectively. The LC-MS data were col-lected in MS or MS/MS negative ion mode with an m/z range of50 –350 Th and 0.2-s scan time. For the MS/MS mode, theprecursor m/z 328 Th was selected, and the collision energy wasset to 25 eV. To quantify the cAMP using LC-MS/MS data, acAMP collision-induced dissociation fragment m/z 134.05 Thwith an extraction m/z window of 0.015 Th was selected to plotthe extracted ion chromatogram and calculate the peak areausing MassLynx version 4.1 (Waters, Manchester, UK).

Identification of Protein Post-translational Modifications—Protein bands stained with SyproRuby as specified throughoutwere excised from gel and processed for trypsin digestion asdescribed (37). Tryptic peptides were analyzed by nanoflow LC-MS/MS. Mass spectral data were acquired using a ThermoLTQ-FT mass spectrometer (Thermo Fisher) equipped with ananoelectrospray ion source (New Objective, Woburn, MA), anAgilent 1100 series binary high performance liquid chromatog-

3 The abbreviations used are: IFA, immunofluorescence assay; IP, immunopre-cipitation; PKAc, the catalytic subunit of protein kinase A; CM-H2DCFDA,acetyl ester of 5-(and 6)-chloromethyl-2�,7�-dichlorodihydrofluoresceindiacetate; 8-bromo-cAMP, 8-bromo-cyclic AMP; UPLC, ultraperfor-mance liquid chromatography.




http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

raphy pump (Agilent Technologies, Palo Alto, CA), and aFamos autosampler (LC Packings, San Francisco, CA). Chro-matographic separation was performed on a self-packedreversed phase C18 nanocolumn (75-�m inner diameter � 200mm, 3 �m, 100 Å) using 0.1% formic acid in water as mobilephase A and 0.1% formic acid in 80% acetonitrile as mobilephase B with an injection volume of 5 �l and flow rate of 300 nlmin�1. The gradient in LC separation was 2– 40% B for 70 min,40 –95% B for 10 min, and 95–2% B for 2 min and re-equilibra-tion for 8 min. The MS/MS spectra data were converted intomzXML and mgf formats from the experiment’s RAW file byMM File Conversion (38) and analyzed by MassMatrix (39) forMS/MS ion search. The search parameters in MassMatrix,including the error tolerance of precursor ions and the MS/MSfragment ions in spectra, were 10 ppm and 0.6 Da. The enzymechosen for digestion was trypsin with missed cleavage site num-ber three, and results were further confirmed by manual inter-pretation of each fragmentation spectrum. Variable post-trans-lational modifications in search parameters were assigned toinclude the oxidation of Met, carbamidomethylation of Cys,phosphorylation of Ser/Thr/Tyr, and ubiquitination of Lys.

Protein Kinase Assay—An in vitro protein kinase assay wasperformed as described (40) but with modifications. Briefly,0.6 �M His-TvPKAc was incubated with 3 �M His-Myb3 (26) orHis-Myb2 (25) in a buffer containing 50 mM Tris-HCl, pH 7.5,10 mM MgCl2, 35 �M ATP, and [�-32P]ATP (0.25 �Ci �l�1) in atotal volume of 20 �l at 30 °C for 30 min. Reactions were termi-nated by mixing an equal volume of 2� SDS sample buffer andthen heated to 100 °C for 10 min. Mixtures were separated bySDS-PAGE in 12% gel for detection by autoradiogram.

Statistical Analysis—Differences in data collected in controland treatments were analyzed by Student’s t test, with p � 0.05considered statistically significant.

RESULTS

Iron-inducible Nuclear Influx of Myb3—Iron was previouslyshown to induce the rapid nuclear influx of HA-tagged andendogenous Myb3 protein in T. vaginalis (27). In this report,this phenomenon was re-examined in greater detail. HA-Myb3was localized to the nucleus of T. vaginalis under normalgrowth conditions but barely detected in iron-depleted cells byIFA using a 300� dilution of the anti-HA antibody (Fig. 1A).When iron-depleted cells were replete with 250 �M iron, HA-Myb3 was detected in the nucleus at 3 min and exhibited anincreasing level of peaking at 15 min but returned to baseline at30 min, probably due to nuclear efflux of the protein (27). Sim-ilar results were obtained when cells in normal medium werereplete with iron using a 1000� dilution of the anti-HA anti-body in the IFA (Fig. 1B). The level of inducible nuclear influx asmonitored at 15 min post-repletion was dependent on the ironconcentration being in the range of 75–750 �M (Fig. 1C). Rapidnuclear influx of HA-Myb3 was also detected in serum-starvedcells replete with 250 �M iron but not with 10% serum (Fig. 1D).Inducible Myb3 nuclear influx similar to controls was alsodetected in cells pretreated with 10 mM thiourea, scavenger ofhydroxyl radicals (41) (Fig. 1E). Oxidative stress detected byCM-H2DCFDA staining was apparent in cells treated with 1mM hydrogen peroxide for 30 min, but it was detected only at a

much lower level in cells at 30 min post-iron repletion (Fig. 1F),implying that iron overloading under our test conditions maygenerate a slight oxidative stress that is insufficient for trigger-ing a nuclear influx of Myb3. These results suggest that ironoverloading alone can trigger a rapid nuclear influx of Myb3.Cells depleted of iron were used in the following experiments tostudy the effects of 250 �M iron and 8-bromo-cAMP and inhib-itors of a few signaling molecules on the nuclear influx of HA-Myb3, and the IFA was performed using a 300� dilution of theanti-HA antibody.

Signal Transduction in the Iron-inducible Nuclear Influx ofMyb3—The sequence of Myb3 has a predicted PKA phosphor-ylation motif (151KRIST156) residing within a small hairpin nextto helix 6 in the DNA-binding R2R3 domain (42). To testwhether the iron-inducible nuclear influx of Myb3 is mediatedthrough a PKA-centered signal transduction pathway, cellswere treated with various inhibitors for 30 min prior to therepletion with iron, 50 �M 8-bromo-cAMP, or the same volumeof water and fixed at intervals for the IFA. The nuclear influx ofHA-Myb3 induced by iron peaked at 15 min and subsided at 30min (Fig. 2A). In contrast, the extended nuclear influx of HA-Myb3 was induced in cells stimulated with 50 �M 8-bromo-cAMP. Water had no effect on inducible nuclear influx ofMyb3. The inducible nuclear influx of Myb3 peaking at 15 minpost-repletion of iron was largely inhibited in cells pretreatedwith 20 �M suramin and 10 �M SQ22536, the respective inhib-itors of the G� subunit of heterotrimeric G proteins (31) andadenylyl cyclases (32), but the nuclear influx was peaking at 30min in cells pretreated with 42 nM H89, the inhibitor of PKA(33) (Fig. 2B). The nuclear influx of Myb3 induced by 8-bromo-cAMP was not affected by suramin or SQ22536 but was inhib-ited by H89 at the same dose that only delayed the nuclearinflux induced by iron to a later time point.

Iron-inducible Changes in Cellular cAMP Concentration—The effect of iron on the level of cellular cAMP was assayed byLC-MS/MS. The MS/MS spectra and the mass chromatogramstargeted on the ion transition m/z 328 –134 for cAMP standardand the samples from iron-depleted T. vaginalis and those fromiron repletion for 3 min are shown in Fig. 3A. Based on thecharacteristic cAMP fragmentation ion transition, only onechromatography peak was detected in each T. vaginalis sample,and the MS/MS spectrum within the detected chromato-graphic peak was matched to the one observed in the cAMPstandard. When the time course of intracellular cAMP levelpost-iron repletion was examined (Fig. 3B), a small quantity ofcAMP was detected in iron-depleted samples, and its levels iniron-replete samples were 7- and 13-fold higher than baseline at1 and 3 min, respectively, and subsided to baseline at 5–10 minpost-iron repletion. The increase in cellular cAMP induced byiron at the peak level was reduced from �12-fold to �3- and2-fold by 20 �M suramin and 10 �M SQ22536, respectively. Thebasal level of cAMP as detected in these experiments was notaffected by suramin or SQ22536.

Post-translational Modifications of Myb3—To identify thepost-translational modification sites in HA-Myb3, cell lysatesfrom cells overexpressing HA-Myb3 were enriched by IP usingthe anti-HA antibody and separated by SDS-PAGE. When




http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

stained by SyproRuby (Fig. 4A, lane 1), several protein bandswere detected in gel. A duplicate gel was assayed by Westernblotting (Fig. 4A, lane 2), and a major �34 kDa band and aslower migrating doublet band were detected by the anti-Myb3antibody. Myb3-related bands were excised from the gel andtrypsin-digested. Extracted peptides were analyzed by LC-MS/MS. The phosphorylation at Thr156 and ubiquitination atLys143 in Myb3 were identified in the peptides 153RISTNSNH-KEILLPDR168 (Fig. 4B) and 133LIPGRTDNAIK143 (Fig. 4C),respectively.

Ubiquitination of Lys143 in Myb3 and Inducible NuclearInflux—To study the potential role of Lys143 in Myb3, K143Rwas generated and overexpressed in T. vaginalis. As revealed bythe IFA (Fig. 5A), K143R was localized to the nucleus to a levelsimilar to that of HA-Myb3 under normal growth conditions,but iron-inducible nuclear influx as seen in controls was notapparent in K143R. Cell lysates harvested before and after ironrepletion were separated into cytosolic and nuclear fractionsfor Western blotting (Fig. 5B). Similar amounts of HA-Myb3and K143R were detected by the anti-HA antibody in total cell

FIGURE 1. Iron-inducible nuclear influx of Myb3. T. vaginalis cells overexpressing HA-Myb3 and nontransgenic controls (A and F) were maintained in normal(A and B), iron-depleted (A and C–F), or serum-starved (D) medium. In some experiments, cells were pretreated with 10 mM thiourea (E) or 5 �M CM-H2DCFDA(F) for 30 min. Cultures were replete with 250 �M (A, B, and D–F) or 75–750 �M (C) iron, 10% serum (D), or 1 mM H2O2 (F). Cells were fixed at intervals as indicatedabove the panels for direct microscopic observation (F) or for IFA (A–E), using the anti-HA monoclonal antibody (300� dilution in A and C–E, 1000� dilution inB) and anti-IgG-conjugated with FITC. Nuclei were stained with DAPI. The intensity of fluorescence in the nuclei (A–E) or over the entire cell (F) was measuredunder confocal microscopy and quantified by Metamorph software, and the values are listed below each panel with S.E. Cell morphology was recorded byphase-contrast microscopy. Bars in the micrographs, 5 �m.




http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

lysates regardless of iron. The cytosolic and nuclear HA-Myb3were detected to lower and higher levels, respectively, in sam-ples from iron repletion than in samples from iron depletion. Incontrast, the level of cytosolic K143R remained similar, but aslight increase of nuclear K143R was observed post-iron reple-tion. The subcellular distribution of Myb1 and Myb2 variedlittle. Consistent with previous findings (27), TvCyP1 andH3K9-Ac were only detected in cytosolic and nuclear fractions,respectively, indicating the purity of each fraction.

To study whether iron induces ubiquitination in Myb3, cellsoverexpressing HA-Myb3 replete with iron and cell lysates har-vested at intervals were fractionated into cytosolic and nuclearfractions, and the overexpressed protein was enriched by IP.When these samples were assayed by Western blotting (Fig.5C), a major 55 kDa band and several weaker signals at �36,�45, �70, and �130 kDa and smearing signals were detectedprimarily in nuclear samples by the anti-ubiquitin antibody.Ubiquitination signals were detected to much higher levels insamples harvested at 15 min than at 7.5 and 30 min after ironrepletion, but no such signals were seen in samples depleted ofiron. In a duplicate blot, a major 34 kDa band was detected bythe anti-Myb3 antibody to similar levels in cytosolic samplesharvested over time, but slightly increasing amounts of nuclearMyb3 were detected that reached a peak at 15 min post-ironrepletion and declined to a level slightly lower than baseline at30 min. Additional bands with higher molecular sizes at 45, 55,70, and 130 kDa were also detected upon longer exposure insamples from nuclear fractions to higher levels at 15 min than at7.5 and 30 min after iron repletion, but these bands were notseen in iron depletion samples, indicating that the 34 kDa Myb3band is nonubiquitinated, and those of higher sizes areubiquitinated.

To confirm the site of ubiquitination, cells overexpressingHA-Myb3 and K143R were replete with iron for 15 min, andlysates were separated into cytosolic and nuclear fractions. Theoverexpressed proteins were enriched by IP and assayed byWestern blotting (Fig. 5D). Ubiquitination signals were

detected in HA-Myb3 but not K143R after iron repletion tohigher levels in nuclear than cytosolic samples. The ubiquiti-nated bands were also detected by the anti-Myb3 antibody insamples from cells overexpressing HA-Myb3 but not K143R,suggesting that iron induces the ubiquitination of Myb3 atLys143 to facilitate its nuclear influx.

Phosphorylation of Thr156 in Myb3 and Inducible NuclearInflux—Two mutant proteins, T156A and T156D, were gener-ated and overexpressed in T. vaginalis. Under normal growthconditions, T156A and T156D are each localized to the nucleusto a level similar to that of HA-Myb3 by the IFA (Fig. 6A),indicating that the phosphorylation of Thr156 in Myb3 is notcrucial for steady state nuclear translocation. The typical iron-inducible nuclear influx seen in HA-Myb3 was aborted inT156A, whereas T156D was persistently localized to thenucleus at a level independent of iron, suggesting that the phos-phorylation at Thr156 of Myb3 may account for its facilitatednuclear influx.

When examined by Western blotting, T156A was detected toa level substantially lower than HA-Myb3 in total cell lysates(Fig. 6B). Overall expression levels of these proteins were notaffected by iron. The amounts of nuclear and cytosolic HA-Myb3 were higher and lower, respectively, in samples from ironrepletion than in samples from iron depletion, but the amountsof T156A, Myb1, and Myb2 changed little. When overex-pressed proteins in nuclear lysates were enriched by IP forWestern blotting (Fig. 6C), both the smear and distinct ubiq-uitination signals were observed in HA-Myb3, but not T156A,to a much higher level in samples from iron repletion than insamples from iron depletion. Similar signals plus a 34 kDa band,probably nonubiquitinated Myb3, were detected by the anti-Myb3 antibody in a duplicate blot. Interestingly, a band referredto as Myb3(Thr(P)156) that migrated slightly slower than the 34kDa Myb3 was detected by the anti-phospho-(Ser/Thr)PKAsubstrate antibody in samples from iron-replete cells overex-pressing HA-Myb3 but not T156A, implying that Myb3 is prob-ably phosphorylated at Thr156 upon iron repletion.

FIGURE 2. Mapping the signal transduction pathway of Myb3 nuclear influx. In A, T. vaginalis cells overexpressing HA-Myb3 depleted of iron were treatedwith 250 �M iron, 50 �M 8-bromo-cAMP, or water. In B, iron-depleted cells were pretreated with DMSO, 20 �M suramin, 10 �M SQ22536, or 42 nM H89 for 30 minprior to repletion with 250 �M iron (left) or 50 �M 8-bromo-cAMP (right). Cells were fixed at intervals as indicated above each panel for IFA using the anti-HAantibody and anti-IgG-conjugated with FITC. The intensity of the fluorescence signal in the nuclei was measured under confocal microscopy and quantified byMetamorph software, and the values are listed below each panel with S.E.




http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

In contrast, T156D was overexpressed to a level only slightlylower than HA-Myb3 in total cell lysates (Fig. 6D). In nuclearlysates from iron-depleted cells, T156D was detected at a higherlevel than Myb3. An iron-inducible increase in nuclear sampleswas detected in HA-Myb3 but not T156D (Fig. 6D). When

overexpressed proteins in nuclear lysates were enriched by IPfor Western blotting (Fig. 6E), the ubiquitination of T156D butnot HA-Myb3 was detected in iron-depleted samples. Iron onlyslightly enhanced the ubiquitination of T156D, probably due toits higher basal level. In the 34-kDa nonubiquitinated form,

FIGURE 3. The effect of iron on cellular cAMP level. Iron-depleted T. vaginalis cells were replete with 250 �M iron and sampled at intervals as indicated in eachpanel, and cAMP was assayed by LC-MS/MS with elution time defined by a standard. A, the MS/MS extracted ion chromatograms (XIC) and spectra of standard(30 pmol of cAMP) (top) and endogenous cAMP from 1.5 � 107 T. vaginalis cells depleted of iron (middle) and replete with iron for 3 min (bottom). B,iron-depleted cells were replete with 250 �M iron and sampled at intervals. C, iron-depleted cells were pretreated with DMSO, 20 �M suramin, and 10 �M

SQ22536 for 30 min (open bars) and replete with 250 �M iron for 3 min (closed bars). Relative amount of cAMP is plotted against time of iron repletion. Error bars,S.E. from three experiments.




http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

T156D migrated slightly faster than HA-Myb3, probably due toan extra negative charge from Asp. In both blots, a �20 kDaband was detected at a much higher level in T156D than HA-Myb3 and was also higher in samples from iron repletion thanin samples from iron depletion, suggesting that this band is

probably a degraded form of each protein and implying that thephosphorylation at Thr156 might accelerate protein degrada-tion. This possibility remains to be studied. In a duplicate blot,Myb3(Thr(P)156) was detected only in samples from iron-re-plete cells overexpressing HA-Myb3 but not T156D. These

FIGURE 4. Detection of the post-translational modification sites in Myb3. A, cells overexpressing HA-Myb3 were cultured in normal mediumovernight, and HA-Myb3 was enriched by IP using the anti-HA antibody from cell lysates. Duplicate samples were separated by SDS-PAGE for SyproRubystaining (lane 1) and Western blotting (lane 2) using the anti-Myb3 antibody. The gel slices corresponding to Myb3 signals were excised and trypsin-digested, and their peptides were extracted for LC-MS/MS analysis. The spectra of a peptide phosphorylated at Thr156 (B) and a peptide ubiquitinatedat Lys143 (C) are shown.

FIGURE 5. Iron-inducible ubiquitination of Lys143 and the nuclear influx of Myb3. Transgenic cells overexpressing Myb3 or K143R in iron-depleted mediumwere replete with 250 �M iron and harvested at intervals as indicated in each panel. A, cells were fixed for IFA using the anti-HA antibody (300� dilution) andanti-IgG-conjugated with FITC. The intensity of fluorescence signal in the nuclei was measured under confocal microscopy and quantified by Metamorphsoftware, and the values are listed below each panel with S.E. B–D, cell lysates were fractionated into cytosolic (Cy) and nuclear (N) fractions at intervals, asindicated above the panels. Samples were directly analyzed by Western blotting (B) or enriched by IP before Western blotting (C and D). B, the intensity of HAsignal (L and S, longer and shorter exposures of the same blot, respectively) in the cytosolic and nuclear fractions was quantified from three experiments andstatistically analyzed as shown in the histograms, with p � 0.05 (*) and p � 0.01 (**) indicated. C and D, overall, overexpressed and ubiquitinated Myb3 weredetected by the anti-Myb3, anti-HA, and anti-ubiquitin antibodies, respectively, whereas Myb1, Myb2, TvCyP1, and H3K9-Ac were detected by the anti-Myb1,anti-Myb2, anti-TvCyP1, and anti-H3K9-Ac antibodies, respectively. Arrowheads, bands detected by both antibodies; arrow, band only detected by the anti-Myb3 antibody. To show the linear range of detection among samples in the bottom right panels of C and D, the 34 kDa band, as indicated by the arrow, wastaken from a short exposure. H, heavy chain of IgG. Error bars, S.E.




http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

observations suggest that iron may induce sequential phosphor-ylation and ubiquitination of Myb3 at Thr156 and Lys143,respectively, prior to nuclear influx.

PKA-dependent Phosphorylation and Ubiquitination ofMyb3—To test whether these post-translational modificationsare regulated by PKA, transgenic cells (Fig. 7, A and C) andnontransgenic control (Fig. 7B) were treated with H89 orKT5823, the latter being a PKG inhibitor, for 30 min before ironrepletion. Lysates were fractionated into cytosolic and nuclearfractions for Western blotting. The expression of HA-Myb3 intotal lysates and cytosolic fractions varied little (Fig. 7A),regardless of drug treatments and iron repletion. Upon ironrepletion, a substantial increase of HA-Myb3 in nuclear frac-tions was seen with a concomitant decrease of cytosolic HA-

Myb3 in controls treated with DMSO but to a lesser extent alsoin KT5823-treated samples. The change was marginal in sam-ples treated with H89. The amounts of Myb1 and Myb2 in thesesamples remained constant. When the subcellular distributionof endogenous Myb3 was examined in nontransgenic cells (Fig.7B), H89 and KT5823 also exerted similar inhibitory effects, asobserved in overexpressed Myb3, suggesting that iron induciblenuclear translocation of both endogenous and overexpressedMyb3 is activated by PKA and possibly also by PKG to a lesserextent. HA-Myb3 in nuclear lysates from transgenic cells wasenriched by IP for Western blotting (Fig. 7C). Iron-inducibleubiquitination of HA-Myb3 that was largely inhibited by H89was only slightly inhibited by KT5823. In a duplicate blot, thedoublet 34 kDa bands along with several higher molecular

FIGURE 6. Iron-inducible phosphorylation of Thr156 and the nuclear influx of Myb3. Cells overexpressing HA-Myb3, T156A, or T156D grown in iron-depleted medium were replete with 250 �M iron and harvested at intervals as indicated in each panel. A, cells were fixed for IFA using the anti-HA antibody andanti-IgG-conjugated with FITC. Fluorescence signals were recorded using a confocal microscope and quantified by Metamorph software, and the values arelisted below each panel with S.E. B–E, cell lysates were fractionated into cytosolic (Cy) and nuclear (N) fractions. Samples were directly analyzed by Westernblotting (B and D) or enriched by IP before Western blotting (C and E). B and D, the intensity of HA signal (L and S, longer and shorter exposures of the same blot,respectively) in the cytosolic and nuclear fractions was quantified from three experiments and statistically analyzed as shown in the histograms, with p � 0.05(*) and p � 0.01 (**) indicated. C and E, overall Myb3, ubiquitinated Myb3, and Myb3(Thr(P)156) were detected by the anti-Myb3, anti-ubiquitin, and anti-phospho-(Ser/Thr)PKA substrate antibodies, respectively, whereas Myb1, Myb2, TvCyP1, and H3K9-Ac were detected by the anti-Myb1, anti-Myb2, anti-TvCyP1, and anti-H3K9-Ac antibodies, respectively. Arrowheads, bands detected by both antibodies; arrow, band only detected by the anti-Myb3 antibody. Cand E, overexpressed proteins in nuclear samples were enriched by IP for Western blotting (IB) using the anti-Myb3, anti-ubiquitin, and anti-phospho-(Ser/Thr)PKA substrate to detect overall Myb3, ubiquitinated Myb3, and Myb3(Thr(P)156). Arrowheads, bands detected by both anti-ubiquitin and anti-Myb3antibodies; arrow, band that was only detected by the anti-Myb3 antibody. H and L, heavy and light chains of IgG, respectively. Error bars, S.E.




http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

weight bands were detected by the anti-Myb3 antibody. Themajor and faster migrating band in the doublet was present atsimilar levels in control and treatments. The slower migratingband in the control was detected at much higher levels in sam-ples from iron repletion than in samples from iron depletion.This band was also seen in samples from iron-replete cells pre-treated with KT5823 but not H89, with an increasing levellower than that in control. Moreover, Myb3(Thr(P)156) wasdetected at similar levels in control and samples from KT5823-treated cells only at 15 min after iron repletion. These resultssuggest that Myb3 can be phosphorylated at Thr156 by a PKAupon iron repletion and that under the same conditions, Myb3may also be phosphorylated by other protein kinases like PKG.2

Identification and Characterization of a TvPKAc—In ourpreliminary study,2 a unique phosphopeptide with a differentiallevel of phosphorylation before and after iron repletion wasidentified by LC-MS/MS (Fig. 8A). The peptide, which is phos-

phorylated at Thr164 of a T. vaginalis AGC protein kinase (28)and referred to as TvPKAc, is nearly identical in sequence tothat spanning an autophosphorylation active site, Thr197, ofmouse PKA catalytic subunit (Fig. 8B). TvPKAc shares �32% ofits sequence identity with the � subtype of mouse PKAc. Tostudy the role of the TvPKAc during the inducible nuclearinflux of Myb3, recombinant His-TvPKAc was produced andpurified. When separated by SDS-PAGE, a single 43 kDa bandwas stained by Coomassie Blue (Fig. 8C, lane 1). When thepurified protein was analyzed by Western blotting, the 43 kDaband was detected by both the anti-His6 (Fig. 8C, lane 2) andanti-PKA � (catalytic subunit) (phospho-Thr197) (Fig. 8C, lane3) antibodies, implying that His-TvPKAc is probably autophos-phorylated at Thr164. When total lysates from T. vaginalis T1cells were examined by Western blotting, a major �40-kDaTvPKAc band and a minor band of smaller size were identifiedby the anti-TvPKAc antibody (Fig. 8D). These bands were also

FIGURE 7. PKA-dependent phosphorylation and ubiquitination of Myb3. Cells depleted of iron overnight were treated with DMSO, H89, and KT5823 for 30min and replete with 250 �M iron. Transgenic cells overexpressing HA-Myb3 (A) or nontransgenic control (B) were harvested at intervals, and cell lysates werefractionated into cytosolic (Cy) and nuclear (N) fractions for Western blotting detection by antibodies as indicated. The intensity of HA signal (A) (L and S, longerand shorter exposures of the same blot, respectively) and endogenous Myb3 (B) in the cytosolic and nuclear fractions was quantified from three experimentsand statistically analyzed as shown in the histograms, with p � 0.05 (*) and p � 0.01 (**) indicated. C, HA-Myb3 was enriched by IP. Samples were separated bySDS-PAGE for Western blotting using the anti-Myb3, anti-ubiquitin, and anti-phospho-(Ser/Thr)PKA substrate antibodies to detect overall Myb3, ubiquitinatedMyb3, and Myb3(Thr(P)156), respectively. Arrowheads, bands detected by both the anti-ubiquitin and anti-Myb3 antibodies. Arrow, band detected only by theanti-Myb3 antibody. H and L, heavy and light chains of IgG, respectively. To show the linear range of detection among samples in the middle panel of B, the 34kDa band, as indicated by the arrow, was taken from a very short exposure. H, heavy chain of IgG. Error bars, S.E.




http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

detected by the anti-PKA � (catalytic subunit) (phospho-Thr197) antibody, indicating that TvPKAc is probably phos-phorylated, possibly at Thr164, the conserved autophosphory-lation site referred to as TvPKAc(Thr(P)164). In an in vitroprotein kinase assay (Fig. 8E), His-TvPKA and [�-32P]ATP wereco-incubated with His-Myb2 or His-Myb3, and the reactionproducts were separated by SDS-PAGE for detection by theautoradiogram. The radioisotopic 32P signal was detected at amuch greater level in Myb3 than in Myb2 but not in His-TvPKAc itself. When a duplicate reaction was performed usingonly non-isotopic ATP as a substrate, Myb2 was detected at amuch higher level than Myb3 by Western blotting using theanti-His6 antibody, indicating that the His-TvPKAc-specificphosphorylates Myb3, but it may also nonspecifically phospho-rylate Myb2 to a much lesser extent. When iron-depleted cellswere replete with iron or stimulated with 8-bromo-cAMP, thelevel of TvPKAc(Thr(P)164) increased continuously and peakedat 15 min but returned to baseline at 30 min post-repletion (Fig.8F). During this period, the expression levels of TvPKAc and�-tubulin changed only slightly. These observations suggestthat iron and 8-bromo-cAMP might exert similar effects on thephosphorylation of TvPKAc.

Inducible Complex Formation between TvPKAc and Myb3—To study the effects of iron on TvPKAc and Myb3, cells over-expressing HA-Myb3 were replete with iron and harvested at 0,7.5, 15, and 30 min. Cell lysates were fractionated into cytosolicand nuclear fractions for Western blotting (Fig. 9A). In total celllysates, increasing levels of TvPKAc(Thr(P)164) were detectedpost-iron repletion, although a slightly lower level of TvPKAcwas detected at 7.5 min than at other time points. Other pro-teins detected in the same blot varied little. HA-Myb3 wasdetected to similar levels in cytosolic fractions at various timepoints. It was detected in increasing amounts in nuclear frac-tions and peaked at 15 min post-iron repletion, but returned tobaseline within 30 min. TvPKAc was only detected in cytosolicfractions and at similar levels regardless of iron, but a transientincrease in TvPKAc(Thr(P)164) was observed. In contrast,TvCyP1 and H3K9-Ac were detected in cytosolic and nuclearfractions, respectively, and TvHsp70-1 was in both fractions atsimilar levels.

HA-Myb3 in these samples was enriched by IP for Westernblotting (Fig. 9B). Cytosolic HA-Myb3 was detected at a lowerlevel at 7.5 than at 0 min, but the signal increased at later time

FIGURE 8. Identification and biochemical characterizations of TvPKAc. The mass spectrum of a unique phosphopeptide from a preliminary T. vaginalisphosphoproteomics study2 is depicted in A. In B, the sequences of TvPKAc and the � subtype of the mouse PKAc (mPKAc�) (accession number P05132) arealigned. The conserved amino acids are highlighted, and the sequence spanning the conserved autophosphorylation site (asterisk) is boxed. Purified His-TvPKAc (C) and T. vaginalis cell lysates (D) were separated by SDS-PAGE for Coomassie Blue staining (C, lane 1) or Western blotting using the anti-His6 (C, lane2), anti-TvPKAc (D, lane 1), and anti-PKA�-Thr(P)197 (C, lane 3; D, lane 2) antibodies. E, His-TvPKAc was incubated with His-Myb2 or His-Myb3 in a kinase buffercontaining [�-32P]ATP (left) or ATP (right). Reaction products were separated by SDS-PAGE for autoradiogram (left) or Western blotting using the anti-His6antibody. F, T. vaginalis maintained in an iron-depleted medium was stimulated with iron or 8-bromo-cAMP and sampled at intervals for Western blotting usingthe anti-TvPKAc, anti-PKA�-Thr(P)197, and anti-�-tubulin antibodies to detect TvPKAc, TvPKAc(Thr(P)164), and �-tubulin, respectively. Relative amounts ofTvPKAc(Thr(P)164) are quantified from three independent experiments and statistically analyzed as shown in the histogram, with p � 0.05 (*) and p � 0.01 (**)indicated. Error bars, S.E.




http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

points and reached a maximum at 30 min. By contrast,Myb3(Thr(P)156) was first detected at 7.5 min with decreasinglevels thereafter. Much higher levels of nuclear HA-Myb3 weredetected at 7.5 and 15 min than at 0 and 30 min, andMyb3(Thr(P)156) in these samples was observed to peak at 15min post-repletion. TvPKAc and TvPKAc(Thr(P)164) weredetected post-repletion at 7.5 and 15 min at similar levels onlyin samples from cytosolic fractions. TvHsp70-1 was detected insamples only from cytosolic fractions at similar levels over theentire time course.

To compare the effects of iron and cAMP on the interactionof TvPKAc and Myb3, cells overexpressing HA-Myb3 werereplete with iron or stimulated with 8-bromo-cAMP for 15 min.Cell lysates were fractionated into cytosolic and nuclear frac-tions for Western blotting (Fig. 9C). The purity of each fractionwas validated by the presence of TvCyP1 and H3K9-Ac only incytosolic and nuclear fractions, respectively. HA-Myb3 wasdetected in all cytosolic samples at similar levels, but in nuclearsamples, it was at similar levels in samples from iron repletionand 8-bromo-cAMP stimulation, higher than that in control,indicating that nuclear influx of Myb3 can be induced by iron or8-bromo-cAMP alone. TvPKAc was detected in all cytosolicsamples at similar levels, but TvPKAc(Thr(P)164) was at similarlevels in samples from iron repletion and 8-bromo-cAMP stim-

ulation, much higher than that in control. TvHsp70-1 wasdetected at similar levels in all samples.

These samples were also enriched by IP for Western blotting(Fig. 9D). Cytosolic HA-Myb3 was detected at similar levels insamples from iron repletion and 8-bromo-cAMP stimulation,slightly lower than that in control. In contrast, nuclear HA-Myb3 was detected at similar levels in samples from iron reple-tion and 8-bromo-cAMP stimulation, much higher than that incontrol. Myb3(Thr(P)156) was only detected in nuclear samplesat similar levels in samples from iron repletion and 8-bromo-cAMP stimulation, much higher than that in control. In a dupli-cate blot, a phosphorylated Myb3 as detected by the anti-phos-pho-Thr/Pro antibody was mostly in nuclear samples at a muchhigher level with iron repletion than 8-bromo-cAMP stimula-tion or control to phosphorylate Myb3 and facilitate its nuclearinflux. TvPKAc was detected at similar levels in all cytosolicsamples, but TvPKAc(Thr(P)164) was detected at similar levelsin samples from iron repletion and 8-bromo-cAMP stimula-tion, much higher than that in control. TvHsp70-1 was detectedin all cytosolic samples at similar levels. These results suggestthat the interactions between TvPKAc and Myb3 and subse-quent consequences induced by iron are probably in part medi-ated via its effect on the production of cellular cAMP.

FIGURE 9. Transient interactions between Myb3 and TvPKAc induced by iron and 8-bromo-cAMP. Cells overexpressing HA-Myb3 were maintained iniron-depleted medium and replete with iron (A–D) or stimulated with 8-bromo-cAMP (C and D). Cells were harvested at intervals, and total cell lysates (TL) werefractionated into cytosolic (Cy) and nuclear (N) fractions, as indicated above of each panel. Samples were directly analyzed by Western blotting (A and C) orenriched by IP before Western blotting (B and D) using the anti-Myb3, anti-phospho-(Ser/Thr)PKA substrate, and anti-phospho-Thr/Pro, anti-TvPKAc, anti-PKA�-Thr(P)197, anti-TvHsp70-1, anti-TvCyP1, and anti-H3K9-Ac antibodies to detect overall Myb3, Myb3(Thr(P)156), Myb3(pTP), TvPKAc, TvPKAc(Thr(P)164),TvHsp70-1, TvCyP1, and H3K9-Ac, respectively. Relative amounts of HA-Myb3 in cytosols (Cy) and nuclei (N) are each quantified from three independentexperiments and statistically analyzed as shown in the histogram, with p � 0.05 (*) and p � 0.01 (**) indicated. Error bars, S.E.




http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

DISCUSSION

Iron is by far the best studied exogenous factor inducing myr-iad cellular responses in T. vaginalis (12). Iron was shown toenhance the phosphorylation of a variable surface antigen,P270, and numerous uncharacterized proteins and the expres-sion of a few protein kinase genes (22, 43), but these effects wereevaluated after overnight or longer exposure, a period thatspans multiple cell division cycles. Thus, its direct impact onsignal transduction of the parasite is not clear. In contrast, ironinduces elevation of cellular cAMP and the nuclear influx ofMyb3 within 1–3 min (27, Figs. 1 and 3), implying that ironprobably activates signal transduction to exert its physiologicaleffects (44, 45).

In our experimental system, iron is the sole factor to inducethese cellular responses because serum and the slight oxidativestress generated by iron overloading had little impact on induc-ible nuclear influx of Myb3 (Fig. 1, D and F). The parasite maysense a moderate to drastic elevation of iron supply and adjustthe level of nuclear Myb3 to fine tune the expression of its targetgenes because the peak level of Myb3 nuclear influx is depen-dent on iron concentrations within a wide range (Fig. 1C). Thedose effect might allow temporal expression of a different sub-set of the Myb3 target genes at various levels of exogenous iron.Although the physiological relevance of the rapid cellularresponses induced by iron remains elusive, our observationshave provided a handle for studying poorly understood signaltransduction in the parasite as reported herein.

It is notable that the magnitude of iron-inducible increase innuclear Myb3 as detected by the IFA (Figs. 1, 2, 5, and 6) andWestern (Figs. 5–9) differs greatly, and this incoherence isprobably due to the fact that the volume of the nucleus in atypical cell is much smaller than that occupied by the cyto-plasm, given that the diameter of the former is �1 �m, and thelatter is �10 �m in length and �5 �m in width. Thus, a seem-ingly slight change in the quantity of nuclear Myb3 by Westernblotting can result in substantial change of its concentration inthe nucleus. Although the amount of cytosolic Myb3 is alwaysin excess of that of nuclear Myb3, as shown in the Western blots(Figs. 5–9), its concentration in the cytoplasm is low and prob-ably below the detection limit of the IFA. The concentrationeffect thus may account for the incoherence in the magnitude ofinduction levels assayed by the IFA and Western blot.

As shown by the effects of suramin and SQ22536 on nuclearinflux of Myb3 (Figs. 2 and 3), iron probably triggers a G�-me-diated pathway that relays upstream signals to adenylyl cycla-ses, which in turn catalyze the biosynthesis of cAMP, a secondmessenger for cAMP-binding proteins, including PKA (46), inwhich the binding of cAMP to the regulatory subunits mayrelease the catalytic subunits from the tetrameric holoenzymeand phosphorylate Myb3 to induce its nuclear influx, asdepicted in Fig. 10. Consistent with the proposed pathway, ironinduced transient elevation of intracellular cAMP that wasinhibited by suramin and SQ22536 (Fig. 3), whereas 8-bromo-cAMP induced a prolonged Myb3 nuclear influx that was inhib-

FIGURE 10. A proposed signal transduction pathway and feedback control for iron-inducible nuclear influx of Myb3. In cells at the resting state (irondepletion), a trimeric G protein composed of G� and G�/� resides close to an adenylyl cyclase (AC) on the inner side of the plasma membrane (PM). The PKAholoenzyme comprising two catalytic (TvPKAc) and two regulatory (TvPKAr) subunits and another protein complex comprising Myb3, TvHsp70-1, and pre-sumably other accessory proteins reside in the cytoplasm (C). Right after iron repletion (stimulation state), the upstream signal is relayed to the G protein. TheG� and G�/� are separated and dislodged into the cytoplasm. The activated G� migrates to a nearby AC to start biosynthesis of cAMP, which diffuses into thecytoplasm and binds to TvPKAr, resulting in the release and autophosphorylation of TvPKAc. The activated TvPKAc forms a new complex with Myb3 andphosphorylates Myb3 at Thr156, which facilitates subsequent ubiquitination at Lys143, presumably by an E3 ligase. The modified Myb3 is immediately trans-ported across the nuclear membrane (NM) into the nucleus (N). The level of cAMP is probably regulated by feedback control in the desensitization state, inwhich TvPKAc presumably phosphorylates and activates a phosphodiesterase to hydrolyze cAMP. When cAMP is depleted, TvPKAc is dissociated from theMyb3 protein complex and binds to TvPKAr to form inactive holoenzyme. Active nuclear influx of Myb3 is then terminated.




http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

ited by H89 (Fig. 2B). Because the T. vaginalis genome contains�8 G� (28) and �100 adenylyl cyclase genes, although nearlyhalf of the latter are thought to be pseudogenes (47), it will bechallenging to study the link between a specific pair of G� andadenylyl cyclase induced by iron overloading. Our observationsshould provide a way to decipher these signaling molecules.

Protein ubiquitination is often involved in the degradationand intracellular trafficking of specific cellular proteins ineukaryotic systems (48). As revealed by LC-MS/MS and func-tional assays exploring the site-directed mutagenesis (Figs. 5and 6), the inducible phosphorylation of Thr156 and ubiquiti-nation of Lys143 are crucial for the nuclear influx of Myb3 inresponse to a sudden iron overload. Because both modificationswere inhibited by H89 and ubiquitination was constitutive inT156D and aborted in T156A (Fig. 6), ubiquitination is mostlikely induced after the phosphorylation of Thr156. Theseevents must occur in the cytoplasm because T156A and K143Rwere restrained therein, and TvPKAc and its interaction withMyb3 are most likely in the cytoplasm over the course of ironrepletion (Figs. 5–9). Myb3 thus modified was detected almostexclusively in nuclear lysates with a concomitant influx of Myb3(Fig. 5), indicating that the ubiquitination is a check point forthe PKA-mediated nuclear influx of Myb3. In this regard, theubiquitination may facilitate interactions between Myb3 and acertain component(s) in the protein nuclear import machinery(48). This hypothesis remains to be tested.

Myb3 is unique among solved structures of Myb proteins inthat it has an extra small hairpin known to enhance DNA bind-ing activity via interaction with the N-terminal helices of theR2R3 domain (42). Thr156 resides at the end of the �1 strand topair with Glu162 in the anti-parallel �2 strand (42). Due to anewly acquired negative charge, phosphorylated Thr156 maybreak off from the negatively charged Glu162 and destabilize thehairpin, which might change the Myb3 conformation andrender Lys143, the side chain of which is buried in a compacthelical structure and forms a hydrogen bond with a guanineresidue in the Myb3 recognition DNA element (42), accessibleto ubiquitination machinery. Clustered mutations of 157NSN159

that might also disrupt the hairpin structure revealed a pheno-type similar to T156D (27). Because the small hairpin andLys143 are both essential for optimal DNA-binding of Myb3(42), their modifications would prevent Myb3 that enters thenucleus after iron repletion from promoter entry. For thesereasons, the TvPKAc-mediated nuclear influx of Myb3 maynegatively regulate transcription, possibly by outcompetingcrucial co-factors in the transcription machinery.

The iron-inducible nuclear influx of Myb3 was inhibited bysuramin and SQ22536, but it was only delayed to a later timepoint by H89 (Fig. 2A). This discrepancy is unlikely to be due toan insufficient amount of H89 used in the experiments becausethe same dosage inhibited 8-bromo-cAMP-induced nuclearinflux of Myb3 and the phosphorylation and ubiquitination ofMyb3 at Thr156 and Lys143, respectively (Figs. 2C and 7). More-over, the level of phosphorylation of an unknown Thr/Ser res-idue(s) preceding Pro at Myb3 was only induced by iron and not8-bromo-cAMP (Fig. 9D), implying that iron may also activatea proline-directed protein kinase like MAPK or CDK to phos-phorylate Myb3 (16, 49). This possibility is supported by the

observation that nuclear translocation of Myb3 is regulated byTvCyP1 (36), a cyclophilin catalyzing the cis-trans interconver-sion of the peptidyl-prolyl bond (50). Iron-inducible influx ofMyb3 was also partially inhibited by KT5823 (Fig. 7), which hadlittle effect on iron-inducible phosphorylation at Thr156 andubiquitination at Lys143 of Myb3, whereas 8-bromo-cGMPcould also induce the nuclear influx of Myb3.2 Together, theseobservations suggest that iron might simultaneously triggermultiple signaling pathways and that Myb3 imported into thenucleus through those mediated other than by TvPKAc maybind DNA at promoter sites to positively regulate transcription.Presumably, the parasite might switch off transcription of asubset of its target genes before switching on transcription ofanother subset. Why the parasite should exploit such a compli-cated mechanism to regulate nuclear import of Myb3 remainsan intriguing question.

The proper annotation of protein kinases in T. vaginalis hasbeen difficult, in part due to their complexity and sequencedivergence from eukaryotic paradigms. These hurdles wereovercome in the identification of a TvPKAc while exploring aphosphoproteomics approach.2 The activity and substratespecificity of recombinant His-TvPKAc were confirmed by anin vitro protein kinase assay (Fig. 8D), and its phosphorylationin vivo was induced by iron and 8-bromo-cAMP to similar lev-els (Fig. 8F). Iron and 8-bromo-cAMP exerted similar roles ininducible interaction between TvPKAc and Myb3, leading tothe nuclear influx of Myb3 (Fig. 9, B and D). Because iron butnot cAMP induced phosphorylation of Myb3 at some Ser/Thrresidues preceding Pro (Fig. 9D), Myb3 might also interact witha Pro-directed protein kinase (16, 51) and form a transient pro-tein complex distinct from that with TvPKAc.2 In contrast,Myb3 was persistently associated with TvHsp70-1 in the cyto-plasm independently of iron and cAMP. In this regard,TvHsp70-1 may serve as molecular chaperone in maintainingproper conformation of Myb3 for the assembly and disassemblyof the protein complexes. Also, the transient change of cellularcAMP that leads to the interaction of TvPKAc and Myb3 isprobably regulated by feedback control of the intracellularcAMP level through a phosphodiesterase (52). These possibili-ties remain to be investigated. A survey of the genome databaseonly revealed a TvPKAc and two regulatory isoforms of TvP-KAr in T. vaginalis.2 Given such simplicity in the TvPKA sys-tem, its global roles in iron overloading can be investigated.TvPKAc might also be activated by other extracellular stimulior intrinsic factors because cAMP in T. vaginalis can be pro-duced from numerous adenylyl cyclases (47). To the best of ourknowledge, this is the first protein kinase in T. vaginalis to bebiochemically and functionally defined.

T. vaginalis is a successful parasite that rarely causes severesymptoms in humans. Unlike most other parasites, it survivessolely in the human host as simple asexual trophozoites withoutapparent cell differentiation or a dormant stage. With aremarkably complex proteome and kinome for a unicellularorganism, the parasite may have evolved intricate cellularmachinery to adapt to hostile host environments. In this regard,the signal transduction network can be a frontline for the par-asite to counteract host defenses. Our observations suggest thatT. vaginalis uses a conserved signaling pathway to relay cellular




http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

signals triggered by iron from plasma membrane to the nucleus.It would be interesting to see whether this phenomenon is alsopresent in other organisms. Given the nature of signal trans-duction for amplifying upstream signals at each subsequentstep, it is conceivable that iron may have a much broader impacton the cell physiology of the parasite than observed in thisstudy.2

Acknowledgments—We thank Dr. Fu-An Li at the proteomics core ofIBMS for technical support, the metabolomics core of AcademiaSinica for the use of facilities, and Buford C. Pruitt, Jr., for Englishediting of the manuscript.

REFERENCES1. Rowley, R., Toskin, I., and Ndowa, F. (2012) Global incidence and preva-

lence of selected curable sexually transmitted infections: 2008. WorldHealth Organization, Geneva

2. Secor W. E., Meites E., Starr M. C., and Workowski K. A. (2014) Neglectedparasitic infections in the United States: trichomoniasis. Am. J. Trop. Med.Hyg. 90, 800 – 804

3. Weinstock, H., Berman, S., and Cates, W. Jr. (2004) Sexually transmitteddiseases among American youth: incidence and prevalence estimates,2000. Perspect. Sex. Reprod. Health 36, 6 –10

4. Cotch, M. F., Hillier, S. L., Gibbs, R. S., and Eschenbach, D. A. (1998)Epidemiology and outcomes associated with moderate to heavy Candidacolonization during pregnancy: Vaginal Infections and Prematurity StudyGroup. Am. J. Obstet. Gynecol. 178, 374 –380

5. Petrin, D., Delgaty, K., Bhatt, R., and Garber, G. (1998) Clinical and mi-crobiological aspects of Trichomonas vaginalis. Clin. Microbiol. Rev. 11,300 –317

6. Shafir, S.C., Sorvillo, F. J., and Smith, L. (2009) Current issues and consid-erations regarding trichomoniasis and human immunodeficiency virus inAfrican-Americans. Clin. Microbiol. Rev. 22, 37– 45, Table of Contents

7. Sorvillo, F., Smith, L., Kerndt, P., and Ash, L. (2001) Trichomonas vagina-lis, HIV and African-Americans. Emerg. Infect. Dis. 7, 927–932

8. Nanda, N., Michel, R. G., Kurdgelashvili, G., and Wendel, K. A. (2006)Trichomoniasis and its treatment. Expert Rev. Anti Infect. Ther. 4,125–135

9. Sutcliffe, S., Giovannucci, E., Gaydos, C. A., Viscidi, R. P., Jenkins, F. J.,Zenilman, J. M., Jacobson, L. P., De Marzo, A. M., Willett, W. C., and Platz,E. A. (2007) Plasma antibodies against Chlamydia trachomatis, humanpapillomavirus, and human herpesvirus type 8 in relation to prostate can-cer: a prospective study. Cancer Epidemiol. Biomarkers Prev. 16,1573–1580

10. Twu, O., Dessí, D., Vu, A., Mercer, F., Stevens, G. C., de Miguel, N., Rap-pelli, P., Cocco, A. R., Clubb, R. T., Fiori, P. L., and Johnson, P. J. (2014)Trichomonas vaginalis homolog of macrophage migration inhibitory fac-tor induces prostate cell growth, invasiveness, and inflammatory re-sponses. Proc. Natl. Acad. Sci. U.S.A. 111, 8179 – 8184

11. Schwebke, J. R., and Burgess, D. (2004) Trichomoniasis. Clin. Microbiol.Rev. 17, 794 – 803, table of contents

12. Figueroa-Angulo, E. E., Rendón-Gandarilla, F. J., Puente-Rivera, J., Calla-Choque, J. S., Cárdenas-Guerra, R. E., Ortega-López, J., Quintas-Grana-dos, L. I., Alvarez-Sánchez, M. E., and Arroyo, R. (2012) The effects ofenvironmental factors on the virulence of Trichomonas vaginalis. Mi-crobes Infect. 14, 1411–1427

13. Papanikolaou, G., and Pantopoulos, K. (2005) Iron metabolism and toxic-ity. Toxicol. Appl. Pharmacol. 202, 199 –211

14. Liu, W., Lin, J., Pang, X., Mi, S., Cui, S., and Lin, J. (2013) Increases offerrous iron oxidation activity and arsenic stressed cell growth by overex-pression of Cyc2 in Acidithiobacillus ferrooxidans ATCC19859. Biotech-nol. Appl. Biochem. 60, 623– 628

15. Dixon S. J., and Stockwell B. R. (2014) The role of iron and reactive oxygenspecies in cell death. Nat. Chem. Biol. 10, 9 –17

16. Ubersax, J. A., and Ferrell, J. E. Jr. (2007) Mechanisms of specificity in

protein phosphorylation. Nat. Rev. Mol. Cell Biol. 8, 530 –54117. Rouault, T. A. (2006) The role of iron regulatory proteins in mammalian

iron homeostasis and disease. Nat. Chem. Biol. 2, 406 – 41418. De Freitas, J., Wintz, H., Kim, J. H., Poynton, H., Fox, T., Vulpe, C. (2003)

Yeast, a model organism for iron and copper metabolism studies. Biomet-als 16, 185–197

19. Van Ho, A., Ward, D. M., and Kaplan, J. (2002) Transition metal transportin yeast. Annu. Rev. Microbiol. 56, 237–261

20. Rouault T. A. (2009) Cell biology. An ancient gauge for iron. Science 326,676 – 677

21. Wösten, M. M., Kox, L. F., Chamnongpol, S., Soncini, F. C., and Groisman,E. A. (2000) A signal transduction system that responds to extracellulariron. Cell 103, 113–125

22. Horváthová, L., Safaríková, L., Basler, M., Hrdy, I., Campo, N. B., Shin,J. W., Huang, K. Y., Huang, P. J., Lin, R., Tang, P., and Tachezy, J. (2012)Transcriptomic identification of iron-regulated and iron-independentgene copies within the heavily duplicated Trichomonas vaginalis genome.Genome Biol. Evol. 4, 1017–1029

23. De Jesus, J. B., Cuervo, P., Junqueira, M., Britto, C., Silva-Filho, F. C.,Soares, M. J., Cupolillo, E., Fernandes, O., and Domont, G. B. (2007) Afurther proteomic study on the effect of iron in the human pathogenTrichomonas vaginalis. Proteomics 7, 1961–1972

24. Ong, S. J., Hsu, H. M., Liu, H. W., Chu, C. H., and Tai, J. H. (2006) Multi-farious transcriptional regulation of adhesion protein gene ap65-1 by anovel Myb1 protein in the protozoan parasite Trichomonas vaginalis. Eu-karyotic Cell 5, 391–399

25. Ong, S. J., Hsu, H. M., Liu, H. W., Chu, C. H., and Tai, J. H. (2007) Activa-tion of multifarious transcription of an adhesion protein ap65-1 gene by anovel Myb2 protein in the protozoan parasite Trichomonas vaginalis.J. Biol. Chem. 282, 6716 – 6725

26. Hsu, H. M., Ong, S. J., Lee, M. C., and Tai, J. H. (2009) Transcriptionalregulation of an iron-inducible gene by differential and alternate promoterentries of multiple Myb proteins in the protozoan parasite Trichomonasvaginalis. Eukaryot. Cell 8, 362–372

27. Hsu, H. M., Lee, Y., Indra, D., Wei, S. Y., Liu, H. W., Chang, L. C., Chen, C.,Ong, S. J., and Tai, J. H. (2012) Iron-inducible nuclear translocation of aMyb3 transcription factor in the protozoan parasite Trichomonas vagina-lis. Eukaryot. Cell 11, 1441–1450

28. Carlton, J. M., Hirt, R. P., Silva, J. C., Delcher A. L., Schatz, M., Zhao, Q.,Wortman, J. R., Bidwell, S. L., Alsmark, U. C., Besteiro, S., Sicheritz-Pon-ten, T., Noel, C. J., Dacks, J. B., Foster, P. G., Simillion, C., Van de Peer, Y.,Miranda-Saavedra, D., Barton, G. J., Westrop, G. D., Müller, S., Dessi, D.,Fiori, P. L., Ren, Q., Paulsen, I., Zhang, H., Bastida-Corcuera, F. D., Simoes-Barbosa, A., Brown, M. T., Hayes, R. D., Mukherjee, M., Okumura, C. Y.,Schneider, R., Smith, A. J., Vanacova, S., Villalvazo, M., Haas, B. J., Pertea,M., Feldblyum, T. V., Utterback, T. R., Shu, C. L., Osoegawa, K., de Jong,P. J., Hrdy, I., Horvathova, L., Zubacova, Z., Dolezal, P., Malik, S. B., Log-sdon, J. M., Jr., Henze, K., Gupta, A., Wang, C. C., Dunne, R. L., Upcroft,J. A., Upcroft, P., White, O., Salzberg, S. L., Tang, P., Chiu, C. H., Lee, Y. S.,Embley, T. M., Coombs, G. H., Mottram, J. C., Tachezy, J., Fraser-Liggett,C. M., and Johnson, P. J. (2007) Draft genome sequence of the sexuallytransmitted pathogen Trichomonas vaginalis. Science 315, 207–212

29. Smith, A., and Johnson, P. (2011) Gene expression in the unicellular eu-karyote Trichomonas vaginalis. Res. Microbiol. 162, 646 – 654

30. Tsai, C. D., Liu, H. W., and Tai, J. H. (2002) Characterization of an iron-responsive promoter in the protozoan pathogen Trichomonas vaginalis.J. Biol. Chem. 277, 5153–5162

31. Chung, W. C., and Kermode, J. C. (2005) Suramin disrupts receptor-Gprotein coupling by blocking association of G protein � and �� subunits.J. Pharmacol. Exp. Ther. 313, 191–198

32. Emery, A. C., Eiden, M. V., and Eiden, L. E. (2013) A new site and mech-anism of action for the widely used adenylate cyclase inhibitor SQ22536.Mol. Pharmacol. 83, 95–105

33. Lochner, A., and Moolman, J. A. (2006) The many faces of H89: a review.Cardiovasc Drug Rev. 24, 261–274

34. Taylor, M. S., Okwuchukwuasanya, C., Nickl, C. K., Tegge, W., Brayden,J. E., and Dostmann, W. R. (2004) Inhibition of cGMP-dependent proteinkinase by the cell-permeable peptide DT-2 reveals a novel mechanism of




http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

vasoregulation. Mol. Pharmacol. 65, 1111–111935. Harlow, E., and Land, D. (1988) Antibodies: A Laboratory Manual, pp.

55–137, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY36. Hsu, H. M., Chu C. H., Wang Y. T., Lee Y., Wei, S. Y., Liu, H. W., Ong, S. J.,

Chen, C., and Tai, J. H. (2014) Regulation of nuclear translocation of theMyb1 transcription factor by TvCyclophilin 1 in the protozoan parasite,Trichomonas vaginalis. J. Biol. Chem. 289, 19120 –19136

37. Rosenfeld, J., Capdevielle, J., Guillemot, J. C., and Ferrara, P. (1992) In-geldigestion of proteins for internal sequence analysis after one- or two-dimensional gel electrophoresis. Anal. Biochem. 203, 173–179

38. Xu, H., and Freitas, M. A. (2009) MassMatrix: a database search programfor rapid characterization of proteins and peptides from tandem massspectrometry data. Proteomics 9, 1548 –1555

39. Xu, H., Hsu, P. H., Zhang, L., Tsai, M. D., and Freitas, M. A. (2010) Adatabase search algorithm for identification of intact cross-links in pro-teins and peptides using tandem mass spectrometry. J. Proteome Res. 9,3384 –3393

40. Ausubel, F. M., Brent, R., Kingston, R. E., Moore, D. D., Seidman, J. G.,Smith, J. A., and Struhl, K. (1997) Current Protocols in Molecular Biology,Chapter 18.7, Greene Publishing Associates/Wiley-Interscience, NewYork

41. Suthanthiran, M., Solomon, S. D., Williams, P. S., Rubin, A. L., Novogrod-sky, A., and Stenzel, K. H. (1984) Hydroxyl radical scavengers inhibit hu-man natural killer cell activity. Nature 307, 276 –278

42. Wei, S. Y., Lou, Y. C., Tsai, J. Y., Ho, M. R., Chou, C. C., Rajasekaran, M.,Hsu, H. M., Tai, J. H., Hsiao, C. D., and Chen, C. (2012) Structure of theTrichomonas vaginalis Myb3 DNA-binding domain bound to a promoter

sequence reveals a unique C-terminal �-hairpin conformation. NucleicAcids Res. 40, 449 – 460

43. Alderete, J. F. (1999) Iron modulates phenotypic variation and phos-phorylation of P270 in double-stranded RNA virus-infected Trichomonasvaginalis. Infect Immun. 67, 4298 – 4302

44. Cyert, M. S. (2001) Regulation of nuclear localization during signaling.J. Biol. Chem. 276, 20805–20808

45. Saint Fleur, S., and Fujii, H. (2008) Cytokine-induced nuclear transloca-tion of signaling proteins and their analysis using the inducible transloca-tion trap system. Cytokine 41, 187–197

46. Tilley, D. G. (2011) G protein-dependent and G protein-independent sig-naling pathways and their impact on cardiac function. Circ. Res. 109,217–230

47. Cui, J., Das, S., Smith, T. F., and Samuelson, J. (2010) Trichomonas trans-membrane cyclases result from massive gene duplication and concomi-tant development of pseudogenes. PLoS Negl. Trop. Dis. 4, e782

48. Chernorudskiy, A. L., and Gainullin, M. R. (2013) Ubiquitin system: directeffects join the signaling. Sci. Signal. 10.1126/scisignal.2004251

49. Zhou X. Z., Lu P. J., Wulf G., and Lu K. P. (1999) Phosphorylation-depen-dent prolyl isomerization: a novel signaling regulatory mechanism. CellMol. Life Sci. 56, 788 – 806

50. Wang, P., and Heitman, J. (2005) The cyclophilins. Genome Biol. 6, 22651. Tanoue, T., Adachi, M., Moriguchi, T., and Nishida, E. (2000) A conserved

docking motif in MAP kinases common to substrates, activators and reg-ulators. Nat. Cell Biol. 2, 110 –116

52. Omori, K., and Kotera, J. (2007) Overview of PDEs and their regulation.Circ. Res. 100, 309 –327




http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

Chou, Yet-Ran Chen, Shu-Hui Chen and Jung-Hsiang TaiHong-Ming Hsu, Yu Lee, Pang-Hung Hsu, Hsing-Wei Liu, Chien-Hsin Chu, Ya-Wen

Trichomonas vaginalisMyb3 Transcription Factor in the Parasitic Protozoan Signal Transduction Triggered by Iron to Induce the Nuclear Importation of a

doi: 10.1074/jbc.M114.599498 originally published online September 2, 20142014, 289:29334-29349.J. Biol. Chem.

10.1074/jbc.M114.599498Access the most updated version of this article at doi:

Alerts:

When a correction for this article is posted•

When this article is cited•

to choose from all of JBC's e-mail alertsClick here

http://www.jbc.org/content/289/42/29334.full.html#ref-list-1

This article cites 49 references, 22 of which can be accessed free at


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/lookup/doi/10.1074/jbc.M114.599498

http://www.jbc.org/cgi/alerts?alertType=citedby&addAlert=cited_by&cited_by_criteria_resid=jbc;289/42/29334&saveAlert=no&return-type=article&return_url=http://www.jbc.org/content/289/42/29334

http://www.jbc.org/cgi/alerts?alertType=correction&addAlert=correction&correction_criteria_value=289/42/29334&saveAlert=no&return-type=article&return_url=http://www.jbc.org/content/289/42/29334

http://www.jbc.org/cgi/alerts/etoc

http://www.jbc.org/content/289/42/29334.full.html#ref-list-1

http://www.jbc.org/

Documents

SignalTransductionTriggeredbyIrontoInducetheNuclear ... · ml 1 ampicillin and incubated at 37 °C with constant shaking until an A 600 of 0.6 was reached. Expression of the recombi-nant