Section J – Analysis and uses of cloned DNA. Plant cell Animal cell

Section Section J – Analysis and uses J – Analysis and uses of cloned DNAof cloned DNA

Plant cell

Animal cell

J1 Characterization of clonesJ1 Characterization of clones Characterization, Restriction mapping, Partial digestion,

Labeling nucleic acid, Southern and Northern blottingJ2 Nucleic acid sequencingJ2 Nucleic acid sequencing DNA sequencing, RNA sequencing, Sequence databases,

Analysis of sequences, Genome sequencing projectsJ3 Polymerase of cloned genesJ3 Polymerase of cloned genes PCR, the PCR cycle, Template, Primers, Enzymes, PCR optimization

, PCR variationsJ4 Organization of cloned genesJ4 Organization of cloned genes Organization, Mapping cDNA on genomic DNA,

S1 nuclease mapping, Primer extension, Gel retardation, DNase Ⅰfootprinting, Reporter genes

J5 Mutagenesis of cloned genesJ5 Mutagenesis of cloned genes Deletion mutagenesis, Site-directed mutagenesis, PCR mutagenesisJ6 Applications of cloned genesJ6 Applications of cloned genes Applications, Recombinant protein, Genetically modified organisms,

DNA fingerprinting, Medical diagnosis, Gene therapy

ContentsContents

J1 Characterization of clones — J1 Characterization of clones —

CharacterizationCharacterization

Preparation of pure DNA is the first step of any characterization.Plasmid DNA: from bacterial coloniesBacteiophage DNA: Plaque purified phage → → infecting a bacterial culture → → cell lysis → → phage particles → → phenol-chloroform, ethanol precipitate → → Bacteiophage DNA


Restriction mappingRestriction mapping

Example1 ：DigestsDigests Resultant Resultant

FragmentsFragments

EcoRI 3 kb, 5 kb

HindIII2 kb, 6 kb

EcoRI + HindIII 2 kb, 1 kb, 5 kb

• The most common application of restriction mapping is presented: The most common application of restriction mapping is presented: Determining the orientation of a cloned insert. This method requires Determining the orientation of a cloned insert. This method requires that restriction maps of the cloning vector and the insert are already that restriction maps of the cloning vector and the insert are already available.available.


Restriction mappingRestriction mapping

pGEM-12865 bp

Ava I (40)

Bam HI (35)

Eco RI (53)

Hin dIII (8)

Pst I (21)

Sma I (42)

Xma I (40)

Apa LI (589)

Apa LI (1835)

Apa LI (2332)

Example2 ：


Partial digestionPartial digestion

10 kb insert

Completedigestion

Partialdigestion

1 kb

2 kb

3 kb

4 kb6 kb7 kb10 kb

3kb 1kb 2kb 4kb

Can not delineate the restriction sites.

10 kb insert****

End-labeled radioactive DNA

Partial digestion

Agarose electrophoresis

Autoradiography

3 kb

4 kb6 kb10 kb

3 kb4 kb

6 kb

E E E3kb 1kb 2kb 4kb

Delineate the restriction sites by partial digested end-labeled radioactive DNA.


Labeling nucleic acidLabeling nucleic acid

1.End labeling: put the labels at the ends

2.Uniform labeling: put the labels internally

Radioactive labeling: display and/or magnify the signals by radioactivity Non-radioactive labeling: display and/or magnify the signals by Biotin and digoxin etc

1.End labeling

（ 1 ） Single stranded DNA/RNA

5’-end labeling: dephosphorylation polynucleotide kinase 3’-end labeling: terminal transferase

（ 2 ） Double stranded DNA/RNA

---------------------G---------------------CTTAAp5’

5’pAATTC G

Fill in the recessive 3’-ends （ 3’- 凹端） by DNA polymerase.

Labeled at both ends

For restriction mapping, cut the DNA with another enzyme

2. Uniformly labeling of DNA/RNA

（ 1 ） Nick translation （切口平移） : DNase I to introduce ra

ndom nicks DNA Pol I to

remove dNTPs from 5’ to 3’

and add new dNTP includi

ng labeled nucleotide at the

3’ ends.

（ 2 ） Hexanucleotid

e primed labeling( 六聚核苷酸引物标记， r

andom labeling 随机标记） : Denature DNA add r

andom hexanucleotide p

rimers and DNA pol sy

nthesis of new strand in

corporating labeled nucl

eotide.

3. Specific probes

（ 1 ） Strand-specific DNA probes: e.g.M13 DNA as template the missing strand can be re- synthesized by incorporating radioactive nucleotides.

（ 2 ） Strand-specific RNA probes


Southern and Northern blottingSouthern and Northern blotting

1. Southern blotting, for detecting DNA ;2. Northern blotting, for detecting RNA;3. Western blotting, for detecting protein.

Blot type Target Probe Applications

Southern DNA DNA or RNA mapping genomic clonesestimating gene numbers

Northern RNA DNA or RNA RNA sizes, abundance,and expression

Western Protein Antibodies protein size, abundance

1.Genomic DNA preparation

2.Restriction digestion

3.Denature with alkali

4.Agarose gel electrophoresis

5.DNA blotting/ transfer and fixation

6.Probe labeling 7.Hybridization

(temperature) 8.Signal detection

(X-ray film or antibody)

Southern analysisSouthern analysis

Northern blottingNorthern blotting

J2 Nucleic acid sequencing — J2 Nucleic acid sequencing —

DNA sequencingDNA sequencing

• Three main methods:

1. Maxam and Gilbert chemical method

2. Sanger`s enzymatic method

3. Sequencing by hybridization (SBH)

1. Maxam and Gilbert chemical method

The end-labeled DNA is subjected to base-specific cleavage reactions prior to gel separation.

Modification of bases:

• Methylation by dimethyl sulfate ： G (DMS)

• Formic acid: Purines A & G

• Hydrazine : hydrolyze T & C

• Hydrazine + high salt: only C

A A A G A T T A A G C C*

G A+G C+T C

Dimethyl sulfate Formic acid Hydrazine Hydrazine+high salt

烷基转移酶

2. Sanger`s enzymatic method2. Sanger`s enzymatic method

Uses dideoxynucleotides as chain terminators to produce a ladder of molecules generated by polymerase extension of primer

A C G T

3’GTGACTACTCAGGCACTTGCTTTGCC5’3’GTGACTACTCAGGCACTTGCTTTGCC5’

Sanger’s method

Template+primer (15-17nt)+dNTPs+ddNTPs+[35S]dATP+T7 DNA pol

PAGE

Autoradiography

Automatic sequencer

3. Sequencing by hybridization(SBH)


RNA sequencingRNA sequencing

• By base-specific cleavage ofBy base-specific cleavage of 5’-end-lab5’-end-lab

eledeled RNA using RNases that cleave 3’ tRNA using RNases that cleave 3’ t

o a particular nucleotide.o a particular nucleotide. Partial digestiPartial digesti

onon is required to generateis required to generate a laddera ladder of clof cl

eavage products which are analyzed byeavage products which are analyzed by

PAGE.PAGE.

RNase T1: cleaves after G

RNase U2: after A

RNase Phy M: after A and U

Bacillus cereus RNase: after U and C


Sequence databasesSequence databases

• DDBJ(DDBJ( 日本国家遗传学研究所日本国家遗传学研究所 )) http://www.ddbj.http://www.ddbj.nig.ac.jpnig.ac.jp

• EMBL-EBI (EMBL-EBI ( 欧洲生物信息研究所欧洲生物信息研究所 ) :) : http://www.http://www.ebi.ac.uk/Databases/index.htmlebi.ac.uk/Databases/index.html

• Genbank at NCBI Genbank at NCBI （美国国家生物技术信息中（美国国家生物技术信息中心）心） ::

http://www.ncbi.nlm.nih.govhttp://www.ncbi.nlm.nih.gov


Analysis of sequencesAnalysis of sequences

• Using computers and software packages, suUsing computers and software packages, such as GCG sequence analysis package.ch as GCG sequence analysis package.

• 1. Identify important sequence features such 1. Identify important sequence features such as restriction sites, open reading frames, staras restriction sites, open reading frames, start and stop codons, as well as potential promot and stop codons, as well as potential promoter sites, intron-exon junctions, etc.ter sites, intron-exon junctions, etc.

100 200 300 400 500 600 700

ORF #1

ORF #2

Sequence analysis of a cloned DNA sequence revealed some important features

2. Homology search by BLAST (NCBI) 2. Homology search by BLAST (NCBI)

or FASTA (EBI): or FASTA (EBI):

Compare new sequence with all Compare new sequence with all

other known sequences in the other known sequences in the

databases, which can determine databases, which can determine

whether related sequences have been whether related sequences have been

obtained before.obtained before.


Genome sequencing projectsGenome sequencing projects• With the development ofWith the development of automated DNA seqautomated DNA seq

uencersuencers andand robotic workstations robotic workstations to prepare to prepare samples for sequencing, the entire genome ssamples for sequencing, the entire genome sequence of several organisms have been detequence of several organisms have been determined. ermined.

• Many phages and virusesMany phages and viruses• Several Bacteria (Several Bacteria (E. coliE. coli, 4 x 106), 4 x 106)• Plant (Plant (Arabidopsis Arabidopsis 6.4 x 107 , rice)6.4 x 107 , rice)• Human 3.3 x 109Human 3.3 x 109

J3 Polymerase of cloned genes — J3 Polymerase of cloned genes — PCRPCR

• The polymerase chain reaction (PCR)The polymerase chain reaction (PCR) ：：• To amplify a sequence of DNA using To amplify a sequence of DNA using

a pair of primers each complementary ta pair of primers each complementary to one end of the DNA target sequence.o one end of the DNA target sequence.

J3 Polymerase of cloned genes — J3 Polymerase of cloned genes —

the PCR cyclethe PCR cycle• Denaturation : The target DNA (template) is s

eparated into two stands by heating to 95℃• Primer annealing : The temperature is reduce

d to around 55℃ to allow the primers to anneal.

• Polymerization (elongation, extension): The temperature is increased to 72℃ for optimal polymerization step which uses up dNTPs and required Mg++.

J3 Polymerase of cloned genes — J3 Polymerase of cloned genes — TemplateTemplate

• Single-or double-stranded form;• The size of the template DNA is not critical;• In the case of mammalian or plant genomic DNA,

up to 1.0 ug of DNA is utilized per reaction. The typical amounts of yeast, bacterial, and plasmid DNAs used per reaction are 10 ng, 1ng, and 1pg, respectively;

• Template DNA is dissoved in 10 mM Tris-Cl (pH 7.6) containing a low concentration of EDTA (<0.1 mM).

J3 Polymerase of cloned genes — J3 Polymerase of cloned genes — PrimersPrimers

• PCR primersPCR primers ：： aboutabout 18 to 3018 to 30 nt long nt long and with similar G+C contents.and with similar G+C contents.

• Tm=2(a+t)+4(g+c): determine annealinTm=2(a+t)+4(g+c): determine annealing temperature. If the primer is 18-30 nt, g temperature. If the primer is 18-30 nt, annealing temperature can beannealing temperature can be Tm-5oC.Tm-5oC.

If the target DNA is not known,there is only liIf the target DNA is not known,there is only li

mited amino acid sequence available.mited amino acid sequence available.

Degenerate primersDegenerate primers

An oligo pool derived from protein sequence.An oligo pool derived from protein sequence.

E.g. His-Phe-Pro-Phe-Met-Lys can generate a E.g. His-Phe-Pro-Phe-Met-Lys can generate a

primerprimer

CAU(CAC)-UUU(UUC)-CCU(CCC,CCA,CCG)- UUU(UUC)-AUG-AAA(AAG)CAU(CAC)-UUU(UUC)-CCU(CCC,CCA,CCG)- UUU(UUC)-AUG-AAA(AAG)

2x2x4x2x2 =642x2x4x2x2 =64

J3 Polymerase of cloned genes — J3 Polymerase of cloned genes — EnzymesEnzymes

• The most common is Taq polymerase from T

hermus aquaticus. It has no 3’ to 5’ proofread

ing exonuclease activity. Accuracy is low, no

t good for cloning.

• Pfu (Pyrococcus furiosus, Promega &

Stratagene),


PCR optimizationPCR optimization

• PCR cycle

• Enzymes

• Template DNA

• Mg++


PCR variationsPCR variations

1. Inverse PCR, IPCR1. Inverse PCR, IPCR

2. Anchored PCR, APCR2. Anchored PCR, APCR

3. asym metric PCR3. asym metric PCR4. Reverse transcription RT-PCR4. Reverse transcription RT-PCR5. 5. 修饰引物修饰引物 PCRPCR6. Nest PCR6. Nest PCR

7. multiplex PCR7. multiplex PCR8. 8. 重组重组 PCRPCR9. differential PCR, d-PCR9. differential PCR, d-PCR10. quantitative PCR, qPCR10. quantitative PCR, qPCR11. 11. in situin situ PCR PCR12. immuno-PCR12. immuno-PCR13. Thermal Asymmetric Interlaced PCR13. Thermal Asymmetric Interlaced PCR ，， TAIL-PCRTAIL-PCR

J4 Organization of cloned genes — J4 Organization of cloned genes —

OrganizationOrganization

• The absent sequences are usually intro

ns and sequences upstream of the tran

scription start site and down stream of

the 3’-processing site.

• Start and stop sites for transcription

• regulatory sequences.

J4 Organization of cloned genes — J4 Organization of cloned genes — Mapping cDNA on genomic DNAMapping cDNA on genomic DNA

• The genomic clone is digested on a gel and then suThe genomic clone is digested on a gel and then subjected to Southern blot using all or part of the cDNbjected to Southern blot using all or part of the cDNA as a probe. Show which genomic restriction fragmA as a probe. Show which genomic restriction fragments contain cDNAents contain cDNA sequencessequences

　　 Using a probe from one end of a cDNA can show theUsing a probe from one end of a cDNA can show the

polarity of the genepolarity of the gene in the genomic clone.in the genomic clone.

Some of the restriction sites will be common in both clSome of the restriction sites will be common in both cl

ones but may be different distances apart. ones but may be different distances apart.


S1 nuclease mappingS1 nuclease mapping• Determines the precise 5’- and 3’- ends of

RNA transcripts. Sequence ladder is required to determine the precise position.


Primer extensionPrimer extension• A primer is extended by a polymerase until the end of

the template is reached and the polymerase dissociated.• The length of the extended product indicates the 5’end of

temple.


Gel retardationGel retardation

Mixing a protein extract with a labeled DNMixing a protein extract with a labeled DN

A fragment and running the mixture on A fragment and running the mixture on

a native gel will show the presence of Da native gel will show the presence of D

NA-protein complex as retarded bands NA-protein complex as retarded bands

on the gel.on the gel.

J4 Organization of cloned genes — J4 Organization of cloned genes — DNase footprintingⅠDNase footprintingⅠ• The ‘footprint’ of a protein bound specifical

ly to a DNA sequence can be visualized by treating the mixture of end-labeled DNA plus protein with small amounts of DNase I prior to running the mixture on a gel.

• The footprint is a region with few bands in a ladder of cleavage products.


Reporter genesReporter genes

• To study the function of a control elemTo study the function of a control element of a gene like HSP70 (promoter and ent of a gene like HSP70 (promoter and regulatory elements). Reporter genes sregulatory elements). Reporter genes such asuch as β -galactosidase or luciferaseβ -galactosidase or luciferase to to “report” the promoter action.“report” the promoter action.

J5 Mutagenesis of cloned genes — J5 Mutagenesis of cloned genes —

Deletion mutagenesisDeletion mutagenesis

• In the cDNA clones,it is common to delIn the cDNA clones,it is common to delete progressively from the ends of the cete progressively from the ends of the coding region to discover which parts of oding region to discover which parts of the whole protein have particular propethe whole protein have particular properties.rties.

Exunuclease III ：

Unidirectional

deletion using

exonuclease III.


Site-directed mutagenesisSite-directed mutagenesis

Formerly, single-stranded templates preFormerly, single-stranded templates pre

pared using M13 were usedpared using M13 were used ：： Primer olPrimer ol

igonucleotide with desired mutation, exigonucleotide with desired mutation, ex

tension by DNA polymerase, then ligatitension by DNA polymerase, then ligati

on. on.

• Now PCR techniques are now preferredNow PCR techniques are now preferred


PCR mutagenesisPCR mutagenesis

• By making forward and reverse mutagenic primers and using other primers that anneal to common vector sequence, two PCR reactions are carried out to amplify 5’- and 3’- portions of the DNA to be mutated.

• The tow PCR products are mixed and used for another PCR using the outer primers only-Part of this product is then subcloned to replace the region to be mutated in the starting molecule.

J6 Applications of cloned genes — J6 Applications of cloned genes —

ApplicationsApplications

• Recombinant protein production

• Genetically modified organisms

• DNA fingerprinting

• Diagnostic kits

• Gene therapy

J6 Applications of cloned genes —J6 Applications of cloned genes —

Recombinant proteinRecombinant protein

Recombinant proteins ： Growth hormo

ne, insulin for diabetes ， interferon in

some immune disorders ， blood clotti

ng factor VIII in for hemophilia.


Genetically modified organismsGenetically modified organisms

• Introducing a foreign gene into an organism which can propagate creates a genetically modified organism.

• Transgenic sheep have been crested ro produce foreign proteins in their milk.

• Cloned genes are introduced into germ cells.


DNA fingerprintingDNA fingerprinting

• Hybridizing southern blots of genomic DNA with

probes that recognize simple nucleotide repeats

gives a pattern that is unique to an individual and

can be used an a fingerprint.

• This has applications in forensic science, animal and

plant breeding and evolutionary studies.

• Simple nucleotide repeats vary in number between

individuals but are inherited.


Medical diagnosisMedical diagnosis

• The sequence information derived from cloni

ng medically important genes has allowed th

e design of many diagnostic test kit which ca

n help predict and confirm a wide range of di

sorders.

• By using sequence information to screen pati

ents.


Gene therapyGene therapy

• Attempts to correct a genetic disorder by delivering a gene to a patient are described as gene therapy.

• To treat some genetic disorders by delivering a normal copy of the defective gene to patients. The gene can be cloned into a virus that can replicate but not cause infection.

Multiple choice Multiple choice questionsquestions

1. A linear DNA fragment is (100%) labeled at one end and has 3 restriction sites for EcoRI. If it is partially digested by EcoRI so that all possible fragments are produced how many of these fragments will be labeled and how many will not be labeled?

A 4 labeled; 6 unlabeled. B 4 labeled; 4 unlabeled. C 3 labeled: 5 unlabeled. D 3 labeled; 3 unlabeled. 2. Which of the following are valid methods of labeling duplex DN

A? A 5'-end labeling with polynucleotide kinase. B 3'-end labeling with polynucleotide kinase. C 3'-end labeling with terminal transferase.D 5'-end labeling with terminal transferase.E nick translation.

3. Which one of the following statements about nucleic acid sequencing is correct?

A. the Sanger method of DNA sequencing involves base specific cleavages using piperidine.

B. the Maxam and Gilbert method of DNA sequencing uses a DNA polymerase and chain terminat ing dideoxynucleotides.

C. enzymatic sequencing of RNA uses RNases A, T1, Phy M and B. cereus RNase.

D enzymatic sequencing of DNA uses a primer which is extended by an RNA polymerase.

E enzymatic sequencing of RNA uses RNases T1, U2, Phy M and B. cereus RNase.

4 Which one of the following statements about peR is false? A the PCR cycle involves denaturation of the template ， annealing of the

primers and polymerization of nucleotides. B PCR uses thermostable DNA polymerases. C ideally PCR primers should be of similar length and G+C content. D PCR optimization usually includes varying the magnesium concentrati

on and the polymerization temperature. E if PCR was 100% efficient, one target molecule would amplify to 2n afte

r n cycles.

5. Which two of the following statements about gene mapping techniques are true?

A. S1 nuclease mapping determines the nontranscribed regions of a gene. B. primer extension determines the 3'-end of a transcript. C. gel retardation can show whether proteins can bind to and retard the migrati

on of a DNA frag ment through an agarose gel. D. DNase I footprinting determines where on a DNA fragment a protein binds. E the function of DNA sequences in the promoter of a gene can be determined

if they are ligated downstream of a reporter gene and then assayed for expression.

6. Which one of these statements about mutagenesis techniques is false?

A. exonuclease III removes one strand of DNA in a 5' to 3' direction from a recessed 5'-end.

B. exonuclease III removes one strand of DNA in a 3' to 5' direction from a recessed 3'-end.

C. mutagenic primers can be used in PCR to introduce base changes.D. mutagenic primers can be used with a single stranded template and DNA p

olymerase to intro duce base changes.E. deletion mutants can be created using restriction enzymes.

7. Which one of these statements about the applications of gene cloning is false?

A large amounts of recombinant protein can be produced by gene cloning.

B DNA fingerprinting is used to detect proteins bound to DNA.

C cloned genes can be used to detect carriers of disease-causing genes.

D gene therapy attempts to correct a disorder by delivering a good copy of a gene to a patient.

E genetically modified organisms have been used to produce clinically important proteins.

THANK YOU !

Documents

Section J – Analysis and uses of cloned DNA. Plant cell Animal cell