Runt-Related Transcription Factors Impair Activin ...repro.ucsd.edu/Thackray/SiteAssets/SitePages... · Runt-Related Transcription Factors Impair Activin Induction of the Follicle-Stimulating

Runt-Related Transcription Factors Impair ActivinInduction of the Follicle-Stimulating Hormone�-Subunit Gene

Kellie M. Breen, Varykina G. Thackray, Djurdjica Coss, and Pamela L. Mellon

Department of Reproductive Medicine and Center for Reproductive Science and Medicine, University ofCalifornia, San Diego, La Jolla, California 92093

Synthesis of the FSH �-subunit (FSH�) is critical for normal reproduction in mammals, and itsexpression within the pituitary gonadotrope is tightly regulated by activin. Here we show thatRunt-related (RUNX) proteins, transcriptional regulators known to interact with TGF� signalingpathways, suppress activin induction of FSH� gene expression. Runx2 is expressed within themurine pituitary gland and dramatically represses activin-induced FSH� promoter activity, withoutaffecting basal expression in L�T2 cells, an immortalized mouse gonadotrope cell line. This re-pressive effect is specific, because RUNX2 induces LH� transcription (with or without activin) anddoes not interfere with GnRH induction of either gonadotropin �-subunit gene. Analysis of themurine FSH� promoter by transfection and gel shift assays reveals that RUNX2 repression localizesto a Runx-binding element at �159/�153, which is adjacent to a previously recognized regioncritical for activin induction. Mutation of this �153 activin-response element or, indeed, any of thefive activin-responsive regions prevents activin induction and, in fact, RUNX2 suppression, insteadconverting RUNX2 to an activator of the FSH� gene. Although the Runx-binding element is re-quired for RUNX2-mediated repression of FSH� induction by either activin or Smad3, confirminga functional role of this novel site, protein interactions in addition to those between RUNX2 andSmads are necessary to account for full repression of activin induction. In summary, the presentstudy provides evidence for Runx2-mediated repression of activin-induced FSH� gene expressionand reveals the context dependence of Runx2 action in hormonal regulation of the gonadotropingenes. (Endocrinology 151: 2669–2680, 2010)

FSH is essential for reproductive function in mammals.Indeed, female mice lacking FSH are infertile due to

defects in proper development and maturation of ovarianfollicles (1). At the molecular level, FSH is a heterodimerconsisting of a common �-subunit complexed with aunique �-subunit (2). The �-subunit confers biologicalspecificity, and its synthesis is the rate-limiting step in theoverall production of FSH (2, 3). Transcriptional regula-tion of FSH� occurs via endocrine, paracrine, and auto-crine action from a variety of key players including hypo-thalamic GnRH, gonadal steroid hormones, and theactivin-inhibin-follistatin system (3, 4).

Activin, a member of the TGF� superfamily, is an im-portant regulator of FSH synthesis and promotes expres-

sion of FSH� during the ovulatory cycle (5, 6). The activityof activin is antagonized by a closely related TGF� familymember, inhibin, and both are critical for physiologicalregulation of FSH synthesis. Mice lacking either activin orinhibin exhibit abnormal FSH� expression and disruptedfertility (6, 7), demonstrating the importance of their tran-scriptional regulation of FSH� for overall reproductivefitness.

Although activin is considered an important regulatorof FSH�-subunit gene expression, the mechanisms under-lying transcriptional responsiveness are complex, requir-ing many individual elements that act in cooperation, andexhibit species specificity (8–11). Several of these activinresponse elements have been found to harbor consensus

ISSN Print 0013-7227 ISSN Online 1945-7170Printed in U.S.A.Copyright © 2010 by The Endocrine Societydoi: 10.1210/en.2009-0949 Received August 12, 2009. Accepted March 4, 2010.First Published Online March 31, 2010

Abbreviations: FoxL2, Forkhead transcription factor L2; RUNX, runt-related protein.

N E U R O E N D O C R I N O L O G Y

Endocrinology, June 2010, 151(6):2669–2680 endo.endojournals.org 2669

Smad-binding sites, and a few of these sites have beenshown to bind Smad proteins, known mediators of TGF�

signaling cascades, including activin (8, 11, 12). Of inter-est, the �153 activin-response element in the mouse(�167 in the ovine gene) is required to respond effectivelyto activin (8, 11) but has not been shown to directly bindSmad proteins or any other known activin-induced medi-ator. Interestingly, Su et al. (13) demonstrated that dis-ruption of a sequence juxtaposed to this activin-respon-sive site within the context of the ovine FSH� promotercauses severe dysregulation of basal expression and tran-scriptional regulation in L�T2 cells. When this mutantovine FSH� reporter was introduced into transgenic mice,the transgene revealed diminished basal expression, im-proper regulation by activin or follistatin, and failure toexhibit the secondary FSH surge (13). In silico analysisindicated that this sequence could represent a putativebinding site for the runt-related (RUNX) family of tran-scription factors.

The RUNX family of nuclear transcription factors(RUNX, human; Runx, mouse) was originally identifiedin Drosophila as the pair rule gene runt (14). In mammals,the three Runx family members (Runx1, -2, and -3) allplay critical roles in cell differentiation, tissue develop-ment, and ultimately, human disease (15). The gene-reg-ulatory actions of Runx factors are mediated not only bybinding specific promoter regions, using a conserved Runtdomain essential for DNA binding but also through theformation of protein interactions that assist in the assem-bly of transcriptional complexes at specific subnuclearsites (16, 17). These protein-protein interactions potentlyinfluence transactivation or repression by Runx itself andincrease the complexity of the mechanisms of transcrip-tional regulation by Runx family members.

Given that Runx factors appear to function as scaffold-ing proteins involved in the integration of complex andcoordinated gene-regulatory mechanisms, including TGF�

family signaling, we sought to investigate the role for Runxproteins in the transcriptional regulation of FSH�. In L�T2cells, a model of cultured gonadotrope cells that endog-enously expresses FSH� and contains the machinery to re-spond to the activin-follistatin system, RUNX proteins ab-rogated activin induction of FSH� promoter activity. Wefurther identified a Runx cis-regulatory element at �159 inthe murine FSH� promoter juxtaposed to the �153 criticalregion for activin responsiveness. This Runx-binding site notonly is necessary for the physical interaction of Runx2 withthe murine FSH� promoter. but it is also required forRUNX2 repression of activin induction. These results clarifythe importance of Runt-related transcription factors in tran-scriptional regulation within the gonadotrope cell and pro-

vide an important role for Runx2 in feedback control ofreproductive hormone synthesis.

Materials and Methods

PlasmidsFSH� reporter plasmids have been previously described:

�1000 murine FSH�luc (18, 19); �985 ovine FSH�luc (20, 21);�1028 human FSH�luc (12); and the activin-response elementcis mutations within the �1000 murine FSH�luc at �267,�153, �120, and the 5X mutation (containing mutations in allfive activin-responsive elements at �267, �153, �139, �120,and �106) (11). The 1.8-kb rat LH�luc was kindly provided byMark Lawson. The expression vectors for human RUNX1, -2,and -3 were provided by Yoshiaki Ito (22), and murine Runx2was provided by Jane Lian (16, 17). Smad3 was provided by RikDerynck (23).

Mutations were generated by PCR using specific primers(Supplemental Table 1 published on The Endocrine Society’sJournals Online web site at http://endo.endojournals.org) for the�398 FSH� promoter (�156/�154 mutation) or murine Runx2expression vector (HTY� and WRPY�). Mutagenesis was per-formed using the QuikChange XL site-directed mutagenesis kit(Stratagene, La Jolla, CA) and confirmed by sequencing.

Cell culture and transient transfectionL�T2 cells, cultured as previously described (18), were seeded

into 12-well plates at 3 � 105 cells per well and incubated over-night at 37 C. Each well was transfected with 400 ng of theluciferase-reporter plasmid or empty pGL3 vector, 200 ng of thehuman RUNX1, -2, or -3 expression vector (vector pEF-BOS),murine Runx2 (vector pHA) or empty vector, and 100 ng of a�-galactosidase reporter gene regulated by the thymidine kinasepromoter (TK-�gal) as a control for transfection efficiency usingFuGENE 6 transfection reagent (Roche Applied Science, India-napolis, IN). In experiments using Smad3 to induce FSH� pro-moter activity, cells were also transfected with 200 ng Smad3 orempty pRK5 vector. Eighteen hours after transfection, cells weretransferred to serum-free DMEM supplemented with 0.1% BSA,5 mg/liter transferrin, and 50 nM sodium selenite. After 6 h,activin A (25 ng/ml; Calbiochem, San Diego, CA), follistatin (25ng/ml; R&D Systems, Minneapolis, MN), or vehicle (0.1% BSA)was administered for 24 h before harvest. Where indicated,GnRH (10 ng/ml; Sigma-Aldrich, St. Louis, MO) treatment be-gan 6 h before harvest. Cells were harvested and extracts pre-pared for assay of luciferase and �-galactosidase activity as pre-viously described (24).

Quantitative real-time PCRPreparation of cDNA from mouse pituitary or L�T2 cells was

performed as previously described (25). Male and femaleC57BL/6 mice (6 wk of age) were purchased from The JacksonLaboratory (Bar Harbor, ME), and housed in a University ofCalifornia, San Diego (UCSD), animal facility under standardconditions. At 8 wk of age, mice were decapitated and pituitariesremoved for immediate processing. All procedures were ap-proved by the UCSD Institutional Animal Care and Use Com-mittee. Briefly, RNA was extracted with Trizol reagent (Invitro-gen/GIBCO, Carlsbad, CA) according to the manufacturer’s

2670 Breen et al. Runx Repression of FSH� Gene Expression Endocrinology, June 2010, 151(6):2669–2680

instructions, treated to remove contaminating DNA (DNA-free;Ambion, Austin, TX), and reverse transcribed using SuperscriptIII first-strand synthesis system (Invitrogen). Quantitative real-time PCR was performed in an iQ5 real-time PCR instrument(Bio-Rad, Hercules, CA) and used iQ SYBR Green Supermix(Bio-Rad) with specific primers for GAPDH, FSH�, Runx2, andtotal Runx (Supplemental Table 1).

The iQ5 real-time PCR program was as follows: 95 C for 15min, followed by 40 cycles at 95 C for 15 sec, 55 C for 30 sec, and72 C for 30 sec. Within each experiment, the amount of FSH�,Runx2 or total Runx, and GAPDH was calculated by comparinga threshold cycle obtained for each sample with the standardcurve generated from serial dilutions of a plasmid containingGAPDH, ranging from 1 ng to 1 fg. Values for FSH� and Runx2or total Runx were determined from the same sample and areexpressed relative to GAPDH. All samples were assayed (in trip-licate) within the same run, and the experiment was conductedtwo times.

Western blotting analysisNuclear extracts were prepared from �T3-1 and L�T2 cells as

previously described (26). When experiments were conductedwith activin A (25 ng/ml), follistatin (25 ng/ml), or vehicle (0.1%BSA), treatment began 24 h before harvest. Nuclear extract (30�g) was boiled for 5 min in 5� Western loading buffer, frac-tionated on a 10% SDS-PAGE gel, and electroblotted for 90 minat 300 mA onto polyvinylidene difluoride (Millipore, Billerica,MA) in 1� Tris-glycine-sodium dodecyl sulfate/20% methanol.Blots were blocked overnight at 4 C in 3% BSA and then probedfor 1 h at room temperature with goat antihuman Runx1, rabbitantimouse Runx2, or rabbit antihuman Runx3 antibody (SantaCruz Biotechnology, Santa Cruz, CA) diluted 1:500 in blockingbuffer. Blots were then incubated with a horseradish peroxidase-linked secondary antibody (Santa Cruz Biotechnology) andbands visualized using the SuperSignal West Pico chemilumines-cent substrate (Pierce Biotechnology Inc., Rockford, IL). Bio-Rad prestained protein ladder plus serves as a size marker.

EMSAMouse FSH� promoter oligonucleotides from �164 to �134

(Supplemental Table 1) or the corresponding sequences in thesheep and human were annealed, end-labeled, and purified aspreviously described (27). Binding reactions used 2 fmol 32P-labeled oligonucleotide and 8 �g L�T2 nuclear extract. In com-petitor assays, 250-fold excess unlabeled oligonucleotide wasadded to the binding reaction before addition of probe. For su-pershift assays, 1 �g rabbit antimouse Runx2 antibody (SantaCruz Biotechnology) or normal rabbit IgG control, was added tothe reaction. Reactions were electrophoresed on a 5% polyacryl-amide gel at 250 V for 2 h and then dried under vacuum andexposed to film.

StatisticsAll experiments were performed in triplicate and were re-

peated at least three times. To normalize for transfection effi-ciency, all luciferase values were divided by �-galactosidase, andthe triplicate values were averaged. To control for interexperi-mental variation, the empty pGL3 reporter plasmid was trans-fected with TK-�gal and any relevant expression vectors, and theaverage pGL3/�gal value was calculated. Average luc/�gal val-ues were divided by the corresponding pGL3/�gal value. Indi-

vidual values obtained from each independent experiment werethen averaged, and statistics were performed using JMP 7.0(SAS, Cary, NC). Significance was established as P � 0.05 bytwo-way ANOVA followed by Tukey’s post hoc test.

Results

RUNX proteins are present in the pituitary glandand immortalized gonadotrope cells

Because Runx proteins are known regulators of TGF�

signaling pathways, including activin, we first identifiedthe presence of these factors in the mouse pituitary glandand in model gonadotrope cells. Quantitative RT-PCRanalysis detected total mRNA for the Runx family in bothmale and female mouse pituitary tissue as well as in L�T2cells, an immortalized pituitary gonadotrope cell line (Fig.1A). Total transcript level for the Runx family in L�T2cells is approximately 2-fold greater than in the pituitarygland, a heterogeneous tissue that contains less than 10%gonadotrope cells (28). Protein expression of Runx1, -2,and -3 is readily detected by Western blotting analysis of

B

64 kD48 kD

82 kD

LβT2

αT3

-1

LβT2

αT3

-1

LβT2

αT3

-1

A

0

0.1

0.2

0.3

0.4

0.5 Total Runx FSHβ

male pit

female pitLβT2Tr

ansc

ript

Rel

ativ

e to

GA

PD

H

Runx1 Runx2 Runx3FIG. 1. Runx proteins are expressed in pituitary tissue andimmortalized gonadotrope cells. A, Quantitative RT-PCR analysis oftotal Runx and FSH� mRNA from male and female mouse pituitary (pit)tissue or L�T2 cells. In each sample, the amount of total Runx or FSH�mRNA was compared with the amount of GAPDH mRNA and resultsare expressed as relative transcript level. Results represent the mean �SEM of two independent experiments, each performed in triplicate. B,Western blotting analysis of nuclear extracts from �T3-1 and L�T2 cellswas performed using antibodies for Runx1, -2, and -3. Protein bandswere detected at the expected sizes of 53, 55, and 44 kDa for Runx1,-2, and -3, respectively, in both �T3-1 and L�T2 cells. An additionalhigher molecular weight band in the Runx3 Western blot likelyrepresents posttranslationally modified Runx3 (15). The experimentwas repeated three times with similar results, and representative gelsare shown.


nuclear extracts from both L�T2 cells and �T3-1 cells, agonadotrope precursor cell line (Fig. 1B), revealing a cellmodel for understanding the role of this novel family of tran-scription factors in gonadotrope subunit gene expression.

RUNX proteins regulate FSH� gene expression ingonadotrope cells

Because activin is a potent regulator of FSH� synthesis,we sought to test whether Runx proteins are transcrip-tional effectors of FSH�. The murine FSH� promoter(�1000 bp) fused upstream of a luciferase reporter gene(FSH�luc) was transiently cotransfected along with hu-man RUNX1, -2, or -3 expression vectors into L�T2 cells.Overexpression of RUNX1, -2, or -3 did not significantlyalter basal expression of the 1-kb murine FSH� promoter(Fig. 2A). In contrast, all three RUNX proteins blunted therobust induction by activin (Fig. 2B). Specifically, treat-ment with activin resulted in an 11-fold induction ofFSH�, which was reduced by 42, 48, or 23%, byRUNX1,RUNX2, or RUNX3, respectively. Although all threemammalian Runx proteins are present in L�T2 cells andare capable of transcriptional repression of activin induc-tion of the FSH� promoter, we focused on Runx2 based onthe intensity of its effect and evidence for its interactionwith members of TGF� signaling cascades (29, 30). Wefirst confirmed the presence of Runx2 within the murinepituitary gland (Fig. 2C) and determined whether proteinexpression is changed by treatment with activin or fol-listatin (Fig. 2D), a potent activin-binding protein thatneutralizes endogenous activin secreted by the L�T2 cellitself (31). Levels of Runx2 protein are similar in L�T2cells treated with vehicle, activin, and follistatin. Collec-tively, these data identify the Runx family as potentialregulators of gonadotrope function and focus our atten-tion on the molecular mechanism whereby RUNX2 po-tently represses FSH� expression.

Differential regulation of FSH� and LH� by RUNX2Appropriate expression of the gonadotropin subunit

genes is dependent on paracrine and autocrine actionswithin the anterior pituitary. To determine whether theeffect of RUNX2 is dependent on hormonal milieu, L�T2cells were cultured in the presence of activin, follistatin, orGnRH, and the effect of RUNX2 overexpression was as-sessed on FSH� promoter activity. Again, RUNX2 po-tently reduced activin-induced FSH� expression (Fig. 3A),whereas it failed to alter FSH� promoter activity in cellstreated with follistatin, indicating that RUNX2 repressionrequires a threshold level of promoter activation. More-over, this effect does not occur with any hormonal induc-tion because GnRH regulation, although it results in a2.7-fold induction of FSH� expression, is not affected by

RUNX2, indicating that repression by RUNX2 is specificfor induction by activin.

Previously, we reported that, in addition to its affect onFSH�, activin signaling induces LH� expression, albeit toa lesser extent (32). To further address the specificity ofRUNX2 action on gonadotropin subunit gene expression,we tested the effect of RUNX2 on LH� promoter activity.RUNX2 was transiently cotransfected along with �1800bp of the rat LH� promoter fused to a luciferase reporter(LH�luc) into L�T2 cells. Upon treatment with activinalone, LH� expression was induced 1.6-fold, whereas

0

2

4

6

8

10

12

14

C

Em

pty

Vect

orR

UN

X1

RU

NX

2R

UN

X3

Em

pty

Vect

orR

UN

X1

RU

NX

2R

UN

X3

#

#

#

#***

*

**

0

2

4

6

8

10

12

14

Fold

Indu

ctio

n by

Act

ivin

A B

Fold

Cha

nge

DAb: α-Runx2

+ A

ctiv

in

+ Fo

llist

atin

Con

trol

0

0.1

0.2

0.3

0.4

0.5

Runx2FSHβ

male pit

female pitLβT2Tr

ansc

ript

Rel

ativ

e to

GA

PD

H

FIG. 2. RUNX proteins repress activin-induced FSH� gene expression.A and B, Effect of overexpression of RUNX1, -2, or -3 on FSH�promoter activity. The 1-kb murine FSH�luc reporter plasmid wastransiently cotransfected into L�T2 cells with an expression vector forhuman RUNX1, -2, or -3 or pEF-BOS as an empty vector control. Cellswere treated for 24 h with vehicle (A) or activin (B) and harvested forluciferase activity as a measure of FSH� promoter activity. Resultsrepresent the mean � SEM and are depicted as FSH� activity relative tothe vehicle empty vector control. #, Significant effect of activin vs.vehicle empty vector control; *, P � 0.05; **, P � 0.01; ***, P �0.001, significant suppression by RUNX expression plasmid vs. emptyvector expression plasmid in the presence of activin as determined bytwo-way ANOVA followed by Tukey’s post hoc test. C, QuantitativeRT-PCR analysis of Runx2 and FSH� mRNA extracted from male andfemale mouse pituitary (pit) tissue or L�T2 cells. D, Western blottinganalysis of Runx2 in nuclear extracts from L�T2 cells treated withactivin, follistatin, or vehicle (control), using an antibody specific forRunx2 (Ab: �-Runx2). The experiment was repeated three times withsimilar results, and a representative gel is shown.


GnRH induced LH� by 2.0-fold (Fig. 3B). In contrast toits effect on FSH�, RUNX2 induced LH� expressionnearly 2-fold, and this increase occurred in the presence ofvehicle, activin, or follistatin. Interestingly, RUNX2 doesnot appear to further induce LH� in the presence ofGnRH. Taken together, these experiments demonstratethat the repressive action of RUNX2 is specific to FSH�

and dependent on elevated levels of circulating activin.

RUNX2 repression localizes to anactivin-responsive region of the FSH� promoter

We examined the proximal promoter region of the mu-rine FSH� gene and identified three possible binding sitesfor Runx transcription factors within 1 kb upstream of thetranscription start site [�652, �455, and �159; �85%identity each, by web-based software TFSEARCH (33)].To identify regions of the FSH� gene that are functionallyinvolved in RUNX2 regulation, L�T2 cells were transientlytransfected with a series of truncated FSH� reporter plas-mids, ranging in length from �1000 to �95 bp of the 5�

regulatory sequence. Figure 4 illustrates the effects of co-transfectionofRUNX2ontheprogressive5�-promoter trun-cationsonbasal (Fig.4A)oractivin-inducedFSH� promoteractivity (Fig. 4B). Although RUNX2 causes no change inbasal expression of the 1-kb FSH� promoter (Fig. 4A,�1000), expression is increased by approximately 30%when the reporter gene is truncated to �230 or �194. Fur-ther deletion of the region to �127 results in a loss ofRUNX2 induction, indicating that elements important forthe effectofRUNX2onbasalFSH� expression residewithinthe �194- to �127-bp region of the gene.

As observed previously (25), activin induction of theFSH� gene declined incrementally as the promoter wasprogressively truncated from �1000 to �95 (Fig. 4B).RUNX2 repressed FSH� promoter activity by approxi-mately 40% when the region contained at least �304 bpof the proximal promoter. Interestingly, further trunca-tion of the region from �304 to �230, removing the most5� activin response element at �267 (34), results in a lossof activin induction and elimination of RUNX2 repres-sion, indicating that activin responsiveness of the FSH�

gene is required for RUNX2 repression.The �267 site is one of five important cis-regulatory

elements (Fig. 4C), each of which is critical for activinresponsiveness of the murine FSH� gene (8, 11, 34). Thesebind proteins such as Smad family members (11, 34), Pbx1and Prep1 homeodomain proteins (8, 11), or forkheadtranscription factor L2 (FoxL2) (35). We therefore ana-lyzed the necessity of the known activin response elementswithin the FSH� gene for RUNX2 repression (11). Re-markably, cis mutation of individual elements or com-bined mutation of all five sites in the 1-kb FSH� promoterallowed RUNX2 to induce expression in the absence ofactivin (Fig. 4D), similar to its effect on basal expressionof the promoter truncations (�230 and �194; Fig. 4A). Asin the case of the �230 truncation that lost activin re-sponsiveness concurrent with RUNX2 repression, muta-tion of single elements in the FSH� gene prevents activininduction and, thus, RUNX2 repression in the presenceof activin (Fig. 4E). In fact, mutation of all five activinresponse elements actually converts the repression byRUNX2 to strong induction. Taken together, these dataindicate that the direction of RUNX2 activation or repres-sion is dependent on representation, availability, and co-ordinated binding of coregulatory factors, including thoseinvolved in activin signaling.

Runx2 binds a novel Runx element within theFSH� proximal promoter

Because we found that each mutation or truncation thatprevents activin induction also prevents RUNX2 repres-sion, we focused on the region of the FSH� gene required

0

2

4

6

8

10

12

Vehicle Activin Follistatin GnRH

FSH

β Fo

ld In

duct

ion

FSHβ lucEmpty VectorRUNX2

0

1

2

3

4

Vehicle Activin Follistatin GnRH

LHβ luc

A

B

#

#

#

#

*

*

*

*

#

#

#

#

LHβ

Fold

Indu

ctio

n

FIG. 3. RUNX2 repression of activin induction is specific for FSH�. The1-kb murine FSH�luc reporter gene (A) or 1.8-kb rat LH�luc reportergene (B) was transfected into L�T2 cells along with RUNX2 or itsempty vector. Cells were treated with vehicle, activin, follistatin, orGnRH and harvested for luciferase activity to determine the effects ofRUNX2 on hormone induction of both LH� and FSH�. Results aredepicted as fold induction by hormone treatment relative to the vehicleempty vector control for each reporter plasmid. #, Significant inductionby hormone treatment vs. vehicle empty vector control; *, significanteffect of RUNX2 vs. empty vector on hormone-induced FSH�/LH�expression.


for RUNX2 activation in the absence of activin. In silicoanalysis of this region (�194/�127) identified a putativeRunx-binding site based on homology to a consensus rec-ognition sequence 5�-PyGPyGGTPy-3� (36). This putativesite, �159 TGTGGCA �153, is positioned immediatelyupstream of the activin response element at �153 ATT-TAGAC �146 (Fig. 4C). EMSAs were performed to testthe hypothesis that Runx2 could physically interact at thissite. When an oligonucleotide encompassing the �164/�134 region of the gene was used in EMSA with nuclearextracts from L�T2 cells, specific complexes were ob-served (Fig. 5A, lane 1, labeled i, ii, and iii). Unlabeledwild-type oligonucleotide successfully competes with thelabeled probe for protein binding of all three complexes(lane 2), whereas an oligonucleotide containing a muta-tion of the 7-bp putative Runx2 consensus site (�159AAAAAAA �153; underlined in Fig. 5B) successfully

competes complex i and iii but fails to com-pete complex ii (lane 3). Inclusion of controlIgG (lane 4) does not alter protein binding;however, a Runx2-specific antibody resultsin a supershift of complex ii (lane 5), iden-tifying this complex as containing Runx2.

We next determined the nucleotides nec-essary for Runx2 interaction with DNA.EMSA was performed with the wild-type�164/�134 probe (Fig. 5B, WT) and scan-ning 2-bp mutant oligonucleotides as unla-beled competitors (Fig. 5B, A–M). The threemutant oligonucleotides that were unable tocompete for Runx2 binding, mutations C–E(Fig. 5C, lanes 5–7), together encompass sixof the seven nucleotides within the putativeRunx site identified at �159/�153.

RUNX2 repression is conserved acrossspecies

Elements conveying responsiveness to ac-tivin are well conserved across species, and arecent report (13), combined with the cur-rent study, implicates the Runx family oftranscription factors in the regulation of ac-tivin responsiveness in the sheep and mouse.We tested the hypothesis that RUNX reg-ulation is a conserved mechanism of re-pression among mouse, sheep, and humansby transiently transfecting RUNX2 intoL�T2 cells along with either a �985 ovineFSH�luc or �1028 human FSH�luc, andcompared repression with the �1000 mu-rine FSH�luc reporter (Fig. 6, A and B). Theeffect of RUNX2 on basal and activin-in-duced FSH� promoter activity is similar for

all three species. Specifically, ovine, human, and murinebasal FSH� promoter activity was not significantly alteredby RUNX2 (Fig. 6A). In contrast, responsiveness to ac-tivin was reduced by 53% in the sheep, 39% in the human,and 47% in the mouse (Fig. 6B), demonstrating that re-pression by RUNX2 is functionally conserved in the ovine,human and murine FSH� genes.

DNA sequences of the ovine and human FSH� geneswere compared with that of the murine �159 Runx-bind-ing site (Fig. 6C, murine, underlined) and investigated forconservation. Although this murine Runx site shows min-imal conservation (�50% conserved) with the species in-vestigated, another site was recently reported as critical foractivin responsiveness of the ovine FSH� gene in vivo andproposed as a putative Runx-binding site based on its se-quence (13). This Runx site sits 3 bp downstream of the

0

1

2

3

4

Fold

Cha

nge

Empty Vector

RUNX2

0

2

4

6

8

10

Fold

Indu

ctio

n by

Act

ivin

A

B

C-267 -153 -120 -106

Runx

-159

TGTGGCA

murine FSHβ 5’ regulatory region

**

*

*

*-139

Activin

BasalSmad2/3/4 Pbx1

Prep1Smad4

??

0

10

20

30

40

0

3

6

9

12Activin

Basal

Fold

Cha

nge

Fold

Indu

ctio

n by

Act

ivin

E

D

** *

*

*

**

*

FoxL2

WT

-267 m

ut

-153 m

ut

-120 m

ut

5X m

ut

WT

-267 m

ut

-153 m

ut

-120 m

ut

5X m

ut

FIG. 4. RUNX2 suppression of the murine FSH� promoter maps to an activin-responsiveregion. A and B, L�T2 cells were transfected with a series of 5�-truncated FSH�lucreporter plasmids along with RUNX2 or its vector control and treated with vehicle (A) oractivin (B) to determine regions of the FSH� promoter that are responsive to RUNX2.Results are depicted as FSH� fold induction relative to the empty vector �1000 FSH�lucreporter plasmid. *, Significant effect of RUNX2 vs. empty vector on FSH� promoteractivity. C, Schematic of the murine FSH� 5� regulatory region illustrating the knownactivin-responsive elements (open circles) involved in expression of the FSH� gene.Proteins binding each site are indicated or, if unknown, are denoted with a questionmark. Juxtaposed to the �153 activin response element is a Runx-binding site �159TGTGGCA �153. D and E, L�T2 cells were transfected with FSH�luc reporter plasmidscontaining mutations (mut) in known activin response elements (11), along with RUNX2or its vector control, treated with vehicle (D) or activin (E), and analyzed for FSH�promoter activity as described above. The FSH�luc reporter plasmids either containedelements mutated individually (�267 mut, �153 mut, and �120 mut) or all fiveelements mutated in combination (5X mut; containing cis mutations at �267, �153,�139, �120, and �106).


murine �159 Runx site and is highly conserved betweenhuman and ovine (Fig. 6C, ovine, dashed underline),providing circumstantial evidence that the region en-compassing the �153 activin response element (Fig. 6C,illustrated on murine promoter, gray shading) harborsa potential element for Runx modulation of activin re-sponsiveness across multiple species.

EMSA was performed with species-specific oligonucle-otide probes corresponding to the �164/�134 FSH� re-gion of the mouse to determine whether Runx2 binds thisregion in the ovine and human FSH� genes as well. L�T2nuclear extracts were incubated with probe alone, non-specific IgG, or a Runx2-specific antibody (Fig. 6D). Al-though an antibody specific for Runx2 causes a supershifton the murine probe (Fig. 6D; lane 9, supershifted com-plex indicated as Runx2 ss), a complex was not detectedon the ovine or human probe that could be identified asRunx2 or a supershift of Runx2. It is possible that wecould not visualize binding of Runx2 on the sheep andhuman probes due to lower-affinity binding than themouse. Altogether, our results identify a conserved mech-anism of repression of activin induction via RUNX2 butraise the possibility that RUNX2 uses different sequences

A

B

WT: TGCTCTGTGGCATTTAGACTGCTTTGGCGAG A: TAATCTGTGGCATTTAGACTGCTTTGGCGAG B: TGCAATGTGGCATTTAGACTGCTTTGGCGAG C: TGCTCAATGGCATTTAGACTGCTTTGGCGAG D: TGCTCTGAAGCATTTAGACTGCTTTGGCGAG E: TGCTCTGTGAAATTTAGACTGCTTTGGCGAG F: TGCTCTGTGGCGGTTAGACTGCTTTGGCGAG G: TGCTCTGTGGCATGGAGACTGCTTTGGCGAG H: TGCTCTGTGGCATTTCCACTGCTTTGGCGAG I: TGCTCTGTGGCATTTAGGGTGCTTTGGCGAG J: TGCTCTGTGGCATTTAGACCCCTTTGGCGAG K: TGCTCTGTGGCATTTAGACTGGGTTGGCGAG L: TGCTCTGTGGCATTTAGACTGCTGGGGCGAG M: TGCTCTGTGGCATTTAGACTGCTTTAACGAG

A B J K L MWT F G H IC D E

Runx2

C

3 4 12 13 14 152 8 9 10 115 6 71

3 42 51

Pro

be

250x

WT

250x

MU

T

IgG

Run

x2 A

b

ii

i

iii

Runx2 ss

* * *

Runx2

i

iii

-164 -134

FIG. 5. Runx2 binds the �164/�134 region of the murine FSH�promoter. A, EMSA was performed using L�T2 nuclear extract and aradiolabeled oligonucleotide probe containing the putative Runx2binding site identified at �159 bp of the FSH� promoter to test forcomplex formation (lane 1, Probe; sequence in B, WT with Runx siteunderlined). A 250-fold excess of unlabeled wild-type probe (lane 2,250� WT) or mutant probe (lane 3, 250� MUT) or nonspecific IgG(lane 4) were included in the binding reactions as indicated. Theaddition of an antibody specific for Runx2 (lane 5, Runx2 Ab) resultedin reduction of the Runx2 band and formed an antibody supershift asindicated by Runx2 ss. B, An alignment of the wild-type murine FSH�promoter sequence (�164/�134; WT), and the oligonucleotides usedas competitors, labeled A–M, are shown. The scanning 2-bp mutationsintroduced are underlined. C, EMSA was performed by using L�T2nuclear extracts incubated with labeled wild-type probe (lane 1) alongwith 250-fold excess of the indicated wild-type (lane 2, WT) or mutantcompetitor (lanes 3–15, A–M).

A

C-178 TGATCTACTGCATTTAGACTGCTTTGGCGAG -148-175 TAATCTACTGCGTTTAGACTACTTTAGTAAA -145-164 TGCTCTGTGGCATTTAGACTGCTTTGGCGAG -134

OvineLβT2 NE:

Runx2

D

3 42 8 95 6 71

+ +++ +++ + ++ + + ++ +

Runx2 ss

Human Murine

IgG:Runx2 Ab:

OvineHumanMurine

0

2

4

6

8

10

12Empty VectorRUNX2

Fold

Cha

nge

0

2

4

6

8

10

12

Fold

Indu

ctio

n by

Act

ivin

OvineHuman

MurineOvine

HumanMurine

B

#

*

#

#

#

#

*

*

FIG. 6. A and B, Effect of overexpression of RUNX2 on ovine, human,and murine FSH� promoter activity. The �985-bp ovine FSH�luc,�1028-bp human FSH�luc, or �1000 murine FSH�luc reporterplasmid was transfected into L�T2 cells with RUNX2 or its vectorcontrol, and FSH� promoter activity was assessed in cells treated withvehicle (A) or activin (B). Results are depicted as FSH� fold inductionrelative to the empty vector reporter control for each species. #, Significanteffect of activin; *, significant suppression by RUNX in the presence ofactivin. C, Sequence comparison of the putative Runx elementidentified in the murine FSH� gene (�159/�153, underline) withcorresponding gene regions in the ovine and human. The �153 activinresponsive element (murine, gray shading) and putative ovine Runx siterecently identified (dashed underline) (13) are also highlighted. D,Nuclear extracts from L�T2 cells were incubated with the ovine,human, or murine oligonucleotide probe, and complex formation wasassayed by EMSA. Inclusion of a nonspecific IgG antibody or anantibody specific for Runx2 is indicated. Addition of an antibodyspecific for Runx2 resulted in elimination of the Runx2 band and anantibody supershift on the murine probe (lane 9, Runx2 ss).


from those identified in the mouse to mediate repression ofthe sheep and human FSH� promoters.

Integrity of the Runx-binding element is critical forRUNX2 repression

Once we had determined that Runx2 could bind theRunx element at �159/�153, transient transfection as-says were used to determine whether this site plays a func-tional role in the suppression of activin-induced FSH�

gene expression by RUNX2. For this experiment, L�T2cells were transfected with the �398 FSH�luc reporter(wild type) or the same reporter plasmid containing a cismutation in which the �156 GGC �154 nucleotides,known to be critical for high-affinity binding by Runxproteins to DNA (37) (Fig. 5C), were mutated to AAA(�156/�154 mutation). Basal FSH� promoter activitywas slightly, but not significantly, elevated by introduc-tion of the Runx site cis mutation compared with the wild-type mouse FSH� promoter (Fig. 7A, WT); overexpres-sion of RUNX2 did not alter promoter activity comparedwith the empty vector control (Fig. 7A, �156/�154 mu-tation). Activin induced FSH� expression of both the wild-type and �156/�154 mutant FSH� promoters equally(Fig. 7B). Although RUNX2 suppresses activin inductionof the wild-type promoter (Fig. 7B; WT, �50% reducedby RUNX2), mutation of the Runx element preventsRUNX2 repression of activin-induced FSH� expression(Fig. 7B; �156/�154 mutation, not significantly sup-pressed as indicated by ns). Mutation of this binding sitedoes not alter the ability of RUNX1 or RUNX3 to repressthe induction of FSH� (P � 0.05, data not shown). Taken

together, these studies indicate that the �159 Runx sitewithin the FSH� promoter is important and necessary forthe suppressive effect of RUNX2.

It is well established that Smad proteins are critical formurine FSH� expression (9, 10, 34, 38). Indeed, micelacking Smad3 exhibit reduced FSH� expression (32), il-lustrating the importance of this Smad factor in vivo. Wehypothesized that if RUNX2 suppresses activin inductionvia disrupting Smad signaling, then overexpression ofRUNX2 would repress the induction of FSH� by Smad3.Alternatively, if RUNX2 were acting upstream of Smad3in the activin signaling cascade, RUNX2 would not inter-fere with induction by Smad3. As expected, overexpres-sion of Smad3 induces a robust increase in wild-type FSH�

promoter activity; this response is potently repressed byRUNX2 (Fig. 7C; WT, �80% reduced by RUNX2). Sim-ilar to the case with activin, RUNX2 is unable to suppressSmad3 induction of the FSH� promoter containing the�156/�154 mutation (Fig. 7C; �156/�154 Mutation).Collectively, these data show that the �159 Runx site isnecessary for RUNX2 to inhibit Smad3-induced tran-scriptional activity and support the hypothesis thatRUNX2 repression of FSH� expression acts on or down-stream of Smad3 activation.

Mutation of the Smad interacting domain ofRunx2 fails to relieve Runx2 repression of activininduction

The carboxy terminus of RUNX2 contains specific re-gions necessary for mediating functional interactions witha number of coregulatory proteins involved in either tran-scriptional activation or repression (29, 39–43). For ex-ample, a three-amino-acid His-Thr-Tyr motif (HTY;amino acids 426-428) within the Smad interacting domainof Runx2 has been shown to mediate Smad protein inter-actions (29, 39), and a four-amino-acid Trp-Arg-Pro-Tyrmotif (WRPY; amino acids 525-528) is necessary for in-teractions with corepressors of the Groucho/TLE family(40). We assessed the importance of these motifs forRunx2-induced repression of activin- or Smad3-inducedFSH� promoter activitybycotransfectingamurineRunx2plasmid containing either HTY (HTY�) or WRPY(WRPY�) domain mutations (residues mutated to ala-nine; AAA or AAAA, respectively). Overexpression ofRunx2 or WRPY� results in a similar reduction in Smad3-induced FSH� activity (Fig. 8A; Runx2 vs. WRPY�). Incontrast, HTY� fails to significantly repress FSH� expres-sion (Fig. 8A; Runx2 vs. HTY�, P � 0.05), suggesting thatthe Runx2 HTY motif is necessary to mediate repressionby Runx2. Interestingly, neither the WRPY nor the HTYRunx2 mutation was sufficient to alleviate repressionwhen FSH� was induced by activin (Fig. 8B; Runx2 vs.

A

0

1

2

3

4

5*

B

0

1

2

3

4

5C

0

5

10

15

20

25

ns

Fold

Cha

nge

Fold

Indu

ctio

n by

Act

ivin

Fold

Indu

ctio

n by

Sm

ad3

RUNX2

Empty Vector

WT WT WT-156/-154Mutation

-156/-154Mutation

-156/-154Mutation

*ns

FIG. 7. Cis mutation of the Runx element relieves RUNX2-mediatedrepression of mouse FSH� transcription. A and B, L�T2 cells weretransfected with RUNX2 or its control vector along with the �398mouse FSH�luc wild-type (WT) reporter or the �398 FSH�luc reporterwith a cis mutation in the �159 Runx site (�156/�154 Mutation).FSH� promoter activity was assessed in cells treated with vehicle (A) oractivin (B) to determine the necessity of the �159 site for RUNX2repression. C, To test whether RUNX2 can interfere with Smad3-induced FSH� expression and whether the �159 Runx site is necessaryfor this effect, cells were cotransfected with Smad3 and RUNX2.*, Significant suppression of FSH� promoter activity by RUNX2 vs.empty vector; ns, not significant.


WRPY� or HTY�, P � 0.05), although there was a trendfor reduced inhibition by HTY� (P � 0.08 vs. Runx2).Furthermore, mutation of either domain did not alter theability of Runx2 to induce LH� (Fig. 8C), suggesting thatRunx2 coordinates induction of LH� via interaction withproteins other than Smads or Groucho family members.Taken together, these results demonstrate that the Runx2HTY motif is critical for repression of Smad3-inducedFSH� activity but not solely responsible for mediating therepressive actions of Runx2 on FSH� expression inducedby activin.

Discussion

In the present study, we identify a mechanism whereby theRunx family of transcription factors potently regulatesactivin induction of FSH� gene expression. Our investi-gation confirms the expression of Runx2 in the pituitarygland of mice and focuses on the role of Runx2 as a potentrepressor of activin action using a gonadotrope cell model.Promoter analyses show that RUNX2-mediated repres-sion of activin induction is lost upon 5� truncation or cismutation of any of the five previously characterized ele-ments mutation of which causes a loss of activin induction,converting RUNX2 repression to induction of FSH� geneexpression. Promoter truncations also reveal that in theabsence of activin signaling, RUNX2 induces FSH� ex-

pression, an activity lost when region �194/�127 is de-leted, thereby focusing our attention on the �159 Runxconsensus site within the FSH� promoter. With regardto the mechanism of RUNX2-mediated transcriptionalactivity, these findings demonstrate that the effect ofRUNX2 to induce or repress is closely tied to the highlycoordinated and complex mechanism of activin actionon the FSH� gene.

With regard to potential mechanisms of activin induc-tion, Smad proteins are well-known signaling moleculesactivated by TGF� family members. Smad2 and Smad3are phosphorylated by activin receptors at the plasmamembrane and, together with Smad4, induce transcrip-tion of target genes (44), including FSH� (9, 11, 12, 34).Of importance to our investigation, Smad3 and Runx2can physically and functionally interact at Runx compos-ite elements (29, 30) and induce repression of the osteo-calcinpromoter (29,30), providingapotentialmechanismwhereby Runx2 could inhibit activin induction of FSH�

gene expression. Consistent with this possibility, RUNX2not only suppresses activin induction of FSH� but alsorepresses induction by Smad3 as well. In actuality,RUNX2 nearly abolishes FSH� induction by Smad3 incomparison with the partial effect on activin induction(�85% vs. �50% reduced, Smad3 vs. activin, respective-ly; Fig. 7), and mutation of the Runx2/Smad interactiondomain eliminates Runx2-mediated repression of Smad3induction. However, our finding that mutation of this do-main only partially relieves repression of FSH� when it isinduced by activin suggests that the mechanism of Runx2-mediated repression of activin induction likely involvesmultiple factors in addition to Smad3.

With regard to other mediators, recent evidence sug-gests that the forkhead transcription factor, FoxL2, an-other transcriptional regulator known to bind Smads (45),is a critical mediator of activin induction of FSH� geneexpression. Indeed, FoxL2 has been shown to bind themurine �106 activin response element (35) and has thepotential to physically interact at the �153 site (46). Thus,if FoxL2 is binding at �153, Runx2 could interfere withits action and interaction with Smads by binding at �159.Taken together, our results show that Runx2 action isdependent on the availability of Smad3 and other co-regulatory proteins that interact at the �159 Runx-binding element and that the balance of these factorscontribute to the direction in which Runx2 regulates theFSH� promoter.

Our findings reinforce the idea that Runx2 is a context-dependent transcription factor, functioning as either acorepressor or coactivator depending on formation of spe-cific coregulatory protein interactions at the DNA level.These interactions are dictated by the carboxy terminus of

A

0

5

10

15

20

25

B

0

1

2

3

4

5

C

*

ns

FSH

β Fo

ld In

duct

ion

by A

ctiv

in

LHβ

Fold

Indu

ctio

n by

Act

ivin

Em

pty

Vect

or

WR

PY

µ

ns

FSH

β Fo

ld In

duct

ion

by S

mad

3

HTY

µ

Run

x2

0

1

2

3

4

5

Em

pty

Vect

or

WR

PY

µ

HTY

µ

Run

x2

Em

pty

Vect

or

WR

PY

µ

HTY

µ

Run

x2

FSHβLuc + Smad3 FSHβLuc + Activin LHβLuc + Activin

ns

FIG. 8. Runx2 repression of activin induction is mediated, in part,through an interaction with Smads. A and B, L�T2 cells weretransfected with the �398 FSH�luc reporter and an expressionvector containing wild-type murine Runx2, Runx2 with a mutatedWRPY motif (WRPY�), Runx2 with a mutated HTY motif (HTY�), orempty vector to assess whether Runx2 HTY or WRPY proteininteraction domains are necessary for repression of Smad3-induced(A) or activin-induced (B) FSH� activity. C, To test whether Runx2HTY or WRPY protein interaction domains are necessary for LH�induction, a 1.8-kb rat LH�luc reporter gene was transfected intoL�T2 cells along with Runx2, WRPY�, HTY�, or its empty vector,and activin-induced promoter activity was assessed. *, Significantrelief of repression by Runx2 mutation vs. wild-type Runx2; ns, notsignificant.


Runx2, which contains regions involved in either tran-scriptional activation or repression by Runx2, and motifsnecessary for mediating physical and functional interac-tions with a number of coregulatory proteins, includingthe corepressors of the Groucho/TLE family (40), his-tone deacetylase 3 (41), homeodomain activators suchas Dlx3 (42), and Smad proteins (43). Although ourstudies implicate the HTY Smad-interacting domainmotif as important for Runx2-mediated repression ofFSH�, protein interactions via this domain are not nec-essary for the induction of LH� by Runx2. Further-more, the idea that Runx2 can physically interact witha host of transcriptional effectors, which collectivelydictate activation or repression, sheds light on our find-ing of induction of LH� as well as our observation thatbasal expression of FSH was induced, rather than re-pressed, when the FSH� promoter was rendered unre-sponsive to activin via cis mutation or 5� truncation.Again, these findings underscore the complexity of generegulation by Runx2 and provide an intriguing andhighly exciting mechanism of hormonal regulation ofthe gonadotropin genes.

Developmentally, the importance of Runx2 cannot beunderestimated because mice lacking Runx2 die immedi-ately after birth due to the absence of mineralized bone(47). In the reproductive axis, Runx2 is expressed withinthe ovary during the follicular to luteal phase transition ofthe ovulatory cycle and is important for luteinization ofovarian follicles (48, 49). As for the pituitary gland, recentevidence suggests that RUNX2 is involved in human pi-tuitary tumor formation (37), and our findings confirmthe presence of Runx2 in the mouse pituitary and the L�T2gonadotrope cell model. Although we did not detectchanges in Runx2 mRNA across the ovulatory cycle inmice (unpublished observations) or observe protein levelsof Runx2 within L�T2 cells to change during hormonetreatment, we cannot exclude the possibility that thistightly regulated transcription factor is altered by hor-monal milieu within the gonadotrope cell itself. Anotherintriguing scenario is the potential interplay between themembers of the Runx family. Indeed, all three Runx mem-bers are expressed in L�T2 cells; however, we postulatethat the protein interactions unique to Runx2 enable thisregulatory factor to mediate specific regulatory effectsupon the gonadotropin subunit genes.

In summary, our results demonstrate a novel role forRunx2 regulation of FSH� gene expression in gonado-trope cells. We identify a putative Runx binding site at�159 in the mouse FSH� gene and show that this site isnecessary for RUNX2 repression of activin induction ofFSH�. Although RUNX2 also inhibits activin induction ofovine and human FSH�, the mechanism of repression in

these species may be indirect or through an element atanother location. Collectively, this work has revealed newinsights regarding hormonal regulation of the FSH� pro-moter by identifying a mechanism whereby FSH� expres-sion is dampened after induction by activin.

Acknowledgments

We thank Dr. Daniel Bernard (McGill University, Montreal,Canada) for generously providing the human FSH�-luciferaseplasmid. The rat LH�-luciferase plasmid was kindly provided byDr. Mark Lawson (University of California, San Diego, La Jolla,CA). We thank Dr. Yoshiaki Ito (National University of Singa-pore, Singapore) for providing the human RUNX1, -2, and -3plasmids and Dr. Jane Lian (University of Massachusetts,Worcester, MA) for providing the murine Runx2 plasmid. TheSmad3 expression plasmid was a kind gift of Dr. Rik Derynck(University of California-San Francisco, San Francisco, CA).Special thanks go to Dr. Rachel Larder for critical reading of themanuscript and members of the Mellon laboratory for helpfuldiscussions throughout this work. DNA sequencing was per-formed by the UCSD Cancer Center DNA sequencing sharedresource (NCI P30 CA023100).

Address all correspondence and requests for reprints to: PamelaL. Mellon, Department of Reproductive Medicine and Center forReproductive Science and Medicine, University of California,San Diego, 9500 Gilman Drive, La Jolla, California 92093-0674. E-mail: [email protected].

This work was supported by National Institutes of Health(NIH) Grant R01 HD020377 (to P.L.M.) and by the EuniceKennedy Shriver National Institute of Child Health and HumanDevelopment/NIHthroughcooperativeagreement (U54HD012303)as part of the Specialized Cooperative Centers Program in Re-production and Infertility Research (P.L.M.). K.M.B. was par-tially supported by NIH Grant F32 HD051360. V.G.T. waspartially supported by NIH Grant K01 DK080467, and D.C.was partially supported by NIH Grants R01 HD057549 andR03 HD054595.

Disclosure Summary: The authors have nothing to disclose.

References

1. Kumar TR, Wang Y, Lu N, Matzuk MM 1997 Follicle stimulatinghormone is required for ovarian follicle maturation but not malefertility. Nat Genet 15:201–204

2. Pierce JG, Parsons TF 1981 Glycoprotein hormones: structure andfunction. Annu Rev Biochem 50:465–495

3. Kaiser UB, Conn PM, Chin WW 1997 Studies of gonadotropin-releasing hormone (GnRH) action using GnRH receptor-expressingpituitary cell lines. Endocr Rev 18:46–70

4. Vale W, Rivier C, Brown M 1977 Regulatory peptides of the hy-pothalamus. Annu Rev Physiol 39:473–527

5. Matzuk MM, Kumar TR, Bradley A 1995 Different phenotypes formice deficient in either activins or activin receptor type II. Nature374:356–560


6. Vassalli A, Matzuk MM, Gardner HA, Lee KF, Jaenisch R 1994Activin/inhibin �B subunit gene disruption leads to defects in eyeliddevelopment and female reproduction. Genes Dev 8:414–427

7. Burns KH, Matzuk MM 2002 Genetic models for the study of go-nadotropin actions. Endocrinology 143:2823–2835

8. Bailey JS, Rave-Harel N, McGillivray SM, Coss D, Mellon PL 2004Activin regulation of the follicle-stimulating hormone �-subunitgene involves Smads and the TALE homeodomain proteins Pbx1and Prep1. Mol Endocrinol 18:1158–1170

9. Gregory SJ, Lacza CT, Detz AA, Xu S, Petrillo LA, Kaiser UB 2005Synergy between activin A and gonadotropin-releasing hormone intranscriptional activation of the rat follicle-stimulating hormone-�gene. Mol Endocrinol 19:237–254

10. Suszko MI, Balkin DM, Chen Y, Woodruff TK 2005 Smad3 medi-ates activin-induced transcription of follicle-stimulating hormone�-subunit gene. Mol Endocrinol 19:1849–1858

11. McGillivray SM, Thackray VG, Coss D, Mellon PL 2007 Activinand glucocorticoids synergistically activate follicle-stimulating hor-mone �-subunit gene expression in the immortalized L�T2 gona-dotrope cell line. Endocrinology 148:762–773

12. Lamba P, Santos MM, Philips DP, Bernard DJ 2006 Acute regula-tion of murine follicle-stimulating hormone �-subunit transcriptionby activin A. J Mol Endocrinol 36:201–220

13. Su P, Shafiee-Kermani F, Gore AJ, Jia J, Wu JC, Miller WL 2007Expression and regulation of the �-subunit of ovine follicle-stimu-lating hormone relies heavily on a promoter sequence likely to bindSmad-associated proteins. Endocrinology 148:4500–4508

14. Nusslein-Volhard C, Wieschaus E 1980 Mutations affecting seg-ment number and polarity in Drosophila. Nature 287:795–801

15. Bae SC, Lee YH 2006 Phosphorylation, acetylation and ubiquiti-nation: the molecular basis of RUNX regulation. Gene 366:58–66

16. Javed A, Guo B, Hiebert S, Choi JY, Green J, Zhao SC, Osborne MA,Stifani S, Stein JL, Lian JB, van Wijnen AJ, Stein GS 2000 Groucho/TLE/R-esp proteins associate with the nuclear matrix and repressRUNX (CBF�/AML/PEBP2�) dependent activation of tissue-spe-cific gene transcription. J Cell Sci 113:2221–2231

17. Zaidi SK, Javed A, Choi JY, van Wijnen AJ, Stein JL, Lian JB, SteinGS 2001 A specific targeting signal directs Runx2/Cbfa1 to sub-nuclear domains and contributes to transactivation of the osteocal-cin gene. J Cell Sci 114:3093–3102

18. Thackray VG, McGillivray SM, Mellon PL 2006 Androgens, pro-gestins and glucocorticoids induce follicle-stimulating hormone�-subunit gene expression at the level of the gonadotrope. Mol En-docrinol 20:2062–2079

19. Coss D, Jacobs SB, Bender CE, Mellon PL 2004 A novel AP-1 siteis critical for maximal induction of the follicle-stimulating hor-mone-� gene by gonadotropin-releasing hormone. J Biol Chem 279:152–162

20. Strahl BD, Huang HJ, Pedersen NR, Wu JC, Ghosh BR, Miller WL1997 Two proximal activating protein-1-binding sites are sufficientto stimulate transcription of the ovine follicle-stimulating hor-mone-� gene. Endocrinology 138:2621–2631

21. Vasilyev VV, Pernasetti F, Rosenberg SB, Barsoum MJ, Austin DA,Webster NJ, Mellon PL 2002 Transcriptional activation of the ovinefollicle-stimulating hormone-� gene by gonadotropin-releasing hor-mone involves multiple signal transduction pathways. Endocrinol-ogy 143:1651–1659

22. Bae SC, Lee KS, Zhang YW, Ito Y 2001 Intimate relationship be-tween TGF-�/BMP signaling and runt domain transcription factor,PEBP2/CBF. J Bone Joint Surg Am 83-A Suppl 1(Pt 1):S48–S55

23. Zhang Y, Feng XH, Derynck R 1998 Smad3 and Smad4 cooperatewith c-Jun/c-Fos to mediate TGF-�-induced transcription. Nature394:909–913

24. McGillivray SM, Bailey JS, Ramezani R, Kirkwood BJ, Mellon PL2005 Mouse GnRH receptor gene expression is mediated by theLHX3 homeodomain protein. Endocrinology 146:2180–2185

25. Coss D, Hand CM, Yaphockun KK, Ely HA, Mellon PL 2007 p38mitogen-activated kinase is critical for synergistic induction of the

FSH� gene by gonadotropin-releasing hormone and activin throughaugmentation of c-Fos induction and Smad phosphorylation. MolEndocrinol 21:3071–3086

26. Rosenberg SB, Mellon PL 2002 An Otx-related homeodomain pro-tein binds an LH� promoter element important for activation duringgonadotrope maturation. Mol Endocrinol 16:1280–1298

27. Cherrington BD, Bailey JS, Diaz AL, Mellon PL 2008 NeuroD1 andMash1 temporally regulate GnRH receptor gene expression in im-mortalized mouse gonadotrope cells. Mol Cell Endocrinol 295:106–114

28. Ooi GT, Tawadros N, Escalona RM 2004 Pituitary cell lines andtheir endocrine applications. Mol Cell Endocrinol 228:1–21

29. Javed A, Bae JS, Afzal F, Gutierrez S, Pratap J, Zaidi SK, Lou Y,van Wijnen AJ, Stein JL, Stein GS, Lian JB 2008 Structural couplingof Smad and Runx2 for execution of the BMP2 osteogenic signal.J Biol Chem 283:8412–8422

30. Alliston T, Choy L, Ducy P, Karsenty G, Derynck R 2001 TGF-�-induced repression of CBFA1 by Smad3 decreases cbfa1 and osteo-calcin expression and inhibits osteoblast differentiation. EMBO J20:2254–2272

31. Pernasetti F, Vasilyev VV, Rosenberg SB, Bailey JS, Huang HJ,Miller WL, Mellon PL 2001 Cell-specific transcriptional regulationof FSH� by activin and GnRH in the L�T2 pituitary gonadotropecell model. Endocrinology 142:2284–2295

32. Coss D, Thackray VG, Deng CX, Mellon PL 2005 Activin regulatesluteinizing hormone �-subunit gene expression through Smad-bind-ing and homeobox elements. Mol Endocrinol 19:2610–2623

33. Heinemeyer T WE, Reuter I, Hermjakob H, Kel AE, Kel OV,Ignatieva EV, Ananko EA, Podkolodnaya OA, Kolpakov FA,Podkolodny NL, Kolchanov NA 1998 Databases on transcriptionalregulation: TRANSFAC, TRRD, and COMPEL Nucleic Acids Res26:362–367

34. Suszko MI, Lo DJ, Suh H, Camper SA, Woodruff TK 2003 Regu-lation of the rat follicle-stimulating hormone �-subunit promoter byactivin. Mol Endocrinol 17:318–332

35. Lamba P, Fortin J, Tran S, Wang Y, Bernard DJ 2009 A novel rolefor the forkhead transcription factor FOXL2 in activin A-regulatedfollicle-stimulating hormone �-subunit transcription. Mol Endocri-nol 23:1001–1013

36. Thornell A, Hallberg B, Grundstrom T 1991 Binding of SL3-3 en-hancer factor 1 transcriptional activators to viral and chromosomalenhancer sequences. J Virol 65:42–50

37. Zhang HY, Jin L, Stilling GA, Ruebel KH, Coonse K, Tanizaki Y,Raz A, Lloyd RV 2009 RUNX1 and RUNX2 upregulate galectin-3expression in human pituitary tumors. Endocrine 35:101–111

38. Bernard DJ 2004 Both SMAD2 and SMAD3 mediate activin-stim-ulated expression of the follicle-stimulating hormone beta subunit inmouse gonadotrope cells. Mol Endocrinol 18:606–623

39. Afzal F, Pratap J, Ito K, Ito Y, Stein JL, van Wijnen AJ, Stein GS, LianJB, Javed A 2005 Smad function and intranuclear targeting share aRunx2 motif required for osteogenic lineage induction and BMP2responsive transcription. J Cell Physiol 204:63–72

40. Lutterbach B, Westendorf JJ, Linggi B, Isaac S, Seto E, Hiebert SW2000 A mechanism of repression by acute myeloid leukemia-1, thetarget of multiple chromosomal translocations in acute leukemia.J Biol Chem 275:651–656

41. Schroeder TM, Kahler RA, Li X, Westendorf JJ 2004 Histonedeacetylase 3 interacts with runx2 to repress the osteocalcin pro-moter and regulate osteoblast differentiation. J Biol Chem 279:41998 – 42007

42. Hassan MQ, Javed A, Morasso MI, Karlin J, Montecino M, vanWijnen AJ, Stein GS, Stein JL, Lian JB 2004 Dlx3 transcriptionalregulation of osteoblast differentiation: temporal recruitment ofMsx2, Dlx3, and Dlx5 homeodomain proteins to chromatin of theosteocalcin gene. Mol Cell Biol 24:9248–9261

43. Zaidi SK, Sullivan AJ, van Wijnen AJ, Stein JL, Stein GS, Lian JB


2002 Integration of Runx and Smad regulatory signals at transcrip-tionally active subnuclear sites. Proc Natl Acad Sci USA 99:8048–8053

44. Massague J 1998 TGF-� signal transduction. Annu Rev Biochem67:753–791

45. Blount AL, Schmidt K, Justice NJ, Vale WW, Fischer WH,Bilezikjian LM 2009 FoxL2 and Smad3 coordinately regulate fol-listatin gene transcription. J Biol Chem 284:7631–7645

46. Corpuz PS, Lindaman LL, Mellon PL, Coss D 16 March 2010 FoxL2is required for activin induction of the mouse and human follicle-stimulating hormone �-subunit genes. Mol Endocrinol 10.1210/me.2009-0425

47. Otto F, Thornell AP, Crompton T, Denzel A, Gilmour KC, RosewellIR, Stamp GW, Beddington RS, Mundlos S, Olsen BR, Selby PB,Owen MJ 1997 Cbfa1, a candidate gene for cleidocranial dysplasiasyndrome, is essential for osteoblast differentiation and bone devel-opment. Cell 89:765–771

48. Park ES, Choi S, Muse KN, Curry Jr TE, Jo M 2008 Response geneto complement 32 expression is induced by the luteinizing hormone(LH) surge and regulated by LH-induced mediators in the rodentovary. Endocrinology 149:3025–3036

49. Jo M, Curry Jr TE 2006 Luteinizing hormone-induced RUNX1regulates the expression of genes in granulosa cells of rat periovu-latory follicles. Mol Endocrinol 20:2156–2172

Refer a new active member and you couldreceive a $10 Starbucks Card when they join.

www.endo-society.org/referral


Documents

Runt-Related Transcription Factors Impair Activin ...repro.ucsd.edu/Thackray/SiteAssets/SitePages... · Runt-Related Transcription Factors Impair Activin Induction of the Follicle-Stimulating