RoleofErk1/2SignalingintheRegulationofNeutrophil Versus ... · monopoiesis, respectively. Hematopoietic cytokines have been shown to stimulate cell proliferation and survival; however,

Role of Erk1/2 Signaling in the Regulation of NeutrophilVersus Monocyte Development in Response to G-CSF andM-CSF*

Received for publication, May 29, 2015, and in revised form, August 14, 2015 Published, JBC Papers in Press, August 20, 2015, DOI 10.1074/jbc.M115.668871

Nan Hu, Yaling Qiu, and Fan Dong1

From the Department of Biological Sciences, University of Toledo, Toledo, Ohio 43606

Background: G-CSF and M-CSF are cytokines that support the development of neutrophils and monocytes, respectively.Results: The duration of Erk1/2 activation by G-CSF and M-CSF affects the lineage commitment of myeloid precursors.Conclusion: G-CSF and M-CSF instruct neutrophil versus monocyte development through differential activation of Erk1/2.Significance: This reveals a key mechanism by which G-CSF and M-CSF control lineage specification.

Lineage specification in the hematopoietic system depends onthe expression of lineage specific transcription factors. How-ever, the role of hematopoietic cytokines in this process has beencontroversial and little is known about the intracellular signal-ing mechanisms by which cytokines instruct lineage choice.G-CSF and M-CSF are two lineage-specific cytokines that play adominant role in granulopoiesis and monopoiesis, respectively.We show here that a G-CSFR mutant in which tyrosine 729 hadbeen mutated to phenylalanine (Y729F) promoted monocyterather than neutrophil development in myeloid precursors,which was associated with prolonged activation of Erk1/2 andaugmented activation of downstream targets c-Fos and Egr1.Inhibition of Erk1/2 activation or knockdown of c-Fos or Egr1largely rescued neutrophil development in cells expressingG-CSFR Y729F. We also show that M-CSF, but not G-CSF, stim-ulated strong and sustained activation of Erk1/2 in mouse line-age marker negative (Lin�) bone marrow cells. Significantly,inhibition of Erk1/2 signaling in these cells favored neutrophilover monocyte development in response to M-CSF. Thus, pro-longed Erk1/2 activation resulted in monocyte development fol-lowing G-CSF induction whereas inhibition of Erk1/2 signalingpromoted neutrophil development at the expense of monocyteformation in response to M-CSF. These results reveal an impor-tant mechanism by which G-CSF and M-CSF instruct neutro-phil versus monocyte lineage choice, i.e. differential activationof Erk1/2 pathway.

Neutrophils and monocytes/macrophages, key componentsof host innate immune defense against infections, are derivedfrom hematopoietic stem cells (HSCs)2 through a processcalled myelopoiesis, in which HSCs, through progressive com-mitment, give rise to common myeloid progenitors (CMPs)

that in turn develop into granulocyte-monocyte progenitors(GMPs) (1, 2). GMPs are bipotent and can terminally differen-tiate into either granulocytes or monocytes in response to cellintrinsic and external signals. Myelopoiesis is a dynamic pro-cess that is tightly controlled by two interacting mechanisms,i.e. a transcription factor network that regulates the expressionof lineage-specific genes and a group of hematopoietic cyto-kines that stimulate intracellular signaling by binding to cellsurface cytokine receptors (3–5). These two mechanisms act incollaboration to regulate the commitment, differentiation, pro-liferation, and survival of HSCs and myeloid precursors. Dis-ruption of the regulatory mechanisms is often associated withmyeloid leukemia.

The lineage specification of HSCs and precursors depends onthe expression and activities of lineage specific transcriptionfactors. Monocyte and neutrophil lineage specifications requirethe transcription factors C/EBP� and PU.1 that are compo-nents of a myeloid transcriptional regulatory circuit, whichincludes Egr1, Egr2, Nab2, and Gfi1, among others (5, 6). A highC/EBP�/PU.1 ratio supports neutrophil development whereasincreased expression of PU.1 favors monocyte over granulocytelineage decision (7). C/EBP� instructs neutrophil cell fate inpart through activating Gfi1 that promotes neutrophil develop-ment and suppresses the alternative monocyte development(8 –10). PU.1 acts in a graded manner to direct distinct cell fateswith a high expression promoting monocyte development anda low expression required for B lymphocyte development (11).PU.1 activates IRF8, Klf4, Egr2, and Nab2 that direct monocytedevelopment at the expense of neutrophil cell fate (12–14). Inaddition, transcription factors c-Fos and c-Jun have beenshown to positively regulate monocyte development (5, 15, 16).

G-CSF and M-CSF are two lineage-specific hematopoieticcytokines that play a dominant role in granulopoiesis andmonopoiesis, respectively. Hematopoietic cytokines have beenshown to stimulate cell proliferation and survival; however,their role in lineage specification remains controversial (17–19). According to the stochastic model, cell fate choice is sto-chastic and cytokines simply provide nonspecific permissivesignals for the survival and proliferation of already committedcells. The instructive model, on the other hand, proposes thatcytokines actively instruct uncommitted cells to differentiate

* This work was supported in part by National Institutes of Health GrantR15HL112183 (to F. D.) from the NHLBI. The authors declare that they haveno conflicts of interest with the contents of this article.

1 To whom correspondence should be addressed: Dept. of Biological Sci-ences, University of Toledo, 2801 West Bancroft St., Toledo, Ohio 43606.Tel.: 419-530-1577; Fax: 419-530-7737; E-mail: [email protected].

2 The abbreviations used are: HSC, hematopoietic stem cell; GMP, granulo-cyte-monocyte progenitors; G-CSFR, granulocyte colony-stimulating fac-tor receptor; BM, bone marrow; Lin�, lineage marker negative; MPO,myeloperoxidase; NE, neutrophil elastase.

crossmarkTHE JOURNAL OF BIOLOGICAL CHEMISTRY VOL. 290, NO. 40, pp. 24561–24573, October 2, 2015

© 2015 by The American Society for Biochemistry and Molecular Biology, Inc. Published in the U.S.A.

OCTOBER 2, 2015 • VOLUME 290 • NUMBER 40 JOURNAL OF BIOLOGICAL CHEMISTRY 24561

by guest on January 30, 2020http://w

ww

.jbc.org/D

ownloaded from

http://crossmark.crossref.org/dialog/?doi=10.1074/jbc.M115.668871&domain=pdf&date_stamp=2015-8-20

http://www.jbc.org/

into distinct types of mature blood cells. While both models arebacked by experimental data, two recent reports lend strongsupport to the instructive model, at least for G-CSF and M-CSF.Using the bio-imaging approaches that permit continuouslong-term observation at the single-cell level, it was shown thatG-CSF and M-CSF can instruct myeloid lineage choice in HSCsand GMPs (20, 21). However, the intracellular signaling mech-anisms by which G-CSF and M-CSF instruct granulocyte versusmonocyte lineage commitment are unknown.

In this report, we show that substitution of Tyr-729 ofG-CSFR with phenylalanine (F) resulted in monocyte develop-ment in response to G-CSF, which was associated with pro-longed activation of Erk1/2 and augmented activation of c-Fosand Egr1. Treatment of cells with Mek1/2 inhibitors or knock-down of c-Fos or Egr1 essentially rescued neutrophil develop-ment. Notably, the Mek1/2 inhibitors also promoted neutro-phil development at the expense of monocyte formationinduced by M-CSF. Our data reveal an important signalingmechanism by which G-CSF and M-CSF direct neutrophil ver-sus monocyte lineage specification.

Experimental Procedures

Cell Lines and Cell Culture—Murine myeloid 32D cellsexpressing the different forms of G-CSFR have been described(22, 23). Cells were maintained in RPMI 1640 with 10% heat-inactivated fetal bovine serum (HI-FBS), 10% WEHI-3B cell-conditioned media as a crude source of murine interleukin-3,and 1% penicillin/streptomycin (P/S). Murine multipotentialFDCP-mix A4 cells (24) were maintained in IMDM mediumsupplemented with 15% horse serum and 10% WEHI-3B cell-conditioned medium. FDCP-mix A4 cells were transfected withthe human G-CSFR expression constructs by electroporationand then selected in G418 (0.6 mg/ml). Cells expressing thehuman G-CSFR were isolated by fluorescence-activated cellsorting (FACS) following staining with an anti-human G-CSFRantibody (BD Biosciences, San Jose, CA).

Flow Cytometry—Cells were washed in PBS with 2% horseserum and blocked with Fc block (eBioscience) for 15 min. Cellswere then incubated with isotype control anti-mouse IgG anti-body conjugated with phycoerythrin (PE), anti-mouse IgG anti-body conjugated with fluorescein isothiocyanate (FITC) or PE-conjugated anti-F4/80 antibody for 30 min prior to washing inPBS with 2% horse serum. All antibodies were purchased fromeBioscience. Samples were analyzed by flow cytometry usinga FACSCalibur and the CellQuest software system (BDBiosciences).

Western Blot Analysis—Cells were lysed in SDS lysis bufferand proteins were separated by SDS-PAGE prior to transferonto polyvinylidenedifluoride (PVDF) membranes. The mem-branes were incubated with the appropriate antibodies andsignals were detected by enhanced chemiluminescence. Theantibodies against phospho-Stat5, phospho-Stat3, phospho-Erk1/2, c-Fos, phospho-c-Fos (Ser32), Egr-1, and �-actin werepurchased from Cell Signaling.

Luciferase Reporter Assay—Cells were transfected with thereporter constructs TRE3-tk-Luc (a gift from Dr. Lirim Shem-shedini, The University of Toledo) or pEBS24-Luc (a gift fromDr. Gerald Thiel, University of the Saarland Medical Center).

Sixteen hours after transfection, cells were washed and stimu-lated with G-CSF (10 ng/ml) for 8 h. Luciferase activities weremeasured using the Molecular Devices Lmaxluminometer(Sunnyvale, CA).

RNA Interference—Lentiviral constructs containing murinec-Fos and Egr-1 shRNAs were purchased from Thermo Scien-tific. Lentiviral vector encoding a murine ERK2 shRNA(TRCN54729) was purchased from Dharmacon. To targetmurine ERK1, oligonucleotides were designed to generatea mature antisense AATGTAAACATCTCTCATGGC andcloned into pLKO.1-Hygro (Addgene plasmid 24150). 293Tcells were transfected with the lentiviral constructs along withpackaging plasmids psPAX2 and pMD2G using the calciumphosphate coprecipitation procedure. Supernatants containingviral particles were harvested at 48 and 72 h post-transfection,concentrated, and used to infect cells in the presence of 8 �g/mlpolybrene (Santa Cruz Biotechnology). Cells were selected in 2�g/ml puromycin for 48 h or hygromycin (1 mg/ml) for 4 daysprior to evaluation of gene knockdown by Western blotanalysis.

Real-time Reverse Transcription Polymerase Chain Reaction(qRT-PCR)—Total RNA was extracted using TRIzol reagent(Invitrogen), and cDNA was synthesized using the GoScriptTM

Reverse Transcription System and Oligo(dT)15 primer (Pro-mega, Madison, WI). qRT-PCR was performed using theSsoFastTM EvaGreen Supermix� kit (Bio-Rad), and the relativelevels of mRNAs for the different myeloid differentiation mark-ers were normalized to GAPDH mRNA expression.

Bone Marrow (BM) Cell Culture—BM cells were isolatedfrom the long bones of 6 – 8-week-old C57BL/6 mice and redblood cells were lysed with ACK Lysing buffer (Lonza). Cellswere then subjected to lineage depletion using the antibodiesagainst the following lineage markers: CD3e, CD11b, CD45R/B220, Ly6G, and Ly-6C, and TER-119 (BD Biosciences) andimmunomagnetic beads (Miltenyi Biotec). Lineage negative(Lin�) cells were cultured in IMDM media with 10% HI-FBS, 10ng/ml IL-3, 20 ng/ml IL-6, and 25 ng/ml SCF (Peprotech). ForM-CSF-induced differentiation, cells were cultured in IMDMmedium with 10% HI-FBS, 10 ng/ml IL-3, 20 ng/ml IL-6, 25ng/ml SCF, and 10 ng/ml M-CSF for 3 days prior to evaluationof cell differentiation. For colony forming assays, 6 – 8-week-old C57BL/6 mice were treated with 5-fluorouracil (5-FU; 150mg/kg). BM cells were isolated 5 days later and incubated inIMDM media with 10% HI-FBS, 10 ng/ml IL-3, 20 ng/ml IL-6,25 ng/ml SCF for 1 h for recovery. Cells (104) were then seededin methylcellulose-based medium (R&D System) with 10% HI-FBS, IL-3, IL-6, SCF, and M-CSF with or without indicatedinhibitors. Colonies were enumerated on day 7.

Apoptosis Assay—Apoptosis was examined using theAnnexin V-PE apoptosis detection kit (BD Biosciences). Briefly,0.3 � 106 cells were collected and incubated with AnnexinV-PE and 7 amino-actinomycin (7-AAD). Cells were analyzedby two-color flow cytometry.

Statistics—GraphPad Prism software (GraphPad Software,La Jolla, CA) was used for all statistical analysis. Data are shownas mean � S.D. in all figures. A p value of �0.05 was consideredsignificant for all analyses and shown as *. ** denotes p � 0.01,*** denotes p � 0.001, and **** denotes p � 0.0001.

G-CSF in Neutrophil Lineage Specification

24562 JOURNAL OF BIOLOGICAL CHEMISTRY VOLUME 290 • NUMBER 40 • OCTOBER 2, 2015


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/

Results

Tyrosine 729 of G-CSFR Is Essential for Instructing Neutro-phil Lineage Choice—The human G-CSFR contains four tyro-sine (Y) residues in the cytoplasmic domain, i.e. Y704, Y729,Y744, and Y764 (Fig. 1A), that have been implicated inG-CSF-stimulated proliferation, survival and differentiation(23, 25–28). Notably, Y729, Y744, and Y764 are located in the

C-terminal region of G-CSFR required for differentiationsignaling (22, 29). To address the roles of the C-terminaltyrosine residues in G-CSF response, we evaluated theG-CSF response of 32D cells transfected with the G-CSFRmA mutant (32D/mA) in which the three C-terminal tyro-sine (Y) residues were mutated to phenylalanine (F) (23, 30).As reported previously (22, 31), 32D cells expressing the wild

FIGURE 1. Mutations of the three C-terminal tyrosine residues of G-CSFR result in monocyte development in response to G-CSF. A, schematic repre-sentation of the different G-CSFR forms. Shown are the transmembrane and cytoplasmic domains. Boxes 1, 2, and 3 denote regions conserved among somemembers of the cytokine receptor superfamily. Cytoplasmic tyrosine residues are also indicated. B, 32D cells expressing WT or mA form of G-CSFR wereexamined for growth behaviors by phase contrast light microscopy after culture in G-CSF for 4 days. Cells were also examined on day 6 for morphologicalfeatures by Wright-Giemsa staining (C), surface expression of F4/80 by flow cytometry (D), and expression of M-CSF and Mmp-12 mRNAs by qRT-PCR (E).

FIGURE 2. Tyrosine 729 of G-CSFR is required for neutrophil development in 32D cells. Cells expressing the indicated G-CSFR mutants were cultured inG-CSF and examined for growth behaviors on day 4 (A). On day 6, cells were evaluated for morphological features (B), surface expression of F4/80 (C), and theexpression of M-CSF and Mmp-12 mRNAs (D).




ww

.jbc.org/D

ownloaded from

http://www.jbc.org/

FIGURE 3. Tyrosine 729 of G-CSFR is required for neutrophil development in FDCP-mix A4 cells. Cells were transfected with the WT or Y729F form of G-CSFR andevaluated for G-CSFR expression by flow cytometry (A). Cells were then cultured in G-CSF for 2 days prior to evaluation of growth behaviors (B), morphological features(C), surface expression of F4/80 (D), and the levels of M-CSF and Mmp-12 mRNAs (E) except that the morphology of FDCP/GR cells was examined on day 5.

FIGURE 4. G-CSFR Y729F mediates prolonged activation of downstream signaling pathways. 32D (A and C) and FDCP-mix A4 (B and D) cells expressing WTor Y729F form of G-CSFR were starved for 2 h prior to stimulation with G-CSF for indicated minutes (A and B) or hours (C and D). Activation of Stat5, Akt, andErk1/2 was examined by Western blot analysis using phospho-specific antibodies.




ww

.jbc.org/D

ownloaded from

http://www.jbc.org/

type (WT) G-CSFR (32D/GR) underwent terminal neutro-philic differentiation after culture in G-CSF for 6 to 9 days.Interestingly, upon culture in G-CSF, 32D/mA cells showedincreased cell sizes, adherence to the culture dishes and mor-phological features characteristic of monocytes (Fig. 1, B andC). Consistent with this, the surface expression of macro-phage marker F4/80 and the mRNA levels of M-CSF andMmp-12 were significantly higher in 32D/mA cells than in32D/GR cells (Fig. 1, D and E). Thus, mutations of the C-ter-minal tyrosine residues of G-CSFR resulted in monocyterather than neutrophil development in response to G-CSF,suggesting that the C-terminal tyrosine residues function topromote neutrophil cell fate and suppress the alternativemonocyte development.

To identify the involved tyrosine residue, we evaluated theG-CSF responses of 32D cells transfected with the G-CSFRmutants containing individual Y-to-F substitutions in the C ter-minus (Fig. 1A). Y744F and Y764F mutations had no significanteffect on neutrophil development; however, 32D cells express-

ing G-CSFR Y729F (32D/Y729F) displayed features associatedwith monocyte development (Fig. 2). To confirm the observa-tions in a different cell line, we expressed the WT G-CSFR andY729F mutant in murine multipotent FDCP-mix A4 cells.Parental FDCP-mix A4 cells expressed no detectable levels ofendogenous G-CSFR and M-CSFR on cell surface, and the cellsdied in G-CSF or M-CSF within 24 h (data not shown). FDCP-mix A4 cells transfected with the WT G-CSFR (FDCP/GR)developed into mature neutrophils after culture in G-CSF for 6days (Fig. 3). In contrast, FDCP/Y729F rapidly developed intomonocytes within 2–3 days following G-CSF induction anddied subsequently. Thus, G-CSFR Y729 is required for neutro-phil development in response to G-CSF.

Prolonged Activation of Erk1/2 Is Required for MonocyteDevelopment Mediated by G-CSFR Y729F—We previouslyshowed that Y729 of G-CSFR controls the duration of G-CSFRsignaling (23). The kinetics of G-CSF-stimulated activation ofdifferent downstream pathways was examined in more detail in32D and FDCP-mix A4 cells. As shown in Fig. 4, A and B,

FIGURE 5. Suppression of Erk1/2 signaling restores neutrophil development. 32D/Y729F and FDCP/Y729F cells were cultured in G-CSF in the absence (Ctr)and presence of U0126 (U0; 10 �M) or PD0325901 (PD; 0.25 �M) for 6 (32D/Y729F) or 2 (FDCP/Y729F) days prior to evaluation of growth behaviors (A),morphology (B), F4/80 surface expression (C) and expression of M-CSF and Mmp-12 mRNAs (D).




ww

.jbc.org/D

ownloaded from

http://www.jbc.org/

G-CSFR Y729F mediated prolonged activation of Stat5, Akt,and Erk1/2 in both cell lines. Activation of these pathways wasalso enhanced in FDCP-mix A4 cells. It has been shown thatM-CSF stimulates more potent activation of Erk1/2 as com-pared with G-CSF and that sustained activation of Erk1/2 isrequired for M-CSF-induced monocytic differentiation (32,33). We therefore examined the activation status of Erk1/2 incells continuously cultured in G-CSF for up to 48 h. Erk1/2phosphorylation was barely detectable at 24 h in cells express-ing the WT G-CSFR, but readily detected in cells expressingG-CSFR Y729F, and even at 48 h in 32D/Y729F cells (Fig. 4, Cand D). Thus, prolonged activation of Erk1/2 led to theirpersistent activation when cells were cultured continuouslyin G-CSF.

We addressed whether inhibition of Erk1/2 activation res-cued neutrophil development. As shown in Fig. 5, treatmentof 32D/Y729F and FDCP/Y729F cells with the Mek1/2 inhib-itor U0126 or PD0325901 resulted in the typical neutrophildevelopment with reduced cell sizes, loss of adherent phe-notype and diminished expression of M-CSF and Mmp-12although the expression of F4/80 was not significantlyaltered. Comparable results were obtained with anotherMek1/2 inhibitor PD98059 (data not shown). To furtheraddress the role of Erk1/2 pathway in monocyte develop-ment mediated by G-CSFR Y729F, we knocked down theirexpression using shRNAs specifically targeting murine Erk1and Erk2 (32). As shown in Fig. 6, knockdown of Erk1 andErk2 largely rescued neutrophil development in response toG-CSF in both 32D/Y729F and FDCP/Y729 cells. Thus, pro-longed activation of Erk1/2 pathway is essential for mono-cyte development directed by G-CSFR Y729F.

Suppression of Erk1/2 Pathway Favors Neutrophil Develop-ment at the Expense of Monocyte Cell Fate in Response toM-CSF—Previous studies have provided supportive evidencefor an instructive role of M-CSF in monocyte development (20,21). However, how M-CSF instructs monocyte cell fate remainsunresolved. We examined Erk1/2 activation by G-CSF andM-CSF in mouse Lin� BM cells. Treatment with M-CSF, butnot G-CSF, resulted in strong and sustained activation ofErk1/2 for at least six hours (Fig. 7A). In contrast, G-CSF, butnot M-CSF, stimulated Stat3 phosphorylation. When culturedin M-CSF for 3 days, more than 70% of Lin� BM cells developedinto monocytes/macrophages (Fig. 7, B and C). Interestingly,addition of U0126 or PD0325901 to the cultures increased thenumbers of mature neutrophils, but markedly suppressedmacrophage development. The decrease in macrophage popu-lation was unlikely due to increased apoptosis as U0126 andPD0325901 had only a modest effect on cell survival (data notshown). We further performed colony formation assays toassess the effect of the Mek1/2 inhibitors on the developmentof myeloid precursors. As shown in Fig. 7D, U0126 andPD0325901 caused an approximate 2-fold increase in the num-ber of CFU-G, but significantly decreased the number ofCFU-M. In support of increased neutrophil development at theexpense of monocyte formation, the two Mek1/2 inhibitorsdownregulated the expression of M-CSF and Mmp-12, but up-regulated the mRNA levels of the neutrophil differentiationmarkers, including the primary granule proteins myeloperoxi-dase (MPO) and neutrophil elastase (NE), secondary granuleprotein lactoferrin (LF) and tertiary granule protein gelatinaseB in BM cells cultured in M-CSF (Fig. 7E). Thus, upon suppres-

FIGURE 6. Knockdown (KD) of Erk1 and Erk2 rescues G-CSF-induced neutrophil development. A, 32D/Y729F and FDCP/Y729F cells were transducedwith empty lentiviral vector (Ctr) or sequentially with Erk2 and Erk1 shRNAs, and examined for Erk1/2 expression by Western blot analysis. Cells werethen cultured in G-CSF for 6 (32D/Y729F) or 2 (FDCP/Y729F) days prior to evaluation of growth behaviors (B), morphology (C), and the levels of M-CSFand Mmp-12 mRNAs (D).




ww

.jbc.org/D

ownloaded from

http://www.jbc.org/

sion of Erk1/2 signaling, M-CSF mainly supported neutrophildevelopment in mouse BM cells.

G-CSFR Y729F Mediates Enhanced Activation of c-Fos andEgr1—c-Fos and Egr1 are immediate early genes (IEGs) that areactivated by the Erk1/2 pathway (34, 35). When persistentlyactivated, Erk1/2 also directly phosphorylates c-Fos that is rap-idly induced following Erk1/2 activation and thus c-Fos phos-phorylation serves as a sensor for Erk1/2 signal duration (36,37). Erk1/2-mediated phosphorylation stabilizes c-Fos andprimes additional phosphorylation by exposing an Erk1/2docking site, called DEF domain. Interestingly, Egr1 also has aDEF domain and several potential Erk1/2 phosphorylation sites(37). We investigated whether prolonged activation of Erk1/2mediated by G-CSFR Y729F led to enhanced phosphorylationand activation of c-Fos and Egr1. In 32D and FDCP-mix A4cells expressing the WT or Y729F form of G-CSFR, G-CSF

stimulation resulted in rapid induction of c-Fos and Egr1,accompanied by their electrophoretic mobility shifts thatbecame increasingly more significant up to 8 h after G-CSFstimulation (Fig. 8A). Both U0126 and PD0325901 blockedc-Fos and Egr1 induction by G-CSF (data not shown). Notably,the induction of c-Fos and Egr1 was more sustained, and theirmobility shifts greater in cells expressing G-CSFR Y729F thanin cells expressing WT G-CSFR. Consistent with this, phosphor-ylation of c-Fos on serine 32, which occurred one hour afterc-Fos induction, was greater and more sustained in cellsexpressing G-CSFR Y729F.

Egr1 has been shown to promote monocyte development atthe expense of neutrophil cell fate (14, 16, 38). A potential roleof c-Fos in monocyte development has also been proposed (5,15, 39). We next examined whether sustained induction andphosphorylation of c-Fos and Egr1 enhanced their transcrip-

FIGURE 7. Suppression of Erk1/2 signaling favors neutrophil over monocyte development in response to M-CSF. A, mouse Lin� BM cells were starved for1 h, followed by stimulation with G-CSF or M-CSF for indicated times prior to evaluation of Erk1/2 and Stat3 activation. Lin� BM cells were cultured in M-CSF inthe absence (Ctr) and presence of U0126 (U0) or PD0325901 (PD). Morphological analysis (B) and differential cell counts (C) were performed on day 3. D, BMmononuclear cells were obtained from 5-FU-treated mice and cultured in methylcellulose medium containing IL-3, IL-6, SCF, and M-CSF at 104 cells/dish withno inhibitors (Ctr), U0126 or PD0325901. Colonies were counted 7 days later. Data are presented as fold changes of colony numbers obtained with the 2 Mek1/2inhibitors relative to the control colony numbers. E, Lin� BM cells were cultured in M-CSF in the absence (Ctr) and presence of U0126 (U0) or PD0325901 (PD)for 3 days. The mRNA levels for the indicated proteins were examined.




ww

.jbc.org/D

ownloaded from

http://www.jbc.org/

tional activities. c-Fos heterodimerizes with Jun family tran-scription factors to form AP-1 proteins that activate transcrip-tion of target genes via the tetradecanoyl phorbol acetate

response element (TRE). In both 32D and FDCP-mix A4 cells,G-CSFR Y729F mediated augmented activation of the lucifer-ase reporter construct containing three repeats of TRE (40)

FIGURE 8. G-CSFR Y729F mediates augmented activation of c-Fos and Egr1. A, 32D (left panels) and FDCP-mix A4 (right panels) cells expressing WT or Y729Fform of G-CSFR were treated with G-CSF for different times and examined for c-Fos and Egr1 expression, and c-Fos phosphorylation on serine 32 by Westernblot analysis. B and C, cells as indicated were transfected with the luciferase reporter constructs containing three repeats of TRE (B) or four repeats of Egr1binding site (C). Eighteen hours later, cells were treated with IL-3 or G-CSF for 8 h prior to evaluation of luciferase activity. Data are presented as luciferaseactivity induced by G-CSF relative to that induced by IL-3.

FIGURE 9. Knockdown of c-Fos restores G-CSF-induced neutrophil development in 32D/Y729F cells. A, cells were transduced with empty lentiviral vector(Ctr) or two different c-Fos shRNAs (79 and 80), and examined for c-Fos expression. Cells were subsequently cultured in G-CSF for 6 days prior to evaluation ofgrowth behaviors (B), morphology (C), M-CSF and Mmp-12 mRNA levels (D), and F4/80 expression (E).




ww

.jbc.org/D

ownloaded from

http://www.jbc.org/

(Fig. 8B). Activation of the reporter construct with four repeatsof conserved Egr1 binding site (41) was also augmented in cellsexpressing G-CSFR Y729F (Fig. 8C). As expected, activation ofthe two reporter constructs by G-CSF was inhibited by U0126and PD0325901 (data not shown). Thus, prolonged activationof Erk1/2 was associated with augmented activation of AP1 andEgr1.

Neutrophil Development Is Partially Restored upon Knock-down of c-Fos or Egr1 in Cells Expressing G-CSFR Y729F—Toaddress whether enhanced activation of c-Fos contributed tomonocyte development, we transduced 32D/Y729F cells withthe lentiviral constructs containing two different shRNAs

against c-Fos. shRNA 79 markedly and shRNA 80 moderatelyinhibited c-Fos induction by G-CSF (Fig. 9A). When cultured inG-CSF for 6 days, the c-Fos knocked down 32D/Y729F cellsdeveloped into morphologically mature neutrophils with sig-nificantly less adherence to culture dishes and reduced expres-sion of M-CSF and Mmp-12 (Fig. 9, B–D). Notably, as in cellstreated with U0126 and PD0325901, the expression of F4/80was not altered by c-Fos knockdown (Fig. 9E). To address therole of enhanced Egr1 activation in monocyte development, weexpressed 3 different Egr1 shRNAs in 32D/Y729F cells. Asshown in Fig. 10A, shRNAs 25 and 26 inhibited Egr1 inductionby G-CSF whereas shRNA 24 showed no effect. Notably,

FIGURE 10. Knockdown of Egr1 restores G-CSF-induced neutrophil development in 32D/Y729F cells. A, cells were transduced with empty lentiviral vector(Ctr) or three different Egr-1 shRNAs as indicated, and examined for Egr1 expression. Cells were subsequently cultured in G-CSF for 6 days prior to evaluationof growth behaviors (B), morphology (C), M-CSF and Mmp-12 mRNA levels (D), and F4/80 expression (E).




ww

.jbc.org/D

ownloaded from

http://www.jbc.org/

shRNAs 25 and 26, but not shRNA 24 supported neutrophildevelopment at the expense of monocyte development (Fig. 10,B–D). Similar to c-Fos knockdown, F4/80 expression was notaffected following Egr1 knockdown (Fig. 10E).

We also knocked down c-Fos and Egr1 in FDCP/Y729F cells.As shown in Fig. 11, knockdown of either c-Fos or Egr1 resultedin a shift in cell morphology toward neutrophils following cul-ture in G-CSF for 2 days, which was associated with down-regulation of M-CSF and Mmp-12, and up-regulation of NEand MPO. No significant changes in F4/80 expression wereobserved (data not shown). Thus, knockdown of c-Fos or Egr1partially rescued neutrophil development in both 32D/Y729Fand FDCP/Y729F cells. The data also indicated that c-Fos andEgr1 were not involved in the regulation of F4/80 expression.

Discussion

It has long been debated whether hematopoietic cytokinesdirect lineage specification and, if they do, little is known aboutthe underlying signaling mechanisms. Two recent studies pro-vide strong evidence for an instructive role of G-CSF andM-CSF in the regulation of lineage commitment toward neu-trophils and monocytes, respectively, in GMPs and HSCs (20,21). However, how G-CSF and M-CSF regulate the intracellularsignaling pathways to resolve neutrophil versus monocyte cellfate decision is still unknown.

In this report, we have shown that G-CSFR Y729F promotesmonocyte rather than neutrophil development. Interestingly,G-CSFR Y729F has previously been shown to induce macro-phage-like morphology in murine myeloid L-GM cells (25) andsupport significantly increased formation of macrophage colo-nies but reduced number of granulocyte colonies in mouse pri-mary BM cells (27). Our data further indicate that monocytedevelopment directed by G-CSFR Y729F is associated with pro-longed activation of Erk1/2 and inhibition of Erk1/2 signalinglargely rescues neutrophil development. Importantly, M-CSF,but not G-CSF, induces sustained and strong activation ofErk1/2 in mouse Lin� BM cells, and inhibition of Erk1/2 path-way favors neutrophil over monocyte/macrophage develop-ment in Lin� BM cells cultured in M-CSF. Thus, prolongedErk1/2 activation results in monocyte development followingG-CSF induction whereas inhibition of Erk1/2 signaling pro-motes neutrophil development at the expense of monocyte cellfate in response to M-CSF. It appears that the signals for termi-nal differentiation transduced by G-CSFR and M-CSFR mightbe similar, but the decision whether to develop along the neu-trophil or monocytes/macrophage lineage largely depends onthe duration and probably also the magnitude of Erk1/2 activa-tion. These results point to an important mechanism by whichG-CSF and M-CSF instruct neutrophil versus monocyte lineagechoice, i.e. differential activation of Erk1/2 pathway. In support

FIGURE 11. Knockdown of c-Fos or Egr1 favors neutrophil over monocyte development in FDCP/Y729F cells. A, cells transduced with empty lentiviralvector (Ctr), c-Fos shRNA 79, or two different Egr1 shRNAs (24 and 25) were examined for expression of c-Fos and Egr1. Cells were then cultured in G-CSF for 2days prior to evaluation of cell morphology (B), and the levels of mRNAs for M-CSF and Mmp-12 (C), and for NE and MPO (D).




ww

.jbc.org/D

ownloaded from

http://www.jbc.org/

of this, it has been shown that inhibition of Erk1/2 signalingwith U0126 or through overexpression of the Erk1/2-specificnuclear phosphatase DUSP5 led to neutrophil instead of mono-cyte development in response to M-CSF in a mouse E2A-Pbx1-immortalized pro-T cell line transfected with M-CSFR (42, 43).

The Erk1/2 signaling pathway has been shown to play a piv-otal role in cell differentiation in different cellular systems. Forinstance, sustained ERK1/2 activation by nerve growth factor(NGF) induces neuronal differentiation in PC12 cells (44, 45).Thrombopoietin-induced megakaryocytic differentiation is de-pendent on prolonged activation of the Ras-Erk1/2 pathway(46). Persistent Erk1/2 signaling has also been shown to berequired for M-CSF-induced monocytic differentiation in mye-loid FDCP1 cells (33) and that the Mek1/2 inhibitors U0126 andPD98059 inhibit the production of monocytes/macrophagesfrom primary BM cells in vitro (32, 47). The data presented hereindicate that Erk1/2 pathway regulates neutrophil versusmonocyte lineage choice, but is not required for the process ofterminal differentiation. It is of note that treatment of Lin� BMcells cultured in M-CSF with U0126 and PD0325901 not onlydecreases the production of monocytes and macrophages, butalso increases the total number of neutrophils, indicating thatinhibition of Erk1/2 signaling redirects the Lin� BM cells todevelop along the alternative neutrophil lineage in response toM-CSF. However, monocyte/macrophage development is notcompletely blocked by the Mek1/2 inhibitors in Lin� BM cells.It is possible that Erk1/2 pathway promotes, but is not essentialfor monocyte development. An alternative explanation is thatsome Lin� cells are already committed to the monocyte lineageand their terminal differentiation is not dependent on Erk1/2signaling.

Our data also indicate that the Erk1/2 pathway promotesmonocyte cell fate through c-Fos and Egr1. Prolonged Erk1/2activation by G-CSFR Y729F is associated with more sustainedinduction, greater mobility shifts and augmented activation ofc-Fos and Egr1, consistent with the previous study demonstrat-ing that the persistently activated Erk1/2 directly phosphory-late and stabilize c-Fos and likely other early response geneproducts including Egr1 (36, 37). Phosphorylation of c-Fos byErk1/2 also primes it for additional phosphorylation (37).Indeed, G-CSF-induced c-Fos phosphorylation on Ser 32 wasmore sustained in cells expressing G-CSFR Y729F than in cellsexpressing WT G-CSFR. Egr1 has been shown to supportmonopoiesis and suppresses the alternative neutrophil cell fate(14, 38). c-Fos has also been suggested to be involved in mono-poiesis (5, 15, 39). Significantly, similar to the effects of Erk1/2knockdown and the Mek1/2 inhibitors, knockdown of c-Fos orEgr1 largely restores neutrophil cell fate in response to G-CSF.Thus, c-Fos and Egr1 represent the key transcription factorsthat are differentially activated by G-CSF and M-CSF in anErk1/2-dependent manner to resolve neutrophil versus mono-cyte cell fate. Additionally, our data reveal for the first time acritical role of c-Fos in monopoiesis.

In addition to activating c-Fos and Egr1, Erk1/2 have beenshown to phosphorylate serine 21 of C/EBP� and therebyinhibit its activity (48). However, we have observed no signifi-cant difference in C/EBP� activity upon G-CSF stimulation of32D cells expressing the WT or Y729F form of G-CSFR in lucif-

erase reporter assays (data not shown). In contrast, we haveconsistently observed that G-CSFR Y729F, but not the WTG-CSFR activates a luciferase reporter construct containingthree repeats of the conserved PU.1 binding site, which is notblocked by the Mek1/2 inhibitors.3 In this aspect, it is interest-ing to note that the expression of F4/80 is not suppressed fol-lowing inhibition of Erk1/2 signaling, or knockdown of c-Fos orEgr1. Notably, PU.1 activation has been associated with up-reg-ulation of F4/80 expression (7, 49 –51). It is possible thatG-CSFR Y729F may also activate other signaling pathways topromote monocyte development. Further studies are needed toexamine the signaling pathway downstream of G-CSFR Y729Fleading to PU.1 activation and determine whether PU.1 directlyactivates F4/80 expression.

Author Contributions—N. H., Y. Q., and F. D. performed experi-ments; N. H. and F. D. analyzed results, prepared the figures, andwrote the paper; and F. D. designed the research.

Acknowledgments—We thank Drs. Lirim Shemshedini and Dr. Ger-ald Thiel for the luciferase reporter vectors, Dr. Ivo P Touw for theG-CSFR Y-to-F substitution mutants used in this study, and Dr. BobWeinberg for the pLKO.1-Hygro vector.

References1. Kondo, M., Wagers, A. J., Manz, M. G., Prohaska, S. S., Scherer, D. C.,

Beilhack, G. F., Shizuru, J. A., and Weissman, I. L. (2003) Biology of hema-topoietic stem cells and progenitors: implications for clinical application.Annu. Rev. Immunol. 21, 759 – 806

2. Iwasaki, H., and Akashi, K. (2007) Hematopoietic developmental path-ways: on cellular basis. Oncogene 26, 6687– 6696

3. Ward, A. C., Loeb, D. M., Soede-Bobok, A. A., Touw, I. P., and Friedman,A. D. (2000) Regulation of granulopoiesis by transcription factors andcytokine signals. Leukemia 14, 973–990

4. Terry, R. L., and Miller, S. D. (2014) Molecular control of monocyte de-velopment. Cell. Immunol. 291, 16 –21

5. Huber, R., Pietsch, D., Günther, J., Welz, B., Vogt, N., and Brand, K. (2014)Regulation of monocyte differentiation by specific signaling modules andassociated transcription factor networks. Cell Mol. Life Sci. 71, 63–92

6. Friedman, A. D. (2002) Transcriptional regulation of granulocyte andmonocyte development. Oncogene 21, 3377–3390

7. Dahl, R., Walsh, J. C., Lancki, D., Laslo, P., Iyer, S. R., Singh, H., and Simon,M. C. (2003) Regulation of macrophage and neutrophil cell fates by thePU.1:C/EBP� ratio and granulocyte colony-stimulating factor. Nat. Im-munol. 4, 1029 –1036

8. Lidonnici, M. R., Audia, A., Soliera, A. R., Prisco, M., Ferrari-Amorotti, G.,Waldron, T., Donato, N., Zhang, Y., Martinez, R. V., Holyoake, T. L., andCalabretta, B. (2010) Expression of the transcriptional repressor Gfi-1 isregulated by C/EBP{�} and is involved in its proliferation and colony for-mation-inhibitory effects in p210BCR/ABL-expressing cells. Cancer Res.70, 7949 –7959

9. Hock, H., Hamblen, M. J., Rooke, H. M., Traver, D., Bronson, R. T., Cam-eron, S., and Orkin, S. H. (2003) Intrinsic requirement for zinc fingertranscription factor Gfi-1 in neutrophil differentiation. Immunity 18,109 –120

10. Karsunky, H., Zeng, H., Schmidt, T., Zevnik, B., Kluge, R., Schmid, K. W.,Dührsen, U., and Möröy, T. (2002) Inflammatory reactions and severeneutropenia in mice lacking the transcriptional repressor Gfi1. Nat. Genet.30, 295–300

11. DeKoter, R. P., and Singh, H. (2000) Regulation of B lymphocyteand macrophage development by graded expression of PU.1. Science

3 N. Hu and F. Dong, unpublished data.




ww

.jbc.org/D

ownloaded from

http://www.jbc.org/

288, 1439 –144112. Feinberg, M. W., Wara, A. K., Cao, Z., Lebedeva, M. A., Rosenbauer, F.,

Iwasaki, H., Hirai, H., Katz, J. P., Haspel, R. L., Gray, S., Akashi, K., Segre, J.,Kaestner, K. H., Tenen, D. G., and Jain, M. K. (2007) The Kruppel-likefactor KLF4 is a critical regulator of monocyte differentiation. EMBO J. 26,4138 – 4148

13. Schönheit, J., Kuhl, C., Gebhardt, M. L., Klett, F. F., Riemke, P., Scheller,M., Huang, G., Naumann, R., Leutz, A., Stocking, C., Priller, J., Andrade-Navarro, M. A., and Rosenbauer, F. (2013) PU.1 level-directed chromatinstructure remodeling at the Irf8 gene drives dendritic cell commitment.Cell Reports 3, 1617–1628

14. Laslo, P., Spooner, C. J., Warmflash, A., Lancki, D. W., Lee, H. J., Sciam-mas, R., Gantner, B. N., Dinner, A. R., and Singh, H. (2006) Multilineagetranscriptional priming and determination of alternate hematopoietic cellfates. Cell 126, 755–766

15. Lord, K. A., Abdollahi, A., Hoffman-Liebermann, B., and Liebermann,D. A. (1993) Proto-oncogenes of the fos/jun family of transcription factorsare positive regulators of myeloid differentiation. Mol. Cell. Biol. 13,841– 851

16. Friedman, A. D. (2007) Transcriptional control of granulocyte and mono-cyte development. Oncogene 26, 6816 – 6828

17. Metcalf, D. (1998) Lineage commitment and maturation in hematopoieticcells: the case for extrinsic regulation. Blood 92, 345–347

18. Enver, T., Heyworth, C. M., and Dexter, T. M. (1998) Do stem cells playdice? Blood 92, 348 –351; discussion 352

19. Robb, L. (2007) Cytokine receptors and hematopoietic differentiation.Oncogene 26, 6715– 6723

20. Rieger, M. A., Hoppe, P. S., Smejkal, B. M., Eitelhuber, A. C., and Schroe-der, T. (2009) Hematopoietic cytokines can instruct lineage choice. Sci-ence 325, 217–218

21. Mossadegh-Keller, N., Sarrazin, S., Kandalla, P. K., Espinosa, L., Stanley,E. R., Nutt, S. L., Moore, J., and Sieweke, M. H. (2013) M-CSF instructsmyeloid lineage fate in single haematopoietic stem cells. Nature 497,239 –243

22. Dong, F., van Buitenen, C., Pouwels, K., Hoefsloot, L. H., Löwenberg, B.,and Touw, I. P. (1993) Distinct cytoplasmic regions of the human granu-locyte colony- stimulating factor receptor involved in induction of prolif-eration and maturation. Mol. Cell. Biol. 13, 7774 –7781

23. Zhuang, D., Qiu, Y., Haque, S. J., and Dong, F. (2005) Tyrosine 729 of theG-CSF receptor controls the duration of receptor signaling: involvementof SOCS3 and SOCS1. J. Leukoc Biol. 78, 1008 –1015

24. Heyworth, C. M., Dexter, T. M., Kan, O., and Whetton, A. D. (1990) Therole of hemopoietic growth factors in self-renewal and differentiation ofIL-3-dependent multipotential stem cells. Growth Factors 2, 197–211

25. Yoshikawa, A., Murakami, H., and Nagata, S. (1995) Distinct signal trans-duction through the tyrosine-containing domains of the granulocyte col-ony-stimulating factor receptor. EMBO J. 14, 5288 –5296

26. Ward, A. C., Smith, L., de Koning, J. P., van Aesch, Y., and Touw, I. P.(1999) Multiple signals mediate proliferation, differentiation, and survivalfrom the granulocyte colony-stimulating factor receptor in myeloid 32Dcells. J. Biol. Chem. 274, 14956 –14962

27. Akbarzadeh, S., Ward, A. C., McPhee, D. O., Alexander, W. S., Lieschke,G. J., and Layton, J. E. (2002) Tyrosine residues of the granulocyte colony-stimulating factor receptor transmit proliferation and differentiation sig-nals in murine bone marrow cells. Blood 99, 879 – 887

28. Hermans, M. H., van de Geijn, G. J., Antonissen, C., Gits, J., van Leeuwen,D., Ward, A. C., and Touw, I. P. (2003) Signaling mechanisms coupled totyrosines in the granulocyte colony-stimulating factor receptor orches-trate G-CSF-induced expansion of myeloid progenitor cells. Blood 101,2584 –2590

29. Fukunaga, R., Ishizaka-Ikeda, E., and Nagata, S. (1993) Growth and differ-entiation signals mediated by different regions in the cytoplasmic domainof granulocyte colony-stimulating factor receptor. Cell 74, 1079 –1087

30. Ward, A. C., Hermans, M. H., Smith, L., van Aesch, Y. M., Schelen, A. M.,Antonissen, C., and Touw, I. P. (1999) Tyrosine-dependent and -indepen-dent mechanisms of STAT3 activation by the human granulocyte colony-stimulating factor (G-CSF) receptor are differentially utilized dependingon G-CSF concentration. Blood 93, 113–124

31. Zhuang, D., Qiu, Y., Kogan, S. C., and Dong, F. (2006) Increased C/EBP-epsilon expression and premature apoptosis in myeloid cells expressingGfi-1 N382S mutant associated with severe congenital neutropenia. J. Biol.Chem. 281, 10745–10751

32. Jack, G. D., Zhang, L., and Friedman, A. D. (2009) M-CSF elevates c-Fosand phospho-C/EBP�(S21) via ERK whereas G-CSF stimulates SHP2 phos-phorylation in marrow progenitors to contribute to myeloid lineage spec-ification. Blood 114, 2172–2180

33. Gobert Gosse, S., Bourgin, C., Liu, W. Q., Garbay, C., and Mouchiroud, G.(2005) M-CSF stimulated differentiation requires persistent MEK activityand MAPK phosphorylation independent of Grb2-Sos association andphosphatidylinositol 3-kinase activity. Cell Signal. 17, 1352–1362

34. Buchwalter, G., Gross, C., and Wasylyk, B. (2004) Ets ternary complextranscription factors. Gene 324, 1–14

35. O’Donnell, A., Odrowaz, Z., and Sharrocks, A. D. (2012) Immediate-earlygene activation by the MAPK pathways: what do and don’t we know?Biochemical Society Transactions 40, 58 – 66

36. Okazaki, K., and Sagata, N. (1995) The Mos/MAP kinase pathway stabi-lizes c-Fos by phosphorylation and augments its transforming activity inNIH 3T3 cells. EMBO J. 14, 5048 –5059

37. Murphy, L. O., Smith, S., Chen, R. H., Fingar, D. C., and Blenis, J. (2002)Molecular interpretation of ERK signal duration by immediate early geneproducts. Nat. Cell Biol. 4, 556 –564

38. Krishnaraju, K., Hoffman, B., and Liebermann, D. A. (2001) Early growthresponse gene 1 stimulates development of hematopoietic progenitor cellsalong the macrophage lineage at the expense of the granulocyte anderythroid lineages. Blood 97, 1298 –1305

39. Cai, D. H., Wang, D., Keefer, J., Yeamans, C., Hensley, K., and Friedman,A. D. (2008) C/EBP �:AP-1 leucine zipper heterodimers bind novel DNAelements, activate the PU.1 promoter and direct monocyte lineage com-mitment more potently than C/EBP alpha homodimers or AP-1. Onco-gene 27, 2772–2779

40. Cai, C., Hsieh, C. L., and Shemshedini, L. (2007) c-Jun has multiple en-hancing activities in the novel cross talk between the androgen receptorand Ets variant gene 1 in prostate cancer. Molecular cancer research : MCR5, 725–735

41. Al-Sarraj, A., Day, R. M., and Thiel, G. (2005) Specificity of transcriptionalregulation by the zinc finger transcription factors Sp1, Sp3, and Egr-1.J. Cell. Biochem. 94, 153–167

42. Bourette, R. P., Grasset, M. F., and Mouchiroud, G. (2007) E2a/Pbx1 on-cogene inhibits terminal differentiation but not myeloid potential ofpro-T cells. Oncogene 26, 234 –247

43. Grasset, M. F., Gobert-Gosse, S., Mouchiroud, G., and Bourette, R. P.(2010) Macrophage differentiation of myeloid progenitor cells in responseto M-CSF is regulated by the dual-specificity phosphatase DUSP5. J. Leu-koc Biol. 87, 127–135

44. Gotoh, Y., Nishida, E., Yamashita, T., Hoshi, M., Kawakami, M., and Sakai,H. (1990) Microtubule-associated-protein (MAP) kinase activated bynerve growth factor and epidermal growth factor in PC12 cells. Identitywith the mitogen-activated MAP kinase of fibroblastic cells. Eur.J. Biochem. 193, 661– 669

45. Nguyen, T. T., Scimeca, J. C., Filloux, C., Peraldi, P., Carpentier, J. L., andVan Obberghen, E. (1993) Co-regulation of the mitogen-activated proteinkinase, extracellular signal-regulated kinase 1, and the 90-kDa ribosomalS6 kinase in PC12 cells. Distinct effects of the neurotrophic factor, nervegrowth factor, and the mitogenic factor, epidermal growth factor. J. Biol.Chem. 268, 9803–9810

46. Matsumura, I., Nakajima, K., Wakao, H., Hattori, S., Hashimoto, K., Suga-hara, H., Kato, T., Miyazaki, H., Hirano, T., and Kanakura, Y. (1998) In-volvement of Prolonged Ras Activation in Thrombopoietin-InducedMegakaryocytic Differentiation of a Human Factor-Dependent Hemato-poietic Cell Line. Mol. Cell. Biol. 18, 4282– 4290

47. Bourgin-Hierle, C., Gobert-Gosse, S., Thérier, J., Grasset, M. F., andMouchiroud, G. (2008) Src-family kinases play an essential role in differ-entiation signaling downstream of macrophage colony-stimulating factorreceptors mediating persistent phosphorylation of phospholipase C-�2and MAP kinases ERK1 and ERK2. Leukemia 22, 161–169

48. Ross, S. E., Radomska, H. S., Wu, B., Zhang, P., Winnay, J. N., Bajnok, L.,




ww

.jbc.org/D

ownloaded from

http://www.jbc.org/

Wright, W. S., Schaufele, F., Tenen, D. G., and MacDougald, O. A. (2004)Phosphorylation of C/EBP� inhibits granulopoiesis. Mol. Cell. Biol. 24,675– 686

49. Fisher, R. C., Olson, M. C., Pongubala, J. M., Perkel, J. M., Atchison, M. L.,Scott, E. W., and Simon, M. C. (1998) Normal myeloid development re-quires both the glutamine-rich transactivation domain and the PEST re-gion of transcription factor PU.1 but not the potent acidic transactivationdomain. Mol. Cell. Biol. 18, 4347– 4357

50. Yamada, T., Abe, M., Higashi, T., Yamamoto, H., Kihara-Negishi, F., Saku-rai, T., Shirai, T., and Oikawa, T. (2001) Lineage switch induced by over-expression of Ets family transcription factor PU.1 in murine erythroleu-kemia cells. Blood 97, 2300 –2307

51. Nishiyama, C., Nishiyama, M., Ito, T., Masaki, S., Masuoka, N., Yamane,H., Kitamura, T., Ogawa, H., and Okumura, K. (2004) Functional analysisof PU.1 domains in monocyte-specific gene regulation. FEBS Lett. 561,63– 68




ww

.jbc.org/D

ownloaded from

http://www.jbc.org/

Nan Hu, Yaling Qiu and Fan DongDevelopment in Response to G-CSF and M-CSF

MonocyteVersusRole of Erk1/2 Signaling in the Regulation of Neutrophil

doi: 10.1074/jbc.M115.668871 originally published online August 20, 20152015, 290:24561-24573.J. Biol. Chem.

10.1074/jbc.M115.668871Access the most updated version of this article at doi:

Alerts:

When a correction for this article is posted•

When this article is cited•

to choose from all of JBC's e-mail alertsClick here

http://www.jbc.org/content/290/40/24561.full.html#ref-list-1

This article cites 51 references, 21 of which can be accessed free at


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/lookup/doi/10.1074/jbc.M115.668871

http://www.jbc.org/cgi/alerts?alertType=citedby&addAlert=cited_by&cited_by_criteria_resid=jbc;290/40/24561&saveAlert=no&return-type=article&return_url=http://www.jbc.org/content/290/40/24561

http://www.jbc.org/cgi/alerts?alertType=correction&addAlert=correction&correction_criteria_value=290/40/24561&saveAlert=no&return-type=article&return_url=http://www.jbc.org/content/290/40/24561

http://www.jbc.org/cgi/alerts/etoc

http://www.jbc.org/content/290/40/24561.full.html#ref-list-1

http://www.jbc.org/

Documents

RoleofErk1/2SignalingintheRegulationofNeutrophil Versus ... · monopoiesis, respectively. Hematopoietic cytokines have been shown to stimulate cell proliferation and survival; however,