ORIGINAL ARTICLES

Screening of Patients with MaternallyTransmitted Diabetes for MitochondrialGene Mutations in the tRNALeu(UUR)

RegionK. Tsukuda*1, Y. Suzuki2, K. Kameoka3, N. Osawa3, Y. Goto4, H. Katagiri1, T. Asano1, Y.Yazaki1, Y. Oka5

1Third Department of Internal Medicine, Faculty of Medicine,University of Tokyo, Tokyo, Japan,2Saiseikai Central Hospital, Tokyo, Japan,3First Department of Internal Medicine, Osaka Medical College,Osaka, Japan,4Department of Ultrastructural Research, National Institute ofNeuroscience, Tokyo, Japan,5Third Department of Internal Medicine, Yamaguchi University,Yamaguchi, Japan

To investigate the prevalence and clinical characteristics of diabetes mellitus caused bymitochondrial gene mutations in the tRNALeu(UUR) region, a known ‘hot spot’ for pathogenicmutations, we screened 440 diabetic patients with diabetic mothers for 11 mitochondrialgene mutations reported in mitochondrial neuromuscular disorders; nucleotide pairs (np)3250, 3251, 3252, 3254, 3256, 3260, 3271, 3291, 3302 and 3303 in addition to an A toG transition at np 3243. The dot-blot hybridization method using 32P-labelled sequence-specific oligonucleotides as probes was used. One subject carrying a T to C transition atnp 3271 and seven carrying the A to G transition at np 3243 were identified, while noneof the other diabetic patients screened had these mutations in the tRNALeu(UUR) region.The patient with the 3271 mutation, a 39-year-old male, had excellent glycaemic controlwith diet alone and had neither hearing impairment nor symptoms suggesting mitochondrialmyopathy, encephalopathy, lactic acidosis and stroke-like episodes (MELAS). Thus, amongpatients with maternally transmitted diabetes, the prevalence of the 3271 mutation wasapproximately one-seventh that of the 3243 mutation, and other mutations are even morerare in the mitochondrial tRNALeu(UUR) region. 1997 by John Wiley & Sons, Ltd.

Diabet. Med. 14: 1032–1037 (1997)

No of Figures: 4. No of Tables: 2. No of Refs: 34

KEY WORDS mitochondrial mutation; sequence-specific oligonucleotide; dot-blothybridization; diabetes mellitus

Received 29 October 1996; revised 27 May 1997; accepted 2 July 1997

muscular disorders has yielded a number of mitochondrialIntroductiongene mutations, including an A to G transition at np3243 in MELAS (mitochondrial myopathy, encephalopa-Cells harbour thousands of mitochondria and each

mitochondrion contains 2–10 copies of mitochondrial thy, lactic acidosis and stroke like episodes) syndrome3,4

and an A to G transition at np 8344 in myoclonicDNA, a circular molecule 16 569 base pairs in length.It encodes 13 subunits of the respiratory chain and ATP- epilepsy associated with ragged-red fibres (MERRF).5

In addition to these mitochondrial encephalomyop-generating system, as well as two ribosomal RNAs and22 transfer RNAs needed for mitochondrial protein athies, mitochondrial gene mutations have been found

in patients with diabetes mellitus, a much more commonsynthesis.1 The human mitochondrial DNA sequence hasa very high mutation rate, at least 10 times that of disease. A large mitochondrial gene deletion flanked by

a 10 bp direct repeat at np 4387 and 14812 was reportednuclear genes.2 These mitochondrial DNA mutationsmay cause human diseases.2 In fact, research on neuro- in a pedigree with maternally transmitted diabetes

mellitus and sensorineural deafness.6,7 Subsequently, anA to G transition at np 3243, the same mutation asAbbreviations: MELAS mitochondrial myopathy, encephalopathy, lactic

acidosis and stroke-like episodes, MERFF myoclonic epilepsy with reported in MELAS, was found in a pedigree with non-ragged red fibres, mtRNA mitochondrial RNA, tRNA transfer RNA insulin-dependent (type 2) diabetes mellitus (NIDDM)* Correspondence to: Dr Katsunori Tsukuda, Third Department of

and deafness.8,9 More than 10 point-mutations have beenInternal Medicine, Faculty of Medicine, University of Tokyo, 7-3-1Hongo, Bunkyo-ku, Tokyo, 113, Japan reported in neuromuscular disorders10 in the tRNALeu(UUR)

1032 CCC 0742–3071/97/141032–06$17.50 1997 by John Wiley & Sons, Ltd. DIABETIC MEDICINE, 1997; 14: 1032–1037

ORIGINAL ARTICLESregion of the mitochondrial gene, suggesting that this at 60 °C for 1 min, and extension at 72 °C for 1 min,

with a final extension at 72 °C for 3 min.region is a ‘hot spot’ in mitochondrial disease. Further-more, as the 3243A-G mutation in this region has been Equal amounts (2 ml) of amplified DNA were spotted

onto nylon filters, which had been pretreated by incu-found in considerable numbers of diabetic patients,10–12

it is thought to be worth while to screen patients with bation in 10 × SSPE (1.5 M NaCl, 0.1 M NaH2PO4,0.01 M EDTA, pH 7.4). The filters were remoistened withmaternally transmitted diabetes for mutations other than

the 3243 mutation in this region. The tRNA encoding 0.4 M NaOH and then soaked in 10 × SSPE. The DNAside of the filters was illuminated with a 254 nm UVregions including the tRNALeu(UUR) gene were screened

for potentially diabetogenic mtDNA defects, using the lamp at 0.12 J cm−2. The filters were prehybridized in3 M tetramethylammonium (TMAC), 50 mM Tris-HCltechnique of SSCP analysis, in 124 NIDDM patients.13,14

However, screening for mutations other than the 3243 (pH 8.0), 2 mM EDTA (pH 8.0), 0.1% sodium dodecylsulfate (SDS), 5 × Denhardt’s solution, and 1% (wt vol−1)mutation, reported in neuromuscular disorders, in the

tRNALeu(UUR) region has not been performed systematically salmon sperm DNA for 1–5 h at 55 °C.25

19-mer oligonucleotides with the mutant nucleotidein a large number of diabetic patients.Therefore, we screened 440 diabetic patients with in the central position were synthesized as probes

(Table 1) and labelled with [g-32P] dATP (ICN) to adiabetic mothers for 11 gene mutations in the mitochon-drial tRNALeu(UUR) region in this study; np 3250 specific activity of at least 108 cpm mg DNA−1.26 The

filters were hybridized with [g-32P] dATP 5′-end-labelled(myopathy),15 3251 (myopathy),16 3252 (MELAS),17

3254,10 3256 (MERRF and chronic progressive external synthetic oligonucleotide for 1–3 h at 55 °C.25 Filterswere washed twice in rinse buffer (2 × SSPE, 0.1% SDS)ophthalmoplegia (CPEO)),18 3260 (myopathy and

cardiomyopathy),19 3271 (MELAS),20 3291 (MELAS),21 for 10 min at room temperature and then twice in TMACsolution (50 mM Tris-HCl (pH 8.0), 3 M TMAC, 2 mM3302 (myopathy),22 and 3303 (myopathy and

cardiomyopathy)23 in addition to screening at np 3243. EDTA (pH 8.0)) for 10 min at 58 °C.25 Filters wereexposed to Kodak XOMAT film for 2–5 h at −70 °C. Thepositive controls for the mutations at np 3243 andPatients and Methods3271 were recruited from among patients describedpreviously.11,20 When the mutant mtDNA were notPatientsavailable, DNA fragments of approximately 200 bpincluding the portion surrounding the mutated nucleotideFour hundred and forty unrelated diabetic patients were

selected from among those regularly seen in our out- were synthesized by PCR and used as positive controls.The gene mutation suggested by the dot-blot hybridiz-patient diabetes clinics. The only criterion for selection

was that the patient’s mother also had diabetes, based ation was subsequently confirmed by sequencing; mtDNAfragments were subcloned into a plasmid vector using aon patient interviews. Other information such as type of

diabetes, age, sex, the mode of treatment, and the TA cloning kit (Invitrogen, San Diego, California, USA)and sequenced with an ABI sequencer. These clonespresence of hearing impairment or symptoms suggesting

mitochondrial encephalopathy were not considered. TheTable 1. Sequence-specific oligonucleotidesstudy subjects consisted of 249 men (age 45.0 ± 12.8

years) and 191 women (47.2 ± 16.9 years), of whom 58Mutation Oligonucleotide probe(13.2 %) also had fathers with diabetes, based on patient

interviews. Children are not usually followed at the3243A-G TTACCGGGCCCTGCCATCT (3252–3234)clinics participating in this study. Furthermore, the3250T-C AGAGCCCGGCAATCGCATA (3241–3259)incidence of insulin-dependent (Type 1) diabetes mellitus

(IDDM) is much lower in Japan than in western countries. 3251A-G TTATGCGATCACCGGGCTC (3260–3242)Consequently, only 11 patients had been clinically

3252A-G TTTATGCGACTACCGGGCT (3261–3243)diagnosed as having IDDM at the onset based on thecriteria of the National Diabetes Data Group.24

3254C-T GTTTTATGCAATTACCGGG (3263–3245)

3256C-T AAGTTTTATACGATTACCG (3265–3247)DNA Studies3260A-G TTTTAAGTTCTATGCGATT (3269–3251)

Mitochondrial DNA (mtDNA) was isolated from the3271T-C ACTTAAGTTCTATGCGATT (3262–3280)

peripheral leukocytes of patients and a mtDNA fragment3291A-G AGGTTCAATCCCTCTTCTT (3300–3282)surrounding the tRNALeu(UUR) mutation site was amplified

by polymerase chain reaction using sense primer 5′- 3302A-G GGTATGTTGCTAAGAAGAG (3311–3293)AAGGTTCGTTTGTTCAACGA (np 3029–3048) and anti-

3303C-T GGGTATGTTATTAAGAAGA (3312–3294)sense primer 5′-AGCGAAGGGTTGTAGTAGCC (np3456–3437) as previously reported.8 The reaction con-

The nucleotide underlined is specific for each mutation. Probes forditions were: initial denaturation for 3 min at 94 °C then 3243A-G, 3251A-G, 3252A-G, 3254C-T, 3256C-T, 3260A-G, 3291A-

G, 3302A-G and 3303C-T are anti-sense oligonucleotides.30 cycles of denaturation at 94 °C for 1 min, annealing

1033SCREENING OF DIABETIC PATIENTS FOR MITOCHONDRIAL GENE MUTATIONS

1997 by John Wiley & Sons, Ltd. Diabet. Med. 14: 1032–1037 (1997)

ORIGINAL ARTICLESwere also used for determination of the level of 3271 (Figure 1(B)). His mother and grandmother had diabetes

mellitus but did not require insulin therapy. His youngermutation heteroplasmy; randomly selected clones wereanalysed by the dot-blot hybridization method. In sister had normal glucose tolerance. None of the family

members investigated had either hearing impairment oraddition, the presence of heteroplasmy was examinedby digestion with restriction endonuclease Afl II of PCR symptoms suggesting MELAS. The absence of hearing

loss was confirmed by audiometry in the proband andproducts (170 bp) amplified using modified primers aspreviously reported,20 and subsequent agarose gel electro- in his sister. Clinical features of the seven patients

harbouring the 3243 mutation are presented in Table 2.phoresis.The prevalence of the 3243 mutation was approximately1.6% among patients with maternally transmitted dia-Resultsbetes mellitus.

To confirm that the mutation at np 3271 is indeed aWe screened 440 patients with maternally transmitteddiabetes mellitus, using the dot-blot hybridization T to C transition, mtDNA fragments from this patient

were subcloned into a plasmid vector and sequencedmethod, for 11 point-mutations in the tRNALeu(UUR) regionof the mitochondrial gene. These 11 point-mutations with an ABI DNA sequencer. As shown in Figure 2, a T

to C transition at np 3271 in the mitochondrial gene washave been reported in neuromuscular disorders. Nodiabetic patients having the mutation at np 3250, 3251, confirmed. The mutation was proven to be heteroplasmic

based on the following results. Eight independent clones3252, 3254, 3256, 3260, 3291, 3302 or 3303 in themitochondrial gene were found. We did, however, were randomly selected from PCR-amplified mtDNA

fragments and screened for the 3271 mutation by theidentify one diabetic patient carrying a T to C transitionat np 3271 (Figure 1(A)) and seven carrying an A to G dot-blot hybridization method. Three out of 8 clones

had the point-mutation at np 3271 (data not shown),transition at np 3243 in the tRNALeu(UUR) region ofmtDNA (data not shown). The case with the 3271 suggesting an approximately 40 % rate of mutant mtDNA

in peripheral blood leukocytes. The presence of hetero-mutation was a 39-year-old male who maintainedexcellent glycaemic control with diet therapy alone. His plasmy is consistent with the results obtained with Afl II

digestion of the DNA fragments amplified using modifiedmother and younger sister carried the same mutationprimers (Figure 3). The same mutation was also observedin hair follicles and a muscle biopsy specimen from theproband (Figure 1(A)).

To investigate the sensitivity of this dot-blot hybridiz-ation method, mtDNA fragments from a diabetic patientwith the 3243 mutation (degree of heteroplasmy: 29 %)27

and from a diabetic patient with the 3271 mutation(degree of heteroplasmy: 38 %) were mixed with mtDNAfragments from normal controls in various proportionsand spotted onto the filter. The dot-blot hybridizationrevealed that the presence of 2.0 % mutant DNA withthe 3243 mutation (Figure 4(A)) and 2.0 % mutant DNAwith the 3271 mutation (Figure 4(B)) resulted in a signaldistinct from that of control mtDNA.

Discussion

Eleven disease-related mutations have been described inthe mitochondrial tRNALeu(UUR) gene, accounting forapproximately 60 % of all known mitochondrial tRNAgene mutations.10,18 A mutation involving an A to Gtransition at np 3243 was first described in this regionin MELAS patients.3,4 Complex I deficiency and decreasedsynthesis of a number of polypeptides were demonstrated

Figure 1. Screening for the 3271 mutation in the mitochondrialin osteosarcoma cell hybrids having this mutation.28 AtRNALeu(UUR) region by the dot-blot hybridization method. (A)T to C transition at position 3256 was also reported1. Peripheral blood leukocytes from the proband, 2. hair

follicles from the proband, 3. a muscle biopsy specimen from to be associated with impaired activity of respiratorythe proband, 4. peripheral blood leukocytes from a normal complexes I and IV and a decrease in steady-state levels ofsubject, 5. peripheral blood leukocytes from a 3271-MELAS mitochondrial tRNALeu(UUR).29 Furthermore, accumulationpatient. (B) 1. Hair follicles from the proband’s mother, 2. hair

of more than 87 % MELAS 3271 mutant mtDNA impairedfollicles from the proband’s sister, 3. peripheral blood leukocytescomplex I activity and mtDNA encoded polypeptidefrom a normal subject, 4. peripheral blood leukocytes from a

3271-MELAS patient synthesis in Hela cell cybrid clones.30 Therefore, it is

1034 K. TSUKUDA ET AL.

Diabet. Med. 14: 1032–1037 (1997) 1997 by John Wiley & Sons, Ltd.

ORIGINAL ARTICLESTable 2. Clinical features of seven patients harbouring the 3243A-G mutation in thetRNALeu(UUR) region

Case Age at last Sex Age at onset of Type of diabetes Hearing loss Therapynumber examination diabetes mellitus mellitus

(yr) (yr)

1 61 M 46 NIDDM + Glielazide2 63 M 40 NIDDM − Insulin3 53 F 49 NIDDM − Insulin4 50 F 34 NIDDM + Insulin5 53 F 34 NIDDM + Insulin6 57 F 46 IDDM + Insulin7 32 M 30 NIDDM + Insulin

Figure 3. The presence of heteroplasmy of 3271 mutation.Amplified DNA was obtained after 30 cycles at 94 °C for 30 s,45 °C for 30 s and 72 °C for 2 min. A new band (140 bp),obtained by digestion with Afl II in addition to the initialPCR product (170 bp), was electrophorectically detected inperipheral blood leukocytes from the proband (lane 1). Theperipheral blood leukocytes results for a normal subject areshown in lane 2

reasonable to speculate that other point-mutations in thetRNALeu(UUR) region would cause similar abnormalitiesincluding impaired activity of respiratory complex I,leading to impairment of mitochondrial oxidative phos-phorylation and ATP production.

Since oxidative phosphorylation in mitochondria isthought to play a crucial role in insulin secretion frompancreatic beta cells in response to glucose and othernutrients, it has been suggested that other mutations inthe tRNALeu(UUR) region may cause diabetes mellitus.31–

33 Therefore we screened 440 patients with maternallytransmitted diabetes mellitus for these mutations. Thedot-blot hybridization method employed, which usessequence-specific oligonucleotides as probes, was

Figure 2. mtDNA sequence surrounding the mutated site inassumed to be very sensitive, as the existence of as littlethe mitochondrial tRNALeu(UUR) region. (A) Mitochondrial geneas 2.0 % mutant mtDNA was detected in np 3243 andfrom a normal subject; (B) mutated mitochondrial gene from

the proband 3271 mutations. This method was also useful for screening

1035SCREENING OF DIABETIC PATIENTS FOR MITOCHONDRIAL GENE MUTATIONS

1997 by John Wiley & Sons, Ltd. Diabet. Med. 14: 1032–1037 (1997)

ORIGINAL ARTICLESthe 3271 mutation among these 440 patients, so theprevalence of the 3271 mutation was one-seventh thatof the 3243 mutation in our maternally transmitteddiabetes patient population. In MELAS, the prevalenceof the 3271 mutation was reported to be approximately10 % that of the 3243 mutation.20 Thus, the relativeprevalence of the 3271 to the 3243 mutation in diabetesmellitus was similar to that observed in MELAS. Nodiabetic patients with 3250, 3251, 3252, 3254, 3256,3260, 3291, 3302 or 3303 point-mutations were foundamong our 440 subjects, indicating that these mutationsin the tRNALeu(UUR) region are rare in patients withmaternally transmitted diabetes. However, it is possiblethat some mutations were undetectable in our studyusing peripheral blood leukocyte DNA because the levelsof heteroplasmy in peripheral blood leukocytes are muchlower than those in post-mitotic tissues. An example ofsuch a situation is provided by the 15990G-A mutation,which was undetectable in peripheral blood leukocytes,while being present at high levels in post-mitotic tissuessuch as muscle.34 Similarly, our present study was notdesigned to detect other possible pathogenic mutationsFigure 4. Sensitivity of the dot-blot hybridization; (A) mtDNAin the tRNALeu(UUR) gene.fragments from a diabetic patient with the 3243A-G mutation

It is not clear at present why the same mutation,(degree of heteroplasmy: 29 %, from Yamasoba et al.27); (B)a diabetic patient with the 3271T-C mutation (degree of 3243A-G or 3271T-C, causes two distinct clinical entities,heteroplasmy: 38 %) were mixed with mtDNA from normal diabete mellitus and MELAS. The present results, demon-controls in various proportions and spotted onto the filter to

strating the similar relative prevalence of the 3243 versusexamine the threshold for detecting a low level of mutantthe 3271 mutation in diabetes mellitus and MELAS,mtDNA. The degree of heteroplasmy (as a percentage) isindicate that neither of these mutations predominatesindicated above each filterin either condition. The difference in the extent ofheteroplasmy in various tissues and the organ-specificthresholds for energy demands might be responsible forof a large number of diabetic patients for known point-

mutations. Using this method, we identified one NIDDM the phenotypic variability among subjects having the3243A-G or the 3271T-C mutation. The higher prevalencepatient harbouring a T to C transition at np 3271. The

proband’s mother and younger sister carried the same of the 3243 mutation, as compared to the 3271 mutation,in both diabetes mellitus and MELAS, may simply reflectmutation, suggesting that this mutation was maternally

transmitted. In addition, the proband’s mother and a greater mutation rate at np 3243 than at np 3271.Another possibility is that impairment of mitochondrialgrandmother were also diabetic, strongly suggesting an

association of this mutation with the development function caused by the 3243 mutation is more severe thanthat caused by the 3271 mutation, as described above.of diabetes mellitus. The proband, his mother and

grandmother had diabetes mellitus but did not require In summary, the prevalence of the 3271 mutation wasapproximately one-seventh that of the 3243 mutation,insulin therapy, and none of the family members

investigated had hearing impairment. Thus, the diabetic and other mutations are apparently even more rare inthe mitochondrial tRNALeu(UUR) region, among Japanesephenotype of patients with the 3271 mutation appears

to be different from that of diabetic patients with the patients with maternally transmitted diabetes mellitus.3243 mutation. These differences suggest that the 3243mutation may cause more severe impairment of mito-chondrial function than the 3271 mutation. However, it Referencesis also possible that the different phenotypic picture

1. Attardi G, Schatz G. Biogenesis of mitochondria. Annusimply reflects differences in the percentage heteroplasmyRev Cell Biol 1988; 4: 289–333.

in the pancreas. 2. Wallace DC. Mitochondrial genetics: a paradigm for agingAmong these 440 patients, we identified 7 who had and degenerative disease? Science 1992; 256: 628–632.

3. Goto Y, Nonaka I, Horai S. A mutation in the tRNALeu(UUR)the tRNALeu(UUR)-3243 mutation. The prevalence of thisgene associated with MELAS subgroup of mitochondrial3243 mutation (1.6 %) in patients with maternallyencephalomyopathy. Nature 1990; 348: 651–653.transmitted diabetes was somewhat low, compared to

4. Kobayashi Y, Momoi MY, Tominaga K, Momoi T, Niheithe prevalence of 1.5 % in all diabetic patients10 and K, Yanagisawa M, et al. A point mutation in the5.7 % in maternal NIDDM,10 but very similar to that in mitochondrial tRNALeu(UUR) gene in MELAS (mitochondrial

myopathy, encepharopathy, lactic asidosis and stroke-likeour previous report.11 We identified one patient with

1036 K. TSUKUDA ET AL.

Diabet. Med. 14: 1032–1037 (1997) 1997 by John Wiley & Sons, Ltd.

ORIGINAL ARTICLESepisodes). Biochim Biophys Res Comm 1990; 173: 20. Goto Y, Nonaka I, Horai S. A new mtDNA mutation

associated with mitochondrial myopathy, encephalopathy,816–822.lactic acidosis and stroke-like episodes (MELAS). Biochim5. Shoffner JM, Lott MT, Lezza AMS, Seibel P, Ballinger SW,Biophys Acta 1991; 1097: 238–240.Wallace DC. Myoclonic epilepsy and ragged-red fiber

21. Goto Y, Tsugane K, Tanabe Y, Nonaka I, Horai S. Adisease (MERRF) is associated with a mitochondrial DNAnew point mutation at nucleotide pair 3291 of thetRNALys mutation. Cell 1990; 61: 931–937.mitochondrial tRNALeu(UUR) gene in a patient with mito-6. Ballinger SW, Shoffner JM, Hedaya EV, Trounce I, Polakchondrial myopathy, encephalopathy, lactic acidosis andMA, Wallace DC. Maternally transmitted diabetes andstroke-like episodes (MELAS) Biochim Biophys Res Commdeafness associated with a 10.4 kb mitochondrial DNA1994; 202: 1624–1630.deletion. Nature Genet 1992; 1: 11–15.

22. Goto Y, Tojo M, Tohyama J, Horai S, Nonaka I. A novel7. Poulton J, Deadmann ME, Bindoff L, Morten K, Land J,point mutation in the mitochondrial tRNALeu(UUR) gene in aBrown G. Families of mtDNA re-arrangements can befamily with mitochondrial myopathy. Annals of Neurologydetected in patients with mtDNA deletions: duplications1992; 31: 672–674.may be a transient intermediate form. Hum Mol Genet

23. Silvestri G, Santorelli FM, Shanske S, Whitley CB,1993; 2: 23–30.Schimmenti LA, Smith SA, DiMauro S. A new mtDNA8. Van den Ouweland JMW, Lemkes HHPJ, Ruitenbeek W,mutation in the tRNALeu(UUR) gene associated with mater-Sandkujli LA, De Vijlder MF, Struyvenberg PAA, et al.nally inherited cardiomyopathy. Hum Mutat 1994; 3:Mutation in mitochondrial tRNALeu(UUR) gene in a large37–43.pedigree with maternally transmitted type II diabetes

24. National Diabetes Data Group. Classification and diag-mellitus and deafness. Nature Genet 1992; 1: 368–371.nosis of diabetes mellitus and other categories of glucose9. Reardon W, Ross RJM, Sweeney MG, Luxon LM, Pembreyintolerance. Diabetes 1979; 28: 1039–1057.ME, Harding AE, Trembath RC. Diabetes mellitus associa-

25. Wood WI, Gitcher J, Lasky LA, Lawn RM. Base compo-ted with pathogenic point mutation in mitochondrialsition-independent hybridization in tetramethylammon-DNA. Lancet 1992; 340: 1376–1379.ium chloride: a method for oligonucleotide screening of10. Gerbitz K-D, Van den Ouweland JMW, Maassen JA,highly complex gene libraries. Proc Natl Acad Sci USAJaksch M. Mitochondrial gene mutation: a review. Biochim1985; 82: 1585–1588.Biophys Acta 1995; 1271: 253–260.

26. Kipps TJ, Fong S, Tomhave E, Chen PP, Goldfien RD,11. Katagiri H, Asano T, Ishihara H, Inukai K, Anai M,Carson DA. High-frequency expression of a conservedYamanouchi T, et al. Mitochondrial diabetes mellitus:kappa light-chain variable-region gene in chronic lympho-prevalence and clinical characterization of diabetes duecytic leukemia. Proc Natl Acad Sci USA 1987; 84:to mitochondrial tRNALeu(UUR) gene mutation in japanese 2916–2920.patients. Diabetologia 1994; 37: 504–510. 27. Yamasoba T, Yoshitomo O, Tsukuda K, Nakamura M,12. Kadowaki T, Kadowaki H, Mori Y, Tobe K, Sakuta R, Kaga K. Auditory findings in patients with maternally

Suzuki, Y, et al. A subtype of diabetes associated with a inherited diabetes and deafness harboring a point mutationmutation of the mitochondrial DNA. N Engl J Med 1994; in the mitochondrial transfer RNALeu(UUR) gene. Laryngo-330: 962–968. scope 1996; 106: 49–53.

13. Thomas AW, Morgan R, Sweeney M, Rees A, Alcolado 28. Dunbar DR, Moonie PA, Zeviani M, Holt IJ. Complex IJ. The detection of mitochondrial DNA mutations using deficiency is associated with 3243 G:C mitochondrialsingle stranded conformation polymorphism (SSCP) analy- DNA in osteosarcoma cell hybrids. Hum Mol Genetsis and heteroduplex analysis. Hum Genet 1994; 94: 1996; 5: 123–129.621–623. 29. Hao H, Moraes T. Function and molecular mitochondrial

14. Thomas AW, Edwards A, Sherratt EJ, Magid A, Gagg J, abnormalities associated with a C-T transition at positionAlcolado JC. Molecular scanning of candidate mitochon- 3256 of human mitochondrial genome. The effects of adrial tRNA genes in type 2 (non-insulin dependent) pathogenic mitochondrial tRNA point mutation indiabetes mellitus. J Med Genet 1996; 33: 253–255. organelle translation. J Biol Chem 1996; 271: 2347–2352.

15. Goto Y, Yojo M, Tohyama J, Horai S, Nonaka I. A novel 30. Hayashi J, Ohta S, Takai D, Miyabayashi S, Sakuta R,point mutation in the mitochondrial tRNALeu(UUR) gene in Goto Y, Nonaka I. Accumulation of mtDNA with aa family with mitochondrial myopathy. Ann Neurol 1992; mutation at position 3271 in tRNALeu(UUR) gene introduced31: 672–675. from a MELAS patient to Hela cells lacking mtDNA results

16. Sweeney MG, Bundey M, Brockington KR, Poulton KR, in progressive inhibition of mitochondrial respiratoryWiner JB, Harding AE. Mitochondrial myopathy associated function. Biochem Biophys Res Commun 1993; 197:with sudden death in young adults and a novel mutation 1049–1055.in mitochondrial DNA transfer RNALeu(UUR) gene. Q J 31. Giroix M-H, Sener A, Bailbe D, Portha B, Malaisse WJ.Med 1993; 86: 709–713. Impairment of the mitochondrial oxidative response to d-

17. Morten KJ, Cooper JM, Brown GK, Lake BD, Pike glucose in pancreatic islets from adult rats injected withD, Poulton J. A new point mutation associated with streptozotocin during the neonatal period. Diabetologiamitochondrial encephalomyopathy. Hum Mol Genet 1990; 33: 654–660.1993; 2: 2081–2087. 32. Gerbitz K-D, Gempel K, Brdiczka D. Mitochondria and

18. Moraes CT, Ciacci F, Bonilla E, Jansen C, Hirano M, Rao diabetes; genetic, biochemical and clinical implicationsN, et al. Two novel pathogenic mitochondrial DNA of the cellular energy circuit. Diabetes 1996; 45: 113–126.mutations affecting organelle number and protein syn- 33. Alcolado JC, Thomas AW. Maternally inherited diabetesthesis. Is the tRNALeu(UUR) gene an ethiologic hot spot? J mellitus: the role of mitochondrial DNA defects DiabeticClin Invest 1993; 92: 2906–2915. Med 1995; 12: 102–108.

19. Zeviani M, Gellera C, Antozzi C, Rimoldi M, Morandi L, 34. Moraes CT, Ciacci F, Bonilla E, Ionasescu V, Schon EA,Villani F, et al. Maternally inherited myopathy and DiMauro S. A mitochondrial tRNA anticodon swapcardiomyopathy: association with mutation in mitochon- associated with a muscle disease. Nature Genet 1993; 4:

284–288.drial DNA tRNALeu(UUR). Lancet 1991; 338: 143–147.

1037SCREENING OF DIABETIC PATIENTS FOR MITOCHONDRIAL GENE MUTATIONS

1997 by John Wiley & Sons, Ltd. Diabet. Med. 14: 1032–1037 (1997)