Submitted 11 February 2019Accepted 14 June 2019Published 30 July 2019

Corresponding authorTonia DeBellistdebellisdawsoncollegeqcca

Academic editorErica Goss

Additional Information andDeclarations can be found onpage 17

DOI 107717peerj7295

Copyright2019 DeBellis et al

Distributed underCreative Commons CC-BY 40

OPEN ACCESS

Shared mycorrhizae but distinctcommunities of other root-associatedmicrobes on co-occurring native andinvasive maplesTonia DeBellis12 Steven W Kembel3 and Jean-Philippe Lessard1

1Department of Biology Concordia University Montreal Quebec Canada2Department of Biology Dawson College Montreal Quebec Canada3Deacutepartement des sciences Biologiques Universiteacute du Queacutebec agrave Montreacuteal Montreacuteal Queacutebec Canada

ABSTRACTBackground Biological invasions are major drivers of environmental change that cansignificantly alter ecosystem function and diversity In plants soil microbes play animportant role in plant establishment and growth however relatively little is knownabout the role they might play in biological invasions A first step to assess whether rootmicrobes may be playing a role in the invasion process is to find out if invasive plantshost different microbes than neighbouring native plant speciesMethods In this study we investigated differences in root associated microbes of nativesugar maple (Acer saccharum Marsh) and exotic Norway maple (A platanoides L)collected from a forested reserve in eastern Canada We used microscopy to examineroot fungi and high-throughput sequencing to characterize the bacterial fungal andarbuscular mycorrhizal communities of both maple species over one growing seasonResults We found differences in root associated bacterial and fungal communities be-tween host species Norway maple had a higher bacterial and fungal OTU (operationaltaxonomic units) richness compared to sugar maple and the indicator species analysisrevealed that nine fungal OTUs and three bacterial OTUs had a significant preferencefor sugarmaple The dominant bacterial phyla found on the roots of bothmaple specieswere Actinobacteria and Proteobacteria The most common fungal orders associatedwith the Norway maple roots (in descending order) were Helotiales AgaricalesPleosporalesHypocreales Trechisporaleswhile theAgaricales PleosporalesHelotialesCapnodiales and Hypocreales were the dominant orders present in the sugar mapleroots Dark septate fungi colonization levels were higher in the sugar maple but nodifferences in arbuscular mycorrhizal fungal communities and colonization rates weredetected between maple speciesDiscussion Our findings show that two congeneric plant species grown in close prox-imity can harbor distinct root microbial communities These findings provide furthersupport for the importance of plant species in structuring root associated microbecommunities The high colonization levels observed in Norway maple demonstratesits compatibility with arbuscular mycorrhizal fungi in the introduced range Plant-associated microbial communities can affect host fitness and function in many waystherefore the observed differences suggest a possibility that biotic interactions caninfluence the dynamics between native and invasive species

How to cite this article DeBellis T Kembel SW Lessard J-P 2019 Shared mycorrhizae but distinct communities of other root-associatedmicrobes on co-occurring native and invasive maples PeerJ 7e7295 httpdoiorg107717peerj7295

Subjects Ecology Microbiology Molecular BiologyKeywords Exotic species Acer saccharum Mycorrhizal fungi Acer platanoides Illumina MiSeq

INTRODUCTIONInvasion of native ecosystems by non-native species can alter the structure of biologicalcommunities often leading to changes in biodiversity (Thomas amp Palmer 2015 BellardCassey amp Blackburn 2016) or ecosystem functioning (Ehrenfeld 2010 Vilagrave et al 2011)Studies attempting to determine what factors may be playing a role in the invasion processhave shown that multiple factors such as facilitation enemy release competitive releaseand propagule pressure can simultaneously influence invasion success (Lockwood Hoopesamp Marchetti 2007) Invasions of trees and shrubs in the last few decades around the worldhas revealed that woody plants are among the most widespread of invasive organisms(Richardson amp Rejmaacutenek 2011) Natural plant populations associate with a multitude ofsoil microbes and several hypotheses aimed at explaining the success of exotic plants revolvearound the biotic interactions between plants and their associated microbial communitiesFeedback between plants and root-associated microbes can be positive when mycorrhizalfungi and N-fixing bacteria are involved or negative when the plant associates withmicrobial pathogens and parasites (Bever 2003) Therefore microbial communities in soilcan influence invasion success of plants in several ways (Wolfe amp Klironomos 2005Reinhartamp Callaway 2006 Pringle et al 2009) Nevertheless how soil microbial communities differbetween native and exotic plant species remains largely unexplored Here we investigatedifferences in the microbes associated with the roots of native sugar maple and exoticNorway maple from a forested reserve in eastern Canada

Several mechanisms directly or indirectly involving soil microorganisms are proposed toexplain the success of invasive plants in their introduced ranges The two functional groupsof microbes hypothesized to have strong effects on invasive plants are the pathogens andmutualistic symbionts due to their important influence on plant growth and performancePathogens that are present in the native range may not occur in the introduced range suchthat exotic species gain a competitive advantage over native species (Callaway et al 2004Reinhart et al 2010) This phenomenon is consistent with the enemy release hypothesiswhich posits that invasive species thrive in their new range by no longer being hinderedby their natural enemies (Elton 1958 Keane amp Crawley 2002) For plants that requiresoil-borne mutualists various strategies facilitating invasion have been proposed Plantswill not be hindered in their new range if they are able to associate with novel mutualistsassociate with generalist symbionts or co-invade with their native symbionts (Nuntildeezamp Dickie 2014) Although the role of soil microbes in the invasion process of plants isbecoming increasingly recognized (Wolfe amp Klironomos 2005 Reinhart amp Callaway 2006Inderjit amp Van der Putten 2010 Dickie et al 2017) we still lack an understanding of thesecomplex dynamics for most introduced species

Plants and soil microbes form complex interactions which can affect host fitness andfunction (Vandenkoornhuyse et al 2015) Many bacteria are known to be able to stimulateplant growth through direct or indirect interactions with plant roots Root associated

DeBellis et al (2019) PeerJ DOI 107717peerj7295 225

bacteria may contribute to plant nutrition by nutrient solubilization or nitrogen fixationto plant growth and stress release by phytohormone production or degradation andto pathogen suppression (Berg et al 2016) Soil fungi also assist plants with nutrientavailability protection against pathogens and stress tolerance (Rodriguez amp Redman 2008Van Wees Van der Ent amp Pieterse 2008 Vandenkoornhuyse et al 2015) Soil bacteria andfungi can also be pathogenic to plants and can therefore affect the distribution andabundance of plant species by suppressing plant recruitment growth and survival (Packeramp Clay 2000 Bever 2003 Reinhart et al 2003) An understanding of these complexrelationships requires an assessment of the resident microbes on different plant hosts

Plant species identity can be an important factor influencing root microbial diversityhowever this relationship is not universal It has been shown to be a significant factor insome field studies (Aleklett et al 2015 Uroz et al 2016) and not significant in others(Knapp Pintye amp Kovaacutecs 2012 Johansen et al 2016) The phylogenetic relationshipamong plant hosts being compared may be an important factor affecting plant-microbeassociations Related plants tend to have more similar microbial communities because hosttraits that influence interactions with microbes tend to be phylogenetically conserved(Wehner et al 2014) Laforest-Lapointe Messier amp Kembel (2016) examined bacterialcommunities of five temperate tree species and found that red maple (A rubrum L) andsugar maple have similar bacterial communities when compared to paper birch (BetulapapyriferaMarsh) and to the two coniferous species sampled However other studies havereported the opposite with closely related plant species hosting distinct root microbes(Reinhart amp Anacker 2014 Veresoglou amp Rillig 2014) Hence a first step to infer the roleof soil microbes in the invasion process is to discover if there are different communities ofmicrobes around two congeneric plant species growing in close vicinity

Norway maple is an invasive tree species found in temperate forests of the northeasternUnited States and Canada It is a European native that was introduced to North Americaaround 1756 (Nowak amp Rowntree 1990) It became a popular choice for street trees afterWWII when the native white elm population (Ulmus americanum L) was devastated byDutch Elm disease (Nowak amp Rowntree 1990) but it is now invading wild woodland andnatural areas in urban settings Previous studies attributed the success of the Norwaymaple in its introduced range to its fast growth high shade tolerance high seed outputand tolerance to a wide range of environmental conditions (Kloeppel amp Abrams 1995Wyckoff amp Webb 1996 Webb et al 2000 Meiners 2005) Many studies have reportedreduced species richness of native species and increased abundances of Norway mapleseedlings relative to nearby non-invaded areas (Wyckoff amp Webb 1996 Martin 1999Reinhart Greene amp Callaway 2005) Norway maple can inhibit the growth of nativespecies (Reinhart Greene amp Callaway 2005 Galbraith-Kent amp Handel 2008) including thenative sugar maple by outcompeting it (Wyckoff amp Webb 1996 Martin 1999) Reinhart ampCallaway (2004) have shown that Norway maple can experience increased growth whengrown in soil from its invaded range and another experimental study showed that Norwaymaple had significantly greater aboveground and root biomass than sugar maple (Paquetteet al 2012) However no study to date has investigated whether there are differences in

DeBellis et al (2019) PeerJ DOI 107717peerj7295 325

root microbial communities associated with native and introduced maples using ampliconsequencing of DNA extracted directly from root tissue

The roots of maple trees (Acer spp) are colonized by arbuscular mycorrhizal fungi(hereafter AMF) which are symbiotic micro-organisms that colonize the roots of themajority of the worldrsquos land plant species (Smith amp Read 2008) AMF provide host plantswith nutrients water heavy metal tolerance andor enhanced pathogen resistance inexchange for carbon (Smith amp Read 2008) and could therefore promote the establishmentand spread of invasive plant species (Marler et al 1999) Ameta-analysis of 67 studies foundthat the degree of AMF colonization (measured as a percentage) of invasive plants did notdiffer from that of native species across studies but AMF communities associated withco-occurring invasive and native plants can differ substantially (Bunn Ramsey amp Lekberg2015) Different AMF fungi have differing effects on their host (Klironomos 2003) thereforechanges in AMF communities may impact plant performance and competitiveness Studiesshow that exotic plants are primarily colonized with dominant widespread AMF ratherthan rare AMF taxa (Moora et al 2011 Bunn et al 2014) Most AMF have low levelsof endemism (Davison et al 2015) therefore these widespread AMF with low speciesspecificity may have the ability to quickly colonize alien hosts possibly aiding the invasionprocess (Moora et al 2011 Dickie et al 2017) Beyond overall root colonization levelsanother method used to further examine the state of the AMF symbiosis is to examine thearbuscule to vesicle ratio Arbuscules are the site of nutrient exchange in AMF while vesiclesare fungal storage structures (Smith amp Read 2008) therefore high arbuscule numberscoupled with low vesicle numbers is usually a sign of a healthy mycorrhizal associationA decreased number of arbuscules with higher vesicle numbers have been observed inthe roots of stressed sugar maples (Cooke Widden amp Halloran 1992 Klironomos 1995) Ahigher arbuscule to vesicle ratio can reveal another competitive advantage in co-occurringplant species

Here we examined the microbial communities associated with the roots of co-occurringnon-native Norway maple and native sugar maple from a temperate forested reserveWe used microscopy and DNA sequencing-based methods targeting bacteria fungi andAMF in maple roots to address the following questions (1) Do root-associated microbialcommunities vary in their composition between co-occurring native and exotic mapleseedlings (2) Do root fungal colonization rates differ between the two species (3) Are thearbuscule to vesicle ratios higher in the Norway maple

MATERIALS amp METHODSStudy site and root collectionMaple seedlings were collected from the Morgan Arboretum a forested reserve located inSainte-Anne-de-Bellevue Queacutebec Canada (4543N 7394W) Norway maple trees wereplanted in the Arboretum in the mid-1950s and these mature trees were cut and removedfrom the site in 2008 Although mature trees have been removed many seedlings are stillpresent in the reserve In an area containing many Norway and sugar maple seedlings fiveparallel 60 m transects (separated by 10 m) were set up Along each transect we randomly

DeBellis et al (2019) PeerJ DOI 107717peerj7295 425

selected a sampling point On each sampling date one Norway maple and one sugar mapleseedling of similar height (sim25 cm) were sampled within a radius of 15m for each transectA total of 10 seedlings were collected on each sampling date Seedlings were selected becauseentire seedlings could be collected in the field ensuring the exact identification of each rootsystem examined We repeated this protocol eight times at intervals of two weeks betweenJune and October 2015 A total of 80 seedlings were collected (5 transects times 8 dates times 2species) Each seedling was removed from the soil with a trowel leaving soil around theroots to prevent desiccation Seedlings were then placed in sealable plastic bags and storedin a cooler with ice packs until they were returned to the laboratory for further processing

Once in the laboratory roots were carefully removed from the soil were thoroughlywashed with tap water and the small pale feeder roots were isolated Half of the roots werepreserved in Formalin-Acetic Acid-Alcohol (FAA) solution at room temperature for aminimum of 24 h for the morphological analysis and the other half were dried using papertowels and placed in 15 ml microtubes and stored at minus80 C for the molecular analysis ofthe root microbial community While collecting the roots approximately 100 ml of soilsurrounding the roots of each seedling was collected air-dried for 48 hrs and stored inpaper bags for soil chemical analysis (see Supplemental Information for details of the soilchemical analyses) Seedling collection and root processing until this point occurred onthe same day

DNA ExtractionDNA was extracted from approximately 150 mg of root sample using the PowerSoil DNAIsolation Kit (MOBIO Laboratories Inc Carlsbad CA USA) with the two followingmodifications Firstly in order to increase cell disruption and increase DNA yield sampleswere milled using a MiniBead Beadbeater-16 (BioSpec Products Bartlesville OK USA)for 2 min with three 23 mm diameter stainless steel beads (BioSpec Products) After thisstep the roots were paste-like in consistency therefore the contents of the PowerBeadTubes tube were added to the tubes containing the crushed roots and the procedure wascontinued following manufacturerrsquos instructions The second modification occurred at thefinal elution step where 75 microl of solution C6 solution was added to the spin filter tubeinstead of the recommended 100 microl also an effort to increase final DNA concentrationExtracted DNA was stored at minus80 C

DNA library preparation and sequencingFor bacteria we amplified the V5-V6 region of the bacterial 16S ribosomal RNA gene usingthe chloroplast-excluding primers 799F-1115R (799F AACMGGATTAGATACCCKG1115R AGGGTTGCGCTCGTTG Chelius amp Triplett 2001 Redford et al 2010) in orderto eliminate contamination by host plant DNA For the fungal communities theinternal transcribed spacer (ITS) region was amplified using the fungal specific primersITS-1F (CTTGGTCATTTAGAGGAAGTAA Gardes amp Bruns 1993) and ITS2 (GCT-GCGTTCTTCATCGATGCWhite et al 1990) For the AMF we used the Glomeromycotaspecific primer AML2 (GAACCCAAACACTTTGGTTTCC Lee Lee amp Young 2008 andthe universal eukaryotic primer WANDA (CAGCCGCGGTAATTCCAGCT Dumbrell et

DeBellis et al (2019) PeerJ DOI 107717peerj7295 525

al 2011) The WANDA and AML2 primer pair amplifies a portion of the small subunit(SSU) RNA gene We chose this region because it is frequently targeted and the curatedMaarjAM database (Oumlpik et al 2010) has been developed based on this region allowingus to compare our sequences to the largest AMF sequence database to date

The forward and reverse primers used in the PCR consisted of the target primer aunique twelve-nucleotide barcode and an Illumina adaptor (5prime ndashIllumina adaptor ndash12nucleotide barcode ndashtarget primer) Reactions were performed using 05 unit of PhusionHot Start II High-Fidelity DNA polymerase and accompanying 5X Phusion HF Buffer(Thermo Scientific) with one microL of undiluted root DNA for bacteria and fungi but a 110DNA dilution was used for the AMF The reactions were carried out in a final volumeof 25 microl in the presence of 200 microM dNTPs 200 pmols of each primer and 075 microl ofDMSO The reaction was run on an Eppendorf MasterCycler thermocycler with a 30 sinitial denaturation step at 98 C and 35 cycles of 98 C for 15 s annealing at 64 C for 30 sand extension at 72 C for 30 s with a final extension at 72 C for 10 min Controls withno DNA and positives with target DNA were run with every series of amplifications to testfor the presence of contaminants and ensure PCR reaction mix was correct The resultingPCR products were loaded on a 1 agarose gel to verify each PCR run All amplifiedsamples were cleaned and normalized using the Invitrogen Sequalprep PCR Cleanup andNormalization Kit Multiplexed amplicon libraries for each of the 3 groups were preparedby mixing equimolar concentrations of DNA and each library was quantified using QubitdsDNA High Sensitivity kit Each DNA library was sequenced using an Illumina MiSeqSequencer with the 2times 300 bp paired end platformusing the IllunimaMiSeq Reagent Kit v3

BioinformaticsIllumina adapters were trimmed from the raw sequences using BBDuk (BBtools packagehttpsjgidoegovdata-and-toolsbbtools) and the trimmed paired-end sequences wereassembled with PEAR (Zhang et al 2014) Sequences were demultiplexed using defaultsettings in QIIME (v 191) (Caporaso et al 2010) with the exception of allowing for twoprimer mismatches Chimeric sequences were identified using the Usearch algorithm andthen eliminated We then binned the remaining sequences into operational taxonomicunits (OTUs) at a 97 sequence similarity cutoff Taxonomic identity of each OTU wasdetermined with QIIME using the uclust algorithm and the Greengenes database ver13_8 (DeSantis et al 2006) for bacteria RDP classifier and the UNITE database ver 12_11(Kotildeljalg et al 2005) for fungi and the uclust algorithm and MaarjAM database for AMF(Oumlpik et al 2010)

Root staining and quantification of AMF and Dark Septate Endophytecolonization in maple rootsThe preserved roots were removed from the FAA solution and placed separately inOmniSette Rcopy Tissue-Teks Rcopy (Fisher Scientific) Samples were then cleared by autoclavingfor 20 min in 10 KOH The autoclave step was repeated two times changing the KOHsolution each time If the KOH solution was a dark brown color after the second autoclavestep the process was repeated a third time in order to ensure the roots would be sufficiently

DeBellis et al (2019) PeerJ DOI 107717peerj7295 625

cleared for morphological analysis Following the KOH step roots were gently rinsedwith tap water and bleached with 35 hydrogen peroxide for 30 min Samples were thenrinsed again with tap water and acidified in 15 HCl for 15 min Finally roots werestained in 01 chlorazol black E at 90 C for 12 min (Brundrett Picheacute amp Peterson 1984)After staining the samples were allowed to destain in a 50 glycerin solution overnightThe roots were then mounted on slides in glycerine jelly and squashed with a cover slip(Widden 2001) Root fungi were examined using a Leica DM6000 light microscope at amagnification of 400x The colonization rate for each root sample was quantified using themagnified grid-intersect method (McGonigle et al 1990) Each intersect was evaluated forthe following AMF structures hyphae arbuscules and vesicles for a total of 100 intersectsper root sample For each fungal structure the colonization rate was determined bycounting the total number of intersects in which it was present Total AMF colonizationrates were determined by counting all intersects in which at least one AMF structure waspresent When the stained roots were observed under the microscope the dark septateendophytic (DSE) fungi were clearly evident and easily distinguishable from the AMFtherefore at each intersect the presence of these fungi were also noted and quantified

Statistical analysisPrior to the analyses of the microbial sequence data in order to eliminate potentiallyspurious OTUs caused by PCR error or sequencing artifacts all OTUs with fewer than10 occurrences were removed and the number of sequences per microbial communitywas rarefied based on the number of sequences present in the sample with the lowestnumber sequences in order to maintain equal sampling depth across samples Toillustrate differences in the structure of bacterial and fungal communities non-metricmultidimensional scaling (NMDS) analysis based on BrayndashCurtis similarities at theOTU level (using Hellinger transformation) was used and the significance of theobserved differences were determined by PERMANOVA (distance-based permutationalmultivariable analysis of variance Anderson 2001) using 999 permutations To identifywhich OTUs differed in abundance between maple species we used ANCOM (Analysis ofcomposition of microbiomes (Mandal et al 2015) implemented in R with the multcorr2parameter ANCOM was used because of its power and accuracy in the detection ofdifferential abundance of OTUs and for its low false detection rate (Weiss et al 2017)For this analysis unrarefied community datasets are used and all OTUs with fewer than10 sequence reads were removed We also classified the functional guild of the 25 mostcommon fungal OTUs using FUNGuild (Nguyen et al 2016) These 25 OTUs included allOTUs that had gt05 relative abundance for each maple species In brief FUNGuild usesthe given OTU taxonomy assigned file to compare it to its database to attempt to assign anecological guild to each OTU For each match a confidence rating is also given with highlyprobable being absolutely certain probable being fairly certain and the lowest rating beingpossible meaning the identification is suspected but not highly supported

We calculated richness of all three microbe groups from the OTU community matricesand performed t -tests to test for differences between species The overall effects of speciesdate and interaction between species and date on AMF and DSE colonization were

DeBellis et al (2019) PeerJ DOI 107717peerj7295 725

determined with two-way ANOVAs Two-way ANOVAs were also used to determine ifthere were any significant differences in soil chemical parameters with species and samplingdate When data did not satisfy the ShapirondashWilk test for normality a log transformationwas performed All statistical analyses and visualization were performed in R (R Core Team2013) using the following packages ggplot2 (Wickham 2009) picante (Kembel et al 2010)vegan (Oksanen et al 2017) and ANCOM (Mandal et al 2015)

The metadata and sequences files have been deposited in Figshare (see DNA Depositionand Data Availability sections) Raw sequence reads have also been deposited in the NCBISequence Read Archive under accession number PRJNA553535

RESULTSTaxonomic identification of soil microbial communities associatedwith the roots of Norway and sugar maplesDue to a contamination with one of the forward primers used all 10 samples from the Junesampling date were removed from the analysis and we did not obtain any sequences fromone Norway maple sampled on July 11th From the remaining 69 samples we obtained atotal of 207280 bacterial sequences after quality trimming and the removal of chimerasOnce all OTUs with fewer than 10 sequences were removed and the dataset was rarefiedto 1000 sequences per sample a total of 66 samples and 1077 OTUs remained and wereused in the analyses A total of 18 bacterial phyla were detected from the maple roots andthese 18 phyla were further classified into 47 bacterial orders with 12 having an abundanceof over 1 (Fig 1A) Approximately 16 of the OTUs were not identified to order

A total 256 389 fungal (ITS) sequences were obtained after quality trimming and theremoval of chimeras When all OTUs with fewer than 10 sequences were removed andthe dataset was rarefied to 1000 sequences per sample a total of 75 samples were includedin the analyses and the remaining sequences clustered into 474 OTUs The majority ofOTUs were Basidiomycota 502 followed by Ascomycota 311 Glomeromycota 43Zygomycota 17 and 127 were unidentified at phylum level The OTUs were classifiedinto 40 orders with 11 having a relative abundance of over 1 (Fig 1B)

Using the AMF specific primers we obtained sequences from 79 of the 80 samplesA total of 166 403 sequences were obtained after quality trimming and the removal ofchimeras Once all OTUs with fewer than 10 sequences were removed and the datasetwas rarefied 800 a total of 76 samples were included in the analyses and the remainingsequences clustered into 199 OTUs The relative abundance of the AMF OTUs classifiedto family level was similar for both host species (Fig 1C)

Quantification of differences in the composition of soil microbialcommunities associated with the roots of Norway and sugar maplesWe found that the composition of bacterial and fungal communities associated withthe roots of Norway and sugar maple were distinct from each other while the AMFcommunities were not distinguishable based on plant host (Fig 2 Table 1) Host speciesexplained 36 of the variation in root bacterial and 84 of the variation for the fungalcommunity structure Sampling date explained 36 of the total variation in the bacterial

DeBellis et al (2019) PeerJ DOI 107717peerj7295 825

Figure 1 Relative abundance () of the main taxa detected among the microbial communities in theroots of Norway and sugar maple (A) Bacterial communities (Order) (B) Fungi ITS (Order) (C) AMF(Family level) The stacked bar graphs represent the overall relative abundance across the entire dataset

Full-size DOI 107717peerj7295fig-1

DeBellis et al (2019) PeerJ DOI 107717peerj7295 925

Figure 2 Plots of (A) Bacterial (B) Fungal and (C) AMF communities associated with the roots ofsugar and Norwaymaples based on 16S ITS and 18S regions (respectively) using NMDS scalingOr-dinations based on BrayndashCurtis distances among samples Ellipses indicate 2 standard deviations aroundsamples from each host species Stress values for bacterial fungal and AMF ordinations are 017 in 2Dspace 017 and 019 in 3D space respectively

Full-size DOI 107717peerj7295fig-2

DeBellis et al (2019) PeerJ DOI 107717peerj7295 1025

Table 1 Microbial community structure variation amongmaple roots explained by various factors(PERMANOVA on BrayndashCurtis dissimilarities) P-values are based on 999 permutations

BrayndashCurtis dissimilarities

Microbial Community Variable R2 () Pr (gtF)

Bacteria Species 36 001Date 36 003SpeciesDate 17 204

Fungi Species 84 001Date 18 084SpeciesDate 12 519

AMF Species 15 349Date 06 979SpeciesDate 12 576

communities and had no significant effect on the variation in the fungal communities(Table 1)

We also found significant differences in the relative abundance of particular OTUsbetween the native and invasive speciesManyOTUs from eachmicrobial groupwere foundin both maple species with plant hosts sharing 954 656 and 83 of all bacterialfungal and AMF OTUs respectively However when we compared OTU abundancebetween species using ANCOM (Mandal et al 2015) we found three bacterial and 10fungal (ITS) OTUs whose abundances differed significantly between the sugar and Norwaymaples (P lt 005 Fig 3) All three bacterial OTUs and nine of the 10 fungal OTUs hadsignificantly higher abundance in sugar maple compared to Norway maple (Fig 3) Theten fungal OTUs that varied significantly in abundance between maple species represent121 of the relative sequence abundance in Norway maple and 397 of the sequencesin sugar maple The nine fungal OTUs that were found in significantly greater abundancesin sugar maple accounted for 37 of its total OTU relative abundance compared to only66 in Norway maple The three differentially abundant bacterial OTUs represent 72and 150 of the relative sequences in Norway maple and sugar maple respectively

Only 8 out of the 25 most commonly occurring OTUs could be classified to a functionalgroup using FUNGuild with the remaining left unidentified These 25 OTUsmade up 74of the relative OTU abundance in Norway maple and 82 in sugar maple Only two OTUfunctional guild classifications were ranked as highly probable and both were categorizedas symbiotic ectomycorrhizal fungi Four OTUs were ranked as probable and two possibleThese six OTUs were either classified as solely saprotrophs or another category whichincluded saprotrophs symbionts and pathogens The top two fungal OTUs with higherabundances in sugar maple (Fig 3 Didymosphaeriaceae and Entoloma sp) were classifiedas saprotroph-symbiont-pathogen with Didymosphaeriaceae having the lsquoprobablersquo ratingand Entoloma sp lsquopossiblersquo These two OTUs made up 308 and 52 of the OTU relativeabundance in sugar and Norway maple respectively

DeBellis et al (2019) PeerJ DOI 107717peerj7295 1125

Figure 3 Boxplots of median bacterial (A) and fungal (B) taxa that differed significantly in abundanceamongmaple species (ANCOM P lt 005) Whiskers represent interquartile range (IQR)times15

Full-size DOI 107717peerj7295fig-3

DeBellis et al (2019) PeerJ DOI 107717peerj7295 1225

Quantification of differences in the richness of soil microbialcommunities on the roots of Norway and sugar maplesBacterial OTU richness was significantly higher in Norway maple (28823 plusmn SE 487)compared to sugar maple (25174 plusmn SE 529 t -test P lt 0001) The same pattern wasseen with the fungi with Norway maple having an OTU richness of 5472 plusmn SE 276 andsugar maple 4597 plusmn SE 236 (t -test P = 002) AMF OTU richness did not differ betweenspecies Norway maple had an OTU richness of 2887 plusmn SE 158 and sugar maple AMFOTU richness was 2794 plusmn SE 208 (t -test P = 072)

Quantification of differences in colonization rates of AMF and DSEon the roots of Norway and sugar maplesOverall therewas no significant effect ofmaple species on total AMF colonization (ANOVAF164= 024 P = 062) Total AMF colonization rates were equally high in both Norwaymaple and sugar maples with an average of 811 and 80 respectively However date(F764 = 2209 P lt 0001) and the interaction between species and date (F764 = 294P = 001) was significant

Therewas no significant effect ofmaple species on the abundance of arbuscules (ANOVAF164 = 0206 P = 0651) and vesicles (F164 = 0029 P = 0865) The abundance ofvesicles was low with an average of 2 and 21 for the Norway and sugar maplesrespectively (Fig 4A) while the abundance of arbuscules was similar and quite high in theNorway and sugar maples with an average abundance of 779 and 766 respectively(Fig 4B) However the effect of date on the abundance of arbuscules and vesicles wassignificant (F764= 2996 P = 0006 and F764= 916 P lt 0001 respectively) There wasalso a significant interaction effect between maple species and date on the abundanceof arbuscules (F764 = 3152 P = 0006) but not for vesicle abundance (F779 = 128P = 0274) No differences in vesicle and arbuscule colonization levels were detectedbetween maples species at any of the eight sampling dates (Tukey post-hoc test P gt 005)

Therewas a significant effect ofmaple species and date on the colonization of dark septateendophytes (ANOVA species F164= 2556 P lt 0001 date F764= 586 P lt 0001) butthe interaction term was not significant (F764 = 210 P = 006) The average rate ofcolonization of dark septate endophytes in the Norway maple and sugar maple was 165and 334 respectively (Fig 4C) DSE were significantly more abundant in the sugarmaple compared to Norway maple on August 28 and September 13 (Tukey post-hoc testP lt 005 Fig 4C)

Chemical analysis of the soil surrounding the Norway and Sugarmaple rootsThere were no significant differences in any of the measured soil chemical parametersamong species and sampling dates (ANOVA tests all P gt 005) The only significanteffect observed was the interaction term of species and date with CN ratio (P = 004)CN ratio decreased with time for Norway maple but slightly increased for sugar mapleANOVA results and chemical analyses of the soil data set can be found in the SupplementalInformation

DeBellis et al (2019) PeerJ DOI 107717peerj7295 1325

Figure 4 Percent root colonization of mycorrhizal and dark septate endophytes in the Norway maple(Norway) and sugar maple (Sugar) throughout the sampling period (meanplusmn SE) (A) Vesicular col-onization percent of root length containing mycorrhizal vesicles (B) Arbuscular colonization percentof root length containing arbuscules (C) Dark septate endophyte colonization percent of root lengthcontaining dark septate fungi Symbols above bars indicate a significance difference (P lt 005) betweenspecies at the specified sampling date based on the two-way ANOVA and Tukey post-hoc test

Full-size DOI 107717peerj7295fig-4

DeBellis et al (2019) PeerJ DOI 107717peerj7295 1425

DISCUSSIONWe examined the community composition of different groups of microbes simultaneouslyfrom the roots of Norway maple and sugar maple and we show that soil microbialcommunities associate differently with host species Our findings are consistent with thebody of evidence showing that plant species identity can influence soil bacterial and fungalcommunities (Haichar et al 2008 Berg amp Smalla 2009 Leff et al 2018 Linde et al 2018)We observed small but significant differences in microbial communities between thesetwo co-occurring maple species albeit other work has suggested that closely related plantstend to share microbial communities (Gilbert amp Webb 2007 Wehner et al 2014 Johansenet al 2016) and time since invasion can diminish the impact of an invasive plant on thecommunities of soil microbes (Lankau 2011)

Although host species has been shown to be an important factor shaping root associatedmicrobes numerous other factors also influence their community composition The mostabundant bacterial phyla in the maple roots were Proteobacteria and Actinobacteria Thisis in agreement with a study byWallace Laforest-Lapointe amp Kembel (2018) who examinedmicrobes from roots and leaves of sugar maple seedings collected from a national parkin eastern Quebec using similar methods Proteobacteria and Actinobacteria were themost prevalent bacterial root endophytes in their samples with Actinobacteria beingan indicator taxon for the root compartment However there are distinct differences inthe distribution of the dominant fungal taxa between our study and Wallace Laforest-Lapointe amp Kembel (2018) The main fungal taxa we observed in the sugar maples wereAscomycota (527) and Basidiomycota (417) while the dominant fungal taxonreported by Wallace Laforest-Lapointe amp Kembel (2018) is Zygomycota (464) followedby Ascomycota (401) and they report relatively little Basidiomycota (124) Some ofthe variation observed between the two studies may be attributed to time of sampling andsite Wallace Laforest-Lapointe amp Kembel (2018) only sampled once in the month of Julyand we sampled every two weeks from June to October for a total of 8 sampling periodsThe multiple sampling periods may give a better overall representation of the fungi onthe maple roots However date was not a significant factor explaining the variation of thefungal communities in our study (Table 1) Site differences may also be an important factorexplaining for variation in fungal communities An obvious site difference between ourstudy and that of Wallace Laforest-Lapointe amp Kembel (2018) is that we sampled at a sitewhere Norwaymaple has been present for over 50 years with a high recruitment of Norwaymaple seedlings therefore the soil microbes at our sampling location may be conditionedby its presence The microbial assessment of maples at several locations would have to becompared in order to assess how much of the variation in fungal communities in sugarmaples is a result of the presence of neighbouring Norway maples and other inter-sitevariations

We detected higher bacterial and fungal richness on Norway maple compared to sugarmaple which may benefit the invasion process Legumes that are able to associate withmore bacterial species can successfully establish into new ranges compared to legumesthat associate with a lower diversity of taxa (Harrison et al 2018) Toole et al (2018)

DeBellis et al (2019) PeerJ DOI 107717peerj7295 1525

found higher fungal OTU richness in rhizosphere soils of Norway maple compared tosugar maple however they correlated fungal richness to plant weediness and not solelyby the plantrsquos invasive status In their study both the native and weedy red maple andinvasive weedy Norway maple had a higher fungal richness than native non-weedy sugarmaple and Japanese Maple (A palmatum Thunb) an introduced non-weedy plant hencenon-invasive species More field sites and plant species would need to be sampled in orderto determine if increased richness in root associated microbial communities is a commontrend for range expanding species

We observed high AMF colonization rates in the roots of Norway maple demonstratingits ability to effectively tap into the established native AMF networkWe did not observe anydifferences in AMF community structure colonization rates or arbuscule to vesicle ratiobetween host species This was somewhat contrary to what we predicted but it does indicatethat Norway maple is not hindered by a lack of suitable AMF in the introduced rangeMoreover it is possible that Norway maple derives more benefit from these associationswith native AMF than does the sugar maple Klironomos (2003) has shown that AMF canhave different impacts on different plant species An AMF survey by Oumlpik et al (2009)showed that AMF specificity is more likely to occur at the level of ecological group ratherthan at the species level The similarities in AMF communities between host species may beexplained by the fact that we two maple species collected from a single location observedno significant difference in soil chemistry surrounding the maple roots and plants grownin close proximity can share mycorrhizal networks (Van der Heijden amp Horton 2009) Ourresults agree with other analyses of AMF in natural communities that have revealed thatwidely distributed AMF tend to associate with widely distributed habitat generalist plants(Oumlpik et al 2009) and associating with generalist symbionts is proposed as a strategy forinvasive plant species to avoid mutualism limitation in its novel range (Moora et al 2011Nuntildeez amp Dickie 2014)

Using morphological assessment of the root fungi we found higher abundance ofdark septate endophytes (DSE) on sugar maple compared to Norway maple DSE area group of ubiquitous ascomycete fungal root colonizers grouped together based onmorphological characteristics (Jumpponen amp Trappe 1998 Newsham 2011 Mandyam ampJumpponen 2015) Despite the global distribution of DSE their ecological role is still notwell understood and ranges from beneficial to pathogenic (Jumpponen 2001) DSE arenot a taxon therefore this range of ecological roles most likely results from the varioustaxa belonging to several orders of the phylum Ascomycota that are included in thisgroup (Jumpponen amp Trappe 1998 Newsham 2011 Porras-Alfaro et al 2014) Of the ninefungal OTUs that had significantly higher abundances in sugar maple four belong to theorder Pleosporales an order belonging to the DSE group (Jumpponen amp Trappe 1998)Although the ecological function of DSE is not well understood and historically they havepredominately been considered benign studies have reported negative effects of rootDSE in tree species (Wilcox amp Wang 1987 Tellenbach Gruumlnig amp Sieber 2011 MayerhoferKernaghan amp Harper 2013) Furthermore Tellenbach Gruumlnig amp Sieber (2011) not onlyshowed that DSE had pathogenic effects but also showed that virulence was positivelycorrelated with the extent of fungal colonization Therefore if DSE do negatively impact

DeBellis et al (2019) PeerJ DOI 107717peerj7295 1625

maple species we observed lower levels of DSE in Norway Maple roots compared to sugarmaple providing support for a possible reduced soil enemy effect in the invasive mapleWe did observe that certain fungal OTUs were more abundant on the roots of sugar maplerelative to Norway maple unfortunately the FUNGuild results did not provide strongevidence for the pathogenicity of these fungi Whether DSE do have negative effects onthe maple species will need to be verified experimentally since we could not quantify thefunctional role of DSE in this particular study system

CONCLUSIONSHere we quantified the community composition of three microbial groups on the rootsof Norway maple and sugar maple and showed that the bacterial and fungal communitiesvaried between the two species but no differences were found with AMF Consequentlyin order to obtain a full picture of the differences in root associated microbes betweenhost species an assessment of the various microbial taxa is required Specific microbescan have different impacts on different plant host and specific plant-microbe associationscan affect plant coexistence (Bever 2003) therefore our observed patterns suggest apotential for belowground biotic interactions playing a role in Norway maplersquos invasion inNorth American temperate forests Future work will be required to assess the functionalcapabilities of these microbes to determine their roles on the different maple species Thefact that we did observe differences in root microbes between the two species highlights theneed to consider diverse microbial taxa when assessing the role of plant-soil interactionsin the context of plant invasions

ACKNOWLEDGEMENTSWe gratefully acknowledge Victoria Pompa for her field assistance and for themorphological analysis of the roots We also thank Evan Wisdom-Dawson RichardCalveacute Alana Di Vito Sean Di Paolo who helped with the seedling collection andorroot washing and Geneviegraveve Lajoie for providing comments to an earlier version of thismanuscript We also would like to thank Mary-Ann Pavlik Anne Godbout Jim Fyles fromthe Morgan Arboretum for their help at the Arboretum and permission to use the site

ADDITIONAL INFORMATION AND DECLARATIONS

FundingThis researchwas supportedwith funding by the Fonds deRecherche duQueacutebecmdashNature etTechnologies (FRQNT) (Tonia DeBellis) the Natural Sciences and Engineering ResearchCouncil of Canada (NSERC) (Steven W Kembel and Jean-Philippe Lessard) and theCanada Research Chairs program (Steven W Kembel) The funders had no role in studydesign data collection and analysis decision to publish or preparation of the manuscript

Grant DisclosuresThe following grant information was disclosed by the authors

DeBellis et al (2019) PeerJ DOI 107717peerj7295 1725

Fonds de Recherche du QueacutebecmdashNature et Technologies (FRQNT) (Tonia DeBellis)Natural Sciences and Engineering Research Council of Canada (NSERC)Canada Research Chairs program

Competing InterestsThe authors declare there are no competing interests

Author Contributionsbull Tonia DeBellis conceived and designed the experiments performed the experimentsanalyzed the data contributed reagentsmaterialsanalysis tools prepared figures andortables authored or reviewed drafts of the paper approved the final draftbull Steven W Kembel and Jean-Philippe Lessard conceived and designed the experimentscontributed reagentsmaterialsanalysis tools authored or reviewed drafts of the paperapproved the final draft

DNA DepositionThe following information was supplied regarding the deposition of DNA sequences

De Bellis Tonia (2019) 2017 BACTERIAseqsfna figshare Dataset httpsdoiorg106084m9figshare7650104v1

DeBellis Tonia (2019) 2017 FUNGIseqsfna figshare Dataset httpsdoiorg106084m9figshare7650134v1

De Bellis Tonia (2019) 2017 MYCORRHIZAEseqsfna Dataset httpsdoiorg106084m9figshare7650137v1

DNA sequences are also available on the NCBI Sequence Read Archive SRA accessionPRJNA553535

Data AvailabilityThe following information was supplied regarding data availability

De Bellis Tonia (2019) 2017-MYCORRHIZAEmetadatatxt figshare Datasethttpsdoiorg106084m9figshare7650095v1

De Bellis Tonia (2019) 2017-FUNGImetadatatxt figshare Dataset httpsdoiorg106084m9figshare7650080v1

De Bellis Tonia (2019) 2017-BACTERIAmetadatatxt figshare Dataset httpsdoiorg106084m9figshare7650074v2

De Bellis Tonia (2019) 2017 Maple Soil chemistryxlsx figshare Dataset httpsdoiorg106084m9figshare7650143v1

Supplemental InformationSupplemental information for this article can be found online at httpdxdoiorg107717peerj7295supplemental-information

REFERENCESAleklett K Leff JW Fierer N Hart M 2015Wild plant species growing closely con-

nected in a subalpine meadow host distinct root-associated bacterial communitiesPeerJ 3e804 DOI 107717peerj804

DeBellis et al (2019) PeerJ DOI 107717peerj7295 1825

AndersonMJ 2001 A new method for non-parametric multivariate analysis of varianceAustral Ecology 2632ndash46 DOI 101111j1442-9993200101070ppx

Bellard C Cassey P Blackburn TM 2016 Alien species as a driver of recent extinctionsBiology Letters 1224ndash27 DOI 101098rsbl20150623

Berg G Rybakova D GrubeM Koumlberl M 2016 The plant microbiome exploredimplications for experimental botany Journal of Experimental Botany 67995ndash1002DOI 101093jxberv466

Berg G Smalla K 2009 Plant species and soil type cooperatively shape the structure andfunction of microbial communities in the rhizosphere FEMS Microbiology Ecology681ndash13 DOI 101111j1574-6941200900654x

Bever JD 2003 Soil community feedback and the coexistence of competitorsconceptual frameworks and empirical tests New Phytologist 157465ndash473DOI 101046j1469-8137200300714x

Brundrett MC Picheacute Y Peterson RL 1984 A new method for observing themorphology of vesicular-arbuscular mycorrhizae Botany 622128ndash2134DOI 101139b84-290

Bunn RA Lekberg Y Gallagher C Rosendahl S Ramsey PW 2014 Grassland invadersand their mycorrhizal symbionts a study across climate and invasion gradientsEcology and Evolution 4794ndash805 DOI 101002ece3917

Bunn RA Ramsey PW Lekberg Y 2015 Do native and invasive plants differ in theirinteractions with arbuscular mycorrhizal fungi A meta-analysis Journal of Ecology1031547ndash1556 DOI 1011111365-274512456

Callaway RM Thelen GC Rodriguez A HolbenWE 2004 Soil biota and exotic plantinvasion Nature 427731ndash733 DOI 101038nature02322

Caporaso JG Kuczynski J Stombaugh J Bittinger K Bushman FD Costello EKFierer N Pentildea AG Goodrich JK Gordon JI Huttley GA Kelley ST Knights DKoenig JE Ley RE Lozupone CA Mcdonald D Muegge BD PirrungM ReederJ Sevinsky JR Turnbaugh PJ WaltersWAWidmann J Yatsunenko T Zaneveld JKnight R 2010 QIIME allows analysis of high- throughput community sequencingdata Intensity normalization improves color calling in SOLiD sequencing NatureMethods 7335ndash336 DOI 101038nmeth0510-335

Chelius MK Triplett EW 2001 The diversity of archaea and bacteria in association withthe roots of Zea mays LMicrobial Ecology 41252ndash263 DOI 101007s002480000087

CookeMAWidden P Halloran IO 1992Morphology incidence and fertilizationeffects on the vesicular-arbuscular mycorrhizae of Acer saccharum in a QuebecHardwood ForestMycologia 84422ndash430 DOI 10108000275514199212026156

Davison J MooraM OumlpikM Adholeya A Ainsaar L Bacirc A Burla S Diedhiou AGHiiesalu I Jairus T Johnson NC Kane A Koorem K Kochar M Ndiaye CPaumlrtel M Reier Uuml Saks Uuml Singh R Vasar M Zobel M 2015 Global assessmentof arbuscular mycorrhizal fungus diversity reveals very low endemism Science349970ndash973 DOI 101126scienceaab1161

DeSantis TZ Hugenholtz P Larsen N Rojas M Brodie EL Keller K Huber T DaleviD Hu P Andersen GL 2006 Greengenes a chimera-checked 16S rRNA gene

DeBellis et al (2019) PeerJ DOI 107717peerj7295 1925

database and workbench compatible with ARB Applied and Environmental Micro-biology 725069ndash5072 DOI 101128AEM03006-05

Dickie IA Bufford JL Cobb RC Desprez-LoustauML Grelet G Hulme PEKlironomos J Makiola A NuntildeezMA Pringle A Thrall PH Tourtellot SGWallerL Williams NM 2017 The emerging science of linked plantmdashfungal invasions NewPhytologist 2151314ndash1332 DOI 101111nph14657

Dumbrell AJ Ashton PD Aziz N Feng G NelsonM Dytham C Fitter AH Hel-gason T 2011 Distinct seasonal assemblages of arbuscular mycorrhizal fungirevealed by massively parallel pyrosequencing New Phytologist 190794ndash804DOI 101111j1469-8137201003636x

Ehrenfeld JG 2010 Ecosystem consequences of biological invasions Annual Review ofEcology Evolution and Systematics 4159ndash80DOI 101146annurev-ecolsys-102209-144650

Elton C 1958 The ecology of invasions by animals and plants London MethuenGalbraith-Kent SL Handel SN 2008 Invasive Acer platanoides inhibits native sapling

growth in forest understorey communities Shannon Journal of Ecology 96293ndash302DOI 101111j1365-274520070

Gardes M Bruns TD 1993 ITS primers with enhanced specificity for basiodi-omycetespdfMolecular Ecology 2113ndash118 DOI 101111j1365-294X1993tb00005x

Gilbert GSWebb CO 2007 Phylogenetic signal in plant pathogen-host rangeProceedings of the National Academy of Sciences of the United States of America1044979ndash4983 DOI 101073pnas0607968104

Haichar FEZ Marol C Berge O Rangel-Castro JI Prosser JI Balesdent J HeulinT AchouakW 2008 Plant host habitat and root exudates shape soil bacterialcommunity structure ISME Journal 21221ndash1230 DOI 101038ismej200880

Harrison TL Simonsen AK Stinchcombe JR FredericksonME 2018More partnersmore ranges generalist legumes spread more easily around the globe Biology Letters1420180616 DOI 101098rsbl20180616

Inderjit Van der PuttenWH 2010 Impacts of soil microbial communities on exoticplant invasions Trends in Ecology and Evolution 25512ndash519DOI 101016jtree201006006

Johansen RB Johnston P Mieczkowski P Perry GLW RobesonMS Burns BRVilgalys R 2016 A native and an invasive dune grass share similar patchilydistributed root-associated fungal communities Fungal Ecology 23141ndash155DOI 101016jfuneco201608003

Jumpponen A 2001 Dark septate endophytesmdashare they mycorrhizalMycorrhiza11207ndash211 DOI 101007s005720100112

Jumpponen A Trappe JM 1998 Dark septate endophytes a review of facultativebiotrophic root-colonizing fungi New Phytologist 140295ndash310DOI 101046j1469-8137199800265x

Kotildeljalg U Larsson KH Abarenkov K Nilsson RH Alexander IJ Eberhardt U Erland SHoslashiland K Kjoslashller R Larsson E Pennanen T Sen R Taylor AFS Tedersoo L Vraringl-stad T Ursing BM 2005 UNITE a database providing web-based methods for the

DeBellis et al (2019) PeerJ DOI 107717peerj7295 2025

molecular identification of ectomycorrhizal fungi New Phytologist 1661063ndash1068DOI 101111j1469-8137200501376x

Keane RM Crawley MJ 2002 Exotic plant invasions and the enemy release hypothesisTrends in Ecology and Evolution 17164ndash170 DOI 101016S0169-5347(02)02499-0

Kembel SW Cowan PD HelmusMR Cornwell WKMorlon H Ackerly DD BlombergSPWebb CO 2010 Picante R tools for integrating phylogenies and ecologyBioinformatics 261463ndash1464 DOI 101093bioinformaticsbtq166

Klironomos JNN 1995 Arbuscular Mycorrhizae of Acer saccharum in different soiltypes Canadian Journal of Botany 731824ndash1830 DOI 101139b95-193

Klironomos JN 2003 Variation in plant response to native and exotic arbuscularmycorrhizal fungi Ecology 842292ndash2301 DOI 10189002-0413

Kloeppel BD AbramsMD 1995 Ecophysiological attributes of the Native Acersaccharum and the Exotic Acer platanoides in Urban Oak Forests in PennsylvaniaUSA Tree Physiology 15739ndash746 DOI 101093treephys1511739

Knapp DG Pintye A Kovaacutecs GM 2012 The dark side is not fastidiousmdashdark septateendophytic fungi of native and invasive plants of semiarid sandy areas PLOS ONE71ndash8 DOI 101371journalpone0032570

Laforest-Lapointe I Messier C Kembel SW 2016Host species identity site and timedrive temperate tree phyllosphere bacterial community structureMicrobiome41ndash10 DOI 101186s40168-016-0174-1

Lankau RA 2011 Resistance and recovery of soil microbial communities in the face ofAlliaria petiolata invasions New Phytologist 189536ndash548DOI 101111j1469-8137201003481x

Lee J Lee S Young JPW 2008 Improved PCR primers for the detection and identifi-cation of arbuscular mycorrhizal fungi FEMS Microbiology Ecology 65339ndash349DOI 101111j1574-6941200800531x

Leff JW Bardgett RDWilkinson A Jackson BG PritchardWJ De Long JR Oakley SMason KE Ostle NJ Johnson D Baggs EM Fierer N 2018 Predicting the structureof soil communities from plant community taxonomy phylogeny and traits ISMEJournal 121794ndash1805 DOI 101038s41396-018-0089-x

Linde S Van Der Suz LM Orme CDL Cox F Andreae H Asi E Atkinson B BenhamS Carroll C Cools N Vos De B Dietrich H Eichhorn J Titeux H VanguelovaE Verstraeten A Vesterdal L Waldner PWijk S Zhang Y 2018 Environmentand host as large-scale controls of ectomycorrhizal fungi Nature 558243ndash248DOI 101038s41586-018-0189-9

Lockwood JL Hoopes MF Marchetti MP 2007 Invasion ecology Oxford Wiley-Blackwell

Mandal S Van TreurenWWhite RA EggesboslashM Knight R Peddada SD 2015 Analy-sis of composition of microbiomes a novel method for studying microbial composi-tionMicrobial Ecology in Health amp Disease 261ndash7 DOI 103402mehdv2627663

MandyamKG Jumpponen A 2015Mutualism-parasitism paradigm synthe-sized from results of root-endophyte models Frontiers in Microbiology 51ndash13DOI 103389fmicb201400776

DeBellis et al (2019) PeerJ DOI 107717peerj7295 2125

Marler MJ Zabinski CAWojtowicz T Callaway RM 1999Mycorrhizae and fine rootdynamics of Centaurea maculosa and native bunchgrasses in western MontanaNorthwest Science 73217ndash224

Martin PH 1999 Norway maple (Acer platanoides) invasion of a natural forest standunderstory consequence and regeneration pattern Biological Invasions 1215ndash222DOI 101023A1010084421858

Mayerhofer MS Kernaghan G Harper KA 2013 The effects of fungal root endophyteson plant growth a meta-analysisMycorrhiza 23119ndash128DOI 101007s00572-012-0456-9

McGonigle TP Miller MH Evans DG Fairchild GL Swan JA 1990 A new methodwhich gives an objective measure of colonization of roots by vesicular- arbuscularmycorrhizal fungi New Phytologist 115495ndash501DOI 101111j1469-81371990tb00476x

Meiners SJ 2005 Seed and seedling ecology of acer saccharum and acer platanoides acontrast between native and exotic congeners Northeastern Naturalist 1223ndash32DOI 1016561092-6194(2005)012[0023SASEOA]20CO2

MooraM Berger S Davison J OumlpikM Bommarco R Bruelheide H Kuumlhn I KuninWE Metsis M Rortais A Vanatoa A Vanatoa E Stout JC TruusaMWestphalC Zobel MWalther GR 2011 Alien plants associate with widespread generalistarbuscular mycorrhizal fungal taxa evidence from a continental-scale studyusing massively parallel 454 sequencing Journal of Biogeography 381305ndash1317DOI 101111j1365-2699201102478x

NewshamKK 2011 A meta-analysis of plant responses to dark septate root endophytesNew Phytologist 190783ndash793 DOI 101111j1469-8137201003611x

Nguyen NH Song Z Bates ST Branco S Tedersoo L Menke J Schilling JS KennedyPG 2016 FUNGuild an open annotation tool for parsing fungal communitydatasets by ecological guild Fungal Ecology 20241ndash248DOI 101016jfuneco201506006

Nowak D Rowntree R 1990History and range of norway maple Journal of Arboricul-ture 16291ndash296

NuntildeezMA Dickie IA 2014 Invasive belowground mutualists of woody plants BiologicalInvasions 16645ndash661 DOI 101007s10530-013-0612-y

Oksanen J Blanchet FG Friendly M Kindt R Legendre P McGlinn D Minchin PROrsquoHara RB Simpson GL Solymos P Stevens MHH Szoecs E Wagner H 2017vegan community ecology package R package version 24-3 Available at httpsCRANR-projectorgpackage=vegan

OumlpikMMetsis M Daniell TJ Zobel M MooraM 2009 Large-scale parallel 454sequencing reveals host ecological group specificity of arbuscular mycorrhizal fungiin a boreonemoral forest New Phytologist 184424ndash437DOI 101111j1469-8137200902920x

OumlpikM Vanatoa A Vanatoa E MooraM Davison J Kalwij JM Reier Uuml Zobel M2010 The online database MaarjAM reveals global and ecosystemic distribution

DeBellis et al (2019) PeerJ DOI 107717peerj7295 2225

patterns in arbuscular mycorrhizal fungi (Glomeromycota) New Phytologist188223ndash241 DOI 101111j1469-8137201003334x

Packer A Clay K 2000 Soil pathogens and spatial patterns of seedling mortality in atemperate tree Nature 404278ndash281 DOI 10103835005072

Paquette A Fontaine B Berninger F Dubois K Lechowicz MJ Messier C Posada JMValladares F Brisson J 2012 Norway maple displays greater seasonal growth andphenotypic plasticity to light than native sugar maple Tree Physiology 321339ndash1347DOI 101093treephystps092

Porras-Alfaro A Raghavan S Garcia M Sinsabaugh RL Natvig DO Lowrey TK2014 Endophytic fungal symbionts associated with gypsophilous plants Botany92295ndash301 DOI 101139cjb-2013-0178

Pringle A Bever JD Gardes M Parrent JL Rillig MC Klironomos JN 2009Myc-orrhizal symbioses and plant invasions Annual Review of Ecology Evolution andSystematics 40699ndash715 DOI 101146annurevecolsys39110707173454

R Core Team 2013 R a language and environment for statistical computing Vienna RFoundation for Statistical Computing Available at httpswwwR-projectorg

Redford AJ Bowers RM Knight R Linhart Y Fierer N 2010 The ecology ofthe phyllosphere geographic and phylogenetic variability in the distribu-tion of bacteria on tree leaves Environmental Microbiology 122885ndash2893DOI 101111j1462-2920201002258x

Reinhart KO Anacker BL 2014More closely related plants have more distinct mycor-rhizal communities AoB Plants 61ndash10 DOI 101093aobplaplu051

Reinhart KO Callaway RM 2004 Soil biota facilitate exotic Acer invasions in Europeand North America Ecological Applications 14(6)1737ndash1745 DOI 10189003-5204

Reinhart KO Callaway RM 2006 Soil biota and invasive plants The New Phytologist170445ndash457 DOI 101111j1469-8137200601715x

Reinhart KO Greene E Callaway RM 2005 Effects of Acer platanoides invasionon understory plant communities and tree regeneration in the northern RockyMountains Ecography 28573ndash582 DOI 101111j20050906-759004166x

Reinhart KO Packer A Van Der PuttenWH Clay K 2003 Plant-soil biota interactionsand spatial distribution of black cherry in its native and invasive ranges EcologyLetters 61046ndash1050 DOI 101046j1461-0248200300539x

Reinhart KO Tytgat TOG Van der PuttenWH Clay K 2010 Virulence of soil-borne pathogens and invasions by Prunus serotina New Phytologist 186484ndash495DOI 101111j1469-8137200903159x

Richardson DM RejmaacutenekM 2011 Trees and shrubs as invasive alien speciesmdasha globalreview Diversity and Distributions 17788ndash809 DOI 101111j1472-4642201100782x

Rodriguez R Redman R 2008More than 400 million years of evolution and someplants still canrsquot make it on their own plant stress tolerance via fungal symbiosisJournal of Experimental Botany 591109ndash1114 DOI 101093jxberm342

Smith S Read D 2008Mycorrhizal Symbiosis London Academic PressTellenbach C Gruumlnig CR Sieber TN 2011 Negative effects on survival and perfor-

mance of Norway spruce seedlings colonized by dark septate root endophytes

DeBellis et al (2019) PeerJ DOI 107717peerj7295 2325

are primarily isolate-dependent Environmental Microbiology 132508ndash2517DOI 101111j1462-2920201102523x

Thomas CD Palmer G 2015 Non-native plants add to the British flora without negativeconsequences for native diversity Proceedings of the National Academy of Sciences ofthe United States of America 1124387ndash4392 DOI 101073pnas1423995112

Toole DR Cannon GH Brislawn CJ Graves JM Lamendella R Muth TR MuthNZ 2018 Differences in soil fungal assemblages associated with native andnon-native tree species of varying weediness Biological Invasions 20891ndash904DOI 101007s10530-017-1580-4

Uroz S Oger P Tisserand E Ceacutebron A Turpault MP BueeacuteM De BoerW Leveau JHJFrey-Klett P 2016 Specific impacts of beech and Norway spruce on the structureand diversity of the rhizosphere and soil microbial communities Scientific Reports61ndash11 DOI 101038srep27756

Van der HeijdenMGA Horton TR 2009 Socialism in soil the importance of myc-orrhizal fungal networks for facilitation in natural ecosystems Journal of Ecology971139ndash1150 DOI 101111j1365-2745200901570x

VanWees SC Van der Ent S Pieterse CM 2008 Plant immune responses trig-gered by beneficial microbes Current Opinion in Plant Biology 11443ndash448DOI 101016jpbi200805005

Vandenkoornhuyse P Quaiser A Duhamel M Le Van A Dufresne A 2015 The im-portance of the microbiome of the plant holobiont New Phytologist 2061196ndash1206DOI 101111nph13312

Veresoglou SD Rillig MC 2014 Do closely related plants host similar arbuscularmycorrhizal fungal communities A meta-analysis Plant and Soil 377395ndash406DOI 101007s11104-013-2008-2

Vilagrave M Espinar JL HejdaM Hulme PE Jarošiacutek V Maron JL Pergl J Schaffner USun Y Pyšek P 2011 Ecological impacts of invasive alien plants a meta-analysisof their effects on species communities and ecosystems Ecology Letters 14702ndash708DOI 101111j1461-0248201101628x

Wallace J Laforest-Lapointe I Kembel SW 2018 Variation in the leaf and rootmicrobiome of sugar maple (Acer saccharum) at an elevational range limit PeerJ6e5293 DOI 101103PhysRevB74094517

Webb SL Dwyer M Kaunzinger CKWyckoff PH 2000 The myth of the resilient forestcase study of the invasive Norway maple (Acer platanoides) Rhodora 102332ndash354

Wehner J Powell JR Muller LAH Caruso T Veresoglou SD Hempel S Rillig MC2014 Determinants of root-associated fungal communities within Asteraceae in asemi-arid grassland Journal of Ecology 102425ndash436 DOI 1011111365-274512197

Weiss S Xu ZZ Peddada S Amir A Bittinger K Gonzalez A Lozupone C ZaneveldJR Vaacutezquez-Baeza Y Birmingham A Hyde ER Knight R 2017 Normalizationand microbial differential abundance strategies depend upon data characteristicsMicrobiome 51ndash18 DOI 101186s40168-017-0237-y

DeBellis et al (2019) PeerJ DOI 107717peerj7295 2425

White TJ Bruns T Lee S Taylor J 1990 Amplification and direct sequencing of fungalribosomal RNA genes for phylogenetics In PCR protocols a guide to methods andapplications New York Academic Press 315ndash322

WickhamH 2009 ggplot2 elegant graphics for data analysis New York SpringerWidden P 2001 The use of glycerine jelly for mounting stained roots for the

observation and quantification of VAM fungiMycologia 931026ndash1027DOI 10108000275514200112063236

WilcoxWEWang CJK 1987 ECM and ECM associations of Phialophora finlandia withPibus resinosa Picea rubens and Betual alleghaniensis Canadian Journal of ForestResearch 17976ndash990 DOI 101139x87-152

Wolfe BE Klironomos JN 2005 Breaking new ground soil communities and exoticplant invasion Bioscience 55477ndash487DOI 1016410006-3568(2005)055[0477bngsca]20co2

Wyckoff PHWebb SL 1996 Understory influence of the invasive Norway maple (Acerplatanoides) Bulletin of the Torrey Botanical Club 123197ndash205DOI 1023072996795

Zhang J Kobert K Flouri T Stamatakis A 2014 PEAR a fast and accurate IlluminaPaired-End reAd mergeR Bioinformatics 30614ndash620DOI 101093bioinformaticsbtt593

DeBellis et al (2019) PeerJ DOI 107717peerj7295 2525