Sequence organization in African trypanosome minicircles is defined by 18 base pair inverted repeats

Molecular and Biochemical Parasitology, 18 (1986) 321-331 321 Elsevier

MBP 00632

SEQUENCE ORGANIZATION IN AFRICAN TRYPANOSOME MINICIRCLES IS DEFINED BY 18 BASE PAIR INVERTED REPEATS

DOUGLAS P. JASMER and KENNETH STUART

Issaquah Health Research Institute, 1595 N W Gilman Blvd., Issaquah, WA 98027, U.S.A.

(Received 9 September 1985; accepted 4 October 1985)

We have found that minicircles of African trypanosomes contain 18 base pair sequences that occur as 3 or 4

pairs of imperfect inverted repeats. The 18 base pair sequence is polar; one half is almost perfectly conserved, while the other half has a more variable sequence. The distribution of the 18 base pair sequences in minicircles defines two classes of sequences ('A' and 'B' segments) that have distinct characteristics. 'A' segments vary considerably in length and contain about 10% more G+C than 'B' segments which are all about 100 base pairs long. The 18 base pair sequences are absent from minicircles of other kinetoplastids. Thus, 'B' segments along with their terminal 18 base pair sequences superficially resemble insertion sequences. Minicircles of African trypanosomes therefore conserve their organization but have only limited

nucleotide sequence homology.

Key words: Kinetoplast DNA; Inverted repeats; Sequence organization

INTRODUCTION

The mitochondrial DNA of Trypanosoma brucei consists of approximately 5 000 minicircles, each about 1 kilobase pairs (kb) in size and 50 maxicircles, each about 22 kb in size, that are all concatenated into a single network [1]. Based on sequence homology and transcription analyses, maxicircles contain genes that are functionally equivalent to those in other mitochondrial DNAs [2-5]. In contrast, the role of minicircles, which have no sequence homology to maxicircles, is unresolved.

Minicircle sequences are very diverse among the kinetoplastid protozoa. Minicircle size ranges from 0.8 to 2.5 kb among species [1]. The minicircles of Trypanosoma lewisi are dimeric direct repeats of an approximately 0.5 kb sequence [6], those of Trypano- soma cruzi are tetrameric direct repeats of an approximately 0.4 kb sequence [7] and those ofLeishmania tarentolae are 0.8 kb monomers [8]. Minicircle sequence diversity varies greatly among species. The total kinetic complexity of T. brucei minicircles is about 300 kb, While that of L. tarentolae is a few kb [1]. Interestingly, Trypanosoma

Abbreviations: bp, base pair(s); kb, kilobase pairs.

0166-6851/86/$03.50 © 1986 Elsevier Science Publishers B.V. (Biomedical Division)

322

equiperdum, which is closely related to T. brucei but lacks the insect stage of the life

cycle, has a total minicircle complexity of about 1 kb [9]. A variable fraction of the minicircle nucleotide sequence is conserved within and

among species. In L. tarentolae between 18 and 31% of the minicircle is conserved as a

region of sequence homology [8]. Such a conserved sequence represents about 13% of the minicircle in African trypanosomes [ 10,11]. T. brucei minicircles also contain short scattered regions of homology [11]. Only 13 bp of the conserved sequence is conserved

among genera [8]. In addition, all minicircles that have been examined contain a

segment with abnormal mobility in acrylamide gels as a result of a conserved structural characteristic [7,11-13].

We have recently found that African t rypanosome minicircles conserve sequence characteristics, but not nucleotide sequence homology, in the region that is contiguous with the conserved sequence (referred to as the adjacent segment) [14]. This observa-

tion suggested to us that characteristics other than specific nucleotide sequences were being conserved among the minicircles of African trypanosomes. The outer limit of the adjacent segment is bounded by an 18 bp sequence that is conserved among all African trypanosome minicircles. We report here that this 18 bp sequence occurs as pairs of inverted repeats dispersed throughout the minicircles of African trypanosomes. These

pairs of inverted repeats do not occur either as related or analogous sequences in other kinetoplastids. The pairs of repeats define two sets of sequences with distinct character-

istics; each unit of one set with flanking 18 bp inverted repeats superficially resembles insertion sequences. The characteristic distribution of these repeats and the sequences that they define indicate that the minicircle organization is conserved in African

trypanosomes although the nucleotide sequences vary widely among these molecules.

METHODS AND MATERIALS

The pTKP1, pTKP2, pTKH39 and pTKH40 minicircles were cloned into the Pst I or Hind III sites of pBR322 after digestion of isolated kDNA from T. brucei strain

EATRO 164 with the same restriction enzymes. Fragments of these clones were subcloned into M 13 bacteriophage and sequenced by the dideoxy chain termination

method. The details of the cloning, subcloning, sequencing and the complete nucleotide sequence are as previously described [15] or are presented elsewhere [14]. The nucleotide sequence of the T. cruzi minicircle was kindly provided by Dr. Carlos Morel prior to publication. The nucleotide sequences were analyzed with a DEC 10 (Digital Equipment Corp.) computer using the SEQ, HAIRPN, RESCH and D I R E C T nucleic

acid sequence programs.

RESULTS

All four T. brucei 164 minicircles contain six imperfect copies of an 18 bp sequence. Analysis of published sequences of two T. brucei I L R A D 18E2 minicircles [ 10] and a T.

323

equiperdum minicircle [11] showed that they contain five and eight copies, respectively,

o f this sequence. The consensus sequences o f all of these repeats, which occur in both orientations, as discussed below, are shown in Fig. 1. This figure also shows the frequency of nucleotides at each position. The 18 bp sequences are very A + T rich and

are highly conserved. The consensus sequences for both orientation are not perfectly complementary but differ at positions 4, 11, and 18. In 27 of the 42 18-bp sequences

examined, two or fewer nucleotides differ from the consensus sequence and no more than 5 nucleotides differ from the consensus sequence in any of the 18 bp sequences.

The 18 bp sequence exhibits a distinct polarity with respect to sequence conservation. Positions 1 through 9 in each sequence are more highly conserved than positions 10 through 18 regardless of orientation in the minicircle. Only position 4 of the first 9

positions varies from the consensus sequence and the variation is always a transition. No position is invariant in the less conserved half of the sequence; variations occur in

positions 10 through 18 in one orientation or the other. The 18 bp sequences are dispersed in a characteristic arrangement within the

minicircles. They occur as alternating inverted repeats separated by non-18 bp sequence. Each T. brucei 164 minicircle contains three pairs of inverted repeats as diagrammed in Fig. 2. Alignment o f the minicircles according to the 130 bp conserved

Pl I TCTAGAGAAAGAAATAATATAATAGATAATGATAATAT

3 CCTGATGAGAAGAATGAGATAATAGATAGGTATAAAGT

5 TCTAGAATGGAAAGTAAAATAATAGATAAATTTATAAA

P2 i TCTAAATAAAGAGATAAAATAATAGATAGGTAATTAAT

3 CTGAAGATGGGAAATAATGTAATAGATAGGTAGATAGT

5 CTAGAAGGGAGAAATATGATAATAGATATGTATGTAGG

H39 1 AAATAAAAAGAAAATATATTAATAAATAGAAGTACGTC

3 CTGACTAATAAAGATAAGATAATAGATAGGAGTATAAA

5 CTAAAAGAGAGAAGTATAATAATAGATACGAGATAAAT

H40 I CAAGGTGAGAGAAATAAGATAATAGATAAGATTATAGT

3 GATGGATGGAAAAATGATATAATAGATATGTAATGATA

5 TAAAAGAAAGAAAATAAAGTAATAGATAGGATGAATAA

51 i AGAAAAGAATGAGATATTATAATAGATAGAAATTTAGA

3 CTAGGTAAGGGAAATAAGATAATAGATAGACAAGATAA

5 CTACGAGAAGAAAATAATATAATAGATAGAATAGAACT

201 1 CCTATGAAAAGAAATGAGATAATAGATAGACTTGAAGT

3 TGAGATAAGAGAAATGGGATAATAGATACGATATAAAA

5 TAGAGGAAAAGAAATATGATAATAGATAAGAATTAGAA

TEQ I CTAGAGAAAATAAATGTTGTAATAGATAGAGATATAAA

3 TTTAGAGAAGAAAGTAATATAATAGATATGAATTGTAA

5 CA AGAAGAGAGAAAT AG GA TA ATAA AT AGA TGCTTAA T

7 TAAAGTAAA AAATGATATAATAGATA GGATATAGT

G- A A A T A A G A T A A T A G A T ~A

T 1 22 6 8 1 22 22 22

A 9 21 19 19 16 14 5 18 22 22 22 2 22 22

C

G 12 i 3 3 6 2 9 3 20

2 TTGTACTATTTATCTATTATAATATTTTATTTTCTAGG

4 TTGTAATATATATTTATTATCTTATTTATATATAGAGA

6 ATATTTAAACTATCTATTATTTTATTCTTAATGAGTAG

2 TATTTATACTTATTTATTATTCCATTTCTTTTCAGGGA

4 AAAGATAATCTATTTATTATTTAATTTTTATTATATGT

6 TATGATTATATATTTATTATTATATTTTTATTAATTAG

2 TATAATTATCTATCTATTATTTATTTTTATTGTTTGGA

4 TTTTGTATATTATTTATTATTTTATTTTGTTCTTGGAG

6 AATTAATACTTATTTATTATATTATTTTAATTAGTGGG

2 TTGTAATATTTATCTATTATCTTATTTTAATCCTGGTA

4 TTGAATAATCTATTTATTATAATATTTCTTTATTTTAG

6 GACTAATATTTATTTATTATAAGATTTTTAAATTAGAG

2 TTTTAATACCTATTTATTATTTTATGATTCTTTCTAGG

6 TTACTATAAATATCTATTATTATATTTTATTAATTAGA

2 TTTATGTATATATTTATTATATTATTTTTTATTATAGG

6 TATTGTAATATATTTATTATTATATTTTAAGCCAAGGG

2 TATTTACACCTATTTATTATCTTATTCT~TG GTTTAG

4 GT~TATGTTTATTTATTATTATATTTTGTTACAAGAA

6 TCTTATTATTTATTTATTATTTTATTGAGATTAATGGG

8 AATGATATCA ATTTATTACTTTATTT ATTAATGGA

T T A T T T T

20 15 20 20 20 19 12 12 16 1 20 19 15 15

20 20 20 5 7 2 19 1 3

5 1 3 1 1 32

1 ii

Fig. 1. 18 bp inverted repeats and flanking sequences from African trypanosome minicircles. 18 bp sequences are indicated by the overline and are numbered sequentially beginning with the repeat adjacent to the c sequence in segment 'AI' (Fig. 3). The consensus sequence for each orientation of the 18 bp repeats is shown in the expanded portion of the figure and the frequency of occurrence of nucleotides at each nucleotide position (NP) is shown below the consensus sequence. P1, P2, H39 and H40, T. brucei 164; 51 and 201, T, brucei 18E2; TEQ, 1". equiperdum.

324

P 2 ~ / / - ~ . . . .

H 3 9 I / / / / / / ~ 7 - - / / / I

H40L / / / / / / / ,," / I

I lOObp I

Fig. 2. D i s t r ibu t ion of 18 bp repeats in minic i rc les of T. brucei 164. Ar rows indicate the loca t ion and

or ien ta t ion of the repeats; the a r rowheads des ignate the more conserved 9 bp of the sequence shown in Fig.

1. The l inear ized minicircles are a l igned wi th respect to the 130 bp conserved sequence (open box). The

ha tched box indicates the adjacent segment .

sequence reveals that the 18 bp repeats occur in a similar pattern in all of these minicircles. The organization of the 18 bp sequences into pairs of inverted repeats

defines two classes of sequences within the minicircles. One class, which we refer to as the 'A ' segments, occurs between the less conserved ends of the repeats. The other class occurs between the more conserved end of the repeats and is called the 'B' segments. Each of the three 'A ' and 'B' segments has been numbered for identification as shown in Fig. 3. The 'A 1' segment is substantially larger than the other 'A ' segments or the 'B' segments. It contains the adjacent segment and the conserved sequence which is described elsewhere [14], and an additional sequence which represents the remainder of segment ' A I ' . These sequences are designated as subsegments a, b, and c, respectively.

Except for the conserved sequence, no homology was detected among 'A ' segments either within each minicircle or among minicircles. Similarly, no homology was detected among 'B' segments either within or among minicircles. However, as shown in Table I, the 'A ' segments all share similar characteristics, as do the 'B' segments. This suggests that members of each set are related and this makes it difficult to exclude the

possibility that these sequences have minimal sequence homology. The mean G + C content of the three 'A ' segments ranges from 31.3 to 36.3% and is thus more than 10% higher than that of the 'B' segments which ranges from 18.9 to 20.1% G + C (Table I). Both 'A ' and 'B' segments also exhibit G versus C strand bias. The length of the 'B ' segments is more conserved than that of the 'A ' segments. The mean length of the 'B'

segments ranges from t02 to 110 bp and exhibits little variation among minicircles as evident from the moderate standard deviations. In contrast, the mean length of 'A ' segments ranges from 43 to 422 bp and exhibits greater variability among minicircles than do the 'B' segments. While the large size of the ' A I ' segment reflects the presence of the adjacent segment and conserved sequence sequences, the variability of this segment is due to t h e " A l a ' and ' A l c ' subsegments. The ' A l b ' subsegment can have

little variation in size since it is defined by the conservation of sequence homology. The mean length of the ' A I ' segment is larger than that of the 'A3' segment which is larger

325

A

A1 B1 A2 B2 A3 8 3 1641 a I ~ I' c I > Y / / / / / I 1 / / / / / / 1 < 1 I > V / / / / / w I

A1 B1 A2 "B2" * "A3" 83 511 a I b I c I > 1 , ' / / / / 1 1 < 1 I > V / / / , . ' j r / / / / / l 1 / / / / / / ! < 1 I > [ / / / / / A V / / / / , / d ~ . |

B

51

201

A1 Te l a I ~ I

TATT[fATTA~TT~I

B1 A2 B2 A3 B3 A4 8 4 C J > ~ ' , / , / / , / / A V / / / / / I ~ I I > 1 / / / / / / 1 < 1 I > Y / / / / / A < I

I 100 bP i

Fig. 3. Comparison of minicircles from different African trypanoSomes. (A) Comparison of the composite organization of four minicircles from T. brucei 164 with two from T. brucei 18E2 (51 and 201) and one from T. equiperdum (Te). The location of the 18 bp sequences are indicated with < and >; the closed end of the symbol indicates the more conserved 9 bp of the sequence. The 'A' and 'B' segments including those identified with .... , which assume divergent 18 bp sequences, are discussed in the text. The a, b and c regions in 'AI ' refer to the adjacent segment, the conserved sequence, and the remaining sequence of 'AI', respectively. (B) Comparison of 18 bp-like sequences, identified with an asterisk in A from minicircles 51 and 201, with the consensus 18 bp sequence (bottom sequence in each comparison) from Fig. 1. The boxed regions show nucleotide identity between the two sequences.

than that o f the 'A2 ' segment (P < 0.05). These f indings taken toge ther suggest that the

' A ' and 'B ' segments be long to two dist inct sequence classes.

Based on the above analyses we have d i a g r a m m e d the general o rgan iza t ion for the

T. brucei strain 164 minicircles and c o m p a r e d it to that o f the minicircles f rom T. brucei

18E2 [10] and T. equiperdum [11] (Fig. 3). Minicircles f rom these la t ter Afr ican

t r ypanosomes have an o rgan iza t ion that is s imilar to that of s train 164 minicircles.

Both minicircles f rom clone 18E2 have five 18 bp sequences. The pos i t ion and

o r ien ta t ion of the 18 bp sequences are s imilar to those in s train 164 minicircles; only the

18 bp sequence between segments 'B2' and ' A Y appears to be absent in the 18E2

minicircles. However , bo th the 51 and 201 minicircles have a sequence at a pos i t ion

co r re spond ing to the B 2 / A 3 junc t ion that resembles the 18 bp sequence (see aster isk,

Fig. 3A). These sequences (Fig. 3B) occur in the correct o r ien ta t ion and match the

consensus sequence in 13 or 12 of 18 pos i t ions in the 51 or 201 minicircles, respectively.

While this suggests that these sequences may be diverged 18 bp sequences, this

conclus ion must be t empered by the recogni t ion that all the matches are A / T base

pairs and the more highly conserved 9 bp ha l f o f the 18 bp sequence is not well

326

TABLE I

Mean length and single strand base composition of four minicircles from T. brucei 164

Segment Length (bp) Base composition

A C G T

A1 422.0(45.4) 34.4(1.3) 9.0(1.0) 27.1(0.9) 29.4(1.5)

a 227.0(41.9) 38.8(3.0) 3.5(1.1) 28.5(1.6) 29.2(2.4)

b 132.8(1.0) 29.5(2.2) 17.1(1.3) 24.1(1.0) 29.2(1.6)

c 62.2(21.4) 30.7(7.7) 14.7(6.7) 24.9(7.4) 29.7(7.4)

A2 43.2(20.1) 29.9(5.4) 7.4(2.0) 28.5(5.7) 34.1(5.0)

A3 110.5(49.4) 37.5(2.8) 8.5(2.3) 22.8(5.3) 31.1(2.2)

BI 101.7(6,6) 42.0(5.4) 7.8(2.9) 12.4(1.8) 37.8(5.0)

B2 106.5(2,4) 42.1(3.7) 3.7(3.1) 15.2(2.4) 38.9(5.3)

B3 109.7(3.8) 43.9(4.9) 6.6(3.4) 13.5(2.7) 36.5(5.6)

' A 1-3', 'A 1 a-c ' and 'B 1-3' refer to minicircle segments that are described in the text and shown in Fig. 3. The

numbers in parentheses refer to the standard deviation for the mean segment length or the mean percent base

composition. Note the G versus C strand bias that is more pronounced for the 'A ' segments, the conserva-

tion of the length of the 'B' segments compared to 'A ' segments, the decreasing size of the 'A ' segments in the

order ' A I ' > ' A 3 ' > ' A 2 ' , and the consistently lower G + C content of the 'B' segments compared to the 'A '

segments (see text for details).

TABLE II

Length and single strand base composit ion of 'A ' and 'B' segments from T. brucei 18E2 minicircles (51 and

201) and T. equiperdum minicircles (Te)

Sequence 51 201 Te

Length % Length % Length % (bp) (bp) (bp)

A C G T A C G T A C G T

AI 419 34 11 26 29 439 33 10 27 29 365 36 8 30 26

A2 15 20 13 27 40 45 31 2 33 33 15 27 0 33 40

A3 a 157 33 8 25 34 87 42 7 23 28 14 50 7 29 14

A4 - - - 56 39 7 25 29

BI 94 37 10 13 40 111 42 5 13 40 99 43 11 12 33

B2 a 92 46 9 13 33 105 44 5 15 36 97 45 4 16 35

B3 98 42 7 12 36 109 40 4 16 40 110 42 9 14 35

B4 - - 112 36 4 19 42

Note the conservation of the characteristics of the 'A ' and 'B' segments among different African trypano-

somes, despite the divergence of minicircle sequence, a'B2' and 'A3' of minicircles 51 and 201 are as indicated

in Fig. 3.

327

conserved in these sequences. Nevertheless, the 'A3' and 'B2' segments that are defined by these 18 bp-like sequences resemble the corresponding 'A' and 'B' segments in the 164 minicircles (Tables I and II).

The T. equiperdum minicircle contains eight 18 bp sequences (Fig. 3) which have a distribution within the minicircle similar to those in strain 164. This results in four each of the 'A' and 'B' segments which have characteristics similar to those of the 'A' and 'B' segments from the 164 minicircle (Tables I and II). While the 'A' segments are generally shorter in the T. equiperdum minicircle, the 'B' segments have a similar size range to that of the T. brucei minicircles. Thus, it appears that additional 'A' and 'B' segments, and 18 bp repeats are accommodated in the T. equiperdum minicircle by shorter 'A' segments compared to T. brucei minicircles, while the length of the 'B' segments is conserved.

No other 18 bp sequences were found among the seven minicircles described above. A sequence was identified in minicircle 201 that was identical to the more conserved half of the 18 bp sequence. However, this repeat has the reverse orientation expected for its position in the minicircle and the other half of this sequence had C, G, T, and Tat positions 11, 14, 16, and 17, respectively, which represent unique substitutions (Fig. 1). Thus, this sequence probably is not derived from an 18 bp sequence. No 18 bp sequences were detected in the minicircle sequences ofL. tarentolae [8], T. lewisi [6], or T. cruzi. A sequence that is identical to the more highly conserved 9 bp sequence occurs only at one position in each of the two dimeric T. lewisi sequences but the associated sequences do not resemble the remainder of the 18 bp repeat. In addition, we were unable to detect inverted repeats in these three kinetoplastids that might be analogous to the 18 bp sequences of African trypanosomes. We therefore conclude that these three kinetoplastids lack the 18 bp sequences or analogous sequences.

DISCUSSION

Our finding of an 18 bp sequence in an alternating inverted repeat arrangement in African trypanosome minicircles shows that the overall organization, but not the nucleotide sequence, is conserved among minicircles in these organisms. This organization defines two distinct classes of minicircle sequences in African trypanosomes; the 'A' and 'B' segments. Characteristics of 'A' segments are conserved among minicircles of various species, suggesting these sequences have evolutionary homology to other minicircles. The 'AI ' segment contains the only nucleotide sequence that is conserved among genera [6,7,14] in addition to a nearby segment that results in abnormal mobility of DNA fragments in polyacrylamide gels [8,12,14]. In contrast, 'B' segments are more A+T rich than the 'A' segments, have a conserved length and have been found only in the African trypanosomes. While we cannot exclude that 'B' segments occur in other kinetoplastid minicircles, these sequences with the flanking 18 bp inverted repeats could represent sequence units that were either acquired by African trypanosomes or lost by the others. Since African trypanosomes probably evolved more recently than other kinetoplastids, the 'B' segments are probably acquired.

328

The ‘B’ segments resemble insertion sequences with 18 bp terminal inverted repeats.

However, their small size (about 140 bp), the lack of internal nucleotide sequence

conservation, and the lack of flanking direct repeats are uncharacteristic of insertion

sequences but not without precedent. A small (about 200 bp) insertion sequence occurs

in pSClO1 [ 161, the nucleotide sequences of maize DS elements are variable [ 171 and

direct repeats are not an obligate result of bacteriophage Mu transposition [18]. In

addition, ‘B’ sequence divergence may reflect divergence that occurred since acquisition

by the minicircles. The lower conservation of the terminal 9 bp of the 18 bp repeats may

reflect nucleotide changes resulting from insertion. A property of insertion sequences

is their mobility within the genome. We have not observed such mobility but the

variation in the number of 18 bp sequences between T. brucei and T. equiperdum minicircles might reflect this property. Alternatively, these sequences may be ancestral

minicircle sequences that have been lost from other kinetoplastids. In this case, it is

conceivable that the 18 bp sequences have functions in minicircles which could involve

participation in hairpin loop formation or sequence interactions between minicircles.

Additionally, the conserved length of ‘B’ segments may be necessary for alignment of

18 bp sequences for such interactions.

The alternating ‘A’ and ‘B’ segment organization of African trypanosome minicir-

cles resembles the direct repeat organization of minicircles of some other Trypanosoma species. Two alternate schemes are shown in Fig. 4 to illustrate the organization of

Fig. 4. Hypothetical scheme illustrating the general organization of kinetoplastid minicircles. 1, ancestral

minicircle sequence composed of a single ‘A’ segment; 2, 3 and 4, monomeric, dimeric and tetrameric

minicircles such as occur in L. tarentolue, T. lewisi and T. cruzi, respectively, that may have arisen from 1 by

sequence divergence and amplification; 2’, 3’ and 4’. hypothetical minicircles in the evolution ofthe African

trypanosome minicircle (An.

329

minicircles from different species and to outline possible events leading to African trypanosome minicircles. One scheme assumes insertion of 'B' segments followed by minicircle amplification and 'A' segment deletion. By this scheme an ancestral, monomeric, minicircle (Fig. 4 [1]), like that ofL. tarentolae [2], acquired a 'B' segment. This chimeric minicircle (2') subsequently underwent amplification to produce minicircles (3' and 4') resembling the dimeric [3] and tetrameric [4] minicircles of T. lewisi and 7". cruzi, respectively. African trypanosome minicircles would then result from deletions of 'A' segments and sequence divergence. The alternate scheme assumes multiple insertions of 'B' segments into the ancestral minicircle to produce African trypanosome minicircles. The processes of sequence insertion, deletion, amplification and divergence may not be mutually exclusive, permitting several other schemes to be envisioned. Nevertheless, the tendency of minicircles to be composed of apparently tandemly repeated sequences is illustrated.

The conserved organization of T. brucei minicircles provokes questions concerning their sequence diversity. Recombination, amplification, deletion, and point mutations might have contributed to this diversity. Recombination has been proposed to explain minicircle diversity [10,19,20] and the 18 bp sequences may serve as recognition sequences for this process. However, recombination must occur in a way that conserves the sequence and structural characteristics of minicircles. Several tandem repeats occur in the 'A 1' segments of T. brucei and T. equiperdum [ 10,11,14], implying that amplification may be common in minicircles and may contribute to their diversity. In view of the conserved organization of these minicircles, point mutations also probably account for some Of this diversity. Processes producing this diversity may be restricted to the insect vector since minicircles from T. equiperdum, which lacks the insect stage of the life cycle, are homogeneous [9].

The significance of minicircles remains obscure. Minicircles from various species do not have common sequence characteristics that reveal minicircle function. Only a short sequence within the conserved sequence is common to all minicircles [6,8] and may be within the replication origin. The position of a bend near the conserved sequence is also conserved [8,13,14] and may also be related to a minicircle replication function. Despite the indirect evidence that the large (2.5 kb) minicircles of Crithidia may encode a protein [21], the absence of detectable minicircle transcripts [22,23] or conserved open reading frames [14] and the extreme diversity of nucleotide sequence among minicircles all suggest that African trypanosome minicircles do not have this function.

Our results demonstrate that despite the great sequence diversity among African trypanosome minicircles, the organizational integrity of these molecules is maintained even among different species. These findings support the suggestion by others [12] that the importance of minicircles in the biology of kinetoplastids may depend on structural characteristics rather than specific nucleotide sequences.

330

ACKNOWLEDGEMENTS

W e exp r e s s o u r a p p r e c i a t i o n to Dr s . C a r l o s M o r e l ( I n s t i t u t o O s w a l d o C r u z , R io de

J a n e i r o , Braz i l ) a n d P i e r o B a t a g l i a ( I n s t i t u t o S u p e r i o r e di S a n i t a , V ia l e R e g i n a E l e n a ,

R o m a , I t a ly ) f o r p r o v i d i n g the n u c l e o t i d e s e q u e n c e s o f T. cruzi a n d T. lewisi m i n i c i r c l e s

p r i o r to p u b l i c a t i o n . W e a l so t h a n k D r . M a r i l y n P a r s o n s fo r h e l p f u l d i s c u s s i o n s

c o n c e r n i n g m i n i c i r c l e s e q u e n c e d i v e r s i t y a n d D r . J e a n F e a g i n fo r c r i t i ca l r e a d i n g o f

th i s m a n u s c r i p t . T h i s w o r k was s u p p o r t e d b y N I H g r a n t A I 14102.

REFERENCES

1 Stuart, K. (1983) Kinetoplast DNA, mitochondrial DNA with a difference. Mol. Biochem. Parasitol. 9, 93-104.

2 Benne, R., De Vries, B.F., Van Den Burg, J. and Klaver, B. (1983) The nucleotide sequence of a segment of Trypanosoma brucei mitochondrial maxi-circle DNA that contains the gene for apocytochrome b and some unusual unassigned reading frames. Nucleic Acids Res. 11, 6925-6941.

3 Hensgens, L.A.M., Brakenhoff, J., De Vries, B.F., Sloof, P., Tromp, M.C., Van Boom, J.H. and Benne, R. (1984) The sequence of the gene for cytochrome c oxidase subunit I, a frameshift containing gene for cytochrome c oxidase subunit II and seven unassigned reading frames in Trypanosoma brucei mitochondrial maxi-circle DNA. Nucleic Acids Res. 12, 7327-7344.

4 Johnson, B.J.B., Hill, G.C. and Donelson, J.E. (1984) The maxicircle of Trypanosoma brucei kinetoplast DNA encodes apocytochrome b. Mol. Biochem. Parasitol. 13, 135-146.

5 Feagin, J.E. and Stuart, K. (1985) Differential expression of mitochondrial genes between life cycle stages of Trypanosoma brucei. Proc. Natl. Acad. Sci. U.S.A. 82, 3380-3384.

6 Ponzi, M., Birago, C. and Battaglia, P.A. (1985) Two identical regions in the min~circle structure of Trypanosoma lewisi kinetoplast DNA. Mol. Biochem. Parasitol. 13, 111-119.

7 Riou, G. and Barrois, M. (1979) Restriction cleavage map of kinetoplast DNA minicircles from Trypanosoma equiperdum. Biochem. Biophys. Res.Commun. 90, 405-409.

8 Kidane, G.Z., Hughes, D. and Simpson, L. (1984) Sequence heterogeneity and anomolous electropho- retic mobility of kinetoplast minicircle DNA from Leishmania tarentolae. Gene 27,265-277.

9 Riou, G. and Saucier, J.M. (1980) Characterization of the molecular components in kinetoplast-mitochondrial DNA of Trypanosoma equiperdum. J. Cell Biol. 82, 248-263.

10 Chen, K.K. and Donelson, J.E. (1980) Sequences of two kinetoplast DNA minicirclesofTrypanosoma brucei. Proc. Natl. Acad. Sci. U.S.A. 77, 2445-2449.

11 Barrois, M., Riou, G. and Galibert, F. (1981) Complete nucleotide sequence of minicircle kinetoplast DNA from Trypanosoma equiperdum. Proc. Natl. Acad. Sci. U.S.A. 78, 3323-3327.

12 Marini, J.C., Levene, S.D., Crothers, D.M. and Englund, P.T. (1982) Bent helical structure in kinetoplast DNA. Proc. Natl. Acad. Sci. U.S.A. 79, 7664--7668.

13 Wu, H.-M. and Crothers, D.M. (1984) The locus of sequence-directed and protein-induced DNA bending. Nature 308, 509-513.

14 Jasmer, D.P. and Stuart, K. (1986) Conservation of kinetoplastid minicircle characteristics without nucleotide sequence conservation. Mol. Biochem. Parasitol. 18, 257-269.

15 Stuart, K. (1983) Mitochondrial DNA of an African trypanosome. J. Cell. Biochem. 23, 13, 26. 16 Ravetch, J.V., Ohsumi, M., Model, P., Vovis, G.F., Fischhoff, D. and Zinder, N. (1979) Organization of

a hybrid between phage fl and plasmid pSCI01. Proc. Natl. Acad. Sci. U.S.A. 76, 2195-2198. 17 Doring, H.P., Tillman, E. and Starlinger, P. (1984) DNA sequence of the maize transposable element

Dissociation. Nature 307, 127-130.

331

18 Harsbey, R.M. (1984) Transposition without duplication of infecting bacteriophage Mu DNA. Nature 311,580-581.

19 Manning, J.E. and Wolstenholme, D,R. (1976) Replication of kinetoplast DNA of Crithidia acantho- cephali J. Cell Biol. 70, 406-418.

20 Hoeijmakers, J.H.J. and Borst, P. (1982) Kinetoplast DNA in the insect trypanosomes Crithidia luciliae and Crithidiafasciculata. Plasmid 1,210-220.

21 Shlomai, J. and Zadok, A. (1985) Kinetoplast minicircles of trypanosomatids encode for a protein product. Nucleic Acids Res. 12, 8017-8028.

22 Hoeijmakers, J.H.J., Snijders, J.W. and Borst, P. (1981) Transcription of kinetoplast DNA in Trypanosoma brucei bloodstream and culture forms. Plasmid 5, 329-350.

23 Stuart• K. and Ge•vin• S.B. ( •98•) Kinet•p•ast DNA •f n•rma• and mutant Trypan•s•ma brucei. Am. J. Trop. Med. Hyg. 29, 1075-1081.

Documents

Sequence organization in African trypanosome minicircles is defined by 18 base pair inverted repeats