S

MFa

b

c

a

ARRA

KBPPDS

1

stsopufPo1

onPpaaaD

j

0h

Scientia Horticulturae 144 (2012) 81–86

Contents lists available at SciVerse ScienceDirect

Scientia Horticulturae

journa l h o me page: www.elsev ier .com/ locate /sc ihor t i

ensitivity of peach cultivars against a Dideron isolate of Plum pox virus

anuel Rubioa,∗ , Pedro Martínez-Gómeza, Jesús García-Bruntonb, Thierry Pascal c , Ana García-Ibarraa ,ederico Dicentaa

Department of Plant Breeding, CEBAS-CSIC, PO Box 164, E-30100 Espinardo, Murcia, SpainDepartment of Horticulture, Instituto Murciano de Investigación y Desarrollo Agrario y Alimentario (IMIDA), E-30150 La Alberca, Murcia, SpainUnité de Recherche en Génétique et Amélioration des Fruits et Légumes,GAFL. INRA-Avignon, Domaine Saint-Maurice, BP 94/84143 Monfavet, France

r t i c l e i n f o

rticle history:eceived 17 May 2012eceived in revised form 26 June 2012ccepted 27 June 2012

eywords:

a b s t r a c t

Sharka disease, caused by Plum pox virus (PPV), is one of the most significant limiting factors for Prunusproduction worldwide, and the cultivation of resistant cultivars is the only definitive solution to thisproblem. In this study, 40 cultivated peach cultivars with different origins, chill requirements and fruittype were evaluated against a PPV Dideron-type isolate in controlled conditions in greenhouse for threeevaluation cycles. Cultivars were grafted onto PPV infected ‘GF305′ rootstocks and, in each cycle, the

reedingPVrunus persicaisease resistanceharka

presence of symptoms on leaves was scored and ELISA and RT-PCR was applied to check the presence ofPPV on rootstocks and cultivars. The results showed the resistance of ‘Catherine’ to this strain, for thiscultivar never showed sharka symptoms and was ELISA and RT-PCR negative. Some cultivars withoutsymptoms but ELISA or PCR positive were tolerant to PPV. Most cultivars were sensitive, and showedsymptoms of sharka or were ELISA or RT-PCR positive. In these cultivars, different degrees of symptomexpression among the three cycles and between replications of each cultivar were observed.

. Introduction

The economic cost of Plum pox virus (PPV, sharka) in Prunuspecies has been estimated at around 10,000 million euros overhe last 30 years (Cambra et al., 2006). Among the different Prunuspecies sensitive to this disease, peach [Prunus persica (L.) Batsch] isne of the most affected (Van Oosten, 1975). In sensitive Prunus, PPVroduces symptoms on leaves, flowers and fruits, which becomenmarketable, and also affects vegetative growth and increasesruit drop (Németh, 1994; Milosevic et al., 2010). In countries wherePV is widespread, the cultivation of new resistant cultivars is thenly alternative for maintaining stone fruit production (Németh,994).

Public and private peach breeders release a significant numberf new cultivars each year. Between 1991 and 2001, close to 1200ew cultivars were released worldwide (Sansavini et al., 2006).PV resistance is a desirable trait in some of these peach breedingrograms (Gabova, 1994; Gass et al., 1996; Sansavini et al., 2006),lthough most peach cultivars evaluated so far have been reported

s sensitive. Escalettes et al. (1998) evaluated 250 peach clones,nd only the clones S2844 (from Russel Red) and S2873 (from Earlyouble Red) were resistant against Marcus (PPV-M) and Dideron

∗ Corresponding author. Tel.: +34 968 39 62 00; fax: +34 968 39 62 13.E-mail addresses: mrubio@cebas.csic.es (M. Rubio),

esus.garcia2@carm.es (J. García-Brunton), tpascal@avignon.inra.fr (T. Pascal).

304-4238/$ – see front matter © 2012 Elsevier B.V. All rights reserved.ttp://dx.doi.org/10.1016/j.scienta.2012.06.038

© 2012 Elsevier B.V. All rights reserved.

(PPV-D) PPV isolates, although Pascal et al. (2002) later showedthe sensitivity of these cultivars to PPV-M. However, despite thispredominant feature, important variability exists within peachspecies, ranging from very sensitive to tolerant or resistant culti-vars (Gabova, 1994; Toma et al., 1998; Polák et al., 2003; Tsiporidiset al., 2005; Casati et al., 2010). Furthermore, in Prunus and mainlyin peach, PPV-M isolates produce stronger symptoms and spreadfaster than PPV-D isolates (Quiot et al., 1995; Dallot et al., 1998;Candresse and Cambra, 2006). PPV-M was detected in Spain anderadicated (Cambra et al., 2004), and, to date, no official evidenceof these isolates has been reported since in this country.

In this study, the resistance of 40 peach cultivars to a PPV-D iso-late was evaluated in controlled greenhouse conditions by graftingthese cultivars onto inoculated ‘GF305′ peach rootstocks.

2. Materials and methods

2.1. Plant material

Forty cultivated peach cultivars of different origins were evalu-ated. The cultivars (including nectarines, clingstone and freestonepeaches) have different chill requirements and come from Brazil,

France, Italy, Spain and USA. The pedigree of most of these cultivarsis unknown, probably because they were released by private breed-ers (Table 1). The selected cultivars were grafted onto ‘GF305′ peachseedling rootstocks, described as very sensitive to PPV (Bernhard

82 M. Rubio et al. / Scientia Horticulturae 144 (2012) 81–86

Table 1Some characteristics of the 40 evaluated peach cultivars, including country where cultivars were released, pedigree, type of fruit and chilling requirements.

Cultivar Origin Pedigree Type Chilling requirements

86.6 USA Unknown Nectarine LowAlicia USA Unknown Nectarine MediumBabygold 6 USA NJ13232 × NJ196 Clingstone MediumBig Bang France Unknown1 Nectarine HighBig Top USA Unknown2 Nectarine MediumCalabacero Spain Spanish population Clingstone Medium/HighCasasil USA Unknown2 Nectarine LowCatherine USA NJC95 × D42.13 W Clingstone Low/MediumChato Spain Spanish flat population Freestone-platycarpa Medium/HighCrimson Baby USA FLA69.83 × Mayfire Nectarine MediumDiamante Brazil Brazilian population Clingstone MediumEarly Top USA Unknown2 Nectarine MediumFlordastar USA Flordagold × Early Grande Freestone LowFlored USA Rio Grande op Freestone LowGranada Brazil Brazilian population Clingstone LowHoney Prima USA Unknown2 Nectarine MediumLeonense Brazil Brazilian population Clingstone LowLourdes USA Unknown Nectarine LowMaciel Brazil Brazilian population Clingstone LowMaruja M3 Spain Spanish population Clingstone Medium/HighMelody USA Unknown Nectarine MediumNiv10/03 USA Unknown2 Nectarine LowNiv11/03 USA Unknown2 Nectarine LowNiv30/02 USA Unknown2 Nectarine LowPepita Brazil Brazilian population Clingstone LowRayon USA FLA8B-27 op Freestone LowRed Camden USA Sunred × Spring Brite Freestone LowRio Grandense Brazil Brazilian population Clingstone LowRomea Italy Catherine op Clingstone LowSilver King France Mutation of Armking Nectarine MediumSilvery USA Unknown Nectarine MediumSnow Queen USA Unknown3 Nectarine MediumSpringcrest USA FV89-14 × SpringTime Freestone LowSudanell Spain Spanish population Clingstone Medium/HighSuncoast USA FLA9.12 × FLA7.3 N Nectarine MediumSunraycer USA Forestgold × (Sungold × Armking) Nectarine MediumSweet Cap France Unknown1 Freestone-platycarpa MediumTirrenia Italy Vivian × Federica Clingstone Low/MediumTurmalina Brazil Brazilian population Clingstone LowZincal-5 (Sunred) USA Panamint × FLAR9T10 Nectarine Low

Po

ea

2

icP

2

dwilowwbtaae

rivate breeders: 1A. Maillard; 2Zaiger’s Genetics; 3Amstrong CA.p: open pollination.

t al., 1969) and used as a virus woody indicator in the evaluationssays.

.2. PPV isolate

The PPV-D isolate RB3.30 was used as PPV inoculum, maintainedn ‘GF305′ seedlings. This isolate is from IVIA PPV collection (Valen-ia, Spain) and it is considered representative of the natural SpanishPV isolates.

.3. Evaluation of resistance

Behavior of the peach cultivars was evaluated in controlled con-itions in a sealed greenhouse. Two-month-old ‘GF305′ rootstocksere inoculated by grafting a piece of bark from other previously

nfected ‘GF305′ showing strong sharka symptoms. Two monthsater, five replications of each cultivar were grafted onto the previ-usly inoculated rootstocks, and one sprouted branch of rootstockas kept to check PPV presence. One month after grafting, plantsere submitted to an artificial period of dormancy in a cold cham-

er at 7 ◦C, in darkness, for two months. They were then transferred

o the greenhouse for four months (first cycle of study), and thengain taken to the cold chamber. Three cycles of study (each sep-rated by a two month cold period) were carried out during thisvaluation.

The presence of symptoms in the rootstock and in the cultivarleaves was scored from 0 (absence of symptoms) to 5 (maximumsymptoms intensity). Only plants whose rootstock had been effec-tively inoculated (showing sharka symptoms) were considered forthe evaluation process.

To ascertain the presence of PPV on leaves, ELISA-DASI wasapplied using 5B-IVIA monoclonal antibody (REAL-Durviz®; Valen-cia, Spain). Optical densities (OD) were recorded at 405 nm after60 min. Samples with OD more than double that of the healthycontrol were considered to be ELISA-positive (Sutula et al., 1986).

Finally, in the third cycle of study, RT-PCR analysis (Sánchez-Navarro et al., 2005) was carried out using total RNA extractedwith the Rneasy Plant Mini Kit (Qiagen, Hilden, Germany). Apair of specific primers that amplify the coat protein (CP) gene,VP337 (CTCTGTGTCCTCTTCTTGTG), complementary to positions9487–9508 of genomic PPV, and VP338 (CAATAAAGCCATTGTTG-GATC), homologous to positions 9194–9216, were assayed.

For ELISA and RT-PCR analysis, leaves with symptoms were sam-pled when possible, and, in the case of absence of symptoms, wererandomly collected.

To estimate the level of sensitivity of each cultivar, the numberof plants with symptoms on leaves and their mean intensity as well

as the number of plants that were ELISA or RT-PCR positive in eachcycle were considered. Following the terminology introduced byCooper and Jones (1983), cultivars were classified as sensitive (withsymptoms and ELISA-DASI or RT-PCR positive), tolerant (without

M. Rubio et al. / Scientia Horticulturae 144 (2012) 81–86 83

Table 2Evaluation of resistance of 40 peach cultivars to the PPV-D isolate RB3.30 of PPV grafted on cultivars ‘GF305’ peach rootstocks, for three vegetative cycles. Number of rootstocksand cultivars with symptoms on leaves (mean intensity of symptoms of the positive samples) and number of cultivars ELISA positive (mean optical densities, OD, of thepositive samples), in each cycle. Positive or negative RT-PCR amplification in the third cycle. Symptoms on leaves were scored from 0 to 5. OD of non-inoculated ‘GF305’ = 0.06,OD of infected symptomatic ‘GF305’ = 3.28).

Cultivar Cycle 1 Cycle 2 Cycle 3

Rootstocka Cultivarb Rootstocka Cultivarb Rootstocka Cultivarb

Symptoms Symptoms ELISA Symptoms Symptoms ELISA Symptoms Symptoms ELISA RT-PCR

86.6 2 (2.0) 1 (3.0) 1 (1.58) 2 (3.0) 0 (0.0) 0 (0.04) 3 (2.6) 0 (0.0) 1 (0.19) +Alicia 4 (2.5) 0 (0.0) 2 (1.07) 4 (1.6) 1 (3.0) 1 (0.93) 2 (1.5) 0 (0.0) 1 (0.12) +Babygold 6 3 (3.0) 2 (2.0) 2 (0.35) 3 (3.0) 3 (1.3) na 3 (3.0) 0 (0.0) 0 (0.06) −Big Bang 1 (1.0) 0 (0.0) 0 (0.08) 2 (2.0) 0 (0.0) 1 (0.41) 0 (0.0) 0 (0.0) 0 (0.06) +Big Top 5 (2.4) 1 (1.0) 3 (0.59) 5 (3.4) 0 (0.0) 0 (0.06) 3 (3.0) 0 (0.0) 0 (0.06) −Calabacero 1 (1.0) 0 (0.0) 1 (0.19) 1 (4.0) 0 (0.0) 0 (0.05) 1 (1.0) 0 (0.0) 0 (0.07) −Casasil 1 (1.0) 3 (1.6) 3 (1.15) 1 (2.0) 1 (1.0) 2 (0.84) 1 (4.0) 0 (0.0) 0 (0.07) +Catherine 3 (2.6) 0 (0.0) 0 (0.09) 5 (1.8) 0 (0.0) 0 (0.07) 4 (1.2) 0 (0.0) 0 (0.05) −Chato 4 (4.0) 3 (2.3) 3 (1.20) 4 (3.7) 3 (1.0) 3 (0.38) 2 (1.0) 0 (0.0) 0 (0.06) −Crimson Baby 0 (0.0) 1 (2.0) 1 (1.27) 0 (0.0) 0 (0.0) 0 (0.06) ns 0 (0.0) 0 (0.07) −Diamante 3 (1.6) 2 (1.0) 2 (0.84) 3 (2.3) 1 (1.0) 1 (0.90) 2 (3.0) 0 (0.0) 0 (0.06) −Early Top 5 (2.0) 2 (1.0) 3 (0.75) 3 (2.6) 1 (1.0) 1 (1.09) 2 (3.5) 0 (0.0) 2 (0.29) +Flordastar 5 (3.4) 3 (1.0) 4 (0.52) 5 (3.2) 2 (1.0) 2 (0.73) 1 (3.0) 0 (0.0) 0 (0.06) +Flored 1 (1.6) 1 (1.0) 2 (0.92) 4 (2.5) 0 (0.0) 0 (0.06) 3 (2.3) 0 (0.0) 0 (0.07) −Granada 3 (4.0) 0 (0.0) 2 (0.24) 2 (4.0) 0 (0.0) 1 (0.27) 2 (1.5) 0 (0.0) 0 (0.07) −Honey Prima 4 (3.2) 2 (2.2) 4 (0.92) 1 (5.0) 1 (1.0) 2 (0.72) ns 0 (0.0) 0 (0.08) +Leonense 2 (3.5) 1 (1.0) 1 (1.56) 3 (2.6) 3 (1.0) 3 (0.38) 1 (4.0) 0 (0.0) 1 (0.18) +Lourdes 3 (2.3) 0 (0.0) 1 (0.53) 3 (3.0) 0 (0.0) 0 (0.09) 3 (2.0) 0 (0.0) 0 (0.07) −Maciel 2 (2.5) 1 (2.0) 1 (2.00) 4 (1.5) 1 (1.0) 1 (0.60) 2 (4.0) 0 (0.0) 1 (0.18) +Maruja M3 1 (2.0) 0 (0.0) 0 (0.06) ns 0 (0.0) 0 (0.06) 0 (0.0) 0 (0.0) na naMelody 1 (4.0) 0 (0.0) 0 (0.11) 1 (3.0) 0 (0.0) 0 (0.06) 1 (2.0) 0 (0.0) 0 (0.06) −Niv10/03 2 (2.0) 1 (1.0) 2 (0.29) 2 (3.0) 0 (0.0) 0 (0.05) ns 0 (0.0) 0 (0.07) −Niv11/03 0 (0.0) 0 (0.0) na 1 (1.0) 1 (1.0) 1 (0.14) na na na naNiv30/02 2 (3.5) 0 (0.0) 2 (0.67) 1 (4.0) 0 (0.0) 0 (0.06) 1 (4.0) 0 (0.0) 0 (0.09) +Pepita 2 (2.5) 1 (1.0) 1 (0.88) ns 1 (1.0) 1 (0.15) ns 0 (0.0) 0 (0.06) −Rayon 2 (1.5) 0 (0.0) 0 (0.07) 2 (2.5) 1 (1.0) 1 (0.15) 2 (3.0) 0 (0.0) 0 (0.05) +Red Camden 2 (2.5) 0 (0.0) 0 (0.10) 1 (3.0) na na na na na naRio Grandense 4 (2.2) 1 (1.0) 1 (1.73) 3 (3.6) 3 (1.0) 3 (0.47) 1 (0.0) 0 (0.0) 0 (0.06) +Romea ns 1 (2.0) 1 (0.80) ns 1 (4.0) 1 (1.59) ns 1 (1.0) 1 (2.15) +Silver King 1 (3.0) 0 (0.0) 0 (0.06) ns 0 (0.0) 0 (0.06) ns 0 (0.0) 0 (0.07) −Silvery 5 (3.0) 2 (1.0) 2 (0.22) 4 (3.5) 2 (1.5) 2 (0.51) 0 (0.0) 0 (0.0) 0 (0.07) naSnow Queen 3 (2.0) 0 (0.0) 2 (0.23) 3 (3.0) 0 (0.0) 0 (0.07) 1 (1.0) 0 (0.0) 0 (0.06) −Springcrest 5 (2.4) 0 (0.0) 2 (0.20) 3 (2.6) 1 (1.0) 1 (0.34) 1 (3.0) 0 (0.0) 0 (0.07) −Sudanell 3 (1.3) 2 (1.6) 1 (0.55) 3 (1.0) 3 (1.0) na 4 (1.2) 2 (1.3) na naSuncoast 1 (2.0) 0 (0.0) 1 (0.61) 1 (3.0) 0 (0.0) 0 (0.06) 1 (4.0) 0 (0.0) 0 (0.11) +Sunraycer 3 (2.6) 1 (2.0) 1 (1.43) 3 (2.0) 0 (0.0) 0 (0.07) 1 (4.0) 0 (0.0) 0 (0.08) −Sweet Cap 1 (2.0) 0 (0.0) 0 (0.06) 2 (4.0) 1 (1.0) 1 (0.21) 0 (0.0) 0 (0.0) 0 (0.08) −Tirrenia 0 (0.0) 0 (0.0) na 1 (4.0) 1 (4.0) 1 (1.07) 1 (1.0) 1 (1.0) 1 (2.38) +Turmalina 2 (3.0) 0 (0.0) 0 (0.06) 2 (2.5) 0 (0.0) 0 (0.06) 1 (4.0) 1 (1.0) 1 (0.19) +Zincal 5 (Sunred) 3 (1.6) 0 (0.0) 0 (0.07) 3 (2.6) 1 (1.0) 1 (0.40) 0 (0.0) 0 (0.0) na naTotal 95 (2.4) 32 (1.5) 52 (0.83) 91 (2.8) 33 (1.3) 31 (0.58) 50 (2.6) 5 (1.1) 9 (0.79)

ympto

ss

3

ic

ofelcstp3

t

a Only plants whose rootstock had been effectively inoculated (showing sharka sb ns = not sprouted, na = not available.

ymptoms and ELISA-DASI or RT-PCR positive) or resistant (withoutymptoms and ELISA and RT-PCR negative).

. Results

Table 2 shows the behavior of the 40 peach cultivars grafted ontonfected ‘GF305′ peach rootstocks against PPV over three vegetativeycles.

Although five replications of each peach cultivar were graftednto the ‘GF305′ rootstocks, the final number of plants evaluatedor each cultivar in each cycle ranged from 5 to 1. The success of thevaluation process was determined by the efficiency of the inocu-ation of the rootstock and by effective bud break of the graftedultivars. In the first two cycles, the number of rootstocks withymptoms and sprouted cultivars was high (95 and 91, respec-ively). In the third cycle, this number fell to only 50. Among these

lants, the number with symptoms in the cultivars was lower (32,3 and 5), but followed a similar trend in each cycle.

In general, the mean intensity of symptoms in the rootstock inhe three cycles (2.4, 2.8 and 2.6) was higher than in the cultivars

ms) were considered for the evaluation process.

(1.5, 1.3 and 1.1), and thus were not greatly affected by the cycle ofstudy. Apart from the susceptible ‘GF305′ rootstocks, which showedmaximum intensity of symptoms (5), some cultivars, like ‘Romea’and ‘Tirrenia’, reached a symptom intensity of 4.

During the first cycle, ELISA allowed us to detect the virus notonly in symptomatic plants, but also in some asymptomatic plants,as well. Out of the 95 plants with symptoms in the rootstock, 32showed symptoms in the cultivar while in 52 PPV was detected byELISA. In the second cycle, the number of plants with symptomsand ELISA positive was almost the same (33 and 31, respectively),whereas in the third cycle, as previously mentioned, the numberof plants with symptoms and ELISA positive decreased (5 and 9respectively). On average, the optical density of peach cultivars inthe three cycles of evaluation was quite low (0.83, 0.58 and 0.79)compared to that of the peach ‘GF305′ positive control (3.28). WhileELISA positive samples were always RT-PCR positive, 5% of samples

that tested ELISA negative were RT-PCR positive.

According to the classification system developed by Cooperand Jones (1983), among the 40 cultivars evaluated, 5 were resis-tant (‘Catherine’, ‘Maruja M3′, ‘Melody’, ‘Red Camden’ and ‘Silver

84 M. Rubio et al. / Scientia Horticu

Table 3Overall classification of the sensitivity level of the peach cultivars to PPV-D iso-late according to the percentage of observations with sharka symptoms (numberof observations with symptoms/total number of observations) and the percentagethat were ELISA or RT-PCR positive (number of observations of ELISA or RT-PCRpositive/total number of observations), for the three cycles.

Cultivar Symptoms ELISA or RT-PCR

SensitiveCrimson Baby 1/1 100% 1/1 100%Niv11/03 1/1 100% 1/1 100%Tirrenia 2/2 100% 2/2 100%Romea 3/3 100% 3/3 100%Casasil 4/6 67% 5/6 83%Leonense 4/6 67% 5/6 83%Chato 6/10 60% 6/10 60%Sudanell 6/10 60% 6/10 60%Babygold 6 5/9 56% 5/9 56%Rio Grandense 4/8 50% 5/8 63%Pepita 2/4 50% 2/4 50%Flordastar 5/11 45% 7/11 64%Silvery 4/9 44% 4/9 44%Honey Prima 3/7 43% 7/7 100%Diamante 3/8 38% 3/8 38%Sweet Cap 1/3 33% 1/3 33%Early Top 3/10 30% 6/10 60%Niv10/03 1/4 25% 2/4 50%Maciel 2/8 25% 3/8 38%Turmalina 1/5 20% 1/5 20%Rayon 1/6 17% 2/6 33%Zincal-5 (Sunred) 1/6 17% 1/6 17%86.6 1/7 14% 2/7 29%Sunraycer 1/7 14% 1/7 14%Flored 1/8 13% 2/8 25%Springcrest 1/9 11% 3/9 33%Alicia 1/10 10% 4/10 40%Big Top 1/13 8% 3/13 23%

TolerantNiv30/02 0/4 0% 3/4 75%Big Bang 0/3 0% 2/3 67%Suncoast 0/3 0% 2/3 67%Granada 0/7 0% 3/7 43%Calabacero 0/3 0% 1/3 33%Snow Queen 0/7 0% 2/7 29%Lourdes 0/9 0% 1/9 11%

Resistant pending to be confirmedMaruja M3 0/1 0% 0/1 0%Melody 0/3 0% 0/3 0%Red Camden 0/2 0% 0/2 0%Silver King 0/1 0% 0/1 0%

Kdncw(sn‘ch‘‘sE

4

9

ResistantCatherine 0/12 0% 0/12 0%

ing’) although in the case of ‘Maruja M3′, ‘Melody’, ‘Red Cam-en’ and ‘Silver King’ this resistance must be confirmed with a highumber of replications; 7 were tolerant (‘Niv30/02′, ‘Big Bang’, ‘Sun-oast’, ‘Granada’, ‘Calabacero’, ‘Snow Queen’ and ‘Lourdes’); and 28ere sensitive, with a broad and continuous range of sensitivity

Tables 2 and 3) according to symptoms and virus detection. Inome of the sensitive cultivars (‘Tirrenia’, ‘Romea’, ‘Casasil’, ‘Leo-ense’, ‘Chato’, ‘Sudanell’, ‘Babygold 6′, ‘Rio Grandense’, ‘Pepita’,

Flordastar’, ‘Silvery’ and ‘Honey Prima’), the percentage of repli-ations with symptoms and ELISA and RT-PCR positive wasigh. In contrast, ‘Diamante’, ‘Sweet Cap’, ‘Early Top’, ‘Niv10/03′,

Maciel’, ‘Turmalina’, ‘Rayon’, ‘Zincal-5′, ‘86.6′, ‘Sunraycer’, ‘Flored’,Springcrest’, ‘Alicia’ and ‘Big Top’ showed a lesser degree of sen-itivity, with a low percentage of replications with symptoms andLISA or RT-PCR positive.

. Discussion

The number of evaluated plants within the study (95 in cycle 1,1 in cycle 2 and 59 in cycle 3) was relatively low in comparison

lturae 144 (2012) 81–86

with the total number of plants assayed (6 replications per cultivarwith a total of 240 plants assayed). This was mainly due to the lim-ited success of grafting (50% sprouted buds), and to a lesser degree,to inoculation (with 90% success), which was similar to other stud-ies (Rubio et al., 2009). Due to the results of both processes, 40% ofthe plants were evaluated. Given that problems of rootstock-graftcompatibility (peach–peach) are unlikely, the poor success in graft-ing could be linked to bud quality, as observed in other trials (Rubioet al., 2009), or to health status of the rootstock.

The number of evaluated plants drastically decreased in cycle3. Out of 50 plants showing symptoms in the rootstock, only 5showed symptoms in the cultivar. This could be due to the factthat PPV-D isolates are less aggressive in peach species. Candresseand Cambra (2006) suggested that PPV-D isolates are able to infectapricot and plum, and rarely spread to peach cultivars. However,Dallot et al. (1998) observed the existence of some atypical PPV-D, capable of efficiently infecting peach. Similarly, in our test wewere able to infect 90% of ‘GF305′ peach rootstocks with RB3.30and, despite the generally low symptom intensity of most cultivars,severe symptoms were observed on leaves of ‘Tirrenia’ and ‘Romea’cultivars. Besides the possible effect of the isolate, we have to takeinto account the different degree of sensitivity of the evaluatedcultivars against the different isolates.

Regarding the detection methods, our results showed again thehigher sensitivity of the RT-PCR in comparison with the ELISA-DASIfor the detection of PPV in Prunus where the virus presents a lowconcentration and an erratic distribution (Martínez-Gómez et al.,2003).

Some trials showed that resistance mechanisms may requiretime to be deployed. This was observed in descendants of ‘StarkEarly Orange’ apricot which, despite having shown symptoms ofsharka in the first cycle, recovered resistance later, suggesting aviral induced gene silencing (Karayiannis et al., 2008). Furthermore,Rubio et al. (2003) observed the disappearance of sharka symptomsin the susceptible ‘GF305′ peach rootstock after grafting Garriguesalmond cultivar. According to these observations, the decrease invirus infection (symptoms, ELISA, RT-PCR) in our third cycle, bothin rootstocks and cultivars, could also be a consequence of genesilencing.

The difference in behavior between replications of the samecultivar and between different cycles for the same plant wassignificant. For example, some replications of ‘Alicia’, ‘Rayon’,‘Springcrest’, ‘Sweet Cap’ or ‘Zincal-5′, only showed symptoms inthe second cycle. This irregularity, detected along the differentcycles or years of study, was also observed in apricot (Lambertet al., 2007; Moustafa et al., 2001; Rubio et al., 2007); peach‘GF305′ (Rubio et al., 2009); and plum (Hartmann and Neumüller,2006). Although no explanation has been given, some hypothesesattribute differences to the low concentration and irregular distri-bution of PPV in Prunus.

Information on sensitivity or resistance of peach cultivars to PPVis scarce and frequently published in proceedings or journals withlimited readership (Gabova, 1994; Escalettes et al., 1998; Tomaet al., 1998; Pascal et al., 2002; Tsiporidis et al., 2005; Polák et al.,2003; Polák and Oukropec, 2010; Casati et al., 2010; Pasquini et al.,2010). Furthermore, this information is often contradictory becauseof different evaluation conditions (locations, strains) and/or theauthenticity of plant material. This situation makes it difficult tocompare results, particularly in peach species, which has a highnumber of releases per year (Sansavini et al., 2006).

Our results, with 70% of the cultivars sensitive, confirm a gen-eralized peach sensitivity to PPV-D isolate tested. Some sensitive

cultivars (‘Turmalina’, ‘Zincal-5′, ‘Sunraycer’, ‘Flored’, ‘Big Top’, etc.)only showed sharka symptoms in one replication, and PPV wasdetected in less than 25% of the replicates. If we compare thesecultivars with the tolerant group, we observe that most tolerant

orticu

cdbipo

c‘tthuptcptr

Utm(‘i“CisritPsdP

5

esg1spdPidPgsthtcttaaKP

M. Rubio et al. / Scientia H

ultivars showed a higher percentage of infected replications thanid sensitive cultivars. In this perspective, the distinction betweenoth groups is not entirely clear. These results highlight the

mportance of accurate symptom observation during evaluation,articularly in the case of peach species and PPV-D, where intensityf symptoms was low.

Among the resistant cultivars, only ‘Catherine,’ with 12 repli-ates correctly evaluated, showed convincing results. ‘Maruja M3′,Melody’, ‘Red Camden’ and ‘Silver King’ behaved as resistant, buthe low number of replicates evaluated makes it necessary to repeathe evaluation. This resistance behavior must be confirmed with aigh number of replications. Polák et al. (2003), on the other hand,sed ‘Catherine’ as source of inoculum with PPV-D to infect othereach cultivars. Again, the different method used or the authen-icity of cultivars and M or D isolates could be the reason for theontradictory results. Furthermore, ‘Romea,’ obtained from openollination of ‘Catherine’, appeared very sensitive in our study. Dueo the different origins, pedigrees and peach type of these cultivars,esistance cannot be linked to any one of these characteristics.

In agreement with our results, Polák et al. (2003) evaluated 28SA peach cultivars against a PPV-D isolate by observation of symp-

oms and ELISA. They classified six as highly sensitive, eleven asedium sensitive, four as tolerant and eight as “medium resistant”

‘Flame Prince’, ‘Cotender’, ‘Newhaven’, ‘Ruby Prince’, ‘Sun Prince’,Jefferson’, ‘Camden’ and ‘Jersey Queen’), but none of them werencluded in our test. However, this classification of “tolerant” andmedium resistant” would match with our less sensitive cultivars.asati et al. (2010) evaluated 15 peach cultivars against a PPV-M

solate using ELISA and RT-PCR for just one cycle. They found nineensitive, two tolerant and four resistant cultivars (Fei Cheng, Har-ow Blood, Jing Yu and Rosa Dardi), none of which were evaluatedn our work. In order to be sure these cultivars are resistant, fur-her cycles of evaluation are necessary. Finally, our results withPV-D agree with those of Pascal et al. (2002), who observed a lowensitivity of ‘Diamante’ to a PPV-M isolate. These results againemonstrate the generally low susceptibility of peach species toPV-D.

. Conclusions and breeding perspectives

The general absence of resistance to PPV in peach has led breed-rs to search for new sources of resistance in other related wildpecies such as Prunus davidiana (Carrière) Franch. and Prunus fer-anensis (Kostov and Rjabov) Kovalev and Kostov (Kervella et al.,998; Pascal et al., 1998; Pasquini et al., 2010), or in other Prunuspecies such as Prunus cerasifera Ehrh., Prunus spinosa L. or Prunusumila Bailey (Polák and Oukropec, 2010) and almond (Prunusulcis Mill., D.A. Webb) (Martínez-Gómez et al., 2004). Recently,asquini et al. (2010) in a preliminary test, confirmed the suitabil-ty of P. davidiana as source of resistance for peach breeding, andiscarded the use of P. ferganensis. Rubio et al. (2010) also verified. davidiana as a possible source of resistance in peach, but sug-ested a polygenic nature for PPV resistance in peach and relatedpecies and the importance of the genetic background of the sensi-ive parent. In addition, since the use of these related species oftenas negative consequences on fruit quality, it is important the iden-ification of new sources of resistance within peach species and toonfirm, in suitable conditions, the behavior of the scarce “resis-ant cultivars” distinguished so far against PPV-D and PPV-M. Inhis sense, according to our results, ‘Catherine’ cultivar could be

genetic source for breeding for resistance to PPV-D isolates. Inddition, cultivars ‘Maruja M3′, ‘Melody’, ‘Red Camden’ and’ Silvering’ should be re-evaluated to confirm their resistant behavior toPV-D with a higher number of replications.

lturae 144 (2012) 81–86 85

Acknowledgments

This study was supported by a project of the Seneca Foundationof the Region of Murcia (08672/PI/08): “Importance, transmissionand resistance sources of the main viruses affecting stone fruits inthe Region of Murcia.”

References

Bernhard, R., Marénaud, C., Sutic, D., 1969. Le pêcher GF305 indicateur polyvalentdes virus des espèces a noyau. Ann. Phytopathol. 1, 603–617.

Cambra, M., Capote, N., Myrta, A., Llácer, G., 2006. Plum pox virus and the estimatedcosts associated with sharka disease. EPPO/OEPP Bull. 36, 202–204.

Cambra, M.A., Crespo, J., Gorris, M.T., Olmos, A., Martínez, M.C., Capote, N., Cambra,M., 2004. Detection and eradication of Plum pox virus Type M in Aragón (Spain).Acta Hort. 657, 231–235.

Candresse, T., Cambra, M., 2006. Causal agent of sharka disease: historical perspec-tive and current status of Plum pox virus strains. EPPO/OEPP Bull. 36, 239–246.

Casati, P., Bassi, D., Spadone, P., Bianco, P.A., 2010. Preliminary results on resistanceto PPV-M in Prunus persica (L.) Batsch. Julius-Kühn-Archiv 427, 323–326.

Cooper, J.I., Jones, A.T., 1983. Responses of plants to viruses: proposal for the use ofterms. Phytopathology 73, 127–128.

Dallot, S., Labonne, G., Boeglin, M., Quiot-Douine, L., Quiot, J.B., Candresse, T., 1998.Peculiar Plum pox potyvirus D-populations are epidemic in peach trees. ActaHort. 472, 355–365.

Escalettes, V., Dosba, F., Lansac, M., Eyquard, J.P., 1998. Genetic resistance to Plumpox virus in peaches. Acta Hort. 465, 689–698.

Gabova, M., 1994. Evaluation of peach and nectarine cultivars in Bulgaria for theirresistance to Plum pox potyvirus. EPPO/OEPP Bull. 24, 755–760.

Gass, T., Tobutt, K.R., Zanetto, A., Report of the working group on Prunus, 1996.European Cooperative Program for Crop Genetic Resources Networks (ECP/GR).International Plant Genetic Resources Institute, IPGRI, Roma.

Hartmann, W., Neumüller, N., 2006. Breeding for resistance: breeding for Plum poxvirus resistant plums (Prunus domestica L.) in Germany. EPPO/OEPP Bull. 36,332–336.

Karayiannis, I., Thomidis, T., Tsaftaris, A., 2008. Inheritance of resistance to Plum poxvirus in apricot (Prunus armeniaca L.). Tree Gen. Genomes 4, 143–148.

Kervella, J., Pascal, T., Pfeiffer, E., Dirlewanger, E., 1998. Breeding for multiresistancein peach tree. Acta Hort. 465, 177–184.

Lambert, P., Dicenta, F., Rubio, M., Audergon, J.M., 2007. QTL analysis of resistanceto sharka disease in the apricot (Prunus armeniaca L.) ‘Polonais’ x ‘Stark EarlyOrange’ F1 progeny. Tree Gen. Genomes 3, 299–309.

Martínez-Gómez, P., Rubio, M., Dicenta, F., Aparicio, F., Pallás, V., 2003. Comparativeanalysis of three diagnostic methods for the evaluation of Plum pox virus (PPV)resistance in apricot breeding programs. Acta Hort. 622, 353–357.

Martínez-Gómez, P., Rubio, M., Dicenta, F., Gradziel, T.M., 2004. Resistance to Plumpox virus (Dideron Isolate RB3.30) in a group of California almonds and transferof resistance to peach. J. Am. Soc. Hort. Sci. 129, 544–548.

Milosevic, T.M., Glisic, I.P., Milosevic, N.T., Glisic, I.S., 2010. Plum pox virus as a stressfactor in the vegetative growth fruit growth and yield of plum (Prunus domestica)cv. ‘Cacanska Rodna’. Eur. J. Plant Pathol. 126, 73–79.

Moustafa, T.A., Badenes, M.L., Martínez-Calvo, J., Llácer, G., 2001. Determination ofresistance to sharka (Plum pox) virus in apricot. Sci. Hort. 91, 59–70.

Németh, M., 1994. History and importance of Plum pox in stone-fruit production.EPPO/OEPP Bull. 24, 525–537.

Pascal, T., Kervella, J., Pfeiffer, F., Sauge, M.H., Esmenjaud, D., 1998. Evaluation ofinterspecific progeny Prunus persica cv. Summergrand × Prunus davidiana forresistance and some agronomic traits. Acta Hort. 465, 185–192.

Pascal, T., Pfeiffer, F., Kervella, J., 2002. Preliminary observations on the resistanceto sharka in peach and related species. Acta Hort. 592, 699–704.

Pasquini, G., Ferretti, L., Gentili, A., Verde, I., Micali, S., Conte, L., Barba, M., 2010.Evaluation of different peachgenotypes for resistance to Plum pox virus strainM: preliminary results. Julius-Kühn-Archiv 427, 334–338.

Polák, J., Pívalová, J., Dowler, W., Miller, W., 2003. Evaluation of American peachcultivars for resistance to Plum pox virus. Plant Protect. Sci. 39, 1–6.

Polák, J., Oukropec, I., 2010. Identification of interspecific peach and Prunus sp.Hybrids resistant to Plum pox virus. Plant Protect. Sci. 46, 1–6.

Quiot, J.B., Labonne, G., Boeglin, M., Adamolle, C., Renaud, L.Y., Candresse, T., 1995.Behaviour of two isolates of Plum pox inoculated on peach and apricot trees.First results. Acta Hort. 386, 290–297.

Rubio, M., Martínez-Gómez, P., Dicenta, F., 2003. Resistance of almond cultivars toPlum pox virus (Sharka). Plant Breed 122, 465–466.

Rubio, M., Audergon, J.M., Martinez-Gomez, P., Dicenta, F., 2007. Testing hypoth-esis of genetic control for Plum pox virus resistance in apricot. Sci. Hort. 112,361–365.

Rubio, M., García-Ibarra, A., Martínez-Gómez, P., Dicenta, F., 2009. Analysis of themain factors involved in the evaluation of Prunus resistance to Plum pox virus

(Sharka) in controlled greenhouse conditions. Sci. Hort. 123, 46–50.

Rubio, M., Pascal, T., Bachellez, A., Lambert, P., 2010. Quantitative trait loci anal-ysis of Plum pox virus resistance in Prunus davidiana P1908: new insightson the organization of genomic resistance regions. Tree Gen. Genomes 6,291–304.

8 orticu

S

S

S

6 M. Rubio et al. / Scientia H

ánchez-Navarro, J.A., Aparicio, F., Herranz, M.C., Minafra, A., Myrta, A., Pallás, V.,2005. Simultaneous detection and identification of eight stone fruit viruses by

one-step RT-PCR. Eur. J. Plant Pathol. 111, 77–84.

ansavini, S., Ganberuini, A., Bassi, D., 2006. Peach breeding, genetics and new cul-tivar trends. Acta Hort. 713, 23–48.

utula, C.L., Gillet, J.M., Morrissey, S.M., Ramsdell, D.C., 1986. Interpreting ELISA dataand establishing the positive–negative threshold. Plant Dis. 70, 722–726.

lturae 144 (2012) 81–86

Tsiporidis, C., Thomidis, T., Therios, I., Stylianides, D., 2005. Evaluation ofpeach and nectarine cultivars in northern Greece. J. Am. Pomol. Soc. 59,

57–61.

Toma, S., Ivascu, A., Balan, V., 1998. Analysis of level of PPV infection in peach andnectarine trees in southern Romania. Acta Hort. 472, 447–450.

Van Oosten, H.J., 1975. Susceptibility of some woody plant species, mainly Prunusspp., to sharka (Plum pox) virus. Neth. J. Plant Pathol. 81, 199–203.