Signaling to Sir2-mediated transcriptional silencing through

Wesleyan University The Honors College

Signaling to Sir2-mediated transcriptional silencingthrough metabolism

by

Kuan-lin HuangClass of 2012

A thesis submitted to thefaculty of Wesleyan University

in partial fulfillment of the requirements for theDegree of Bachelor of Arts

with Departmental Honors in Molecular Biology and Biochemistry

Middletown, Connecticut April, 2012

ACKNOWLEDGEMENTS

First and foremost, I would like to thank my advisor, Dr. Scott Holmes, for

providing me with this wonderful learning opportunity. Throughout these three years,

he has been a patient teacher and a caring friend. His advice has often given me fresh

and important perspectives to look at my experiments, education, and life.

I am grateful to all my fellow lab members: Asmitha, Tina, Upasna, Becky,

Sam, Anand, Hannah, Shiwei, Dessie, Priyanka, Lisle and Claire. I have really

enjoyed every moment spent in and out of the lab with you. I have always been proud

to be a member of the Holmes’s lab because you are all awesome.

I also want to thank my friends who have always kept me company.

Specifically, I would like to thank Yu for constantly showing her care and

encouraging me. I would also like to extend my gratitude to Nam-Anh, Taiki, Sandy,

Han-Hsien, and Sunil for bringing great fun into my college life.

Finally, I would like to thank my dad, my mom, and my sister for their

unconditional support. They have always been the extremely supportive, regardless of

whatever I pursue.

TABLE OF CONTENTS

Introduction..................................................................................................................1

I. Sir2.........................................................................................................................2

II. Sir2-mediated transcriptional silencing .................................................................5

1. HM loci ............................................................................................................6

2. Telomeres .........................................................................................................7

3. rDNA repeats ...................................................................................................8

III. Sir2 biochemistry and regulation .........................................................................10

IV. Sirtuins and metabolism.......................................................................................13

1. Signaling from metabolism to Sir2 ................................................................13

2. Sirtuins as metabolic regulators .....................................................................17

V. Sirtuins, mitochondria, and aging ........................................................................19

VI. Goal of the study..................................................................................................21

Material and Methods ...............................................................................................22

I. Plasmids, Strains, and Primers..............................................................................22

II. Strain Construction ...............................................................................................26

1. Overexpression plasmid construction and sequencing ...................................26

2. Creation of gene deletion, site-directed mutation and overexpression strains

........................................................................................................................27

III. Petite strain verification ........................................................................................27

IV. Serial Dilution Assays...........................................................................................28

1. Lethality assay ................................................................................................28

2. Sir-mediated silencing assay...........................................................................29

3. Nuclear NAD reporter assay...........................................................................29

4. Oxidative stress assay .....................................................................................30

5. Two-hybrid assay............................................................................................31

V. Fluorescence microscopy......................................................................................31

VI. rDNA recombination rate measurement ...............................................................32

VII. Western Blotting ...................................................................................................34

Results .........................................................................................................................37

I. Adh1......................................................................................................................37

1. Δadh1 Mutant Exhibits Silencing Defects at Telomeres................................38

2. Δadh1 Mutant Exhibits Lower Tolerance to Oxidative Stress.......................40

II. Tdh3......................................................................................................................43

1. Tdh3 localization studies ...............................................................................43

2. Silencing assay of tdh3T227A, T227K and N314T mutants ..........................46

III. Mrps12 ..................................................................................................................53

1. MRPS12 overexpression enhances Sir2 and Sir3-induced lethality ..............54

2. Lethality assay in Δsir2 and Δsir3 strains ......................................................55

3. Silencing assay of Δmrps12 mutants .............................................................58

4. Silencing assay of MRPS12 overexpressing strains.......................................60

5. rDNA recombination assay of Δmrps12 mutants...........................................63

6. MRPS12 overexpression does not affect Sir2 expression levels....................65

7. Sir2 and Mrps12 do not interact through two-hybrid assays .........................67

8. Nuclear NAD+ levels in mrps12 mutants.......................................................69

Discussion....................................................................................................................72

I. Adh1......................................................................................................................72

II. Tdh3......................................................................................................................74

III. Oxidative stress signaling .....................................................................................77

IV. Mrps12 ..................................................................................................................79

V. Sir2 as a metabolic regulator?...............................................................................81

VI. Conclusion ............................................................................................................82

References ...................................................................................................................83

LIST OF TABLESTable 1: Plasmids used in this study.Table 2: S. cerevisiae strains used in this study.Table 3: Primers used in this study.

LIST OF FIGURESFigure 1. Acetylated histones are deacetylated by Sir2, resulting in transcriptionalsilencing.Figure 2. Molecular phylogeny of the sirtuins.Figure 3. A model of silencing at HML.Figure 4. A model of silencing at telomeres.Figure 5. Sir2 and NAD metabolism.Figure 6. Two potential pathways for CR-mediated life span extension in yeast.Figure 7. Sirt1 and Sirt3 regulate metabolic response pathways in various tissues.Figure 8. Possible calorie restriction pathways in different species.Figure 9. Nuclear NAD+ reporter strain.Figure 10. Silencing assay of adh1 knockout mutant at HMR and Telomere V.Figure 11. H2O2 oxidative stress assay of adh1∆ mutant.Figure 12. Localization of Tdh3-GFP.Figure 13. Localization of a Tdh3-myc construct in wild type, sir2∆ and tdh2∆ strains.Figure 14. Silencing assay of tdh3 mutants at HMR and Telomere V.Figure 15. MRPS12 overexpression enhances Sir2 and Sir3-induced lethality.Figure 16. MRPS12 overexpression enhances Sir2 and Sir3-induced lethality in aΔsir2 strain.Figure 17. MRPS12 overexpression enhances Sir2 and Sir3-induced lethality in aΔsir3 strain.Figure 18. Silencing assay of mrps12∆ mutant at HMR and Telomere V.Figure 19. Silencing assay of mrps12∆ mutant at rDNA repeats.Figure 20. Silencing assay of MRPS12 overexpressing strains at HMR and TelomereV.Figure 21. rDNA recombination assay of ∆mrps12 mutant.Figure 22. Western blotting of Sir2 expression levels from chromosomal SIR2 and anuninduced GAL10-SIR2 construct on a 2μ high-copy plasmid.Figure 22. Western blotting of Sir2 expression levels from an induced GAL10-SIR2construct on a 2μ high-copy plasmid.Figure 23. Nuclear NAD level upon the deletion or the overexpression of MRPS12.Figure 24. A model of Sir2 regulation by Adh1 and Tdh3.Figure 25. A model of aging/oxidative stress signaling to Sir2 through Tdh3 andAdh1.

1

INTRODUCTION

DNA carries the information required to construct a cell. Yet, just as

musical notes need to be thoughtfully arranged to compose a melody, the genetic

information encoded in DNA requires regulated processing in order to create a

functioning cell. Like musical notes, each gene must be “played” or expressed at

the appropriate level and timing. The regulation of gene expression allows diverse

cell characteristics and behaviors within one constant set of genomic sequence.

Gene expression is regulated at multiple steps in the central dogma

pathway from DNA, RNA to protein. As one regulatory mechanism, the

organization of DNA molecules affects their exposure to transcription machineries

and gene expression. In eukaryotic cells, DNA is packaged by histone proteins

into an ordered structure called chromatin. Chromatin structure is dynamic, and

can be controlled by post-translational modifications of histone proteins [reviewed

in (Eberharter, Ferreira et al. 2005)]. Histone acetylation is one such modification

that alters chromatin structure. Chromatins with acetylated histones adopt a more

relaxed structure that is associated with transcriptional activation. In contrast,

chromatins containing hypoacetylated histones are more compact and silenced in

gene expression [reviewed in (Kouzarides 2007)].

2

In budding yeast, Saccharomyces cerevisiae, Sir (Silent information regulator)

proteins are key mediators of chromatin silencing. Among them, Sir2 is a histone

deacetylase that is essential in the establishment and maintenance of silenced

chromatin structure [reviewed in (Rusche, Kirchmaier et al. 2003)]. It is

evolutionarily conserved from bacteria to human, and its orthologs have been

found to serve similar functions (Blander and Guarente 2004). The studies of gene

regulation by Sir2 deacetylation in budding yeast may provide valuable insights

into related mechanisms in other organisms.

Figure 1. Acetylated histones are deacetylated by Sir2, resulting in transcriptionalsilencing. [Diagrams of histones are adopted from (Schreiber Laboratory 2012).]

I. Sir2

Budding yeast Sir2 is a histone deacetylase (HDAC) that works in concert

with other Sir proteins and collaborating factors to silence gene expression from

chromatin. HDACs are divided into three classes. Yeast Rpd3 and Hda1 are the

respective founding members of class I and II HDACs, which share high

similarity in their catalytic cores (de Ruijter, van Gennip et al. 2003). Sir2 is the

3

founding member of class III HDACs that have little sequence homology to class

I and II HDACs (North and Verdin 2004). Distinct from HDACs of the other two

classes, Sir2’s deacetylation activity requires nicotine adenine dinucleotide (NAD)

as a cofactor (Landry, Sutton et al. 2000). This specific requirement may link

Sir2’s transcriptional regulation activity to cell’s redox state and metabolism.

In Saccharomyces cerevisiae, four Sir2 homologs, Hst1-4, have been

discovered and characterized. They serve direct or indirect functions in silencing,

cell cycle progression, radiation resistance, and genome stability (Brachmann,

Sherman et al. 1995). Among them, Hst1 is the closest homolog of Sir2. It is a

NAD-dependent deacetylase that represses the expression of NAD biosynthesis

genes with its DNA binding partner, Sum1. It is suggested that Hst1p may serve as

a cellular NAD sensor that monitors and regulates cellular NAD levels (Bedalov,

Hirao et al. 2003). More specifically, this demonstrates that Hst1 can translate the

message from cell’s metabolic state into its silencing activity, which in turns

affects cell metabolism.

Across species, Sir2 is evolutionarily conserved and its homologs have

been discovered in all three kingdoms of life. Sir2-like NAD-dependent

deacetylases are called sirtuins. They share a conserved core domain of

approximately 260 amino acids. As seen in figure 2, a molecular phylogeny

4

analysis based on this domain classified sixty sirtuins into four major branches

(Frye 2000). Structural studies have implicated the core domain’s role in binding

to NAD and the acetyl-lysine substrate, conferring sirtuins’ NAD-dependent

deacetylase activity (North and Verdin 2004).

Figure 2. Molecular phylogeny of the sirtuins: an unrooted tree diagram of aphylogenetic analysis of the conserved sirtuin core deacylase domain sequences,divided into class I, II, III, IV, and U groups; classes I and IV are further dividedinto subclasses indicated by lowercase letters. Adopted and modified from(Blander and Guarente 2004).

As the list of identified sirtuins expands, novel subcellular localizations,

protein interactors and substrates of sirtuins are also constantly being reported

(Blander and Guarente 2004). In bacteria, CobB is a prokaryote sirtuin that

deacetylates and activates the acyl-CoA synthase in an NAD-dependent manner

(Starai, Takahashi et al. 2003). As one of the five Drosophila sirtuins, dSir2 is a

5

histone deacetylase that is required for transcriptional silencing. The deletion of its

gene causes silencing loss and a shortened lifespan (Astrom, Cline et al. 2003). In

mammals, there are seven Sir2 homologs, SIRT1-7. They are found in diverse

cellular localizations: SIRT1 localizes to the nucleus and cytoplasm, SIRT2

localizes to the cytoplasm, SIRT3-5 are mitochondrial and SIRT6, 7 are nuclear.

They affect a broad range of cellular functions including transcriptional regulation,

stress response and metabolism [reviewed in (Schwer and Verdin 2008) (Haigis

and Guarente 2006)]. The diverse functions of sirtuins implicate their roles as

communication centers for multiple cellular pathways. Importantly, they might be

able to associate other cell functions to their transcriptional regulation activity.

II. Sir2-mediated transcriptional silencing

Sir proteins are required for the proper establishment of silent chromatin

structure at three genetic loci in budding yeast, including the cryptic mating type

loci (HM loci), telomeres and rDNA repeats. In general, silent chromatin

establishment is initiated by the targeting of Sir proteins and their interacting

partners to cis-acting elements, termed silencers. Subsequently, these proteins

spread continuously to the adjacent chromatin regions through the recruitment of

additional Sir proteins (Rusche, Kirchmaier et al. 2003). The detailed mechanisms

of silencing differ between each of the three silenced loci.

6

1. HM loci

The S. cerevisiae yeast genome contains spare copies of mating type genes in

the cryptic mating type loci, HML and HMR. These loci are silenced under normal

conditions, and their silenced state is required for yeast’s mating ability. HMR and

HML are each flanked by an E and an I silencers, which contain different

combinations of binding sites for ORC (origin recognition complex), Rap1 and

Abf1 [reviewed in (Rusche, Kirchmaier et al. 2003)]. In a current model, these

silencer binding proteins recruit the four Sir proteins, which form a stable

complex to nucleate silencing. The Sir2 protein from this complex deacetylates

the histones next to the silencers. These deacetylated histones in turn promote the

binding of another Sir2-4 complex to modify the adjacent histones. This cycle of

Sir proteins complex recruitment and histone modifications repeats until the entire

HM locus is hypoacetylated and stably bound with Sir2-4 protein complexes

[reviewed in (Fox and McConnell 2005)].

Figure 3. A model of silencing at HML. Upon binding to a silencer, silencerbinding proteins recruit Sir1-4. The Sir proteins form a complex and deacetylateadjacent histones, which in turn recruits another Sir2-4 protein complex to modifythe next nearby histones. This cycle is repeated until the entire HML locus ishypoacetylated.

7

2. Telomeres

Telomeres are DNA regions with repetitive sequences at the ends of

chromosomes that maintain the integrity of chromosome ends (Zakian 1996). In a

phenomenon known as telomere position effect (TPE), genes placed near

telomeres are repressed in a position dependent manner, indicating the silenced

state of this chromatin region (Gottschling, Aparicio et al. 1990).

Silencing at telomeres is established by similar factors that are involved in

HM loci silencing. Rap1 binds to its binding sites at telomeres and recruits the Sir

2-4 proteins. Additionally, Ku complex might also participate in the recruitment of

Sir proteins (Mishra and Shore 1999). These Sir proteins form a complex and

propagate to form silenced chromatin structures at the telomeres. Although ORC,

Abf1 and Sir1 are not required for the silencing protein assembly at telomeres,

their binding sites have been identified and they may play some roles in telomeric

silencing [reviewed in (Huang 2002; Rusche, Kirchmaier et al. 2003)].

Figure 4. A model of silencing at telomeres. Rap1 recruits the Sir 2-4 proteins totelomere repeats. These Sir proteins form a complex and propagate to formsilenced chromatin structures at the telomeres.

8

3. rDNA repeats

In budding yeast, the genes encoding for rRNA (rDNA) are organized in

tandem arrays of approximately 100 to 200 repeats. Each rDNA repeat contains

two rRNA genes separated by nontranscribed spacers. The gene encoding 35S

rRNA is transcribed by RNA polymerase (Pol) I, whereas the gene encoding 5S

rRNA is transcribed by Pol III (Rusche, Kirchmaier et al. 2003). Due to silencing

at rDNA repeats, Pol II-transcribed reporter genes are repressed when inserted into

rDNA repeats in a Sir2-dependent manner (Gottlieb and Esposito 1989; Fritze,

Verschueren et al. 1997).

The silencing at rDNA repeats is established by a set of factors that is

distinct from that of HM loci or telomeres. It is mediated by the RENT (regulator

of nucleolar silencing and telophase exit) complex consisting of at least three

protein components: Sir2, Net1 and Cdc14 (Huang 2002). Net1 recruits Sir2 to the

nucleolus and is required for silencing (Straight, Shou et al. 1999). However, the

cis-acting elements and other structural components responsible for rDNA

silencing are unresolved (Huang 2002; Rusche, Kirchmaier et al. 2003), and the

detailed mechanism of rDNA silencing remains unclear.

At rDNA repeats, another function of Sir2 is the suppression of intra- and

inter-chromosomal recombination. Recombination within the rDNA repeats forms

9

extrachromosomal rDNA circles (ERCs), which is a cause of aging in yeast

(Sinclair and Guarente 1997). Accumulation of ERCs and a decreased lifespan is

observed in a sir2 mutant (Kaeberlein, McVey et al. 1999). In one model of ERC

suppression, a cohesion clamp complex serves as a bridge between sister

chromatids to suppress unequal rDNA recombination and ERC formation (Reid

and Rothstein 2004). The cohesion bridge at rDNA repeats is formed by a

complex of proteins, including Sir2 (Huang, Brito et al. 2006). Sir2 may

contribute to the proper formation of this complex. Thus, the loss of Sir2 causes

destabilization of the cohesion bridge and an increased rDNA recombination rate.

It is worth noting that the silenced chromatin structure is dynamic. When

uncoupled from its silencer, DNA rings excised from HMR were initially silent but

ultimately reactivated in cell cycle arrested cells, indicating that maintenance of

silencing at HMR continuously requires silencers. Additionally, in the same study,

newly expressed Sir3 was found to be incorporated into the silenced chromatin

(Cheng and Gartenberg 2000). Finally, by using splitomicin as an inhibitor of Sir2,

it was demonstrated that the continuous histone deacetylation activity of Sir2p

was required for maintaining a silenced state in nondividing cells (Bedalov,

Gatbonton et al. 2001). This implies that a stimulus changing Sir2’s deacetylation

activity can cause an effect on chromatin silencing in a dynamic manner.

10

III. Sir2 biochemistry and regulation

To silence chromatin, Sir2’s histone deacetylase activity requires NAD as a

cofactor. Deacetylation is a thermodynamically favorable reaction, and the NAD

requirement is unique to Sir2’s class of histone deacetylases (Denu 2003).

Hydrolysis of the glycosidic bond between the ribose and nicotinamide moiety of

NAD liberates roughly 8.2 Kcal/mol of free energy (Von Zglinicki 2003). It is

therefore puzzling to why Sir2 would consume an NAD molecule for an already

exothermic reaction. One possible explanation is that the NAD dependence allows

regulation of Sir2’s silencing activity through the availability of NAD, which

reflects the cellular redox state. Additionally, the two enzymatic products

generated, O-acetyl-ADP-ribose and nicotinamide, may also be able to facilitate

feedback regulation (Von Zglinicki 2003).

In both yeast and mammals, there are two major NAD biosynthesis

pathways: a denovo pathway and a salvage pathway. The salvage pathway

regenerates NAD from nicotinamide, which can be produced by the

sirtuin-mediated deacetylation reaction (Rusche, Kirchmaier et al. 2003). Genetic

studies in yeast have confirmed that perturbations in NAD pathways can affect

Sir2 activity [reviewed in (Yang and Sauve 2006)]. For example, deletion of NPT1

from the NAD salvage pathway causes a 60% depletion in cellular NAD and a

11

reduction in Sir2 silencing (Smith, Brachmann et al. 2000). Consistently, extra

copies of NPT1 results in a higher level of silencing (Anderson, Bitterman et al.

2002). Deletion of another NAD salvage pathway gene, PNC1, also causes

silencing defects (Sandmeier, Celic et al. 2002). However, no change in global

NAD concentration was observed upon NPT1 overexpression or pnc1 deletion,

suggesting that the change in silencing may be an effect of nicotinamide or other

factors. Nicotinamide is a known inhibitor of Sir2 that may reverse the

deacetylation reaction through the reformation of NAD (Landry, Slama et al. 2000;

Sanders, Zhao et al. 2007). Thus, the potential nicotinamide accumulation in the

strain lacking Pnc1 may be the cause of its loss in Sir2 silencing (Rusche,

Kirchmaier et al. 2003).

Although genetic evidence suggests that perturbations in NAD

biosynthesis pathways can affect Sir2 silencing, it is worth questioning whether

the changes in cellular or nuclear levels of NAD and nicotinamide can be

effectively sensed by Sir2. In yeast, the cellular NAD concentration is typically in

the range of 1 to 2 mM (Evans, Bogan et al. 2010), whereas that in human is

between 400 to 700 μM (Revollo, Grimm et al. 2004). However, the Km for NAD

of yeast and human sirtuins are in the range of 100 to 300 μM, and it is unclear

whether the NAD level fluctuation would significantly affect sirtuin function

12

(Yang and Sauve 2006). One hypothesis is that a high proportion of NAD in cell is

protein-bound. Thus, the freely available NAD concentration is lower than the

determined ones and insufficient to cause rate saturation for sirtuins (Yang and

Sauve 2006). In this case, the fluctuation in cellular NAD concentration could

regulate sirtuins’ function.

On the other hand, the yeast cell’s nicotinamide’s concentration of 10 to

150 μM closely matches the Ki value range for its inhibition of Sir2, 50 to 150 μM

(Sauve, Wolberger et al. 2006). Therefore, changes in cellular nicotinamide level

should be able to affect Sir2’s enzymatic activity. Interestingly, Sir2’s sensitivity

towards nicotinamide inhibition and its affinity towards acetylated substrates alter

when binding to different silencing partner proteins. Thus, the three silencing loci

may respond differently to a change in NAD metabolism (Tanny, Kirkpatrick et al.

2004).

In addition to nicotinamide, the other enzymatic product of Sir2 mediated

deacetylation, O-acetyl-ADP-ribose (O-AADPr), may also regulate Sir protein

silencing. O-AADPr promotes the assembly of the Sir2-4 complex at silenced loci

by recruiting additional Sir3 and altering its conformation (Liou, Tanny et al.

2005). Hence, there may be a positive feedback loop where the production of

O-AADPr through Sir2’s enzymatic activity aids the elongation of the silenced

13

chromatin structure.

Figure 5. Sir2 and NAD metabolism. In the deacetylation reaction it catalyzes,Sir2 requires NAD as a cofactor and generates nicotinamide and O-AADPr asadditional enzymatic products. NAD, nicotinamide and O-AADPr can regulateSir2’s enzymatic activity and may link Sir2’s silencing function to cell’s metabolicnetworks [adopted from (Denu 2003)].

IV. Sirtuins and metabolism

1. Signaling from metabolism to Sir2

Given the role of NAD metabolites in regulating the deacetylase activity of

Sir2, it can be inferred that changes in NAD pathways would affect Sir2 function.

In cellular metabolism and energy production, NAD and its reduced form, NADH,

14

serve as major hydride-accepting and donating coenzymes (Belenky, Bogan et al.

2007). Different metabolic states of a cell may be reflected by varied

NAD/NADH ratios and discrepancies in other NAD pathways components,

resulting in different levels of Sir2 activity.

Among metabolic treatments, calorie restriction (CR) is extensively

studied due to its ability to extent lifespan in a broad spectrum of life ranging from

yeast to mammals [reviewed in (Guarente and Picard 2005)]. CR is a specific

dietary regime that is modeled in yeast by a reduction of glucose from 2% to 0.5%

in growth media (Lin, Defossez et al. 2000). At least a couple proposed pathways

of CR’s effect on lifespan requires NAD and Sir2 activation [reviewed in (Lu and

Lin 2010)]. In one pathway, CR induces a shift of carbon metabolism from

fermentation towards mitochondria TCA cycle, thereby increasing respiration in

yeast (Lin, Kaeberlein et al. 2002). Mitochondrial respiration regenerates NAD

via NADH oxidation, and the NAD/NADH ratio is balanced between the

mitochondrial and the cytosolic/nuclear pools by an NADH shuttle system

(Bakker, Overkamp et al. 2001). Coherently, a decrease in cellular NADH

concentration was observed as an effect of CR, resulting in a higher NAD/NADH

ratio and elevated Sir2 activity (Lin, Ford et al. 2004). However, since NADH is a

weak inhibitor of Sir2, the change in NAD/NADH ratio without NAD may not be

15

sufficient to greatly alter Sir2 activity (Schmidt, Smith et al. 2004). It is suggested

that there may be specific protein-protein interactions creating higher local

NAD/NADH ratios to activate Sir2 (Lu and Lin 2010).

In the other proposed pathway, the expression level of Pnc1, an enzyme

that deaminates nicotinamide, is up-regulated as a response to CR. As a result,

nicotinamide is depleted and Sir2 is activated (Anderson, Bitterman et al. 2003).

Despite the essential role of Sir2 in both of the models, several life span extension

mechanisms in CR have been found to function independently of Sir2 (Kaeberlein,

Kirkland et al. 2004; Lamming, Latorre-Esteves et al. 2005; Smith, McClure et al.

2007). While the role of Sir2 in life span extension is challenged, a higher Sir2

silencing activity in CR has been reported (Lin, Kaeberlein et al. 2002).

Consistently, a 4-fold increase in NAD/nicotinamide ratio was observed along

with marked elevation of Sirt1 deacetylase activity in the brain of CR mouse (Qin,

Yang et al. 2006). Another study also showed an increased NAD level

accompanied by Sirt1 activation in skeletal muscle cells during CR (Canto, Jiang

et al. 2010). These pieces of evidence demonstrate that the availability of glucose

from the environment may alter NAD metabolism, and eventually, sirtuin’s

transcriptional regulation in a cell.

16

Figure 6. Two potential pathways for CR-mediated life span extension in yeast.CR increases mitochondrial respiration and NAD/NADH ratio, which activatesSir2. CR may also increases the expression level of Pnc1, facilitates the clearanceof nicotinamide (Nam) and enhances Sir2’s activity [adopted from (Lu and Lin2010)].

In addition to CR, several mild environmental stresses have also been shown

to up-regulate Pnc1 expression and potentially activate yeast Sir2 [reviewed in

(Lu and Lin 2010)]. Interestingly, increased dosage of Nampt, the functional

homolog of Pnc1 in mammals, is found to increase the cellular NAD level and

enhance sirtuin’s transcriptional regulatory activity (Revollo, Grimm et al. 2004).

Thus, similar mechanisms may exist in yeast and mammals to alter sirtuin’s

transcriptional regulation in response to stresses.

17

2. Sirtuins as metabolic regulators

Upon sensing the changes in cellular metabolic states, what responses are

elicited by sirtuins? If sirtuins can in turn regulate metabolic pathways, they may

serve key roles in maintaining metabolic homeostasis of a cell under different

conditions. Although there is no concrete evidence demonstrating that yeast Sir2

serve such function, extensive studies in mammalian systems have supported the

role of sirtuins in metabolic control [reviewed in (Haigis and Guarente 2006;

Schwer and Verdin 2008; Yu and Auwerx 2009; Houtkooper, Pirinen et al. 2012)].

Among sirtuins, Sirt1 and Sirt3 are found to regulate numerous aspects of

glucose and lipid metabolism in several tissues. They both deacetylate multiple

protein substrates, which then trigger metabolic responses through different

pathways [figure 7, (Houtkooper, Pirinen et al. 2012)]. In particular, the responses

evoked by sirtuins have been associated with fitness under genotoxic or metabolic

stress conditions. Thus, proper level of sirtuin activity may be crucial in the

maintenance of healthspan as well as the prevention of metabolic syndromes

(Guarente 2006; Houtkooper, Pirinen et al. 2012).

18

Figure 7. Sirt1 and Sirt3 regulate metabolic response pathways in various tissues[adopted from (Houtkooper, Pirinen et al. 2012)].

A large portion of metabolic enzymes was found to be acetylated in cells

from bacteria (Wang, Zhang et al. 2010) to human liver tissues (Zhao, Xu et al.

2010), and some of them have been identified as sirtuin targets in respective

organisms. It is proposed that protein acetylation, and perhaps sirtuin’s

deacetylase activity, may be a universal mechanism of metabolic regulation (Xu

and Zhao 2011). Considering the potentially conserved function of acetylation,

whether yeast Sir2 can mediate the deacetylation state of metabolic proteins

remains as an intriguing question.

19

V. Sirtuins, mitochondria, and aging

It is worth noting that several metabolic responses elicited by sirtuins

affect mitochondrial function. As an example, Sirt1 deacetylates and activates

PGC-1α, which then up-regulates mitochondrial genes expression and fatty acid

oxidation (Gerhart-Hines, Rodgers et al. 2007). Furthermore, three sirtuins,

Sirt3-5, reside in mitochondria. They directly regulate mitochondria biology,

including metabolism, energy production and signaling [reviewed in (Verdin,

Hirschey et al. 2010; Pereira, Lebiedzinska et al. 2012)].

The relationship between Sir2 and mitochondria function not only ties

transcriptional regulation to energy production in cells, but may also shed light on

cell’s aging mechanism. Mitochondria has long been associated with aging due to

its production of potentially harmful reactive oxygen species (ROS) [reviewed in

(Balaban, Nemoto et al. 2005)]. Interestingly, in some instances, both

mitochondria and sirtuin activations are essential for CR-mediated lifespan

extension in organisms including yeast and mammals [figure 8, (Guarente 2008)].

The mechanism of how one activation gives rise to the other may be a crucial link

in aging.

20

Figure 8. Possible calorie restriction pathways in different species. In yeast, Sir2 isactivated by mitochondrial changes in response to calorie restriction (CR),whereas the mammalian Sirt1 is implicated upstream of mitochondrial activation[adopted from (Guarente 2008)].

While complex connections have been established between mitochondria

and mammalian sirtuins, yeast Sir2 is associated to mitochondria metabolic states

through solely global NAD/NADH ratio in certain models. Some evidence

suggests a more active role of mitochondria in regulating Sir2. For example, an

increase in mitochondrial DNA reduce the amount of Sir2 bound to the replication

origins of rDNA, accompanied by higher levels of histone acetylation at that

region (Blank, Li et al. 2008). Such effects of mitochondria on Sir2 may not be

satisfactorily explained by changes in global NAD/NADH ratio, implicating that

specific crosstalk mechanisms coordinating mitochondria and Sir2 functions may

also exist in yeast.

21

VI. Goals of this study

Emerging evidence has drawn a connection between Sir2 and metabolism.

Dissecting protein-protein interactions underlying this connection may deepen our

understanding on how Sir2’s transcriptional silencing activity is mediated by a

cell’s metabolic state. In this study, we investigated Sir2’s relationship with three

metabolic proteins that had previously been implicated to regulate Sir2 function.

Among them, Adh1 and Tdh3 are glycolytic proteins that are associated with

NAD metabolism, whereas Mrps12 is a mitochondrial ribosomal protein. We wish

to confirm these proteins’ roles in Sir2 regulation, and further characterize the

mechanisms of their interactions with Sir2.

22

MATERIAL AND METHODS

I. Plasmids, Strains, and Primers

Table 1: Plasmids used in this study.

Strain Plasmid Description Source Project

BSH25 pAR42 2μ URA3 GALp-SIR3 J. BroachLethalityassay

BSH30 pAR14 2μ LEU2 GALp-SIR2 J. BroachLethalityassay

BSH31 pAR16 2μ LEU2 GALp-SIR3 J. BroachLethalityassay

BSH425 pLA7 2μ LEU2 MRPS12(Ayala1999)

Lethalityassay

BSH484 pACT2pACT2 with NadR-AD fusedto Gal4-AD

D. SinclairNad-ReporterAssay

V18 yEP51 2μ LEU2 GALp Holmes labV31 pRS424 2μ TRP1 Holmes labV32 pRS425 2μ LEU2 Holmes labV51 yEP24 2μ URA3 Holmes lab

V158 pAG25 NAT-MX4

(GoldsteinandMcCusker1999)

Deletion

V172 pACT2 LEU2 Ampr D. SinclairEmpty vectorNad-ReporterAssay

V174 pOADGAL4 (AD), LEU2, CEN4,ARS1,

(Uetz etal., 2000) Two-Hybrid

V175 pOBD

ADH1 promoter,GAL4-DBD, ADH1terminator, TRP1 CEN4

(Uetz etal., 2000) Two-Hybrid

23

Table 2: S. cerevisiae strains used in this study.

Strain Genotype Source ProjectYSH316(KS1)

mat α a α ade2 leu2 lys2 trp1-289ura3-52 lys2

J. Broach Lab Lethality assay

YSH323mat α a α ade2 leu2 lys2 trp1-289ura3-52 lys2 ∆sir2::TRP1


YSH496mat α a α ade2 leu2 lys2 trp1-289ura3-52 lys2 ∆sir3::LEU2


YSH503

MATa W303-1A ade2-1 ura3-1trp1-289 leu2-3,112 his3-11,15can1-100 hmr Δ E::TRP1rDNA::ADE2-CAN1TELVR::URA3

K. RungeTriple reporterstrain

YSH529

MATα W303-1A ade2-1 ura3-1trp1-289 leu2-3,112 his3-11,15can1-100 hmr Δ E::TRP1rDNA::ADE2-CAN1TELVR::URA3 ∆sir2::KAN

K. RungeTriple reporterstrain

YSH614MATα his3 Δ200 leu2 Δ1ura3-167 RDN::Ty1-mURA3Δsir2::HIS3

rDNArecombination

YSH615MATα his3 Δ200 leu2 Δ1ura3-167 RDN::Ty1-mURA3

rDNArecombination

YSH880

MATα W303-1A ade2-1 ura3-1trp1-289 leu2-3,112 his3-11,15can1-100 hmr Δ E::TRP1rDNA::ADE2-CAN1TELVR::URA3 ∆tdh3::KAN

A. RingelTriple reporter/gene deletion

YSH896Genotype unknown; (4x)Nad-boxes-HIS3

D. SinclairNuclear NAD+reporter assay

YSH897Genotype unknown; (4x) MutantNad-boxes-HIS3

D. SinclairNuclear NAD+reporter assay

YSH901Genotype unknown; (4x)Nad-boxes-HIS3 Δsir2::NAT

A. RingelNuclear NAD+reporter assay

YSH902Genotype unknown; (4x)Nad-boxes-HIS3 ∆tdh1::NAT

A. RingelNuclear NAD+rreporter assay

YSH905 MATa his3∆1 leu2∆0 met15∆0 Open Tdh3

24

ura3∆0 TDH3-GFP(S65T)–HIS3MX

Biosystems/ E.O’Shea

localizationstudy

YSH961MAT a his3∆1 leu2∆0met15∆0 ura3∆0TDH3-(3xMyc)-HIS3

A. RingelTdh3localizationstudy

YSH1058mat α his3Δ200 leu2Δ1 ura3-167RDN::Ty1-mURA3 adh1:: NAT

K. HuangTriple reporter/gene deletion

YSH1092

mat α ade2-1 ura3-1 trp1-289leu2-3,112 his3-11,15 can1-100hmrΔE::TRP1 rTELVR::URA3(DNA::ADE2-CAN1) mtDNA(non-petite)

K. HuangTriple reporter/site-directedmutation

YSH1093

mat α ade2-1 ura3-1 trp1-289leu2-3,112 his3-11,15 can1-100hmrΔE::TRP1 rTELVR::URA3(DNA::ADE2-CAN1) tdh3(T227A)


YSH1094

mat α ade2-1 ura3-1 trp1-289leu2-3,112 his3-11,15 can1-100hmrΔE::TRP1 rTELVR::URA3(DNA::ADE2-CAN1) tdh3(T227K)


YSH1095

mat α ade2-1 ura3-1 trp1-289leu2-3,112 his3-11,15 can1-100hmrΔE::TRP1 rTELVR::URA3(DNA::ADE2-CAN1) tdh3(N314T)


YSH1105mat a his3Δ200 leu2Δ1 ura3-167RDN::Ty1-mURA3Δmrps12::NAT1

K. HuangrDNArecombination/gene deletion

YSH1106

mat α ade2-1 ura3-1 trp1-289leu2-3,112 his3-11,15 can1-100hmrΔE::TRP1 rTELVR::URA3(DNA::ADE2-CAN1),Δmrps12::NAT1

K. HuangTriplereporter/genedeletion

YSH1107NADp-HIS3 reporterΔmrps12::NAT1

K. HuangNuclear NAD+rreporter assay

25

Table 3: Primers used in this study.

Primer Sequence DescriptionSP 43 Cta ctt gga gcc act atc For sequencing BSH425SP 44 Gat ata ggc gcc agc aac For sequencing BSH425

SP101GTG ATG TGA GAA CTGTAT CC

Reverse Primer hybridizes to PTEFpromoter on MX plasmids. Used forchecking gene disruptions following geneknockout.

SP1331GAATTGCAAGGTAAGTTGAAAGGTATGGCTTTC

T227K mutagenic primer (forward)

Sp1332GAAAGCCATACCTTTCAACTTACCTTGCAATTC

T227K mutagenic primer (reverse)

SP1333GTCTCCTGGTACGACACCGAATACGGTTACTCTA

N314T mutagenic primer (forward)

SP1334TAGAGTAACCGTATTCGGTGTCGTACCAGGAGAC

N314T mutagenic primer (reverse)

SP1386CAAGAACTTAGTTTCGAATAAACACACATAAACAAACAAAaggaatggtaattcaactag

Forward primer to replace TDH3 withthe reversed pCORE. Anneals up to 40bp upstream of TDH3 ORF.

SP1387AAAGAAAATTTATTTAAATGCAAGATTTAAAGTAAATTCActcgagcaaaagctgtga

Reverse primer to replace TDH3 with thereversed pCORE. Anneals down to 40 bpdownstream of TDH3 ORF.

SP1400

ATTTCTTAAACTTCTTAAATTCTACTTTTATAGTTAGTCTTTTTTTTAGTGAGCTCGTTTTCGACACTGG

Forward primers, anneals to 100-50basepairs upstream of TDH3.

SP1401

ATGAATCGAAAATGTCATTAAAATAGTATATAAATTGAAACTAAGTCATATCCTTACCATTAAGTTGATC

Reverse primers, anneals to 50-100basepairs downstream of TDH3.

SP1402

ATGGTTAGAGTTGCTATTAACGGTTTCGGTAGAATCGGTAGATTGGTCATGAGCTCGTTTTCGACACTGG

Forward primers, anneals to the first 50basepairs of TDH3.

SP1403 TTAAGCCTTGGCAACGTG Reverse primers, anneals to the last 50

26

TTCAACCAAGTCGACAACTCTGGTAGAGTAACTCCTTACCATTAAGTTGATC

basepairs of TDH3.

SP1426 TGGGCCACAAACTGGGCForward primer hybridizes to 300 bpupstream of MRPS12 ORF.

SP1427TTGAGGCAAGAAGATTGCT

Reverse primer hybridizes to 300 bpdownstream of MRPS12 ORF

SP1434 aggtgccgtaaagcactaForward check primer that bindsto1501-1508bp of pRS424.

SP1435 CGGCTTCTTGGGCTTTAAReverse check primer that binds to202-219bp of MRPS12 ORF.

SP1457 ttgagtgagctgataccgReverse primer binding to 2328~2345bpin pRS424 or 3561~3578bp in pRS425.

SP1458 acctcactcattaggcacReverse primer binding to 2139~2156bpin pRS424 or 3372~3386bp in pRS425.

SP1459gtcgacggtatcgataagcttgatatcgaattcctgcagcccgggAGAAGATATGGTGGGCCA

Forward primer binding to 310bpupstream of MRPS12 ORF. Used forgap-repair into pRS424/pRS425.

SP1460ctggagctccaccgcggtggcggccgctctagaactagtggatccCGTCTGAAAATTCAGATCG

Reverse primer binding to 207bpdownstream of MRPS12 ORF. Used forgap-repair into pRS424/pRS425.

II. Strain Construction

1. Overexpression plasmid construction and sequencing

MRPS12 Overexpression plasmids, containing ~200bp up and downstream of

MRPS12 ORF sequence, were constructed by ligation and transformation into E.

Coli cells. Candidate colonies were selected by growth on LB-Amp plates and

diagnostic PCR. A couple each of MRPS12-pRS424 and MRPS12-pRS425 ligated

plasmids were sent for sequencing. As determined by sequencing results, all three

27

MRPS12 overexpression plasmids used in this study, including BSH425

constructed by Laura Ayala, contained the correct MRPS12 sequence.

2. Creation of gene deletion, site-directed mutation and overexpression

strains

Strains with gene deletions were constructed using PCR-based gene

disruption. For null mutants, marker genes (natMX6 conferring nourseothricin

resistance) were amplified using PCR. The amplified DNA fragments were

transformed into the yeast strain. The cells were left overnight and then plated on

selective media. Candidate knockout mutants were screened by diagnostic PCR.

Strains with site-directed mutations were constructed in a similar manner. The

DNA fragments with site-directed mutations were generated using hybrid PCR.

Overexpression strains were created by transforming 2μ plasmids that contain the

genes of interest into strains and selecting for growth on selective plates.

III. Petite strain verification

Control petite strains were selected from slow growing colonies on a

wild-type streaked-out plate. The candidates were verified by their inability to

grow on glycerol plates, showing the lack of respiration. All Δmrps12 strains were

also verified to be petite through this method after gene deletion.

28

IV. Serial Dilution Assays

For all serial dilution assays, the optical density of the 2 mL cultures was

measured at 600nm (OD600). Then, the cultures were diluted with water to

achieve equal optical densities in the first column of a 96-well plate, with a total

volume of 200 μL. All other wells were filled with 180 μL of water. 20 μL of

culture was transferred to each successive cell, corresponding to a 10-fold serial

dilution. Dilutions were carried out 5 times. A frogger or multi-channel pipette

was used to spot 5μL of the culture from each well onto the selective plate. The

assay is carried out in duplicate or triplicate. Plates were incubated at 30C for

2-5days and scanned. Images shown in this study were adjusted in contrast and

brightness levels through Adobe Photoshop or Microsoft Word.

1. Lethality assay

YSH316 (KS1) background series of strains were grown for one to two days

at 30C in 2 mLs of raffinose selective media. The cells were plated onto a control

selective SDC plate and a galactose-added plate lacking specific amino acids that

is included in the plasmids’ markers. The transition from raffinose to galactose

media allows the proper induction of the GAL promoter.

29

2. Sir -mediated silencing assay

In strains containing reporter genes integrated at Sir-silenced loci, serial

dilution assays were performed to visualize growth phenotypes and determine the

strength of silencing. YSH503 was used the wild type strain with URA3 integrated

at the telomere of chromosome V and TRP1 integrated at HMR. The cells are

spotted as described above for the lethality assay. SDC plates are used as controls,

whereas SDC-Ura plates were used to select for strains with loss of repressionat

the telomeres. 5’-fluoroorotic acid (FOA) selects against strains with increased

telomeric expression.

3. Nuclear NAD reporter assay

A genetic assay developed by the Sinclair lab was used to measure the

nuclear NAD level. In S. typhimurium, the transcriptional repressor NadR binds to

a consensus sequence in the genome in the presence of NAD. In a yeast strain

(YSH896), the NadR consensus sequence was integrated upstream of a HIS3

reporter gene. The binding domain of NadR was fused to the Gal4-AD with a

nuclear localization signal on a plasmid containing the LEU2 selectable marker.

In an NAD+-dependent manner, he NadR-Gal4-AD-NLS fusion protein construct

drives HIS3 transcription in the reporter strain. Gene deletions, control vectors and

overexpression plasmids were introduced into the reporter strain. The strains with

30

different combination of plasmids and gene deletions were spotted on

SDC-Trp-Leu plates as controls, and SDC-Trp-Leu-His plates as the experimental

group. The extent of growth on the SDC-Trp-Leu-His plates reflects the level of

freely available nuclear NAD.

Figure 8. Nuclear NAD reporter strain [adopted from (Anderson, Latorre-Esteves

et al. 2003)].

4. Oxidative stress assay

Plates were made with 0, 0.5, 1, 1.5 and 2mM of H2O2, and wrapped

with foils to avoid H2O2 degredation. Cells were grown overnight at 30C before

plating onto the H2O2 plates.

31

5. Two-hybrid assay

The yeast strain YSH625 lacking Sir2, Sir3, and Sir4 was used for the

two-hybrid assay. The combinationsof MRPS12BD/ SIR2AD or MRPS12AD/

SIR2BD were constructed by gap-repair during subsequent yeast transformations.

The transformants were checked for the proper bait gene and BD fusion, or the

prey gene and AD fusion using PCR. Verified colonies were plated onto

SDC-Trp-Leu plates as control plates, and SDC-Trp-Leu-His plates as the

experimental groups.

V. Fluorescence microscopy

Semisquash preparations were adapted from (Fuchs and Loidl 2004)with

minor modifications. Cultures were grown to log phase (OD600 ~0.5), and freshly

prepared paraformaldehyde was added to the cultures to a final concentration of

4%. Fixation was carried out for 1 hour at room temperature. After fixation using

paraformaldehyde, the cells were washed with 1 ml of 1% KAc/1M sorbitol

solution (2 krpm using a Sorvall RT6000B for 4 min). Next, to spheroplast the

cells, the pellet was resuspended in 500 µl 1% KAc/1M sorbitol solution,

containing 10 µl 1M dithiothreitol, and 20 µl of 10mg/ml Zymolyase 20T. After

approximately 30 minutes incubation at 37°C, digestion was stopped by adding

32

500 µl stop solution (0.1 M 2-(N-morpholino) ethane acid (MES), 1 mM EDTA,

0.5 mM MgCl2, 1 M sorbitol in distilled water). Cells were then collected by

centrifugation and the pellets were washed in 1 ml stop solution. Cell pellets were

resuspended in 80 µl cold MES solution (0.1 M 2-(N-morpholino) ethane acid, 1

mM EDTA, 0.5 mM MgCl2) and 200 µl of fixative (4% paraformaldehyde pH 8)

was added. The fixed cells were spread over a glass slide. Afterwards, slides were

mounted with mounting solution containing 1mg/ml DAPI. The coverslips were

laid on glass slides and sealed using nail varnish. The combination of Softworx

software and the Deltavision RT imaging system (Applied Precision) adapted to

an Olympus (IX70) microscope was used to acquire images of the Tdh3-GFP

construct and DAPI staining.

VI. rDNA recombination rate measurements

The rate of recombination at the rDNA repeats was measured by

quantifying the loss rate of the mURA3 reporter gene integrated into the rDNA

repeats in YSH615 series of strains. Before the assay, cells were freshly

streaked-out for 2-4 days on SDC-ura at 30C. Single colonies were picked to

start a 20 mL YPD culture. The cell concentration was estimated through a cell

count. Cultures were diluted to a concentration of 1cell/L with water and an

33

estimated 20 and 200 cells were plated on SDC plates for each strain. The YPD

cultures were then incubated at 30C for 2 days.

The number of colonies on the SDC plate was counted after incubating at

30C for 2-3 days. This is used to correct for the concentration of cells estimated

by the cell count. Then replica plates were made onto SDC-ura. The SDC-Ura

plates were incubated at 30C for 1-2 days, and the fraction of colonies showing

growth on the –Ura plate and retaining the mURA3 reporter recorded. After

two-day incubation, 2 L of the liquid YPD cultures was diluted in 20mLs fresh

YPD and returned to the incubator at 30C. The number of cells/mL was

estimated as 1x108, and diluted by a factor 105 in water to achieve a final

concentration of ~1cell/ L. Approximately 20 and 200 cells were plated per

strain on SDC and allowed to grow at 30C for 2-3 days. Again, the number of

colonies per plate was counted. This procedure was repeated for six to seven

platings cycles. The final SDC plates were relica-plated onto the SDC-ura plate.

Again, the fraction of cells retaining the mURA3 reporter gene calculated. The

recombination rate was calculated as described:

For each cycle of culture:

F0, Ff = cell density at T = 0 and T = 48, T = 48 and T = 96, etc.

= (# colonies)/( # cells plated * estimated cells per mL)

34

N = number of generations between each cycle of cultures

= ln(F0/Ff)/ ln(2) over each consecutive time interval

For the final calculation of recombination rate:

Ip, Fp = Initial, final percentage of mURA3 reporter gene bearing cells

= (# colonies on SDC)/ (# colonies on replica SDC-ura)

R = recombination rate/ rate of URA3 loss

= 1 – (Fp/Ip)^(1/N)

VII. Western Blotting

Western blots were performed to determine the Sir2 protein levels. Cells

were grown to equal OD log phase (OD600 ~0.8) in a 10mL culture. Cells were

pelleted and the supernatant was removed. The cell pellet was resuspended in 1mL

ice cold 20% TCA, which was moved to an Eppendorf tube. Again, the cells were

pelleted and resuspended in 0.5mL 20% TCA. Glass beads were added to equal

volume and vortexed four times at 4C for 30 seconds each. The cell lysate

(supernatant) was removed to a new Eppendorf tube. The beads were washed

twice with 0.5mL of 5% TCA, and the washes were combined with the lysate.

The precipitated protein from the combined lysate and washes was spin down in a

microcentrifuge (Eppendorf 5415C model at 4C for 10 minutes at 14krpm).

35

After discarding the supernatant, the pellet was resuspended in 200L sample

buffer (50mM Tris-HCl pH 6.8, 2% SDS, 10% glycerol, 0.1% bromophenol blue,

0.05% -mercaptoethanol) and 50L 2M TRIS (unpH-ed). The samples were

boiled for five minutes (100C) followed by a Bradford assay (see section I:

Measurement of GAPDH Activity) to quantify protein concentration.

SDS-polyacrylamide gel electrophoresis (SDS-PAGE) was performed on the

protein samples to resolve the Tdh3-myc construct; a 10% running gel and 5%

stacking gel were selected. An equal quantity of protein from each sample was

loaded onto the gel, along with a biotinylated ladder (1.5L Biorad Biotinylated

SDS-PAGE Standards Broad Range diluted in 8.5L 1X sample buffer and boiled

prior to loading) and a rainbow marker (10L Biorad Prestained Standard Broad

Range boiled prior to loading). The gel tank was filled with 1X SDS-running

buffer (25mM Tris base, 250mM glycine pH 8.3, 0.1% SDS) and run at constant

30mA until the dye front reached the bottom of the gel. The proteins were

transferred to a nitrocellulose membrane using a Hoefer TE 70 Series SemiPhor

Semi-Dry Transfer Unit (Amershan Biosciences); the nitrocellulose membrane

(soaked in dH2O) was sandwiched between Whatman blotting paper (soaked in

1X Towbin buffer: 25mM Tris pH 8.8, 192mM glycine with 20% (v/v) methanol)

before transfer, which was carried out at 40mA for 1.5 hours. The nitrocellulose

36

membranes were blocked in 5% nonfat dry milk dissolved in 1X TBS + 0.10%

Tween (20mM Tris pH 7.5, 150mM NaCl, 0.10% Tween-20) overnight at 4C.

Primary antibody was applied at room temperature for one hour at room

temperature in 1X TBS + 0.10% Tween + 5% non-fat dry milk at a 1:100 dilution.

Membranes were washed four times in 1X TBS +0.10% Tween. A secondary

antibody was applied in 1X TBS + 0.10% Tween + 5% non-fat dry milk at 1:4000

dilution for one hour at room temperature. The membrane was subsequently

washed four times with 1X TBS + 0.10% Tween. Detection was performed using

the ECL Western Blotting Reagants from Amersham.

37

RESULTS

Sir2, a NAD-dependent histone deacetylase, is speculated to connect the

distinct cellular functions of metabolism and transcriptional silencing. To further

investigate the connection between Sir2 and cellular metabolic states, this study

examined the relationships of Sir2 and three metabolic proteins: Adh1, Tdh3 and

Mrps12. We utilized molecular genetic techniques to confirm their role in

Sir2-mediated transcriptional silencing. In order to understand how cell

metabolism communicates with transcriptional regulation, we also tested some

potential mechanisms of Sir2 regulation by each of these proteins.

I. Adh1

Alcohol dehydrogenase 1 (Adh1) regenerates NAD through catalyzing the

conversion of acetaldehyde to ethanol in the last step of glycolysis. A yeast strain

carrying an extra copy of the ADH1 gene (2XADH1) showed a 20% rise in

cellular NAD/NADH ratio, as well as an increased telomere VII silencing in a

Sir2-dependent manner (Reverter-Branchat, Cabiscol et al. 2007). Additionally,

Adh1 is found to be in a same multi-protein complex with Sir2 by a large-scale

affinity capture study (Gavin, Bosche et al. 2002). This evidence suggests a

38

potential role of Adh1 in regulating Sir2 silencing, possibly through NAD

metabolism.

1. Δadh1 mutant exhibits silencing defects at telomeres

To further investigate the relationship between Adh1 and Sir2, the effect of

adh1∆ on Sir2 silencing was studied. We deleted ADH1 gene in a strain carrying

reporter genes that are integrated into two separate silenced loci in yeast: TRP1 at

HMR and URA3 at telomere V. The loss of silencing at these loci is reflected by

the transcription of the reporter genes, which can be assessed by cell growth in

plates lacking respective amino acids. When silencing is lost at HMR, the

expression of TRP1 reporter gene allows better cell growth on SDC-Trp plates.

Similarly, when silencing is lost at telomeres, URA3 is expressed and the cell

grows on SDC-Ura plates. 5’-fluoroorotic acid (FOA) mimics a uracil precursor

and it is converted into a toxic compound by the URA3 gene product. Thus, in

contrast to the SDC-Ura plates, viability on FOA plates indicates the presence of

telomeric silencing. In each of the plates, the sir2∆ mutant provides a reference

point that shows a complete absence of Sir-mediated transcriptional silencing.

Upon the deletion of ADH1, cells grew at a decreased rate and formed

smaller colonies. The adh1∆ mutant showed similar reduction of growth on SDC

and SDC-Trp plates. Hence, adh1 deletion does not induce a significant effect in

39

HMR silencing in this assay. On FOA plates, adh1∆ mutant was completely

inviable, just like sir2∆ mutant (Figure 10). This phenotype indicates the

expression of the URA3 gene and the loss of telomeric silencing. It is possible that

adh1 deletion may mediate Sir2 silencing specifically at telomeres, but not HMR.

Alternatively, the silencing assay using FOA to counter-select for URA3

expression may simply be more sensitive and detect at a lower threshold for a

universal loss in Sir-silencing.

SDC SDC-Trp

wt

∆sir2

∆adh1

SDC-Ura FOA

wt∆sir2

∆adh1Figure 10. Silencing assay of adh1 knockout mutant at HMR and Telomere V. adh1∆mutant is deficient in telomeric silencing.

40

2. Δadh1 mutant exhibits lower tolerance to oxidative stress

In addition to the silencing phenotype, 2XADH1 cells exhibited higher

oxidative and heat stress resistance due to increased activities of antioxidant

enzymes, including catalase and superoxide dismutases. The rise in stress

resistance and catalase activity was abolished upon sir2∆, indicating that Sir2 is

required for these effects (Reverter-Branchat, Cabiscol et al. 2007). The elevated

resistance in 2XADH1 cells is consistent with the finding that 2XSIR2 cells are

more resistant when subject to heat shock (Anderson, Bitterman et al. 2002).

Interestingly, another previous report has shown that the deletion of SIR2 actually

increases cells’ oxidative stress resistance (Fabrizio, Gattazzo et al. 2005). Taking

together these earlier findings, additional Sir2 activity and sir2∆ may activate

separate pathways to induce stress resistance. Determining the effect of adh1∆ on

oxidative stress resistance may not only help us understand the interactive nature

of Adh1 and Sir2, but also indirectly clarify Sir2’s role in stress resistance.

In the assay, we spotted cells on plates with serial H2O2 concentrations,

and growth on a plate simply indicates stress resistance to the corresponding level

of oxidative stress. As seen on the 2 mM H2O2 plate, sir2∆ mutant did not show

an apparent change in oxidative stress resistance (Figure 11). This is inconsistent

with the earlier finding by Fabrizio et al. (2005), where sir2∆ exhibited higher

41

resistance to H2O2. It is worth noting that the disagreement in stress resistance

phenotypes may lie in the assays’ different set-ups. In Fabrizio’s experiment

(2005), yeast cells were treated with 100 mM H2O2 for 30 minutes and spotted

onto YPD plates. This set-up determined cells’ resistance to a high concentration

of oxidative stress in a short period; whereas the spotting on H2O2 plates described

in our study tested for cells’ tolerance to a lower oxidative stress over a longer

time period. Thus, sir2∆ may only increase cells’ resistance against a strong and

transient oxidative stress, but not a low and enduring one.

The reduced growth on 2 mM H2O2 plate indicates that adh1∆ mutant has

lower tolerance to oxidative stress (Figure 11). The phenotype is consistent with

earlier studies of adh1 null mutants treated with tert-butyl hydroperoxide,

paraquat, and dioxide stress in large scale studies (Begley, Rosenbach et al. 2004;

Outten, Falk et al. 2005). Unlike the elevated oxidative stress resistance in

2XADH1 strains, the reduction in stress resistance of adh1∆ mutant may be

independent of Sir2. It is possible that adh1∆ results in a lower NAD+ production,

which translates into a less oxidized cellular redox state. Being primed in a

cellular environment with low oxidative stress, adh1∆ mutants may end up with a

lower antioxidant capacity.

In general, the deletion induces an opposite effect from introducing an

42

extra copy of ADH1 into yeast cells. The deletion of ADH1 may reduce cellular

NAD+/NADH ratio, which results in lower Sir2 silencing activity. The imbalanced

redox state may also prime cells to a lower tolerance to oxidative stress.

0mM 0.5mM

wt

∆sir2

∆adh1

1mM 1.5mM

wt

∆sir2

∆adh1

2mM

wt

∆sir2

∆adh1Figure 11. H2O2 oxidative stress assay of adh1∆ mutant. adh1∆mutant exhibits lower tolerance to oxidative stress.

43

II. Tdh3

Tdh3 is another glycolytic protein that can alter cellular NAD+ level

through its catalytic activity. In the reaction it catalyzes,

glyceraldehyde-3-phosphate is oxidized when NAD+ is simultaneously converted

to NADH. It was first identified by Holmes lab as a suppressor of SIR2

overexpression induced lethality (Matecic, Stuart et al. 2002). Subsequent studies

in the lab have established Tdh3 as a novel regulator of Sir2 that affects

Sir2-mediated silencing and rDNA recombination (Ringel 2009).

1. Tdh3 localization studies in Δtdh2 and Δsir2 strains

As one of the yeast GAPDH enzymes, Tdh3 carries out its glycolytic

function in the cytoplasm. It can potentially regulate nuclear-localized Sir2

through the general metabolic state of the cell, such as the cellular NAD+ level.

However, recent studies have suggested that some organisms’ GAPDHs are

present in the nucleus and perform multiple functions in addition to glycolytic

catalysis [reviewed in (Sirover 2005)]. It is possible that yeast Tdh3 also exists in

the nucleus to exert its effect on Sir2 activity.

Two large scale-studies characterized the sub-cellular localization of Tdh3.

Nuclear localization was not observed when Tdh3 was expressed off a TEF

promoter (Wiwatwattana and Kumar 2005). In the other study, when Tdh3 was

44

fused to GFP at its native locus, the Tdh3-GFP construct was found to be present

at both the nucleus and cytoplasm (Huh, Falvo et al. 2003). Tdh3 is expressed at a

high copy number (~169,000copies per cell) from its endogenous promoter, and it

is possible that the lower amount of Tdh3 expressed from the TEF promoter

showed a different localization pattern from the native Tdh3.

Using the same C-terminally tagged Tdh3-GFP construct from Huh et al’s

study (2003), we confirmed the localization of Tdh3 at both the cytoplasm and

nucleus (Figure 12). This result is consistent with an earlier fluorescence

microscopy experiment in the Holmes lab (Ringel 2009). The presence of Tdh3 in

the nucleus is further supported by a large-scale affinity capture study (Gavin,

Bosche et al. 2002) as well as a CoIP experiment (Rebecca Ryznar, unpublished

data), where Tdh3 was found in a same multi-protein complex with Sir2 in yeast.

Interestingly, Tdh3-GFP clustered to a concentrated spot in some cells’ cytoplasm

(Figure 12). It may be an aggregation of oxidatively damaged Tdh3 that is similar

to the GAPDH “speckles” observed in human fibroblast cells under oxidative

stress (Dastoor and Dreyer 2001).

45

DAPI and α-tublin GFP Merge

Figure 12. Localization of Tdh3-GFP. Fluorescence microscopy indicatesthat Tdh3-GFP localizes to the nucleus in a high concentration.

Knowing that Tdh3 localizes to both the nucleus and cytoplasm, we then

investigated whether the presence of Sir2 or Tdh2 would affect Tdh3 localization.

If Sir2 directly interacts and binds strongly to Tdh3, it could possibly retain a

higher concentration of Tdh3 in the nucleus. Tdh2 is another GAPDH isozyme in

yeast that shares some redundant functions with Tdh3. Its depletion may induce

Tdh3 re-localization to compensate for the lack of its function. The

immunofluorescence microscopy experiment was carried out in wild type, sir2∆

and tdh2∆ strains with a C-terminal myc-epitope-tagged Tdh3. Regardless of the

strain backgrounds, Tdh3 was consistently found in both the nucleus and

cytoplasm (Figure 13). Neither Sir2 nor Tdh2 serve an essential role in

constraining Tdh3’s localization to a subcellular location.

46

DAPI myc Mergewt

∆sir2

∆tdh2

Figure 13. Localization of a Tdh3-myc construct in wild type, sir2∆ and tdh2∆strains. Tdh3’s nuclear localization does not depend on the presence of Sir2 or Tdh2.

2. Silencing assay of tdh3T227A, T227K and N314T mutants

Although GAPDH’s localization to the nucleus is evident, the complete

mechanism of GAPDH’s translocation from the cytosol to the nucleus is still

unclear. In mammalian systems, several crucial GAPDH modifications and other

events in this process have been described. One study proposed that

S-nitrosylation of GAPDH triggers binding to Siah1 (an E3 ubiquitin ligase),

leading to its nuclear translocation and cell apoptosis (Hara, Agrawal et al. 2005).

47

Additionally, a separate study observed that GAPDH binding to Siah1 can be

regulated by the acetylation of GAPDH’s lysine residues (Ventura, Mateo et al.

2010). Another study suggested that protein O-linked N-acetylglucosamine

(O-GlcNAcylation) modification on Thr227 can mediate GAPDH’s translocation

to the nucleus through the disruption of GAPDH tetramer conformation. The

author postulates that the bulky hydrophilic sugar ring of N-acetylglucosamine

interrupts the hydrophobic vertical interface between the two subunits. This

destabilizes the GAPDH tetramer, giving rise to its better nuclear translocation. In

their study, two GAPDH mutants were constructed to test the hypothesis. The

T227A mutation prevented O-GlcNAcylation, favoring tetramer formation and

less nuclear localization. In contrast, the T227K mutation mimicked the

modification, which disrupted tetramer GAPDH formation and facilitated

translocation to the nucleus.

Despite the fact that O-GlcNAcylation enzymes are not found in yeast, the

possibility of a similar nuclear translocation mechanism for Tdh3 should not be

precluded. An extensive overlap is identified between the known O-GlcNAc

modified and serine/threonine phosphorylated protein populations (Mishra, Ande

et al. 2011). Moreover, these two modifications are remarkably analogous to each

other in their regulation (Hanover 2001; Hart, Housley et al. 2007). Considering

48

that Thr227 of yeast Tdh3 is a protein phosphorylation site (Smolka, Albuquerque

et al. 2007), it is possible that the phosphorylation of this residue may serve as a

Tdh3 nuclear localization mediator in substitution of O-GlcNAcylation. In this

case, studying Tdh3T227 mutants may provide insight into whether Tdh3’s effect

on Sir2 silencing required nuclear translocation.

Besides their difference in nuclear localization, T227A and T227K mutants

may exist in different monomer/tetramer ratio due to their modified state. Thus,

comparing silencing phenotype between T227A and T227K mutants can possibly

help us unveil the form in which Tdh3 mediates Sir2 silencing. Although GAPDH

functions as a homotetramer to carry out its glycolytic functions, it has been found

to exist as dimers and other forms in different organisms (Zheng, Roeder et al.

2003; Ferreira-da-Silva, Pereira et al. 2006). The transition between various forms

may alter GAPDH’s properties including its NAD+ binding ability and subcellular

localization, allowing GAPDH to serve its different functions.

Aside from defining the form of GAPDH that interacted with Sir2, we were

also interested in whether the NAD+ binding ability of GAPDH was required for

its Sir2 regulation. We constructed a Tdh3N314T mutant, whose GAPDH

counterparts from other organisms have been reported to be defective in NAD+

binding, and assessed its silencing phenotype. In Bacillus stearothermophilus

49

GAPDH, N313 is located in the NAD+-binding domain, and it forms a network of

hydrogen bonds with nearby residues and NAD+. It is linked to NAD+ through

two hydrogen bonds: one connected to the oxygen atom of NAD+’s carboxyamide

group and the other to the atom 07N of NAD+. Bacillus stearothermophilus

GAPDH N313T mutant exhibited a 50-fold increase in the KM for NAD+ as well

as 65-fold decrease in Kcat. Additionally, binding of NAD+ had no significant

effect on the thermal unfolding properties of the apo form of the N313T mutant

(Roitel, Ivinova et al. 2002). This finding agrees with a high-resolution structural

study carried out on Escherichia coli GAPDH, where the structure of the N313T

mutant saturated with NAD appeared more similar to the apo than to the holo

conformation (Duee, Olivier-Deyris et al. 1996). Both studies suggest that the

mutation preclude an efficient binding of NAD+.

We measured the effects of the tdh3T227A, T227K and N314T mutations as

well as tdh3∆ on Sir2 silencing. This study was carried out in a strain with TRP1

and URA3 reporter genes integrated respectively into HMR and telomere V, as

described earlier in the silencing assay of adh1∆ mutant. sir2∆ was included as a

negative control that was completely deficient in silencing. On the SDC-Trp plate,

tdh3∆ showed slightly less growth than the wild type strain, indicating an

enhancement of TRP1 gene repression at HMR. However, we observed no change

50

in the growth of the tdh3T227A, T227K and N314T mutants on the same plate. If

these mutations caused the hypothesized Tdh3 phenotypes, Tdh3’s nuclear

localization, NAD+ binding ability and multimeric form may not influence its

regulation on Sir2 silencing at HMR.

We also assessed the strength of telomeric silencing in the same strains by

examining their growth on SDC-Ura and FOA plates. All tdh3 mutants showed

less growth on FOA plate, indicating de-repression at telomeres. The different

levels of growth on FOA and telomeric de-repression in these strains suggest that

the Tdh3 mutants exert effects on Sir2 silencing at varied strength (Figure 14).

The T227A mutant exhibited a stronger telomeric silencing defect than tdh3∆

mutant. This indicated that the T227A mutated version of Tdh3 inhibited Sir2

silencing at telomeres. T227A mutation was observed to favor the tetrameric form

of GAPDH and discourage its nuclear translocation in mammalian cells (Park,

Han et al. 2009). Assuming that the Tdh3 in this mutant is not be able to enter the

nucleus, its inhibition on Sir2 silencing may not be dependent on direct

interactions, but through its other functions. One possibility is that a higher

proportion of Tdh3 forms stable tetramers in this mutant, increasing its catalytic

activity and depleting the available cellular NAD+ from Sir2.

The other tdh3 mutation at this residue, T227K, resulted in a telomeric

51

de-repression level similar to tdh3∆. It is possible that this Tdh3 protein mutant

failed to affect Sir2 silencing at telomeres. Hence, its silencing phenotypes

resembled tdh3∆ strain. Mammalian GAPDH T227K mutation is speculated to

favor monomer forms that readily translocate into the nucleus (Park, Han et al.

2009). The Tdh3T227K protein, potentially biased towards the monomer form,

may not be the native form of Tdh3 that mediates Sir2 silencing.

The last tdh3 mutant in this assay, N314T, also showed a loss of telomeric

silencing similar to tdh3∆ mutant. If N314T version of the Tdh3 protein is

deficient in NAD+ binding like its GAPDH counterparts in other organisms, we

can conclude that NAD+ binding ability is essential for Tdh3’s regulation of Sir2

silencing. Considering that the deletion of TDH3 causes a reduction in freely

available nuclear NAD+ (Ringel 2009), it is possible that Tdh3 plays a role in

NAD+ nuclear transport to mediate Sir2’s enzymatic function.

In sum, the silencing assay of tdh3 mutants suggested that highly biased

monomer/tetramer ratio and deficit in NAD+ binding could potentially weaken

Tdh3’s ability to regulate Sir2 silencing at telomeres. A specific form of Tdh3 may

be required to maintain Sir2 activity at a normal level.

52

SDC SDC-Trpwt

∆sir2

∆tdh3

tdh3 T227A

tdh3 T227K

tdh3 N314T

SDC-Ura FOAwt

∆sir2

∆tdh3

tdh3 T227A

tdh3 T227K

tdh3 N314T

Figure 14. Silencing assay of tdh3 mutants at HMR and Telomere V. tdh3mutants are deficient in telomeric silencing to various extents.

53

III. Mrps12

Mrps12 is the last potential Sir2 regulator protein presented in this study. It is

a mitochondria ribosomal protein of the small subunit that is encoded in the yeast

genome. As one of the most conserved mitochondrial ribosomal proteins, it is

essential for mitochondrial function (Fujita, Horie et al. 2001). Mrps12 is

suggested to be a major component of ribosomal accuracy center in organisms

including bacteria, fly, mouse and human (Shah, O'Dell et al. 1997). It was first

identified in the Holmes lab as an enhancer of Sir2 overexpression induced

lethality (Ayala 1999). Another enhancer, Sir3, is a collaborator in Sir2’s silencing

activity. Hence, we postulated that Mrps12 could also be a Sir2 silencing partner

and further investigated its relationship with Sir2.

1. MRPS12 overexpression enhances Sir2 and Sir3-induced lethality

To confirm Mrps12’s ability to enhance Sir2-induced lethality, we

performed lethality assays on strains with different combinations of

overexpression plasmids. When induced by the GAL10 promoter on the

galactose-added plate, SIR2 or SIR3 overexpression alone resulted in different

levels of lethality in yeast cells, with SIR2 overexpression inducing a higher level

of lethality. The simultaneous overexpressions of SIR2 and SIR3 caused an

increased level of toxicity to yeast cells than either of the single SIR2 or SIR3

54

overexpression (Figure 15). This result is consistent with an earlier finding

(Holmes, Rose et al. 1997).

In this assay, overexpression of MRPS12 from a 2μ plasmid alone did not

induce lethality to cells on the galactose plate. When it is overexpressed

simultaneously with SIR2, the lethality is enhanced as compared to strains

overexpressing only SIR2. Additionally, we tested Mrps12’s effect on

Sir3-induced lethality. We observed a similar pattern of increased lethality in

strains overexpressing both MRPS12 and SIR3. The level of enhancement in

lethality caused by MRPS12 overexpression is higher for Sir3-induced lethality

than Sir2-induced lethality (Figure 15). The result from this lethality assay not

only confirmed MRPS12 overexpression enhanced Sir2-induced lethality, but also

showed that it could enhance Sir3-induced lethality to an even higher extent. Thus,

Mrps12 may collaborate with both Sir proteins in their functions.

wt SDC-Leu-Ura SC-Leu-Ura GAL

vector

SIR2

SIR3

MRPS12

SIR2SIR2 SIR3

SIR2 MRPS12

SIR3 MRPS12Figure 15. MRPS12 overexpression enhances Sir2 and Sir3-induced lethality.

55

2. Lethality assay in Δsir2 and Δsir3 strains

To investigate if Mrps12’s ability to enhance Sir2 and Sir3-induced

lethality is an effect through either one of these Sir proteins, we also conducted

the overexpression lethality assay in Δsir2 and Δsir3 strains. In agreement with a

previous report, Sir3-induced lethality was mitigated upon the deletion of SIR2

(Figure 16), indicating a requirement of Sir2 to manifest Sir3-induced lethality

(Holmes, Rose et al. 1997). As expected, we observed an enhancement of lethality

through coupling MRPS12 overexpression to that of SIR2. Additionally, MRPS12

overexpression enhanced SIR3’s overexpression-induced lethality in this Δsir2

background (Figure 16), demonstrating that Sir2 was not required for Mrps12’s

effect on the Sir3-induced phenotype.

Δsir2

SDC-Leu-Ura SC-Leu-Ura GAL

vector

SIR2

SIR3

MRPS12 SIR2

SIR2 MRPS12

SIR3 MRPS12

Figure 16. MRPS12 overexpression enhances Sir2 and Sir3-induced lethality inΔsir2 strain.

56

The same overexpression lethality study was carried out on a Δsir3 strain.

MPRS12 overexpression was able to enhance both Sir2 and Sir3-induced lethality

in this background (Figure 17). Surprisingly, Mrps12’s ability to enhance

Sir3-induced lethality is weakened upon the deletion of chromosomal SIR3,

indicating it may function through activating the function of chromosomal SIR3 to

induce lethality. It is worth noting that the MRPS12 overexpression plasmid used

in this study is different from that used in the wild-type or Δsir2 strain. It is

possible that the overexpression level from this plasmid is not as high, thus the

reduced ability of Mrps12 to enhance Sir3-induced lethality. In sum, Mrps12 can

enhance Sir2 or Sir3-induced lethality phenotype independently of the other Sir

proteins, indicating that it can contribute to both proteins’ lethality function.

Δsir3

SDC-Leu-Trp SC-Leu-Trp GAL

vector

SIR2

SIR3

MRPS12 SIR2

SIR2 MRPS12

SIR3 MRPS12

Figure 17. MRPS12 overexpression enhances Sir2 and Sir3-induced lethality inΔsir3 strain.

57

3. Silencing assay for Δmrps12 mutants

After establishing Mrps12 as a potential collaborator of Sir2 and Sir3

through lethality assays, we then asked whether Mrps12 could affect Sir

proteins-mediated transcriptional silencing. Since Mrps12 is essential for

mitochondria function (Fujita, Horie et al. 2001), strains lacking Mrps12 are petite.

Petite mutants are respiratory-deficient, and are characterized by their inability to

utilize non-fermentable substrates for growth (Goldring, Grossman et al. 1971). In

each of the following silencing assay, a petite counterpart of the wild type strain is

used as a control for Δmrps12 mutants.

Both the petite strain and Δmrps12 mutant formed slower colonies,

potentially due to their respiratory deficiency. Δmrps12 mutant showed similar

reduction of growth on SDC and SDC-Trp plates. Thus, we determined that

silencing at HMR is not affected by the deletion of MRPS12 in this assay. On FOA

plates, mrps12∆ mutant was less viable than the wild type or petite control strains,

indicating a higher expression level of the URA3 reporter gene (Figure 18).

Therefore, we concluded that Δmrps12 mutant is deficient in telomeric silencing.

58

SDC SDC-Trp

wt

petite

∆sir2

∆mrps12

SDC-Ura FOA

wt

petite

∆sir2

∆mrps12

Figure 18. Silencing assay of mrps12∆ mutant at HMR and Telomere V. mrps12∆mutant is deficient in telomeric silencing.

59

In addition to HMR and telomeres, we also studied the effect of mrps12∆

on transcriptional silencing at rDNA repeats. We did not observe a significant

difference between the growth of mrps12∆ mutant and the wild type controls on

the SDC-Ura plate. This indicates that mrps12∆ does not affect silencing at rDNA

repeats.

SDC SDC -Ura

wt

∆sir2

petite

∆mrps12

Figure 19. Silencing assay of mrps12∆ mutant at rDNA repeats.

60

4. Silencing assay of MRPS12 overexpressing strains

Since mrps12∆ caused silencing defects at telomeres, we were curious

whether MRPS12 overexpression would affect Sir2 silencing as well. Furthermore,

the effect of MRPS12 overexpression on Sir2 silencing may be a potential cause

for the enhanced Sir2-induced lethality.

We conducted silencing assays on the same HMR and telomere reporter

strains with control vectors or MRPS12-overexpressing 2μ plasmids. We expected

that the strains carrying only the control vectors to exhibit the same phenotype as

the corresponding strains without the vectors in the earlier silencing assay.

However, on the SDC-Leu-Trp plate, the Δmrps12 mutant showed slightly less

growth than the petite control (Figure 20), and this phenotype was not observed in

the same strains without the vector (Figure 18). Thus, although MRPS12

overexpression changed the growth level of this strain on the SDC-Trp-Leu plate,

we concluded that its growth level may not properly represent the silencing

phenotype at HMR.

MRPS12 overexpression did not affect the growth of all four strains on the

FOA- Leu plate (Figure 20), indicating that it did not change the level of telomeric

silencing. Upon MRPS12 overexpression, we expected that Δmrps12 mutant and

the petite control strain would show similar silencing phenotypes. Surprisingly,

Δmrps12 mutant consistently exhibited less growth on FOA-Leu plate than the

61

wild type petite strains under both conditions (Figure 20). One possibility is that

the Mrps12 overexpressed from the plasmid is not functional, and thus it could not

affect Sir2 like its native form. However, the plasmid was sequenced to confirm

that it contained the correct MRPS12 promoter and open reading frame sequence.

Alternatively, it is possible that the lack of Mrps12 can cause a permanent

silencing defect at the telomeres. Hence, successive MRPS12 expression could not

restore the normal level of telomeric silencing. To conclude, we did not observe

any significant effects on HMR or telomeric silencing upon MRPS12

overexpression. This may rule out the possibility that Mrps12 enhanced Sir2 or

Sir3-induced lethality through affecting their silencing functions.

62

SDC- Leu SDC- Leu- Trp

wt vector

petite vector

∆sir2 vector

∆mrps12 vector

wt MRPS12

petite MRPS12

∆sir2 MRPS12

∆mrps12 MRPS12

SDC- Leu- Ura FOA– Leu

wt vector

petite vector

∆sir2 vector

∆mrps12 vector

wt MRPS12

petite MRPS12

∆sir2 MRPS12

∆mrps12 MRPS12Figure 20. Silencing assay of MRPS12 overexpressing strains at HMR andTelomere V.

63

5. rDNA recombination assay of Δmrps12 mutants

In addition to transcriptional silencing, another known function of Sir2 is

the suppression of rDNA recombination. Since Mrps12 can affect Sir2 silencing

and Sir2-induced lethality, it may also play a role in suppressing rDNA

recombination. To investigate this possibility, we measured rDNA recombination

rate in a strain lacking Mrps12.

In the rDNA recombination assay, a mURA3 reporter gene is inserted into

rDNA repeats of the strains, and the rate of rDNA recombination is represented by

the loss rate of the reporter. As expected, sir2∆ increased rDNA recombination

rate, and the role of Sir2 in suppressing rDNA recombination was verified. The

petite strain exhibited a lower rDNA recombination rate than the wild type.

Nevertheless, the rDNA recombination rate of mrps12∆ mutant did not show a

statistically significant difference from the wild type or petite strains (Figure 21).

Therefore, Mrps12 may not play a role in suppressing rDNA recombination.

64

Rate of mURA3 Reporter Loss (number of cells/generation [*10-3])Trial 1 Trial 2 Trial 3 Trial 4 Trial 5 Average Std Dev

wt 1.674 1.587 1.791 1.366 N/A 1.605 0.180∆sir2 2.914 2.702 3.209 1.669 N/A 2.624 0.669petite 0.725 1.044 0.817 1.109 1.060 0.951 0.169

∆mrps12 1.039 2.714 0.970 1.842 N/A 1.641 0.817

Figure 21. rDNA recombination assay of ∆mrps12 mutant. ∆mrps12 mutant has anrDNA recombination rate that is similar to that of the wild type strain and higherthan that of the petite strain.

0.00.51.01.52.02.53.03.54.04.55.0

wt ∆sir2 petite ∆mrps12

Rat

e ofmURA3

Rep

orte

r Los

s(n

umbe

r of

cel

ls/g

ener

atio

n[*

10-3

])

rDNA Recombination

65

6. MRPS12 overexpression does not affect Sir2 expression levels

After establishing Mrps12’s role in telomeric silencing and enhancing

Sir2-induced lethality, we hypothesized two possible mechanisms for its effect on

Sir2. The first possibility is that Mrps12 alters Sir2’s expression level. Specifically,

if Mrps12 increases Sir2 expression, it may enhance Sir2-induced lethality simply

by inducing an even higher level of Sir2 overexpression. The alternative

hypothesis is that Mrps12 does not affect Sir2 expression, but regulates Sir2

function.

To test the first hypothesis, we measured Sir2 protein levels upon MRPS12

overexpression through western blotting. Strains carrying either a vector or a

MRPS12-overexpressing 2μ plasmid showed similar levels of Sir2 expression

(Figure 22). Hence, MRPS12 overexpression does not affect Sir2 expression from

the chromosome.

It is also possible that Mrps12 specifically affects Sir2 expression from the

GAL10-SIR2 construct on a high-copy 2μ plasmid used in the lethality assay. If

Mrps12 activates Sir2 expression simply through inducing the GAL promoter, it

may not have any specific interaction with Sir2.

To test for this possibility, we included strains carrying the GAL10-SIR2

2μ plasmid in the experiment. When GAL10-SIR2 was uninduced, MRPS12

66

overexpression did not alter the strain’s Sir2 expression level (Figure 22).

Similarly, when SIR2 overexpression was induced from the GAL10 promoter, Sir2

expression level did not change upon MRPS12 overexpression (Figure 23). As

expected, there is a remarkable increase in Sir2 expression under induced

conditions. To conclude, MRPS12 overexpression does not change the level of

Sir2 expression, and it is likely that Mrps12 affect the enzymatic function of Sir2.

∆sir2 vector

MRPS12

overexpression

vector

(GAL-SIR2

uninduced)

MRPS12

overexpression

(GAL-SIR2

uninduced)

Tublin

Sir2

Figure 22. Western blotting of Sir2 expression levels from chromosomal SIR2 andan uninduced GAL10-SIR2 construct. MRPS12 overexpression does not alter Sir2expression levels from the chromosome or the uninduced GAL10 promoter.

0.0000

1.2133 1.1708 1.16321.0279

0

0.2

0.4

0.6

0.8

1

1.2

1.4

∆sir2 vector MRPS12overexpression

vector /(GAL-SIR2uninduced)

MRPS12overexpression/

(GAL-SIR2uninduced)

Normalized Sir2/tublin level

67

vector

(GAL-SIR2

induced)

MRPS12

overexpressi

on

(GAL-SIR2

induced)

Tubl

inSir2

Figure 22. Western blotting of Sir2 expression levels from an inducedGAL10-SIR2 construct on a 2μ high-copy plasmid. MRPS12overexpression does not alter Sir2 expression levels from the inducedGAL10 promoter in the plasmid.

7. Sir2 and Mrps12 do not interact through two-hybrid assays

Several of Sir2’s silencing collaborators, such as other Sir proteins,

physically interact with Sir2 to aid its function. Given that Mrps12 may regulate

Sir2 function, there is a possibility that it can also physically interact with Sir2.

2.9499 3.1181

0

0.5

1

1.5

2

2.5

3

3.5

4

vector /GAL-SIR2 induced

MRPS12 overexpression/GAL-SIR2 induced

Normalized Sir2/tublin level

68

Two-hybrid assays were carried out to examine the potential physical

interaction between Mrps12 and Sir2 in vivo. In two hybrid assays, a bait protein

is fused to the DNA binding domain (BD) of a Gal4 transcription factor, whereas a

prey protein is fused to Gal4’s activation domain (AD). The bait protein is

recruited to the promoter of the HIS3 reporter gene by BD’s binding to a Gal4’s

binding site at this region. If the prey protein interacts with the bait protein, the

fused AD would be brought to close proximity of the HIS3 promoter. Thus, HIS3

transcription would be activated, allowing cell growth on plates lacking His.

As seen on the –His plate, the strain with Mrps12-BD and Sir2-AD did not

show additional growth than strains carrying only Sir2-AD plasmid, indicating

that there is no interaction detected between Mrps12-BD and Sir2-AD. Similarly,

the strain carrying both Mrps12-AD and Sir2-BD did not show better growth on

the –His plate strains carrying control plasmids. Thus, Mrps12 and Sir2 do not

interact through a two-hybrid assay. However, there is a possibility that the

two-hybrid assay failed to represent the actual interaction between these two

proteins. In particular, Mrps12 is a small protein containing 153 amino acids, and

the fusion to AD or BD may interrupt the proper folding of Mrps12 into its native

form.

69

SDC-Trp-Leu SDC-Trp-Leu-HispOAD pOBD

Sir2-AD pOBD

pOAD Mrps12-BD

Sir2-AD Mrps12-BD

SDC-Trp-Leu SDC-Trp-Leu-HispOAD pOBD

pOAD Sir2-BD

Mrps12-AD pOBD

Mrps12-AD Sir2-BD

Figure 23. Mrps12 and Sir2 do not interact through two-hybrid assays.

8. Nuclear NAD+ levels in mrps12 mutants

The other two proteins implicated to affect Sir2 in this study are both

involved in NAD metabolism. Thus, we were also interested in investigating the

possibility of Mrps12 affecting Sir2 through NAD levels. Earlier study from the

70

Holmes lab showed that MRPS12 overexpression does not affect cellular NAD

level (Stubbs 2007). However, Sir2 is sensitive to a nuclear pool of NAD, and it is

possible that Mrps12 could alter nuclear NAD concentration without changing the

cellular NAD level.

We measured the NAD level of strains with the deletion or the

overexpression of MRPS12 using a NAD-sensitive genetic reporter. In the

presence of NAD, the NadR-Gal4-AD fusion protein would be able to bind to the

NAD box and activate the transcription of the HIS3 reporter. Thus, a higher level

of growth on the –His plate indicates a higher available nuclear NAD level. In this

assay, both plates on top serve as a control without the activation domain. Oddly,

the strains on the control plate were able to grow on the –His plate at a normal

level, indicating that the HIS3 was transcribed regardless of the fusion protein’s

function. There may be a malfunction within the control system. On the –His

experimental plate at the bottom, MRPS12 overexpression or deletion does not

change the level of growth on the –His plate. Thus, we conclude that Mrps12 may

not be a regulator of the nuclear NAD level, and it may not affect Sir2 through

NAD metabolism.

71

Genetic NAD-dependent system reports on levels of freely available nuclear NAD.

Nad- Box

NadR- AD SDC-Leu-Trp SDC-Leu-Trp-His

wt(y896) + -

y897 - -

petite + -

∆sir2 + -

∆mrps12 + -

wtMRPS1

2+ -

petiteMRPS1

2+ -

∆sir2MRPS1

2+ -

wt(y896) + +

y897 - +

petite + +

∆sir2 + +

∆mrps12 + +

wtMRPS1

2+ +

petiteMRPS1

2+ +

∆sir2MRPS1

2+ +

Figure 23. Nuclear NAD level upon the deletion or the overexpression ofMRPS12.

72

DISCUSSION

Since the discovery of Sir2 deacetylase’s distinct NAD requirement, many

associations have been made between the function of Sir2-like proteins and the

metabolic states of a cell. The connection between Sir2 and metabolism is

considerably complex. In two orders of direct genetic or physical interactions,

Sir2’s metabolic network spans half of the yeast proteome (Ralser, Michel et al.

2012). In this study, we characterized the interactions between Sir2 and three

metabolic proteins, Adh1, Tdh3, and Mrps12. Our results show that manipulations

of all three corresponding genes affect Sir2 function, implicating these proteins’

roles in regulating Sir2. Further investigations reveal that the mechanisms

underlying their interactions with Sir2 may be distinct for each protein, suggesting

that there can be multiple signaling pathways from metabolism to Sir2’s

transcriptional regulation activity.

I. Adh1

Among the three studied proteins, the current model of Adh1’s regulation of

Sir2 may be the most straightforward one. Alcohol dehydrogenase 1 (Adh1) is a

glycolytic protein that regenerates NAD through its enzymatic function. We found

73

that adh1∆ mutants are deficient in telomeric silencing (Figure 10). In contrast,

2XADH1 cells exhibited a higher NAD/NADH ratio, and increased silencing at

telomeres (Reverter-Branchat, Cabiscol et al. 2007). Both of these findings

support a model where Adh1 mediates Sir2 silencing at telomeres through

NAD/NADH ratio. Adh1’s enzymatic activity maintains the NAD/NADH ratio in

the cell. The lack of it may result in a lower level of NAD available for Sir2

function, and thus a reduction in Sir2-mediated silencing.

An assumption of this model is that the NAD/NADH ratio maintained by

Adh1 can be translated to the pool of freely available nuclear NAD utilized by

Sir2. A large-scale fluorescence microscopy study suggests that Adh1 localizes to

the cytosol (Wiwatwattana and Kumar 2005), and its enzymatic activity may only

regenerate NAD in the cytoplasm. In order for the regenerated NAD to be

available for Sir2, a transport mechanism must exist between the cytosol and

nucleus. Presumably, free NAD can pass through the nuclear pore complex by

simple diffusion. However, it is postulated that a large fraction of cellular NAD

may be protein-bound (Yang and Sauve 2006). In this case, it is possible that some

NAD-binding proteins could deliver cytosol NAD into the nucleus and affect Sir2

function. Since Adh1 is found in a protein complex with Sir2 (Gavin, Bosche et al.

2002), the possibility that Adh1 can enter the nucleus and affects nuclear NAD

74

metabolism should be investigated. At the same time, it may be worthwhile to test

if the levels of freely available nuclear NAD in adh1∆ or 2XADH1 cells

correspond to their respective cellular NAD levels.

Figure 24. A model of Sir2 regulation by Adh1 and Tdh3. Adh1 regenerates NAD.The NAD is transported into the nucleus by proteins such as Tdh3 and utilized bySir2 in the histone deacetylation reaction.

II. Tdh3

Tdh3, a yeast GAPDH isozyme that binds NAD, is a potential candidate that

contributes to the communication between cellular and nuclear NAD level. The

fluorescence microscopy images of this study (Figure 12) confirmed earlier

findings (Huh, Falvo et al. 2003; Ringel 2009) that Tdh3 entered the nucleus. This

localization was not dependent on Sir2 or Tdh2 (Figure 13). Furthermore,

although the cellular NAD level is not affected by the deletion or the

75

overexpression of TDH3 (Stubbs 2007), tdh3∆ decreased the levels of freely

available nuclear NAD (Ringel 2009). It is possible that Tdh3 binds NAD and

delivers it to the nucleus. This agrees with a proposed nuclear transportation

model (Ringel 2009) where Tdh3 regulates the nuclear NAD level, and thus

affects Sir2 function.

The significance of nuclear NAD metabolism in regulating Sir2 activity is

demonstrated by alterations in the NAD salvage pathway, which regenerates NAD

from nicotinamide. For example, strains carrying an extra copy of NPT1

(2xNPT1), a gene encoding for a protein in the NAD salvage pathway, show

enhanced telomeric silencing and reduced rDNA recombination rate in a Sir2

dependent manner. However, 2xNPT1 does not change cellular NAD/NADH ratio

(Anderson, Bitterman et al. 2002). Furthermore, many NAD salvage pathways

proteins that affect Sir2 silencing, including Npt1, Pnc1, Nam1 and Nam2

(Anderson, Bitterman et al. 2002; Sandmeier, Celic et al. 2002), localize to the

nucleus (Anderson, Bitterman et al. 2002; Huh, Falvo et al. 2003; Wiwatwattana

and Kumar 2005). This indicates that although some of these proteins may not

alter the global cellular NAD level, their ability to regulate nuclear NAD

metabolism allow them to regulate Sir2-mediated silencing.

Consistent with the nuclear transport model, Tdh3N314T, a mutant whose

76

bacterial homologs are deficient in NAD binding, showed a loss of telomeric

silencing at a level similar to tdh3∆ mutant (Figure 14). The silencing phenotypes

of the Tdh3T227 mutants may also support this nuclear transport model. The

tdh3T227K mutation caused a reduction in telomeric silencing at a level similar to

tdh3∆ and tdh3N314T mutant (Figure 14). Tdh3 functions as a homotetramer to

carry out its glycolytic functions, and binds to four NAD molecules in a

cooperative manner (Kirschner 1971; Kirschner, Gallego et al. 1971). The

Tdh3T227K protein, whose mammalian GAPDH counterpart is biased towards

the monomer form (Park, Han et al. 2009), may be deficient in its NAD binding

ability, resulting in its inability to regulate Sir2 silencing. On the other hand,

T227A mutation caused mammalian GAPDH to favor the tetrameric form and

discourage its nuclear translocation. It is possible that the Tdh3T227K protein was

unable to enter the nucleus to affect Sir2 function. In agreement with the nuclear

transport model, these mutants demonstrated that both the NAD binding ability

and nuclear translocation may be required for Tdh3 to regulate Sir2 silencing at

telomeres.

However, before we can draw a definite conclusion on these tdh3 mutants,

their NAD binding ability, multimeric forms, and cellular localizations in yeast

cells should be defined. Specifically, the NAD binding ability of these Tdh3

77

protein mutants may be determined through measuring their Km for NAD or

thermal unfolding properties in different NAD concentrations. Analytical gel

filtration experiments can be carried out to determine the multimeric states of

Tdh3 mutants, and their cellular localization can be visualized through

fluorescence microscopy. Furthermore, defining these mutants’ glycolytic

activities may allow us to speculate whether Tdh3’s enzymatic function is

required for it to regulate Sir2.

III. Oxidative stress signaling

It is worth noting that Adh1 and Tdh3 are major carbonylated targets during

both the replicative and chronogical aging processes in yeast cells

(Reverter-Branchat, Cabiscol et al. 2004). Additionally, Tdh3 is carbonylated

under oxidative stress conditions (Costa, Amorim et al. 2002). Carbonylation is an

irreversible oxidative damage (Stadtman 1992), and the accumulation of

carbonylated proteins contributes to the aging phenotype [reviewed in (Levine

2002)]. Previous reports and this study have suggested that Adh1 and Tdh3 affect

Sir2 functions. Carbonylated Adh1 and Tdh3 may not be able to regulate Sir2 in

the same manner as their native forms. Thus, Sir2 may sense the oxidative or

aging stress through Adh1 and Tdh3.

78

Once the carbonylated Adh1 or Tdh3 deliver the stress message to Sir2, Sir2

may activate a defense mechanism as a response. Sir2 is involved in the

asymmetric distribution of oxidatively damaged proteins during cytokinesis. The

process allows the new-born daughter cells to inherit a lower proportion of

oxidatively damaged proteins, and potentially contributes to their fitness

(Aguilaniu, Gustafsson et al. 2003). Interestingly, two mammalian Sir2 homologs,

Sirt1 and Sirt2, can also trigger an antioxidant response through deacetylating and

activating the FOXO3a transcription factor under oxidative stress conditions

(Brunet, Sweeney et al. 2004; Wang, Nguyen et al. 2007). This implies sirtuins

may have conserved functions in sensing oxidative stress and triggering defensive

pathways.

To test this model, one may determine if the oxidatively damaged proteins

are asymmetrically distributed in an adh1∆ or tdh3∆ strain. If Adh1 and Tdh3

serve key roles in conveying the stress message to Sir2, the absence of these

proteins would result in a lack of Sir2 response. In this case, the asymmetric

distribution should not be observed.

79

Figure 25. A model of aging/oxidative stress signaling to Sir2 through Tdh3 andAdh1. Aging or oxidative stress cause the carbonylation of Adh1 and Tdh3, whichthen deliver the stress message to Sir2. Sir2 trigger defense responses, such as theasymmetric distribution of oxidatively damaged proteins.

IV. Mrps12

We established Mrps12, a mitochondria ribosomal protein, as a regulator of

Sir2 and Sir3 functions in this study. MRPS12 overexpression enhanced Sir2 and

Sir3-induced lethality (Figure 15). Furthermore, the deletion of MRPS12 caused

telomeric silencing defects (Figure 18). Since no spreading of transcriptional

silencing was observed in SIR-induced strains, it is unlikely that the SIR-induced

lethality is an effect of Sir proteins’ silencing activity (Holmes, Rose et al. 1997).

Therefore, Mrps12 is related to at least two distinct Sir protein-related phenotypes

of overexpression lethality and silencing. The chances of Mrps12 being able to

80

affect both phenotypes but not interacting with Sir proteins are relatively small. In

addition, it is the only gene that is isolated more than once in a screen for

Sir2-induced lethality enhancer (Ayala 1999). This evidence strengthens the

hypothesis that Mrps12 have a specific relationship with the Sir proteins.

SIR2 and SIR3 overexpression induced higher chromosome loss rates, and

chromosome loss is a possible cause of lethality in SIR-induced cells. In contrast,

MRPS12 overexpression alone does not change the chromosome loss rate (Kristen

Martins-Taylor, unpublished data). If chromosome loss is determined to be the

cause of SIR-induced lethality, Mrps12 may aid Sir proteins in their lethality

functions. Interestingly, Mrps12 can enhance Sir3’s lethality level to a higher

extent (Figure 15), and it does not affect Sir2-mediated rDNA repeat silencing

(Figure 19) or rDNA recombination rate (Figure 21). Thus, it is possible that

Mrps12 has interacts more directly with Sir3 instead of Sir2. Unlike Sir2, Sir3

does not have deacetylase activity and serves mainly structural roles in silencing.

Hence, perhaps Mrps12 can also serve a structural function that aid Sir3 control

chromatin structure. However, the exact mechanisms of Mrps12’s regulation on

Sir proteins still need to be examined. Perhaps the nature of Sir2 or Sir3’s

enhanced lethality can be further investigated, and that might provide information

on how Mrps12 can affect this lethality phenotype. For example, is Sir2’s

81

enzymatic function required to induce lethality? One could test the lethality

phenotype of an overexpressed catalytically-dead mutant. If the mutant still

caused lethality to cell, would MRPS12 overexpression enhance lethality in this

strain as well? Given the dynamic relationship between mammalian sirtuins and

mitochondria, studying the relationship between yeast Sir2 and Mrps12 may help

us understand how this signaling pathway is evolved.

V. Sir2: a potential regulator of metabolism?

Thus far, this study of Sir2’s relationship with metabolic proteins has been

focused on the regulation of Sir2 functions through metabolism. However, there is

a reasonable possibility that Sir2 can also mediate cell’s metabolic function. In

particular, Sir2 may be able to deacetylate and regulate the functions of specific

metabolic proteins like its bacterial and mammalian homologs.

No direct evidence has shown either one of Adh1, Tdh3 or Mrps12 is

acetylated in yeast cells. However, a bacterial GAPDH is acetylated and its

acetylation is strongly increased in a sirtuin mutant, cobB (Wang, Zhang et al.

2010). Additionally, human GAPDH is shown to be acetylated (Choudhary,

Kumar et al. 2009). Given that GAPDH is functionally conserved, these two

studies suggest that Tdh3 may also be acetylated, and its acetylation status may be

mediated by Sir2.

82

In addition to Tdh3, Mrps12 is another potential acetylation target of

sirtuins. Mice deficient in Sirt3, a mammalian homolog of Sir2 that localizes to

the mitochondria, exhibited mitochondrial protein hyperacetylation, implicating

Sirt3’s role in deacetylating mitochondrial proteins (Lombard, Alt et al. 2007).

Specifically, Sirt3 deacetylates another mitochondria ribosomal protein in

mammals, Mrpl10, and regulates mitochondrial synthesis. Given these results, it

may be worthwhile to investigate the acetylation status of Mrps12, Tdh3 and other

metabolic or mitochondrial proteins in a wild type and sir2∆ strain. Studying the

potential metabolic regulation by Sir2 would help us understand how Sir2 can

help a cell adjust to different metabolic states.

VI. Conclusion

We have demonstrated that three metabolic proteins, Adh1, Tdh3 and Mrps12,

regulate Sir2 and exert distinct effects on Sir2 functions. The links between these

proteins and Sir2 represent potential pathways that a cell can signal its metabolic

state to Sir2’s transcriptional regulation activity. Instead of being controlled solely

by a global NAD level, Sir2 can sense metabolic changes in multiple ways. Thus,

Sir2 may serve as a coordination center between cell metabolism and

transcriptional regulation that orchestrates different gene expression patterns in

response to varied metabolic states of a cell.

83

References

Aguilaniu, H., L. Gustafsson, et al. (2003). "Asymmetric inheritance ofoxidatively damaged proteins during cytokinesis." Science 299(5613):1751-1753.

Anderson, R. M., K. J. Bitterman, et al. (2002). "Manipulation of a nuclearNAD+ salvage pathway delays aging without altering steady-stateNAD+ levels." Journal of Biological Chemistry 277(21):18881-18890.

Anderson, R. M., K. J. Bitterman, et al. (2003). "Nicotinamide and PNC1govern lifespan extension by calorie restriction in Saccharomycescerevisiae." Nature 423(6936): 181-185.

Anderson, R. M., M. Latorre-Esteves, et al. (2003). "Yeast life-spanextension by calorie restriction is independent of NAD fluctuation."Science 302(5653): 2124-2126.

Astrom, S. U., T. W. Cline, et al. (2003). "The Drosophila melanogaster sir2+gene is nonessential and has only minor effects on position-effectvariegation." Genetics 163(3): 931-937.

Ayala, L. (1999). Novel Genes that collaborate with SIR2 in S. CerevisiaeSilencing Mechanism. Bachelor of Arts, Wesleyan University.

Bakker, B. M., K. M. Overkamp, et al. (2001). "Stoichiometry andcompartmentation of NADH metabolism in Saccharomycescerevisiae." FEMS Microbiol Rev 25(1): 15-37.

Balaban, R. S., S. Nemoto, et al. (2005). "Mitochondria, oxidants, andaging." Cell 120(4): 483-495.

Bedalov, A., T. Gatbonton, et al. (2001). "Identification of a small moleculeinhibitor of Sir2p." Proc Natl Acad Sci U S A 98(26): 15113-15118.

84

Bedalov, A., M. Hirao, et al. (2003). "NAD+-dependent deacetylase Hst1pcontrols biosynthesis and cellular NAD+ levels in Saccharomycescerevisiae." Mol Cell Biol 23(19): 7044-7054.

Begley, T. J., A. S. Rosenbach, et al. (2004). "Hot spots for modulatingtoxicity identified by genomic phenotyping and localizationmapping." Mol Cell 16(1): 117-125.

Belenky, P., K. L. Bogan, et al. (2007). "NAD+ metabolism in health anddisease." Trends Biochem Sci 32(1): 12-19.

Blander, G. and L. Guarente (2004). "The Sir2 family of proteindeacetylases." Annu Rev Biochem 73: 417-435.

Blank, H. M., C. Li, et al. (2008). "An increase in mitochondrial DNApromotes nuclear DNA replication in yeast." PLoS Genet 4(4):e1000047.

Brachmann, C. B., J. M. Sherman, et al. (1995). "The SIR2 gene family,conserved from bacteria to humans, functions in silencing, cell cycleprogression, and chromosome stability." Genes Dev 9(23):2888-2902.

Brunet, A., L. B. Sweeney, et al. (2004). "Stress-dependent regulation ofFOXO transcription factors by the SIRT1 deacetylase." Science303(5666): 2011-2015.

Canto, C., L. Q. Jiang, et al. (2010). "Interdependence of AMPK and SIRT1for metabolic adaptation to fasting and exercise in skeletal muscle."Cell Metab 11(3): 213-219.

Cheng, T. H. and M. R. Gartenberg (2000). "Yeast heterochromatin is adynamic structure that requires silencers continuously." Genes Dev14(4): 452-463.

Choudhary, C., C. Kumar, et al. (2009). "Lysine acetylation targets proteincomplexes and co-regulates major cellular functions." Science325(5942): 834-840.

85

Costa, V. M., M. A. Amorim, et al. (2002). "Hydrogen peroxide-inducedcarbonylation of key metabolic enzymes in Saccharomyces cerevisiae:the involvement of the oxidative stress response regulators Yap1 andSkn7." Free Radic Biol Med 33(11): 1507-1515.

Dastoor, Z. and J. L. Dreyer (2001). "Potential role of nuclear translocationof glyceraldehyde-3-phosphate dehydrogenase in apoptosis andoxidative stress." J Cell Sci 114(Pt 9): 1643-1653.

de Ruijter, A. J., A. H. van Gennip, et al. (2003). "Histone deacetylases(HDACs): characterization of the classical HDAC family." Biochem J370(Pt 3): 737-749.

Denu, J. M. (2003). "Linking chromatin function with metabolic networks:Sir2 family of NAD(+)-dependent deacetylases." Trends Biochem Sci28(1): 41-48.

Duee, E., L. Olivier-Deyris, et al. (1996). "Comparison of the structures ofwild-type and a N313T mutant of Escherichia coli glyceraldehyde3-phosphate dehydrogenases: implication for NAD binding andcooperativity." J Mol Biol 257(4): 814-838.

Eberharter, A., R. Ferreira, et al. (2005). "Dynamic chromatin: concertednucleosome remodelling and acetylation." Biol Chem 386(8):745-751.

Evans, C., K. L. Bogan, et al. (2010). "NAD+ metabolite levels as a functionof vitamins and calorie restriction: evidence for different mechanismsof longevity." BMC Chem Biol 10: 2.

Fabrizio, P., C. Gattazzo, et al. (2005). "Sir2 blocks extreme life-spanextension." Cell 123(4): 655-667.

Ferreira-da-Silva, F., P. J. Pereira, et al. (2006). "The crystal and solutionstructures of glyceraldehyde-3-phosphate dehydrogenase revealdifferent quaternary structures." Journal of Biological Chemistry281(44): 33433-33440.

86

Fox, C. A. and K. H. McConnell (2005). "Toward biochemical understandingof a transcriptionally silenced chromosomal domain inSaccharomyces cerevisiae." Journal of Biological Chemistry 280(10):8629-8632.

Fritze, C. E., K. Verschueren, et al. (1997). "Direct evidence for SIR2modulation of chromatin structure in yeast rDNA." EMBO J 16(21):6495-6509.

Frye, R. A. (2000). "Phylogenetic classification of prokaryotic and eukaryoticSir2-like proteins." Biochem Biophys Res Commun 273(2): 793-798.

Fuchs, J. and J. Loidl (2004). "Behaviour of nucleolus organizing regions(NORs) and nucleoli during mitotic and meiotic divisions in buddingyeast." Chromosome Res 12(5): 427-438.

Fujita, K., T. Horie, et al. (2001). "Cross-genomic analysis of thetranslational systems of various organisms." J Ind MicrobiolBiotechnol 27(3): 163-169.

Gavin, A. C., M. Bosche, et al. (2002). "Functional organization of the yeastproteome by systematic analysis of protein complexes." Nature415(6868): 141-147.

Gerhart-Hines, Z., J. T. Rodgers, et al. (2007). "Metabolic control of musclemitochondrial function and fatty acid oxidation throughSIRT1/PGC-1alpha." EMBO J 26(7): 1913-1923.

Goldring, E. S., L. I. Grossman, et al. (1971). "Petite mutation in yeast. II.Isolation of mutants containing mitochondrial deoxyribonucleic acidof reduced size." J Bacteriol 107(1): 377-381.

Goldstein, A. L. and J. H. McCusker (1999). "Three new dominant drugresistance cassettes for gene disruption in Saccharomyces cerevisiae."Yeast 15(14): 1541-1553.

Gottlieb, S. and R. E. Esposito (1989). "A new role for a yeast transcriptionalsilencer gene, SIR2, in regulation of recombination in ribosomal

87

DNA." Cell 56(5): 771-776.

Gottschling, D. E., O. M. Aparicio, et al. (1990). "Position effect at S.cerevisiae telomeres: reversible repression of Pol II transcription."Cell 63(4): 751-762.

Guarente, L. (2006). "Sirtuins as potential targets for metabolic syndrome."Nature 444(7121): 868-874.

Guarente, L. (2008). "Mitochondria--a nexus for aging, calorie restriction,and sirtuins?" Cell 132(2): 171-176.

Guarente, L. and F. Picard (2005). "Calorie restriction--the SIR2 connection."Cell 120(4): 473-482.

Haigis, M. C. and L. P. Guarente (2006). "Mammalian sirtuins--emergingroles in physiology, aging, and calorie restriction." Genes Dev 20(21):2913-2921.

Hanover, J. A. (2001). "Glycan-dependent signaling: O-linkedN-acetylglucosamine." FASEB J 15(11): 1865-1876.

Hara, M. R., N. Agrawal, et al. (2005). "S-nitrosylated GAPDH initiatesapoptotic cell death by nuclear translocation following Siah1binding." Nat Cell Biol 7(7): 665-674.

Hart, G. W., M. P. Housley, et al. (2007). "Cycling of O-linked[beta]-N-acetylglucosamine on nucleocytoplasmic proteins." Nature446(7139): 1017-1022.

Holmes, S. G., A. B. Rose, et al. (1997). "Hyperactivation of the silencingproteins, Sir2p and Sir3p, causes chromosome loss." Genetics 145(3):605-614.

Houtkooper, R. H., E. Pirinen, et al. (2012). "Sirtuins as regulators ofmetabolism and healthspan." Nat Rev Mol Cell Biol 13(4): 225-238.

Huang, J., I. L. Brito, et al. (2006). "Inhibition of homologous recombination

88

by a cohesin-associated clamp complex recruited to the rDNArecombination enhancer." Genes Dev 20(20): 2887-2901.

Huang, Y. (2002). "Transcriptional silencing in Saccharomyces cerevisiaeand Schizosaccharomyces pombe." Nucleic Acids Res 30(7):1465-1482.

Huh, W. K., J. V. Falvo, et al. (2003). "Global analysis of protein localizationin budding yeast." Nature 425(6959): 686-691.

Kaeberlein, M., K. T. Kirkland, et al. (2004). "Sir2-independent life spanextension by calorie restriction in yeast." PLoS Biol 2(9): E296.

Kaeberlein, M., M. McVey, et al. (1999). "The SIR2/3/4 complex and SIR2alone promote longevity in Saccharomyces cerevisiae by twodifferent mechanisms." Genes Dev 13(19): 2570-2580.

Kirschner, K. (1971). "Co-operative binding of nicotinamide-adeninedinucleotide to yeast glyceraldehyde-3-phosphate dehydrogenase. II.Stopped-flow studies at pH 8-5 and 40 degrees C." J Mol Biol 58(1):51-68.

Kirschner, K., E. Gallego, et al. (1971). "Co-operative binding ofnicotinamide-adenine dinucleotide to yeastglyceraldehyde-3-phosphate dehydrogenase. I. Equilibrium andtemperature-jump studies at pH 8-5 and 40 degrees C." J Mol Biol58(1): 29-50.

Kouzarides, T. (2007). "Chromatin modifications and their function." Cell128(4): 693-705.

Lamming, D. W., M. Latorre-Esteves, et al. (2005). "HST2 mediatesSIR2-independent life-span extension by calorie restriction." Science309(5742): 1861-1864.

Landry, J., J. T. Slama, et al. (2000). "Role of NAD(+) in the deacetylaseactivity of the SIR2-like proteins." Biochem Biophys Res Commun278(3): 685-690.

89

Landry, J., A. Sutton, et al. (2000). "The silencing protein SIR2 and itshomologs are NAD-dependent protein deacetylases." Proc Natl AcadSci U S A 97(11): 5807-5811.

Levine, R. L. (2002). "Carbonyl modified proteins in cellular regulation,aging, and disease." Free Radic Biol Med 32(9): 790-796.

Lin, S. J., P. A. Defossez, et al. (2000). "Requirement of NAD and SIR2 forlife-span extension by calorie restriction in Saccharomycescerevisiae." Science 289(5487): 2126-2128.

Lin, S. J., E. Ford, et al. (2004). "Calorie restriction extends yeast life spanby lowering the level of NADH." Genes Dev 18(1): 12-16.

Lin, S. J., M. Kaeberlein, et al. (2002). "Calorie restriction extendsSaccharomyces cerevisiae lifespan by increasing respiration." Nature418(6895): 344-348.

Liou, G. G., J. C. Tanny, et al. (2005). "Assembly of the SIR complex and itsregulation by O-acetyl-ADP-ribose, a product of NAD-dependenthistone deacetylation." Cell 121(4): 515-527.

Lombard, D. B., F. W. Alt, et al. (2007). "Mammalian Sir2 homolog SIRT3regulates global mitochondrial lysine acetylation." Mol Cell Biol27(24): 8807-8814.

Lu, S. P. and S. J. Lin (2010). "Regulation of yeast sirtuins by NAD(+)metabolism and calorie restriction." Biochim Biophys Acta 1804(8):1567-1575.

Matecic, M., S. Stuart, et al. (2002). "SIR2-induced inviability is suppressedby histone H4 overexpression." Genetics 162(2): 973-976.

Mishra, K. and D. Shore (1999). "Yeast Ku protein plays a direct role intelomeric silencing and counteracts inhibition by rif proteins." CurrBiol 9(19): 1123-1126.

Mishra, S., S. R. Ande, et al. (2011). "O-GlcNAc modification: why so

90

intimately associated with phosphorylation?" Cell Commun Signal9(1): 1.

North, B. J. and E. Verdin (2004). "Sirtuins: Sir2-related NAD-dependentprotein deacetylases." Genome Biol 5(5): 224.

Outten, C. E., R. L. Falk, et al. (2005). "Cellular factors required forprotection from hyperoxia toxicity in Saccharomyces cerevisiae."Biochem J 388(Pt 1): 93-101.

Park, J., D. Han, et al. (2009). "O-GlcNAcylation disruptsglyceraldehyde-3-phosphate dehydrogenase homo-tetramer formationand mediates its nuclear translocation " BBA - Prot. & Proteom.1794(2): 254-262.

Pereira, C. V., M. Lebiedzinska, et al. (2012). "Regulation and protection ofmitochondrial physiology by sirtuins." Mitochondrion 12(1): 66-76.

Qin, W., T. Yang, et al. (2006). "Neuronal SIRT1 activation as a novelmechanism underlying the prevention of Alzheimer disease amyloidneuropathology by calorie restriction." Journal of BiologicalChemistry 281(31): 21745-21754.

Ralser, M., S. Michel, et al. (2012). "Sirtuins as regulators of the yeastmetabolic network." Frontiers in Pharmacology 3.

Reid, R. J. and R. Rothstein (2004). "Stay close to your sister." Mol Cell14(4): 418-420.

Reverter-Branchat, G., E. Cabiscol, et al. (2004). "Oxidative damage tospecific proteins in replicative and chronological-agedSaccharomyces cerevisiae: common targets and prevention by calorierestriction." Journal of Biological Chemistry 279(30): 31983-31989.

Reverter-Branchat, G., E. Cabiscol, et al. (2007). "Chronological andreplicative life-span extension in Saccharomyces cerevisiae byincreased dosage of alcohol dehydrogenase 1." Microbiology 153(Pt11): 3667-3676.

91

Revollo, J. R., A. A. Grimm, et al. (2004). "The NAD biosynthesis pathwaymediated by nicotinamide phosphoribosyltransferase regulates Sir2activity in mammalian cells." Journal of Biological Chemistry279(49): 50754-50763.

Ringel, A. E. (2009). Tdh3 (a GAPDH isozyme) is a novel regulator ofSir2-mediated transcriptional silencing in yeast.

Roitel, O., O. Ivinova, et al. (2002). "Thermal unfolding used as a probe tocharacterize the intra- and intersubunit stabilizing interactions inphosphorylating D-glyceraldehyde-3-phosphate dehydrogenase fromBacillus stearothermophilus." Biochemistry 41(24): 7556-7564.

Rusche, L. N., A. L. Kirchmaier, et al. (2003). "The establishment,inheritance, and function of silenced chromatin in Saccharomycescerevisiae." Annu Rev Biochem 72: 481-516.

Sanders, B. D., K. Zhao, et al. (2007). "Structural basis for nicotinamideinhibition and base exchange in Sir2 enzymes." Mol Cell 25(3):463-472.

Sandmeier, J. J., I. Celic, et al. (2002). "Telomeric and rDNA silencing inSaccharomyces cerevisiae are dependent on a nuclear NAD(+)salvage pathway." Genetics 160(3): 877-889.

Sauve, A. A., C. Wolberger, et al. (2006). "The biochemistry of sirtuins."Annu Rev Biochem 75: 435-465.

Schmidt, M. T., B. C. Smith, et al. (2004). "Coenzyme specificity of Sir2protein deacetylases: implications for physiological regulation."Journal of Biological Chemistry 279(38): 40122-40129.

Schreiber Laboratory, B. i. (2012). Retrieved 4/4/12, 2012, fromhttp://www.broadinstitute.org/chembio/lab_schreiber/anims/animations/smdbHDAC.php.

Schwer, B. and E. Verdin (2008). "Conserved metabolic regulatory functionsof sirtuins." Cell Metab 7(2): 104-112.

92

Shah, Z. H., K. M. O'Dell, et al. (1997). "Metazoan nuclear genes formitoribosomal protein S12." Gene 204(1-2): 55-62.

Sinclair, D. A. and L. Guarente (1997). "Extrachromosomal rDNA circles--acause of aging in yeast." Cell 91(7): 1033-1042.

Sirover, M. A. (2005). "New nuclear functions of the glycolytic protein,glyceraldehyde-3-phosphate dehydrogenase, in mammalian cells." JCell Biochem 95(1): 45-52.

Smith, D. L., Jr., J. M. McClure, et al. (2007). "Calorie restriction extends thechronological lifespan of Saccharomyces cerevisiae independently ofthe Sirtuins." Aging Cell 6(5): 649-662.

Smith, J. S., C. B. Brachmann, et al. (2000). "A phylogenetically conservedNAD+-dependent protein deacetylase activity in the Sir2 proteinfamily." Proc Natl Acad Sci U S A 97(12): 6658-6663.

Smolka, M. B., C. P. Albuquerque, et al. (2007). "Proteome-wideidentification of in vivo targets of DNA damage checkpoint kinases."Proc Natl Acad Sci U S A 104(25): 10364-10369.

Stadtman, E. R. (1992). "Protein oxidation and aging." Science 257(5074):1220-1224.

Starai, V. J., H. Takahashi, et al. (2003). "Short-chain fatty acid activation byacyl-coenzyme A synthetases requires SIR2 protein function inSalmonella enterica and Saccharomyces cerevisiae." Genetics 163(2):545-555.

Straight, A. F., W. Shou, et al. (1999). "Net1, a Sir2-associated nucleolarprotein required for rDNA silencing and nucleolar integrity." Cell97(2): 245-256.

Stubbs, H. (2007). Suppressors of SIR2-induced lethality in Saccharomycescerevisiae, Wesleyan University.

Tanny, J. C., D. S. Kirkpatrick, et al. (2004). "Budding yeast silencing

93

complexes and regulation of Sir2 activity by protein-proteininteractions." Mol Cell Biol 24(16): 6931-6946.

Ventura, M., F. Mateo, et al. (2010). "Nuclear translocation ofglyceraldehyde-3-phosphate dehydrogenase is regulated byacetylation." Int J Biochem Cell Biol 42(10): 1672-1680.

Verdin, E., M. D. Hirschey, et al. (2010). "Sirtuin regulation of mitochondria:energy production, apoptosis, and signaling." Trends Biochem Sci35(12): 669-675.

Von Zglinicki, T. (2003). Aging at the Molecular Level, Kluwer Academic.

Wang, F., M. Nguyen, et al. (2007). "SIRT2 deacetylates FOXO3a inresponse to oxidative stress and caloric restriction." Aging Cell 6(4):505-514.

Wang, Q., Y. Zhang, et al. (2010). "Acetylation of metabolic enzymescoordinates carbon source utilization and metabolic flux." Science327(5968): 1004-1007.

Wiwatwattana, N. and A. Kumar (2005). "Organelle DB: a cross-speciesdatabase of protein localization and function." Nucleic Acids Res33(Database issue): D598-604.

Xu, W. and S. Zhao (2011). "Metabolism is regulated by protein acetylation."Frontiers in Biology 6(3): 213-218.

Yang, T. and A. A. Sauve (2006). "NAD metabolism and sirtuins: metabolicregulation of protein deacetylation in stress and toxicity." AAPS J8(4): E632-643.

Yu, J. and J. Auwerx (2009). "The role of sirtuins in the control of metabolichomeostasis." Ann N Y Acad Sci 1173 Suppl 1: E10-19.

Zakian, V. A. (1996). "Structure, function, and replication of Saccharomycescerevisiae telomeres." Annu Rev Genet 30: 141-172.

94

Zhao, S., W. Xu, et al. (2010). "Regulation of cellular metabolism by proteinlysine acetylation." Science 327(5968): 1000-1004.

Zheng, L., R. G. Roeder, et al. (2003). "S phase activation of the histone H2Bpromoter by OCA-S, a coactivator complex that contains GAPDH asa key component." Cell 114(2): 255-266.

Documents

Signaling to Sir2-mediated transcriptional silencing through