THE JOURNAL OF BIOLOGICAL CHEMISTRY 0 1992 by The American Society for Biochemistry and Molecular Biology, Inc.

Vol. 267, No. 12, Issue of April 25, pp. 827&8274,1992 Printed in U. S. A.

Sequence Requirements for Precursor Cleavage within the Constitutive Secretory Pathway*

(Received for publication, August 27, 1991)

Toshio Watanabe, Tsutomu Nakagawa, Jo Ikemizu, Masami Nagahama, Kazuo Murakami, and Kazuhisa NakayamaSQIl From the Institute of Amlied Biochemistry, PZnstitute of Biological Sciences, and §Gene Experiment Center, University of Tsukuba, Tsukuba, Ibaraki 305, Japan

- . .

We have recently demonstrated that the Arg-X-Lys/ Arg-Arg sequence is a signal for precursor cleavage catalyzed by furin, a mammalian homologue of the yeast precursor-processing endoprotease Kex2, within the constitutive secretory pathway. In this study, we further examined sequence requirements for the con- stitutive precursor cleavage by expression of various prorenin mutants with amino acid substitutions around the native Lys-Arg cleavage site in Chinese hamster ovary cells. The results delineate the following se- quence rules that govern the constitutive precursor cleavage. (a) A basic residue (Lys or Arg) at the 4th (position -4) or 6th (position -6) residue upstream of the cleavage site besides basic residues at positions -1 and -2 is necessary. (b) At position -2, a Lys residue is more preferable than Arg. (c ) At position -4, an Arg residue is more preferable than Lys. (d ) At position 1, a hydrophobic aliphatic amino acid is not suitable.

Endoproteolytic precursor cleavage is one of the key steps in the production of bioactive peptides. In neuroendocrine cells, many peptide hormones and neuropeptides are known to be produced from larger, biologically inactive precursors through cleavage at pairs of basic amino acids, primarily Lys- Arg and Arg-Arg, within the regulated secretory pathway (1- 5). However, many other secretory and membrane proteins have been thought to be produced from precursors through cleavage at multiple, rather than paired, basic amino acids within the constitutive secretory pathway in non-endocrine cells (6, 7). Recently, we have noticed that most of the constitutively processed precursors possess the consensus se- quence, Arg-X-Lys/Arg-Arg (RXK/RR), at the cleavage site, and we have also demonstrated, using native prorenin with a Lys-Arg pair and its mutant with an RXKR sequence, that the RXKR sequence functions as a precursor cleavage signal in non-endocrine cells (8). Moreover, we have demonstrated that precursor cleavage at the RXKR site in non-endocrine cells and that at the Lys-Arg pair in endocrine cells are catalyzed by two distinct endoproteases, furin and PC3 (also referred to as PCl), respectively (8,9); both furin (10-13) and

* This work was supported in part by grants from the Ministry of Education, Science and Culture of Japan, the University of Tsukuba Project Research, the Naito Foundation, the CIBA-GEIGY Founda- tion (Japan) for Promotion of Science, Sankyo Co. Ltd., and Chichibu Cement Co. Ltd. The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked "aduertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

11 To whom correspondence should be addressed Institute of Bio- logical Sciences, University of Tsukuba, Tsukuba, Ibaraki 305, Japan. Tel.: 298-53-6356 Fax: 298-53-6006.

PCl/PC3 (9,14,15) are mammalian homologues of the Kex2 protease of the yeast Saccharomyces cereuisiae which is in- volved in processing of pro-a-factor and prokiller toxin at dibasic sites (16-18).

In this study, we further examined sequence requirements for precursor cleavage within the constitutive secretory path- way by expression of various prorenin mutants with amino acid substitution(s) around the native Lys-Arg cleavage site in non-endocrine cells, Chinese hamster ovary (CHO)' cells.

EXPERIMENTAL PROCEDURES

Site-directed Mutagenesis and DNA Construction-A cDNA frag- ment covering the entire coding sequence of mouse Ren-2 (19) or human (20) preprorenin was subcloned behind the SV40 early pro- moter of the pSVD expression vector (20) as described previously (8, 21,22). Site-directed mutagenesis to substitute amino acid(s) around the Lys-Arg cleavage site of prorenin was performed using an appro- priate oligonucleotide primer in a previously described manner (23). The mutagenic primers used are listed in Table I. The M2R-4L', M2R-4V', M2R"F1, and M2R-4A' mutants were generated by muta- genesis of the M2R-4 cDNA using the M2L1, M2V1, M2F1, and M2A' primers, respectively. The HR-4S' and HR"%Y mutants were gener- ated by mutagenesis of the HR-4 and HR-6 cDNAs, respectively, using the HS' primer. Each mutant prorenin expression plasmid was constructed by exchanging the corresponding cDNA fragment of the native prorenin plasmid with the mutated fragment.

DNA Transfection and Immunological Identification of Renin Mol- ecules-CHOIDXB-11 cells at -70% confluence in a 35-mm dish were transfected with a prorenin expression plasmid (1.5 pg) using the CellPhect transfection kit (Pharmacia LKB Biotechnology Inc.). After 48 h of incubation, the transfected cells were labeled with 0.2 mCi/ml of EXPRE35S35S (a mixture of [35S]methionine and [36S] cysteine, Du Pont-New England Nuclear) for 10 h as described previously (8). The culture medium was then collected, immunopre- cipitated with anti-Ren-2 renin or anti-human renin antiserum, and analyzed by sodium dodecyl sulfate-polyacrylamide gel electrophore- sis followed by fluorography as described previously (8, 24). These experiments were performed at least twice to confirm the reproduci- bility of the data. When indicated, the efficiency of prorenin cleavage was estimated by densitometric scanning of bands of prorenin and renin in the resulting autoradiogram.

RESULTS

Mouse Ren-2 and human prorenins (schematically shown in Fig. 1) are cleaved at a Lys-Arg site within the regulated secretory pathway in endocrine cells, such as mouse pituitary AtT-PO cells (24-27), but not within the constitutive secretory pathway in non-endocrine cells, such as CHO cells (20, 28). However, we have recently demonstrated that a mutant (M2R-4) of Ren-2 prorenin with an Arg residue at the 4th residue upstream of the cleavage site (position -4) besides the basic pair Lys-'-Arg-' is cleaved in CHO cells (8) and in

' The abbreviation used is: CHO, Chinese hamster ovary.

8270

by guest on April 12, 2018

http://ww

w.jbc.org/

Dow

nloaded from

Sequence Requirements for Constitutive Precursor Cleavage TABLE I

Nucleotide sequences of mutagenic primers

8271

Substituted residues are indicated by italics, and sequences of restriction sites introduced (+) or removed (-) to "

facilitate identification of mutated cDNAs are underlined. Designation Sequence

- 1 0 -5 - 1 1 5 SerAlaGluTrpAspValPheThrLysArgSerSerLeuThrAspLeuIle

Ren-2 wild type AGTGCTGAATGGGACGTATTCACAAAGAGGTCTTCCTTGACTGATCTTATC M2R-4 (18 mer) GGGACGTACGCACAAAGA

+SplI M2R"Q-' (27 mer)

M2K-4Q-Z (33 mer)

M2R"R-' (33 mer)

M2K" (28 mer)

M2K-'R-* (33 mer)

ATGGGACGTACGCACACAGAGGTCTTC +SplI

AATGGGACGTCAAGACACAGAGATCTTCCTTGA +Aa tII +BgIII

GAATGGGACGTACGCACGCGTAGG-TC~CCTTG +SO11 +MluI GGGACGTAAAGACAAAGAGATCTTCCTT

+BglI I GAATGGGACGTAAAGACGCGTAGGTCTTCCTTG

+M1 uI M m 3 (19 mer) GACGTATT TCGAAAGAGGT

+NsDV M2R-5 (18 mer)

M2Ra6 (18 mer)

M2R-W4 (33 mer)

M2R-4R-3 (25 mer)

M2L' (20 mer)

AATGGGACCGATTCA~AA +AvaII

CTGAATGGGGTATTCA +HhaI

AATGGGACAGACGTACGAAGAGATCTTCCTTGA +SplI +Bgl I I

ATGGGACGTACGCAGAAAGAGGTCT +Spl I

AGAGGTTAAGCTTGACTGAT +Hind111

M2V' (21 mer) AGAGGGTAAGCTTGACTGATC +Hind111

M2F' (24 mer) AGAGGTmTCGTTAACTGATCTTA +HpaI

M2A' (21 mer) AGAGGGCTAGCTTGACTGATC +NheI

Human wild type HR" (28 mer)

HR-6 (19 mer)

HS' (18 mer)

- 10 -5 - 1 1 5 GlyProGluTrpSerGlnProMetLysArgLeuThrLeuGlyAsnThrThr GGTCCCGAGTGGAGCCAACCCATGAAGAGGCTGACACTTGGCAACACCACC GGTCCCGAATGGAGCCAACGCATGAAGA

CCCGAGTGGCGCCAACCCA "AvaI

+BbeI TGAAGAGG TCGACACTTG

+Sa 1 I

FIG. 1. Schematic representation of the structures of mouse Ren- 2 and human prorenins. Potential N - glycosylation sites of human prorenin are indicated by asterisks.

a Y

Propeptide I Renin

-42 -1 1

I 38 kDa - -42 kDa

Human -43 -1 1 340

other non-endocrine cells, such as BSC-40 and COS-7 cells.' cells, we have proposed that the RXK/RR sequence serves as By surveying the amino acid sequences around the cleavage a signal for precursor cleavage within the constitutive secre- site of a wide variety of precursors processed in non-endocrine tory pathway (8). To examine the role of each basic residue

within the consensus sequence in the constitutive precursor K. Nakayama, K. Hatsuzawa, M. Hosaka, and K. Murakami, cleavage, we expressed a series of Ren-2 Prorenin mutants,

unpublished results. shown in Fig. 2 A , in CHO cells, and analyzed the renin

by guest on April 12, 2018

http://ww

w.jbc.org/

Dow

nloaded from

8272

A

Sequence Requirements for Constitutive Precursor Cleavage

-1 -1 1, EWDVFTKR ' SSLT EWDVRTKR SSLT EWDVRTQR SSLT EWDVKTQR SSLT EWDVRTRR SSLT EWDVKTKR SSLT EWDVKTRR SSLT

n n

FIG. 2. The role of basic residues within the RXK/RR con- sensus sequence. A , amino acid sequences of the pertinent region of native and mutant mouse Ren-2 prorenins used are shown. The substituted residues are underlined. B , CHO cells transfected with the expression plasmid of native or mutant Ren-2 prorenin as shown in A were radiolabeled, and then the secreted renin molecules were analyzed as described under "Experimental Procedures."

molecules secreted into the culture medium in 10 h of incu- bation period in the presence of [3sSS]methionine; we chose this incubation period based on the data that cleavage effi- ciency of M2R-4 prorenin did not significantly change during the preliminarily examined incubation periods (2-24 h) (data not shown). As shown in Fig. 2B, prorenins which lack a basic residue either a t position -4 (native Ren-2) or at position -2 (M2R-4Q-' and M2K-4Q-2) were not cleaved in these cells, whereas those with basic residues a t all three positions (-4, -2, and -1) were cleaved although with different efficiencies; in the case of M2K-4R-2, the band of mature renin was detectable on a film derived from a longer exposure (data not shown), although barely detectable in this figure. The cleavage efficiencies of these prorenins estimated by densitometric scanning were: M2R-4 (-50%); M2RM4R-' (-30%); M2K-4 (-18%); M2K-4R-Z (-8%). These observations indicate that, for the constitutive precursor cleavage, all basic residues at positions -4, -2, and -1 are essential, an Arg residue a t position -4 is more preferable than Lys, and a Lys residue a t position -2 is more preferable than Arg.

We next examined the positional effects of an additional Arg residue on the constitutive precursor cleavage in CHO cells (Fig. 3). A Ren-2 prorenin mutant with an Arg residue at position -6 (M2R-') was cleaved although with a slightly lower efficiency (-30%) than that of the M2R-4 mutant. By contrast, other examined mutants with an Arg residue a t positions -3 (M2R-3) and -5 (M2R+) were not cleaved. These observations indicate that the basic residue at position -6 in concert with the basic pair can also function as a precursor cleavage signal within the constitutive secretory pathway.

Several constitutively processed precursors which we pre- viously examined (see Ref. 8) have a basic residue(s) a t position -5 or -3, or a t both, in addition to those a t positions -4, -2, and -1. To examine whether or not the presence of the basic residue at position -5 or -3 has an additive effect on the efficiency of the constitutive precursor cleavage, we expressed a series of mutant prorenins shown in Fig. 4A in CHO cells. As shown in Fig. 4B, the cleavage efficiencies of M2R-W4 and M2R-4R-3 (-50% each) were as high as that of M2R-4. These results indicate that the presence of basic residues only a t positions -4, -2, and -1 is sufficient for the constitutive precursor cleavage.

A -4 -1 + 1

Ren-2 EWDVFTKR SSLT ~213.3 EWDVFRKR SSLT

~ 2 ~ 4 EWDRFTKR SSLT M2R -4 EWDVBTKR SSLT

M2fT6 EWRVFTKR SSLT

B O C ? ? In rn

Prorenin L

Renin

FIG. 3. Positional effects of an additional Arg residue. A , amino acid sequences of the pertinent region of native and mutant mouse Ren-2 prorenins used are shown. The substituted residues are underlined. B, CHO cells transfected with the expression plasmid of native or mutant Ren-2 prorenin as shown in A were radiolabeled, and then the secreted renin molecules were analyzed as described under "Experimental Procedures."

A

~ 2 ~ 7 - 4 EWDVRTKR SSLT

-4 -1 + 1 Ren-2 EWDVFTKR SSLT

M2R -%-4 EWDRRTKR SSLT M2Rm4R3 E W D ~ ~ K R SSLT

Prorenin L - R - Q P

Renin / FIG. 4. Effects of an Arg res idue at position -3 or -5 in

addition to the RXKR sequence. A , amino acid sequences of the pertinent region of native and mutant mouse Ren-2 prorenins used are shown. The substituted residues are underlined. B, CHO cells transfected with the expression plasmid of native or mutant Ren-2 prorenin as shown in A were radiolabeled, and then the secreted renin molecules were analyzed as described under "Experimental Proce- dures.''

To examine whether or not the constitutive cleavage is specific for mouse Ren-2 prorenin, a human prorenin mutant with an RXKR (HR-4) or RXXXKR (HR-') sequence was also expressed in CHO cells (Fig. 5B). Unexpectedly, the cleavages of HR-4 and HR-' prorenins were undetectable; the heterogenous bands of human renin molecules were probably derived from the heterogeniety in glycosylation. By comparing the sequences around the cleavage site of Ren-2 and human prorenins (see Fig. 5 A ) , we focused upon an amino acid substitution next to the cleavage site, i.e. a t position 1, where Ren-2 and human prorenins have Ser and Leu residues, respectively, since genetic evidence and studies using site- directed mutagenesis have demonstrated that proalbumin mu- tants with a hydrophobic aliphatic amino acid (Leu, Ile, or Val) a t position 1 in place of the native Asp or Glu residue are not cleaved (29-31). Therefore, to examine the effects of the substitution at position 1 on the constitutive precursor cleavage, various mutants of Ren-2 and human prorenins shown in Fig. 5A were expressed in CHO cells (Fig. 5 , B and C). Mutant prorenins with a hydrophobic aliphatic amino acid a t position 1 (M2R-4L1, M2R-4V', HR-4, and HR-') were not cleaved, although they have the consensus cleavage signal. By contrast, other examined mutants with a non-hydrophobic aliphatic residue a t position 1 (M2R-4, M2R-4F', M2R-4A1, HR-4S', and HR"jS') were cleaved. Among these mutants,

by guest on April 12, 2018

http://ww

w.jbc.org/

Dow

nloaded from

Sequence Requirements for Constitutive Precursor Cleavage 8273

A -1 .. 4 ,

Human EWSQPMKR ' LTLG H R 4 EWSQRMKR LTLG HR'4S' EWSQRMKR STLG HFV6 EWRQPMKR LTLG HR% EWEQPMKR STLG

Ren-2 EWVDFTKR SSLT

M2R:, EWVDRTKR SSLT M2R- L EWVDBTKR CSLT ~ i 1 2 ~ 1 - 4 ~ EWVDBTKR VSLT ~ m - 4 ~ EWVDRTKR ESLT M2R-4A' EWVDBTKR ASLT

Prorenin

Renin / - 33

Prorenin L e = - - - r -

Renin FIG. 5. Effects of the residue at position 1. A , amino acid

sequences of the pertinent region of native human and mouse Ren-2 prorenins and their mutants used are shown. The substituted residues are underlined. B, CHO cells transfected with the expression plasmid of native or mutant human prorenin as shown in A were radiolabeled, and then the secreted renin molecules were analyzed as described under "Experimental Procedures." C, CHO cells transfected with the expression plasmid of native or mutant Ren-2 prorenin as shown in A were radiolabeled, and then the secreted renin molecules were analyzed as described under "Experimental Procedures."

that with a Phe residue a t position 1 (M2R-4F') was cleaved with less efficiency (-15%) than that of M2R-4 prorenin. These observations are similar to the data concerning cleavage efficiencies of proalbumin mutants in monkey kidney COS-1 cells (31) and indicate that a hydrophobic aliphatic residue at position 1 is not suitable for the precursor cleavage within the constitutive pathway.

DISCUSSION

It is well known that pairs of basic residues, primarily Lys- Arg and Arg-Arg, serve as precursor cleavage signals within the regulated secretory pathway. Moreover, we have recently shown that the RXK/RR sequence serves as a cleavage signal within the constitutive secretory pathway (8). The present study clearly delineates the following sequence rules that govern the constitutive precursor cleavage. (a) A basic residue at position -4 or -6 as well as basic residues at positions -1 and -2 are essential. ( b ) At position -2, a Lys residue is more preferable than Arg. (c) At position -4, an Arg residue is more preferable than Lys. ( d ) At position 1, a hydrophobic aliphatic residue is not suitable. The cleavage site sequences of most of constitutively processed precursors which we have previously examined (see Ref. 8) fit the above rules. Among them, the cleavage site sequence of proalbumin fits these revised rules but not the RXK/RR rule presented previously (8). Compatible with the present data are the facts that proalbumin processing is catalyzed by a Kex2-like protease of liver Golgi membranes (32), and that furin can cleave coex-

pressed proalbumin in COS-1 cells (33). Among the above rules, rule d is noteworthy, since, until

recently, the residue after the dibasic cleavage site has not been given attention to. However, Brennan et al. (29) have recently identified a new genetic variant of human proalbumin (proalbumin Blenheim). It has a substitution of Asp' to Val, and is secreted from hepatocytes into circulation 'as an un- processed form despite retaining the intact dibasic sequence at the cleavage site. Moreover, Oda et al. (31) have elegantly demonstrated that rat proalbumin mutants with a hydropho- bic aliphatic residue (Leu, Val, or Ile) at position 1 are not cleaved in COS-1 cells when expressed using gene transfer techniques, although the native precursor with a Glu residue is cleaved efficiently, and another mutant with a Phe residue is cleaved with about half the efficiency of the native precur- sor. Our present data extend the rules observed in the case of proalbumin to more general ones. Indeed, none of the consti- tutively processed precursors has a hydrophobic aliphatic residue a t position 1 (see Ref. 8). The nature of the constitu- tive precursor cleavage forms a contrast with that of precursor cleavage a t dibasic sites within the regulated secretory path- way, since the presence of a Leu residue a t position 1 does not affect cleavage of human prorenin in endocrine cells (24- 27). Moreover, this difference in sequence requirements be- tween the constitutive and regulated precursor cleavages sup- ports our previous data that these two cleavages are catalyzed by two distinct endoproteases (8, 9, 34).

Until recently, little was known about endoproteases phys- iologically involved in precursor cleavages, with the exception of the yeast Kex2 protease, which is a Ca2+-dependent serine protease with a bacterial subtilisin-like catalytic domain and which is responsible for cleavage of pro-a-factor and prokiller toxin a t dibasic sites (16-18, 35, 36). Most recently, three mammalian Kex2 homologues, furin (10-13), PC2 (37, 38), and PCl/PC3 (9, 14, 15), have been identified by cDNA cloning. PC2 (39, 40) and PC1/PC3 (8, 9, 39-41) have been shown to be involved in precursor cleavage a t dibasic sites, and furin has been shown to be involved in cleavage a t RXK/ RR sites (8,33,42-44). Thus, processing of precursor proteins in mammals appears to be regulated in a more complicated manner than that thought previously. In this context, data concerning endoproteases involved in processing of proinsu- lin, although unidentified, are noteworthy. Hutton and his colleagues (45, 46) have partially purified two endoproteases (designated type I and type 11) from human insulinoma secre- tory granules, which both share some enzymatic properties with the yeast Kex2 protease. The type I protease catalyzes cleavage of human proinsulin at the B-chain/C-peptide junc- tion, and the type I1 catalyzes cleavage at the C-peptide/A- chain junction as well as that at the B-chain/C-peptide junc- tion. The sequence around the cleavage site of the B-chain/ C-peptide junction and that of the C-peptide/A-chain junction are Thr-'-Pro-Lys-Thr-Arg-Arg"-Glu' and Gly-'-Ser-Leu- Gln-Lys-Arg-'-Gly', respectively; the former but not the latter sequence has a basic residue at position -4. The basic residue a t position -4 of the former sequence is conserved among most known proinsulin sequences of various organisms from invertebrates to vertebrates (data not shown). Moreover, Hut- ton and co-workers have also reported that the type I but not the type I1 protease can cleave proalbumin (47). Taken to- gether, we speculate that the type I protease could be furin itself or a protease with a sequence selectivity similar to that of furin, and the type I1 could be PC2, which is expressed in insulinoma cells and pancreatic islets (14, 37, 38), or its relative.

In summary, data presented here delineate the sequence

by guest on April 12, 2018

http://ww

w.jbc.org/

Dow

nloaded from

8274 Sequence Requirements for C O ;

rules that govern the precursor cleavage within the constitu- tive secretory pathway. However, there are some exceptional precursors whose cleavage site sequences do not fit the above rules. To settle this problem, further site-directed mutagenesis and expression of precursors are under way in our laboratory.

Acknowledgments-We thank Dr. Y. Ikehara for helpful discussion, Dr. K. Yanagisawa for encouragement, and Y. Imai for critical reading of the manuscript.

REFERENCES

1. Docherty, K., and Steiner, D. F. (1982) Annu. Rev. Physiol. 44,

2. Loh, Y. P., Brownstein, M. J., and Gainer, H. (1984) Annu. Reu. Neurosci. 7 , 189-222

3. Eipper, B. A., May, V., Cullen, E. I., Sato, S. M., Murthy, A. S. N., and Mains, R. E. (1987) in Psycopharmacology: The Third Generation of Progress (Meltzer, H. Y., ed) pp. 385-400, Raven Press, New York

4. Burgess, T. L., and Kelly, R. B. (1987) Annu. Reu. Cell Biol. 3,

5. Thomas, G., Thorne, B. A., and Hruby, D. E. (1988) Annu. Reu.

6. Furie, B., and Furie, B. C. (1988) Cell 53 , 505-518 7. Klenk, H.-D., and Rott, R. (1988) Adu. Virus Res. 34 , 247-281 8. Hosaka, M., Nagahama, M., Kim, W.-S., Watanabe, T., Hatsu-

zawa, K., Ikemizu, J., Murakami, K., and Nakayama, K. (1991) J. Biol. Chem. 266, 12127-12130

9. Nakayama, K., Hosaka, M., Hatsuzawa, K., and Murakami, K. (1991) J. Biochem. (Tokyo) 109,803-806

10. Fuller, R. S., Brake, A. J., and Thorner, J. (1989) Science 246 ,

11. van den Ouweland, A. M. W., van Duijnhoven, H. L. P., Keizer, G. D., Dormers, L. C. J., and van de Ven, W. J. M. (1990) Nucleic Acids Res. 18, 664

12. Misumi, Y., Sohda, M., and Ikehara, Y. (1990) Nucleic Acids Res. 18,6719

13. Hatsuzawa, K., Hosaka, M., Nakagawa, T., Nagase, M., Shoda, A., Murakami, K., and Nakayama, K. (1990) J. Biol. Chem.

14. Smeekens, S. P., Avruch, A. S., LaMendola, J., Chan, S. J., and Steiner, D. F. (1991) Proc. Natl. Acad. Sci. U. S.A. 8 8 , 340- 344

15. Seidah, N. G., Marcinkiewicz, M., Benjannet, S., Gaspar, L., Beaublen, G., Mattei, M. G., Lazure, C., Mbikay, M., and Chrbtien, M. (1991) Mol. Endocrinol. 5 , 111-122

16. Julius, D., Brake, A. J., Blair, L., Kunisawa, R., and Thorner, J. (1984) Cell 37 , 1075-1089

17. Fuller, R. S., Sterne, R. E., and Thorner, J. (1988) Annu. Rev. Physiol. 50,345-362

18. Mizuno, K., Nakamura, T., Ohshima, T., Tanaka, S., andMatsuo, H. (1989) Biochem. Biophys. Res. Commun. 159 , 305-311

19. Masuda, T., Imai, T., Fukushi, T., Sudoh, M., Hirose, S., and Murakami, K. (1982) Biomed. Res. 3 , 541-545

20. Imai, T., Miyazaki, H., Hirose, S., Hori, H., Hayashi, T., Kagey- ama, R., Ohkubo, H., Nakanishi, S., and Murakami, K. (1983) Proc. Natl. Acad. Sci. U. S. A. 8 0 , 7405-7409

21. Hatsuzawa, K., Kim, W.-S., Murakami, K., and Nakayama, K. (1990) J. Biochem. (Tokyo) 107,854-857

625-638

243-293

Physiol. 50,323-332

482-486

265,22075-22078

nstitutive Precursor Cleavage 22. Nagahama, M., Nakayama, K., Hori, H., and Murakami, K.

(1989) FEBS Lett. 259,202-204 23. Nakayama, K., Kim, W.-S., Nakagawa, T., Nagahama, M., and

Murakami, K. (1990) J. Biol. Chem. 265 , 21027-21031 24. Nagahama, M., Nakayama, K., and Murakami, K. (1991) Eur. J.

Biochem. 197,135-140 25. Fritz, L. C., Haidar, M. A., Arfsten, A. E., Schilling, J. W., Carilli,

C., Shine, J., Baxter, J. D., and Reudelhuber, T. L. (1987) J. Biol. Chem. 262 , 12409-12412

26. Pratt, R. E., Flynn, J. A., Hobart, P. M., Paul, M., and Dzau, V.

27. Nakayama, K., Nagahama, M., Kim, W.-S., Hatsuzawa, K., Hashiba, K., and Murakami, K. (1989) FEBS Lett. 257, 89- 92

28. Fritz, L. C., Arfsten, A. E., Dzau, V. J., Atlas, S. A., Baxter, J. D., Fiddes, J . C., Shine, J., Cofer, C. L., Kushner, P., and Ponte, P. A. (1986) Proc. Natl. Acad. Sci. U. S. A . 83,4114-4118

29. Brennan, S. O., Peach, R. J., and Boswell, D. R. (1989) Biochim. Biophys. Acta 993,48-50

30. Brennan, S. O., Peach, R. J., and Bathurst, I. C. (1990) J. Biol. Chem. 265,21494-21497

31. Oda, K., Misumi, Y., Sohda, M., Takami, N., Sakaki, Y., and Ikehara, Y. (1991) Biochem. Biophys. Res. Commun. 175,690- 696

32. Brennan, S. O., and Peach, R. J. (1988) FEBS Lett. 229 , 167- 170

33. Misumi, Y., Oda, K., Fujiwara, T., Takami, N., Tashiro, K., and Ikehara, Y. (1991) J. Bid. Chem. 266, 16954-16959

34. Nagahama, M., Ikemizu, J., Misumi, Y., Ikehara, Y., Murakami, K., and Nakayama, K. (1991) J. Biochem. (Tokyo) 110, 806- 811

35. Mizuno, K., Nakamura, T., Ohshima, T., Tanaka, S., and Matsuo, H. (1988) Biochem. Biophys. Res. Commun. 156 , 246-254

36. Fuller, R. S., Brake, A., and Thorner, J. (1989) Proc. Natl. Acad. Sci. U. S. A. 86, 1434-1438

37. Smeekens, S. P., and Steiner, D. F. (1990) J. Biol. Chem. 265,

38. Seidah, N. G., Gaspar, L., Mion, P., Marcinkiewicz, M., Mbikay, M., and Chrbtien, M. (1990) DNA Cell Biol. 9,415-424

39. Benjannet, S., Rondeau, N., Day, R., Chrbtien, M., and Seidah, N. G. (1991) Proc. Natl. Acad. Sci. U. S. A. 88,3564-3568

40. Thomas, L., Leduc, R., Thorne, B. A., Smeekens, S. P., Steiner, D. F., and Thomas, G. (1991) Proc. Natl. Acad. Sci. U. S. A.

41. Korner, J., Chun, J., Harter, D., and Axel, R. (1991) Proc. Natl. Acad. Sci. U. S. A. 88, 6834-6838

42. van de Ven, W. J. M., Voorberg, J., Fontijn, R., Pannekoek, H., van den Ouweland, A. M. W., van Duijnhoven, H. L. P., Roebroek, A. J. M., and Siezen, R. J. (1990) Mol. Biol. Rep. 14,

43. Wise, R. J., Barr, P. J., Wong, P. A., Kiefer, M. C., Brake, A. J., and Kaufman, R. J . (1990) Proc. Natl. Acad. Sci. U. S. A. 8 7 ,

44, Bresnahan, P. A., Leduc, R., Thomas, L., Thorner, J., Gibson, H. L., Brake, A. J., Barr, P. J., and Thomas, G. (1990) J. Cell Biol.

45. Davidson, H. W., Rhodes, C. J., and Hutton, J. C. (1988) Nature

46. Docherty, K., Rhodes, C. J., Taylor, N. A., Shennan, K. I., and

47. Rhodes, C. J., Brennan, S. O., and Hutton, J. C. (1989) J. Biol.

J . (1988) J. Biol. Chm. 263 , 3137-3141

2997-3000

88,5297-5301

265-275

9378-9382

1 1 1,2851-2859

333,93-96

Hutton, J. C. (1989) J. Biol. Chem. 264,18335-18339

Chem. 264,14240-14245

by guest on April 12, 2018

http://ww

w.jbc.org/

Dow

nloaded from

T Watanabe, T Nakagawa, J Ikemizu, M Nagahama, K Murakami and K Nakayamapathway.

Sequence requirements for precursor cleavage within the constitutive secretory

1992, 267:8270-8274.J. Biol. Chem. 

  http://www.jbc.org/content/267/12/8270Access the most updated version of this article at

 Alerts:

  When a correction for this article is posted• 

When this article is cited• 

to choose from all of JBC's e-mail alertsClick here

  http://www.jbc.org/content/267/12/8270.full.html#ref-list-1

This article cites 0 references, 0 of which can be accessed free at

by guest on April 12, 2018

http://ww

w.jbc.org/

Dow

nloaded from