University of Central Florida University of Central Florida

STARS STARS

Electronic Theses and Dissertations, 2004-2019

2008

Role Of Transient Receptor Potential Canonical-6 (trpc6) Channel Role Of Transient Receptor Potential Canonical-6 (trpc6) Channel

In Metastasis Of Glioblastoma Multiforme In Metastasis Of Glioblastoma Multiforme

Rajarajeshwari Venkataraman University of Central Florida

Part of the Cancer Biology Commons, Microbiology Commons, Molecular Biology Commons, and the

Oncology Commons

Find similar works at: https://stars.library.ucf.edu/etd

University of Central Florida Libraries http://library.ucf.edu

This Masters Thesis (Open Access) is brought to you for free and open access by STARS. It has been accepted for

inclusion in Electronic Theses and Dissertations, 2004-2019 by an authorized administrator of STARS. For more

information, please contact STARS@ucf.edu.

STARS Citation STARS Citation Venkataraman, Rajarajeshwari, "Role Of Transient Receptor Potential Canonical-6 (trpc6) Channel In Metastasis Of Glioblastoma Multiforme" (2008). Electronic Theses and Dissertations, 2004-2019. 3714. https://stars.library.ucf.edu/etd/3714

ROLE OF TRANSIENT RECEPTOR POTENTIAL CANONICAL-6 (TrpC6)

CHANNEL IN METASTASIS OF GLIOBLASTOMA MULTIFORME

By

RAJARAJESHWARI VENKATARAMAN B.Sc. Mysore University, India, 1996

M.Sc. Maniple Academy of Higher Education, India, 1999

A thesis submitted in partial fulfillment of the requirements

For the degree of Master of Science

In the Department of Molecular Biology and Microbiology

In the Brunet School of Biomedical sciences

In the College of Medicine

At the University of Central Florida

Orlando, Florida

Fall Term

2008

ii

ABSTRACT

Glioblastoma multiforme (GBM) is one of the extremely fatal brain tumors. The main reason

that makes it so lethal is its capability to invade and spread to other parts of CNS producing

secondary tumors. Among other factors hypoxia, reduced oxygen availability, is linked to higher

metastatic potential of cancers. Hypoxia causes numerous changes in genome and proteome of

the cell. These changes help a normal cell to adapt to nutritional deficiency, but the same

changes can increase the malignancy and metastasis in tumor cells. Extensive research by a

number of curious scientists reveal that various pathways involving numerous proteins cross-talk

and interact with each other and execute a response to hypoxia. We are trying to establish the

link between two such pathways – HIF1-alpha pathway and Notch pathway. Both, HIF1-alpha,

which is a transcription factor that becomes active in hypoxic conditions and Notch, which is an

evolutionarily conserved cell-fate determinant, are implicated in hypoxia-induced metastasis of

cancer. In this given project, we confirm the cross talk between Notch and HIF1-alpha pathway

and further continue our study to show that TrpC6 is the downstream mediator of this pathway,

leading to metastasis of GBM. Expression analysis of hypoxia-induced U373 cells (Grade 3

glioblastoma cells), using Real-time PCR, western blot and immunocytochemistry, revealed

elevated levels of Notch, Hif1 and TrpC6 indicating that these proteins might be important for

the cellular response to hypoxia. Blocking Notch and/or HIF1-alpha, either by DAPT or HIF1-

inhibitor, confirmed the communication between these two pathways. Role of TrpC6 in

iii

metastasis was demonstrated by knocking down this gene using siRNA against TrpC6. Inhibition

of TrpC6 markedly decreased cell proliferation, migration, angiogenesis and tumorigenesis in

these hypoxia-induced Glioblastoma cells. In summary, all these results reveal that TrpC6 is

indeed an important member of the Notch-mediated metastasis of Glioblastoma under hypoxic

conditions. This role of TrpC6 can therefore be utilized for pharmacological intervention to

prevent hypoxia-induced metastasis in GBM.

iv

Dedicated to my family and friends

Your support, confidence and love carried me

v

ACKNOWLEDGMENTS

I would like to thank God Almighty for allowing me the privilege and opportunity to

obtain higher education. I thank Dr. Kiminobu Sugaya, for giving me the opportunity to conduct

research in his lab. His commitment to training students, dedication to biomedical research and

high standards has guided me throughout my graduate career. I would also like to thank my

committee members, Dr. Sic.L.Chan, Dr. Steven Ebert and Dr. Dinender Singla, for their

assistance in completion of my thesis and encouragement. Special thanks go to my spouse

Sathyashankar Somasekar for his patience and understanding.

I would like to recognize Dr. Srinivas for assistance and guidance with the project.

Sincere thanks goes to all my lab sisters and brothers, especially Stephanie, Serene, Rasha and

Manny. To my children Shankari and Vignesh, I thank you for providing me with unconditional

love and motivation. Finally I would like to thank my Parents and my family members, you

have made it possible. I love you all.

vi

TABLE OF CONTENTS

LIST OF FIGURES ..................................................................................................................... viii LIST OF TABLES ......................................................................................................................... ix

LIST OF ABBREVIATIONS ......................................................................................................... x CHAPTER 1: INTRODUCTION ................................................................................................... 1

1.1 Glioblastoma Multiforme – Background and pathophysiology............................................ 5 1.2. Signs and Symptoms of the disease ..................................................................................... 6

1.3. Treatment ............................................................................................................................. 6 1.4 Molecular Genetics of GBM ................................................................................................. 7

1.5 Metastasis .............................................................................................................................. 9 1.6 Hypoxia and Metastasis ...................................................................................................... 11 1.7 Research in our lab.............................................................................................................. 12

1.8 Hypoxia Induced Factor 1 ................................................................................................... 12 1.8.1 HIF-1 – Structure and Function ................................................................................... 12

1.8.1A Structure of HIF1: ................................................................................................. 12 1.8.1B Regulation of alpha subunit: ................................................................................. 13 1.8.1C Function of HIF1: .................................................................................................. 14

1.8.2 Role of HIF-1 in Cancer .............................................................................................. 14 1.9 Notch ................................................................................................................................... 15

1.9.1. Structure and Function ................................................................................................ 15 1.9.1A Structure of notch protein: .................................................................................... 15

1.9.1B Processing of notch protein: .................................................................................. 16 1.9.1C Functions of Notch Protein: .................................................................................. 16

1.9.2. Role of Notch in Cancer: ............................................................................................ 17 1.10 TrpC6 ................................................................................................................................ 20

1.10.1 Structure and function of TrpC6 channels ................................................................. 20

1.10.1A Structure of TrpC6: ............................................................................................. 20 1.10.1B Function of TrpC6: .............................................................................................. 21

1.10.2 Role of TrpC6 in Cancer ............................................................................................ 21 1.11 Hypothesis......................................................................................................................... 22 1.12 Aims of the project............................................................................................................ 23 1.13 Experimental design.......................................................................................................... 23

1.13.1 Aim 1: Expression of Notch, TrpC6 and Hif-1 increases during hypoxia ................ 23 1.13.2 Aim 2: HIF1 and Notch pathways crosstalk under hypoxia ...................................... 24 1.13.3 Aim 3: TrpC6 acts as the downstream effector of Notch and HIF1 and is responsible

for the effect of these proteins on metastasis of Glioblastoma. ............................................ 25 CHAPTER 2: MATERIALS AND METHODS .......................................................................... 26

2.1 Cell Culture – .................................................................................................................. 26 2.2 Inducing Hypoxia –......................................................................................................... 26 2.3 Treatment with DAPT/HIF1-Inhibitor – ......................................................................... 26

vii

2.4 siRNA transfection –....................................................................................................... 27 2.5 RNA extraction and Reverse Transcription – ................................................................. 27 2.6 Quantitative Real-Time Polymerase Chain Reaction – .................................................. 28 2.7 Western Blots – ............................................................................................................... 29

2.8 Immunocytochemistry – ................................................................................................. 29 2.9 Cell migration assay – ..................................................................................................... 30 2.10 In-vitro tube morphogenesis on Matrigel – .................................................................. 31 2.11 MTT assay for cell proliferation – ................................................................................ 32 2.12 Soft Agar Colony formation assay – ............................................................................. 32

2.13 Brdu-Incorporation assay - ........................................................................................... 33 CHAPTER 3: RESULTS AND DISCUSSION ............................................................................ 34

3.1 Expression of Notch, HIF1-alpha and TrpC6 increases in U373-MG and GBM primary

culture cells under hypoxic conditions: ................................................................................ 34 3.2 Hypoxia-induced response of Notch involves cross talk with the HIF1 pathway: ......... 36 3.3 TrpC6 is the downstream mediator of Notch-mediated pathway: .................................. 38

CONCLUSIONS........................................................................................................................... 45 REFERENCES .............................................................................. Error! Bookmark not defined.

viii

LIST OF FIGURES

Figure 1: Brain – General features .................................................................................................. 2

Figure 2: Glioblastoma Multiforme ................................................................................................ 5 Figure 3: Genes responsible for development of primary and secondary glioblastoma ................. 8 Figure 4: Schematic representation of structure if HIF1 .............................................................. 14 Figure 5: Structure of Notch ......................................................................................................... 17 Figure 6: Animation depicting Notch processing ......................................................................... 19

Figure 7: Structure of TrpC6 channels.......................................................................................... 21

Figure 8: Transwell insert for migration assay ............................................................................. 31 Figure 9: Expression analysis of Notch, HIF1 and TrpC channels............................................... 35 Figure 10: Effect of CoCl2, DAPT and HIF1-Inhibitor on the expression of Hif1, NICD and

TrpC6: ........................................................................................................................................... 37 Figure 11: Test for siRNA transfection efficiency: ...................................................................... 38

Figure 12: Invasion/Migration assay: ........................................................................................... 40 Figure 13: In-Vitro tube morphogenesis on matrigel: .................................................................. 41 Figure 14: MTT assay ................................................................................................................... 42

Figure 15: Brdu-incorporation assay ............................................................................................ 43 Figure 16: Soft agar colony formation assay ................................................................................ 44

Figure 17: Schematic representation of projected pathway for notch response to hypoxia in

cancer cells .................................................................................................................................... 46

ix

LIST OF TABLES

Table 1 : Different grades of brain tumors based on WHO grading system ................................... 4

Table 2: Oncogenes and Tumor-suppressor genes implicated in Glioblastoma multiforme .......... 7 Table 3: Primers used for real-time PCR ...................................................................................... 28

x

LIST OF ABBREVIATIONS

1. TRPC = Transient Receptor Potential Canonical ion channel

2. NICD = Notch intracellular domain

3. NECD = Notch extracellular domain

4. HIF1 = Hypoxia induced factor-1

5. GBM = Glioblastoma Multiforme

6. CNS = Central nervous system

7. HREs = HIF1 responsive elements

8. VEGF = Vascular Endothelial Growth Factor

9. EMT = Epithelium-Mesenchyme transition

10. DAPT = N-[N-(3,5-Difluorophenacetyl)-L-alanyl]-S-phenylglycine t-butyl ester

11. CoCl2 = Cobalt chloride

12. DMEM = Dulbecco's Modified Eagle Medium

13. siRNA = Small interfering RNA

1

CHAPTER 1: INTRODUCTION

Nervous system is a complex, intricate system of neuronal and non-neuronal supporting cells that

defines what we are. It is a communication system that can receive and send out a lot of

information simultaneously, thus orchestrating all the bodily functions. Human nervous system is

divided into Central nervous system and peripheral nervous system1. Central nervous system

again consists of two main components namely the Brain and the Spinal cord. Peripheral nervous

system is composed of nerves that connect CNS to peripheral structures such as muscles, glands,

etc. Structurally, brain is comprised of 1

1. Brainstem: Medulla oblongata, Pons, Midbrain – Contains ascending and descending

tracts which convey information to and from forebrain or cerebellum.

2. Hindbrain: Cerebellum – Controls fine motor activities and involuntary movements.

3. Forebrain: Diencephalon and the Cerebral hemispheres – Diencephalon contains

Thalamus, hypothalamus, epithalamus and other associated structures. Thalamus acts as a

relay station for all the sensations except olfaction. It receives these inputs and relays it to

specific part of the cerebral hemisphere. Each cerebral hemisphere contains three major

subdivisions including cerebral cortex, subcortical white matter and basal ganglia.

Lying in the core of the forebrain and brainstem are a series of fluid-filled spaces known as

ventricles1. These ventricles are lined by ependymal cells which secrete the Cerebrospinal Fluid

(CSF) that is seen circulating within these cavities. Adjoining these ventricles we can see the

presence of multi potent Stem Cells which help in the partial replacement of dead brain cells.

Owing to the fact that brain in very soft and fragile, it is covered by three protective tissue layers,

collectively called Meninges1. Brain is also surrounded by a protective bony covering known as

2

the Skull. From outside to inside, the three meninges are - Dura mater, Arachnoid mater and Pia

mater. These meninges also extend to cover the spinal cord and part of cranial nerves.

Cranial nerves originate from nuclei present the brain. These nerves could be sensory, motor or

both. 12 pairs of cranial nerves arise from the brain1. The first cranial nerve (Olfactory nerve)

originates from the basal surface of the brain. Others can be seen arising from the brainstem.

Figure 1: Brain – General features

A – Components of central nervous system

B – Ventricles of the brain

C – Meninges of the brain

D – Cranial nerves

A B

C D

3

Endocrine glands including Pituitary and Pineal can be seen closely associated with the brain.

Pituitary is the master of all endocrine glands because it controls their activity. Its activity in turn

is closely controlled by hypothalamus1. Pineal gland, which promotes sleep by producing

melatonin, is also controlled by hypothalamus.

Normal functioning of the brain is vital for the maintenance of a healthy lifestyle. However, the

nervous system is also invariably vulnerable to diseases and injuries. One such condition is

neoplasm of the brain, also known as tumor. A tumor is a mass of abnormally growing cells.

Tumors of the central nervous system, brain tumors, can occur in the brain or any structure

associated with the brain, including cranial nerves, meninges, skull, pituitary and pineal gland.

Brain tumor death accounts for almost a quarter of deaths resulting from cancer in children (19

years of age)2. The incidence of all primary tumors (over 120 different types) in the USA is 14

per 100,000 people3.

Brain tumors can be classified as

Primary or Secondary: Primary tumors originate in the brain itself while the secondary

tumors spread from cancers primarily located in other organs (metastatic tumors)4.

Benign or Malignant: Benign tumors do not spread while malignant tumors can invade

and spread to other parts of the CNS or sometimes even to the adjoining lymph nodes4.

Gliomas or Non-gliomas: A glioma arises from glial cells. Non-gliomas could arise from

optic nerve, pituitary gland, pineal gland, ependymal cells or primitive cells left over

from early development of CNS4, 5

.

4

The main types of gliomas are4, 5

:

Ependymomas — Arise from ependymal cells

Astrocytomas — Arise from astrocytes

Oligodendrogliomas — Arise from oligodendrocytes

Mixed gliomas, such as oligoastrocytomas, contain cells from different types of glia.

Gliomas are further categorized according to their grade, Low-grade or High-grade. The criteria

for grading include microscopic appearances, malignancy level, growth rate, vascularity and

similarity to normal cells. The most commonly used grading system is the World Health

Organization (WHO) grading system6 (Table 1).

Table 1 : Different grades of brain tumors based on WHO grading system

Criteria GRADE 1 GRADE 2 GRADE 3 GRADE 4

Microscopic

appearance

Normal Slightly

abnormal

Abnormal Very abnormal

and have necrotic

tissue.

Malignancy Least May invade

surrounding

tissue

Invade

surrounding

tissue.

Invade wide

areas of

surrounding

tissue.

Growth rate Slow Faster that

Grade1

Fast Rapid

proliferation

Recurrence None May recur as

grade 2 or higher

Frequently recur

as grade 4.

Frequently recur

as grade 4.

Example Pilocytic

astrocytoma

Diffuse or low-

grade

astrocytoma

Anaplastic

astrocytoma

Glioblastoma

Multiforme.

5

1.1 Glioblastoma Multiforme – Background and pathophysiology

Glioblastoma multiforme (GBM) is a Grade 4 astrocytoma. It is therefore most malignant type of

primary brain tumor. It accounts for 52% of all primary brain tumor cases and 20% of all

intracranial tumors. GBM occurs in 2-3 cases per 100,000 people in Europe and North America3,

7. GBM may manifest at any age, but it is most common between 45-70 years of age. It is

prevalent in males than females. As implied by its name GBM is multiforme8.

In gross anatomy, GBM presents small areas of necrotizing tissue and hemorrhage.

Under a microscope, GBM presents necrosis, surrounded by highly anaplastic cells and

also microvascular proliferation.

Genetically, it has many deletions, amplifications and point mutations in numerous genes.

Location of GBMs is also highly variable8. Most common site is gray or white mater of cerebral

hemispheres. The tumor may also extend to the meningeal or ventricular wall and reach CSF.

Travelling in CSF, malignant cells may spread to the spinal cord or cause meningeal gliomatosis.

However, metastasis of GBM beyond the central nervous system is extremely rare8.

Figure 2: Glioblastoma Multiforme

6

1.2. Signs and Symptoms of the disease

In general, the symptoms may include headaches, personality changes, nausea and vomit. Based

on the site of the tumor, symptoms such as sensory loss, visual loss, hemi paresis, etc can occur.

Seizures can also occur in some patients9. Glioblastomas can be classified as primary or

secondary. Primary or de novo type of GBM affects older adults, especially older than 50 years

of age. The cells are small, undifferentiated and highly proliferative. Secondary GBMs usually

affect younger population (<45 y). It develops from a pre-existing low-grade astrocytoma or

anaplastic astrocytoma10

.

1.3. Treatment

The complex character of the cancer makes it non-responsive to treatments. Diminished self-

repairing capacity, increased susceptibility to damage and protection by blood-brain barrier

makes brain a tough target for therapy. Treatment for GBM is therefore very difficult. Standard

treatments for brain tumors include surgery, radiation therapy and chemotherapy used either

individually or in combination.GBM, in most cases is not completely curable. Therefore, the

goals of treatment are to9:

Eradicate as many tumor cells as possible by surgically removing the tumor.

Use radiation and chemotherapy to destroy as many as possible of the cells still

remaining.

Use radiation and chemotherapy to put remaining tumor cells in a dormant state for as

long as possible.

7

Treatments of primary brain tumors focuses on improving neurologic function (Symptomatic

therapy) and also improve quality of life (Palliative therapy)4. Harsh reality of GBM is that it is

well-known to re-grow8. Thus, being disease-free for long is very unlikely. Usually, the tumor

again develops at the same site or within 2 cm of the original site. Recommended treatment for

such recurrence is extensive surgery and intense local treatment8.

1.4 Molecular Genetics of GBM

There are various reasons which are responsible for transformation of normal cell to cancerous

state. Genetically speaking, there are three groups of genes that exhibit this potential of inducing

cancerous nature to cells10, 11

. They include oncogenes, tumor suppressor genes, and mutator

genes. Oncogenes promote cell proliferation, tumor-suppressor genes inhibit cell proliferation

and mutator genes promote mutations of genes because under normal conditions, these genes

ensure DNA replication and genome integrity10

. Oncogenes and tumor-suppressor genes, whose

abnormal functioning are implicated in glioblastoma multiforme and shown in Table-210

.

Table 2: Oncogenes and Tumor-suppressor genes implicated in Glioblastoma multiforme

# Gene Protein Normal Function Gene type 1 EGFR EGFR Tyrosine kinase receptor Oncogene

2 N-ras Ras Affects cyclin D/E complex Oncogene

3 c-myc c-myc Regulates Cdk4/6 complex Oncogene

4 CDK4 Cdk4 Active in proliferation cells Oncogene

5 PDGFR-α PDGFR Tyrosine kinase receptor Oncogene

6 MDM2 Mdm2 Inhibits p53 transcriptional

activity

Oncogene

7 H-ras Ras Stimulates signal transduction Oncogene

8 TSC-22 TGF-β Modulates p15, fibroblast

mitogen

Oncogene

9 TP53 p53 Induces transcription of MDM2

Tumor suppressor gene

10 CDKN2A/p16 p16 Cdk4 inhibitor Tumor suppressor gene

11 PTEN PTEN Dephosphorylates PIP3 Tumor suppressor gene

12 RB1 PRBl Binds to E2F/DP1 transcription factors

Tumor suppressor gene

8

Figure 3: Genes responsible for development of primary and secondary glioblastoma10

Less frequent but more malignant mutations include the following12

:

• MMAC1-E1, MAGE-E1, NRP/B

• Additional genetic alterations in primary glioblastomas include p16 deletions, p16INK4A

and retinoblastoma (RB) gene protein alterations.

Neural Progenitor cell

Astrocyte

Oligodendrocyte

PRIMARY OR

DE-NOVO

Glioblastoma

LG Astrocytoma

Anaplastic

Astrocytoma

LG Oligodendroglioma

Anaplastic

Oligodendroglioma

EGFR, MDM2, PTEN, P16, RB

TP53, PDGFR,

LOH

RB, LOH, CDK4,

P16

PTEN, PDGFR

LOH

P16

LOH,

EGFR

9

1.5 Metastasis

Metastasis is a complex process causing the spread of a disease from one part of the body to

another. The important steps involved in the metastatic cascade are11, 13

–

1. Detachment13

– As the tumor enlarges, it presses the surrounding structures and blood

vessels. As a result, the space for the tumor regresses and the cells begin to detach. This

process involves down-regulation of E-Cadherin and its switch to N-Cadherin, thereby

reducing cell-cell contact.

2. Invasion13

– The cells that detach from the primary tumor, try to enter the surrounding

lymphatic vessel or vessel. In order to do this, the cells have to penetrate the basement

membrane. The basement membrane is a specialized layer of extracellular matrix that

acts as a barrier for movement of cells from away from their sites of origin. This barrier

is however broken by the cancer cells by secreting several different types of enzymes.

Once inside the vessel, the cells can either colonize there itself or migrate to other places

via blood or lymph.

3. Survival in transport13

– The cells now have to face the challenge of surviving the travel

in the vessels. The main factor posing challenge is the immune system. In order to evade

the body’s immune system, the cancer cells take up many routes. Some of them

include13

o Decreased expression of MHC, which prevents detection by APC.

o Secretion of immunosuppressive factors such as TGF-β that can suppress T-cell

proliferation.

10

o Release of intracellular adhesion molecules, thereby preventing association of T-

cell with APC.

o Developing variants with no recognizable structures.

4. Arrest in distant-organ capillary bed13

– Now that the cells have successfully travelled in

the blood stream, its next intention is to adhere to the microcirculation of a target organ.

In order to do this, the cells secrete some chemicals which attract platelets, thus

surrounding the cancer cells. This produces a sticky mass that can attach to the blood

vessel wall. The site of secondary attachment is dependent on the chemo-attraction

between the cancer cells and the site of interest.

5. Angiogenesis11

– The cells that attach to the endothelial wall of blood vessels break

through this wall and enter the secondary site. Here the cells need extra blood supply to

establish well. This process of formation of new blood vessels is known as

Angiogenesis. The tumor cells secrete many growth factors that enable angiogenesis.

Vascular endothelial growth factor (VEGF) is one such growth factor that attracts

vascular cells that begin to migrate toward the tumor. The vascular cells eventually form

new blood vessels within the tumor, providing ample supply required for growth and

survival of cancer cells.

6. Tumerogenesis13

– The cells are now fully equipped. They have a new site and new

blood vessels with amble blood supply. Therefore, the cells start proliferating and

produce secondary tumors. This process is known as tumorigenesis.

11

1.6 Hypoxia and Metastasis

GBM is highly metastatic. Hypoxia, among others, is an important factor that can enhance

metastasis. Tissue hypoxia may result from many mechanisms. Some of them include14

–

The oxygen tension in the arteries may reduce due to diseases of the lung or even high

altitude (hypoxemic hypoxia).

The oxygen-carrying capability of the blood cells may reduce due to anemia or carbon

monoxide poisoning (anemic hypoxia).

Blockage of the circulatory system components may result in reduced tissue perfusion.

The cells may be unable to utilize the available oxygen due to intoxication, as in cyanide

poisoning.

Some of the reasons for hypoxia in tumor cells include15

–

Increased demand for oxygen due to rapid and uncontrolled proliferation of tumor cells.

Reduced interstitial pressure which is caused due to poor lymphatic drainage in tumor

cells leads to collapse of blood vessels and also reduced pH.

Severe structural abnormalities of tumor microvessels and disturbed microcirculation.

The fact that the regulatory processes are compensated in tumor cells, the changes caused in

these cells due to hypoxia are profound. Hypoxia affects two venues, proteome and genome14

,

and enables the normal cells to adapt to nutritional deficiency but at the same time, it can also

render the tumor cells malignant. Hypoxia stimulates the transcription of many genes including

glycolytic enzymes, glucose transporters, angiogenic molecules, survival and growth factors,

12

enzymes, proteins involved in tumor invasiveness, chaperones, and other resistance-related

proteins. At the same time, hypoxia can inhibit genes like for cell-surface integrins facilitating

tumor cell detachment14

. Sustained hypoxia could result in a more clinically aggressive

phenotype16-20

, increased invasive potential21, 22

, and also augmented regional and distant tumor

cell spreading17, 18, 23-25

. At the same time, the cancer can grow resistant to radiation or other

treatments26-34

.

1.7 Research in our lab

Many curious scientists have explored the effect of hypoxia in normal as well as tumor cells.

These explorations have revealed involvement of many important genes and proteins14

. The

research in our lab and this project in particular focuses on the three such proteins involved in the

hypoxia-induced metastasis of Glioblastoma multiforme, namely HIF1, Notch and TrpC6.

1.8 Hypoxia Induced Factor 1

Hypoxia-induced factor 1 (HIF1) is a highly conserved transcriptional complex that is expressed

in almost all oxygen-breathing organisms. It is an important component of the multi-level

regulatory system that is devoted to oxygen homeostasis in local as well as a systemic level in a

variety of physiological, developmental and pathological conditions.

1.8.1 HIF-1 – Structure and Function

1.8.1A Structure of HIF1:

HIF-1 is a heterodimer14

. It has two subunits – alpha and beta (Fig-3). The beta subunit is

constitutively expressed, while the expression of the alpha subunit is oxygen-regulated. HIF-1

13

belongs to the PER-ARNT-SIM (PAS) subfamily of the basic-helix-loop-helix (bHLH) family of

transcription factors. The alpha-subunit contains an oxygen-dependent degradation (ODD)

domain. This domain allows hydroxylation by proline-hydroxylase-2 (PHD-2)35

. In addition,

HIF-1 alpha subunit contains two transactivation domains (TAD) which regulate HIF-1 target

genes. Two known transcription co-activators, CREB binding protein (CBP) and p300, interact

with the transactivation domain at the C-terminal (C-TAD) of HIF-1 alpha. Both activators are

essential for HIF-1 transcription14, 35

. The beta subunit is identical to aryl hydrocarbon receptor

nuclear translocator (ARNT).

1.8.1B Regulation of alpha subunit:

When the oxygen level in the cell is normal (normoxia), the alpha subunit is prone to

degradation. Under normoxia, prolyl hydroxylase can hydrolyse the prolyl residues in the ODD

domain of the alpha subunit of Hif135

. This targets HIF1 to the E3 ubiquitin ligase leading to

degradation by the proteosome machinery. In hypoxic condition, the enzyme HIF1 prolyl

hydroxylase is inhibited by two ways35

–

In hypoxic conditions, Oxygen, which is a co substrate for this enzymatic reaction, is

depleted. This causes inhibition of the enzyme.

During hypoxia the electron transport chain in the mitochondria is affected. This leads to

accumulation of succinate which is also an end product of the HIF1 hydroxylation

reaction. Thus buildup of succinate in the cell inhibits the enzyme.

14

1.8.1C Function of HIF1:

Upon stabilization HIF-1 protein acts as a transcription factor. It binds to HIF - responsive

elements (HREs) in promoters that contain the sequence NCGTG and upregulates expression of

several genes thereby allowing the cell to survive in hypoxic conditions. The genes upregulated

by HIF-1 include glycolytic enzymes, growth factors and angiogenic molecules like vascular

endothelial growth factor (VEGF), angiotensin that help in angiogenesis14

.

Figure 4: Schematic representation of structure if HIF1

1.8.2 Role of HIF-1 in Cancer

One of the main reasons why cancer cells become malignant and intend to migrate to other areas

is the lack of nutrients and oxygen. Thus hypoxia is a driving force for malignancy and

tumorigenesis. HIF-1 acts as a sensor and responds to changes in levels of cellular oxygen. HIF1

promotes tumor invasion in two ways. It facilitates angiogenesis by inducing VEGF-A and

15

angiotensin-2. It also induces loss of E-cadherin expression via the lysyl oxidase – Snail

activation pathway, thereby allowing epithelium-mesenchyme transition (EMT)14, 35

.

1.9 Notch

Notch is an evolutionarily conserved cell surface receptor36

. The Notch gene was discovered in

1917 by Thomas Hunt Morgan. Knockdown of these gene resulted in a fruit fly with notches

apparent in their wing blades, thus the name. It is involved in a variety of cellular processes such

as cell fate specification, differentiation, proliferation, apoptosis, adhesion, etc36

.

1.9.1. Structure and Function

1.9.1A Structure of notch protein:

Notch is present in all metazoans. Four different isoforms, Notch1 to Notch4, are present in

vertebrates. These are type-1 receptors located in membranes (Fig.4)36

. They possess 2 domains

–a large extracellular domain (NECD) and a cytoplasmic domain (NICD). ECD takes part in

ligand binding while NICD is involved in signal transduction. ECD in turn presents numerous

EGF repeats for ligand binding interaction and an inhibitory LNR region. This region prevents

signal transduction in the absence of ligand. NICD possess protein interaction regions in the

form of RAM3 domain and 6 ankyrin repeats. It also has 2 nuclear localization signals, a

transcriptional activation domain (TAD) and a PEST sequence that negatively regulates protein

stability36

(Fig.4). The 4 isoforms of notch differ in the nature of TAD.

16

1.9.1B processing of notch protein:

Notch is synthesized in the endoplasmic reticulum as a 300 kD precursor. It undergoes 3 main

proteolytic steps before it becomes fully functional. The first cleavage S1 takes place during its

transport and processing in Golgi apparatus36, 37

. This step is catalyzed by the enzyme furin-

convertase. It cleaves Notch adjacent to the amino acid sequence RQRR in the extracellular

domain. After S1 cleavage the matured notch protein reaches the membrane. Delta, Serrate and

Lag-2 are some of the known ligands of notch37

. These are found in the membranes of the

adjoining cells. Binding of these ligands induce two subsequent cleavages of the notch protein.

The second, S2, cleavage occurs in the extracellular domain and is facilitated by TACE, also

known as ADAM17. Ligand binding also induces a third, S3, cleavage at the transmembrane

region. This cleavage is catalyzed by gamma -secretase enzyme complex whose activity is

dependent on presenilin-1. S3 cleavage results in release of notch intracellular domain(NICD)

which is the functional part of notch. NICD then migrates to the nucleus where it associates with

CSL transcription factors and acts as a transcriptional co-activator36, 37

(Fig.5).

1.9.1C Functions of Notch Protein:

Notch is functional during development and also adult life. During CNS development, Notch

determines the fate of progenitor stem cells by its interaction with fate determining proteins such

as numb and dab. Notch activity maintains a progenitor state in these stem cells and prevents

differentiation. However, in gliogenesis, notch has an instructive role36

.

Role of notch during somatogenesis, development of CVS and also during development of

endocrine glands such as pancreas is well established by various experimental evidences. Effect

17

of altered notch signaling on the behaviors of cultured vascular endothelial cells, proved the role

of notch signaling in wound healing, tissue repair, and angiogenesis36

.

Figure 5: Structure of Notch

1.9.2. Role of Notch in Cancer:

Abnormal Notch signaling is known to be involved in different types of cancers including

neoplasms of breast, skin, cervical, gut, blood, etc. Dual role of notch in CNS development

facilitates Notch to act as either an oncogene or a tumor suppressor. Thus, the outcome of notch

signaling activity depends on signal strength, timing, cell type and context. Role of Notch in

cancer has been extensively studied36

. A brief summary of some of these results are as follows -

18

Expression of Notch and its ligand increases in gliomas and are required for cell

proliferation and survival38

.

Notch promotes cell proliferation and formation of neural stem cell-like colonies in

glioma via its interaction with wnt pathway39

.

Inhibition of notch signaling markedly reduced epithelial-mesenchymal transition (EMT)

and invasion in glioma, while over expression of NICD increased these processes. This

effect of notch was through its direct or indirect control on expression of Snail-140

.

Notch was seen clustering with and also inducing expression of HIF1-alpha in MCF7

cells treated with estrogen. Therefore, Notch possibly induces HIF1 expression and

promotes angiogenesis41

.

Analysis with Notch-promoter specific reporter gene proved that HIF1-alpha, which is

stabilized in hypoxic conditions, induced expression of Notch and its downstream genes

in embryonic carcinoma cell line P1942

.

Factor Inhibiting HIF1-alpha (FIH-1) negatively regulates NICD by hydroxylating it at

residues N1945 and N2012. This interaction sequesters FIH-1, thereby promoting the

stabilization of HIF-1 in hypoxic conditions. In summary, under hypoxic conditions,

increased expression of notch increases HIF1-alpha functioning43

.

19

Figure 6: Animation depicting Notch processing

1. Notch precursor undergoes first cleavage, catalyzed by furin-convertase, during its

processing in the Golgi complex.

2. Mature Notch is transported to the membrane where it comes in contact with the ligands

such as Delta, Serrate or Lag-2.

3. Ligand binding induces the second cleavage catalyzed by TACE releasing the Notch

extra-cellular domain (NECD) which is engulfed by the adjoining cell for further

processing.

4. This is followed by a third cleavage catalyzed by gamma-secretase enzyme complex. The

result of the last two cleavages is the release of Notch intra-cellular domain (NICD).

5. NICD translocates to the nucleus where it binds to transcription factors like CSL and acts

as a co-activator resulting in the transcription of a number of genes.

20

1.10 TrpC6

Transient Receptor Potential channels are membrane bound ion channels. The TRP genes were

first identified in Drosophila, deficiency of which resulted in blindness by intense light. Trp

channels are divided into three broad groups44

. They are –

a) Transient Receptor Potential Canonical family (TrpC)

b) Transient Receptor Potential Vanilloid Receptor family (TrpV)

c) Transient Receptor Potential Melastatin family (TrpM)

TrpC channels are non-selectively permeable to cat ions, with a selectivity of calcium. Stimulus

for the channel is via phospholipase C and also diacylglycerol activation. TRPC channels

underlie the store-operated channels (SOC) observed in many cell types. These channels open

due to the depletion of intracellular calcium stores45

. TrpC family contains 7 members, TrpC1 to

TrpC7, which are further classified into 4 sub families based on structural and functional

similarities44

. These sub families are

TrpC1

TrpC2

TrpC3, TrpC6 and TrpC7

TrpC4 and TrpC5

TrpC6 is highly expressed in lung, placenta, ovary, spleen, brain, kidneys45

.

1.10.1 Structure and function of TrpC6 channels

1.10.1A Structure of TrpC6:

The gene for TrpC6 protein is localized on chromosome 11Q21-Q22 and has 13 exons45

. The

human TrpC6 protein has 931 amino acids. TrpC6 resembles its family members in structure. It

21

has intracellular N and C-terminals and six trans-membrane helices. The pore is predicted to be

formed between the 5th

and 6th

helices. It also presents two glycosylation sites (Asn473

; Asn 561

)

to ensure tightly receptor-operated activity of TrpC6. It has TRP box motif near the C-terminus

and 3 to 4 ankyrin repeats near the N-terminus. Many of the TrpC channel subunits are able to

co-assemble45

.

Figure 7: Structure of TrpC6 channels

1.10.1B Function of TrpC6:

Just like all TrpC channels, TrpC6 is also an ion channel, specific especially to calcium. TrpC6

plays an important role in regulation of vascular and pulmonary smooth muscle contraction.

They are also important in kidney podocytes. Functions of TrpC6 in other cell types still remain

elusive45

.

1.10.2 Role of TrpC6 in Cancer

TrpC6 expression increases in cancerous state, including glioma, breast cancer and human

hepatoma, compared to normal cells46, 47

.

PM

NH3+ COO

-

22

TrpC channels are required for cellular growth because blocking these channels hindered cell

cycle with defects in cytokinesis. Histopathological hallmarks of GBM such as Nuclear atypia

and cell enlargement were seen upon TrpC6 block46

.

TrpC6 is also shown to play an important role in angiogenesis and cell proliferation in cancer

cells. Angiogenesis depends on proliferation and migration of endothelial cells and endothelial

cell permeability. Angiogenic factors, such as VEGF, basic fibroblast growth factor, and platelet-

derived growth factor (PDGF) and calcium are involved in these steps of angiogenesis. TRPC6

being a calcium channel is involved in control of endothelial cell permeability. VEGF increases

intracellular calcium level and also vascular permeability by acting via TrpC6 channels46, 48

.

HIF1-alpha induces elevated expression of TrpC6 channels in hypoxic conditions. Loss-of-

function and gain-of-function studies with HIF1-alpha gene in pulmonary smooth muscle cells

proved that increased expression of TrpC6 observed in hypoxic conditions is controlled by HIF1

transcription complex49

.

TrpC6 channels facilitated calcium influx via store operated calcium entry in human hepatoma

cell lines causing increased cell proliferation. This was proved by overexpression and then by

siRNA knockdown of TrpC6 gene50

.

1.11 Hypothesis

In summary, the facts that linked these three proteins (HIF1, Notch and TrpC6) and lead us

towards our hypothesis are as follows –

HIF1 is expressed under hypoxic conditions which is prevalent in gliomas. HIF1 interacts with

Notch, thus reducing neuronal and muscular differentiation35, 51

.

23

Notch is highly expressed in cancer cells, including glioblastoma. Notch maintains stem cell

characteristics in cancer cells. Notch expression increases during hypoxia. Notch is required for

angiogenesis, cell proliferation and invasion40-42, 52, 53

.

TrpC channels are essential for angiogenesis and the growth of gliomas46, 47, 54

.

Based on these facts, we hypothesize that Notch promotes metastasis of Glioblastoma

multiforme under hypoxic conditions by acting through the TrpC6 channel.

1.12 Aims of the project

1. Expression of Notch, TrpC6 and HIF-1 increases during hypoxia.

2. HIF1 and Notch pathways crosstalk under hypoxia.

3. TrpC6 acts as the downstream mediator of Notch and HIF1 and is responsible for the

effect of these proteins on metastasis of Glioblastoma.

1.13 Experimental design

Lack of food and oxygen is very prevalent in cancer. Thus if we could study the function of the

proteins of our interest under hypoxic conditions, we could correlate that to their physiological

roles. Cobalt chloride is a chemical that mimics hypoxia in the cells. Thus we can use CoCl2 as

the stimulus during cell culture.

1.13.1 Aim 1: Expression of Notch, TrpC6 and Hif-1 increases during hypoxia

Our first aim is to determine whether there is any difference in the activity of Notch, HIF1 and

TrpC6 between normoxic and hypoxic conditions. The changes can be monitored at mRNA level

and also protein level. We will determine the expression levels of all the TrpC channels just to

24

ensure whether the downstream target is only TrpC6 or is it any of the TrpC channels. We will

also compare the expression changes in cancerous cells with non-cancerous cells to determine

the effect of hypoxia on metastasis.

Exp#1 – Induce hypoxia by treating the cells with Cobalt chloride and check the mRNA levels

of Notch and TrpC6 by doing quantitative real-time PCR.

Exp#2 – Do quantitative real-time PCR to check the mRNA expression levels of all the TrpC

channels under hypoxic conditions.

Exp#3 – Analyze the expression levels of Notch and TrpC6 in non-cancerous stem cells after

inducing them with Cobalt chloride by real-time PCR.

Exp#4 – Induce hypoxia by treating the cells with Cobalt chloride and check the changes in the

protein levels of Hif1, Notch and TrpC6 by western blotting and Immunocytochemistry.

1.13.2 Aim 2: HIF1 and Notch pathways crosstalk under hypoxia

Cross-talk between Notch and HIF pathway can be determined by activating/blocking one of

these pathways and checking for expression changes of the other pathway. NICD and Hif-1 can

be activated by inducing hypoxia by treating the cells with Cobalt chloride which mimics

hypoxia. Hif-1 can be inhibited by using the commercially available Hif1-inhibitors. NICD can

be inhibited by treating the cells with the gamma-secretase inhibitor DAPT. Effect of these

treatments on expression of TrpC6 would determine whether TrpC6 is indeed downstream of

Notch or HIF1.

25

Exp#1 – Treat the cells with DAPT and do western blot to detect the changes in expression of

NICD, HIF1 and TrpC6.

Exp#2 – Use the commercially available HIF1-Inhibitor on the cells to block the Hif1 pathway

and determine its effect on NICD and TrpC6 expression.

1.13.3 Aim 3: TrpC6 acts as the downstream effector of Notch and HIF1 and is responsible

for the effect of these proteins on metastasis of Glioblastoma.

Metastasis, which is the movement of the cancerous cells to a new location, involves many steps.

Four important steps involved in this process are – Invasion/Migration, Angiogenesis, Cell

proliferation and Tumorigenesis. Experimental evidences have already proved the importance of

Notch in the metastasis of cancer. In order to confirm our hypothesis that TrpC6 is indeed a

downstream effector of Notch, we will use the gene knockdown technique. We will suppress the

expression of TrpC6 under hypoxic conditions using the siRNA specific for TrpC6. Effect of

such a silencing on migration, angiogenesis and cell proliferation would prove the role of TrpC6

as the downstream effector.

Exp#1 – Determine the efficiency of siRNA transfection by checking the expression of TrpC6 at

the mRNA as well as protein levels.

Exp#2 – Transfect the cells with TrpC6 siRNA, induce hypoxia and then determine the effect on

cellular migration by doing invasion/migration assay.

Exp#3 – Do in vitro vessel formation assay to establish the effect of TrpC6 silencing under

hypoxic condition.

26

Exp#4 – Transfect cells with siRNA, induce hypoxia and do MTT assay and also Brdu

incorporation assay to study its effect on cell proliferation.

Exp#5 – Determine the effect of TrpC6 siRNA on the tumorigenicity of the cancer cells under

hypoxic conditions by doing the soft agar colony formation assay.

CHAPTER 2: MATERIALS AND METHODS

2.1 Cell Culture –

U373-MG (obtained from ATCC) and GBM primary (obtained from a patient) were used for our

study. The cells were maintained in plain DMEM medium (Invitrogen cat# 11965159)

supplemented with 10% Fetal Bovine Serum (Atlanta biologicals cat#S11550), and 1.0%

antibiotic and antimycotic (Invitrogen cat#15240-062).

2.2 Inducing Hypoxia –

Hypoxia, which is the main stimulus for metastasis in our studies, was induced by treating the

cells with 100 µM CoCl2 (Sigma Aldrich, Cat# 232696) dissolved in serum-free, glucose-free

Locke’s medium. The cells were exposed to this treatment for 2, 4, 6, 8 or 16 hrs before the cells

were used for the rest of the experiments.

2.3 Treatment with DAPT/HIF1-Inhibitor –

In order to see the effect of DAPT (Sigma Aldrich Cat# D5942), which is a gamma-secretase

inhibitor, and also HIF1-Inhibitor (Calbiochem Cat# 400083) on the expression levels of TrpC6,

we treated the cells with either of these inhibitors overnight in Opti-MEM. Then the cells were

treated with CoCl2 as mentioned above.

27

2.4 siRNA transfection –

Custom-made siRNA against TrpC6 was obtained from Invitrogen. Scrambled RNA (Invitrogen

cat#12935) was used as transfection control. 20 pmoles of siRNA was used to do the

transfection. The transfection was carried out using Lipofectamine 2000 reagent (Invitrogen

cat#11668-027) according to the manufacturer’s protocol. The cells were then incubated at 37ºC

for 24 hrs. After that, the transfection medium was removed and the cells were treated with

CoCl2 to induce hypoxia, as explained above.

2.5 RNA extraction and Reverse Transcription –

Total RNA from the cell was isolated using Trizol reagent (Invitrogen Cat#15596018), in

accordance with the standard protocol. Briefly, proteins, DNA and RNA in the cells were

separated into 3 distinct layers by adding Chloroform and subsequent centrifugation5555

. Only the

mRNA layer was collected and transferred to a clean microfuge tube. RNA was precipitated by

using isopropanol followed by centrifugation. RNA was seen as a pallet after centrifugation. The

supernatant was carefully discarded and the pallet was washed twice with 75% ethanol. The

RNA was resuspended in 50µl of deionized water. The concentration of RNA was determined by

UV absorbance using a Nanodrop spectrophotometer. The RNA was reverse-transcribed using

iScript cDNA synthesis kit (Bio-Rad Labs., Cat#170-8891). Reaction was performed in a final

volume of 20 µl, containing 1µg of RNA, 4 µl of reaction mix, 1 µl of reverse transcriptase

enzyme and D.water. The cDNA synthesis cycle comprised of 3 steps. The cDNA concentration

was again measured by UV absorbance using a Nanodrop spectrophotometer.

28

2.6 Quantitative Real-Time Polymerase Chain Reaction –

Real time quantitative PCR was performed in a Sequence Detector System (ABI Prism 7900

Sequence Detection System and software; PerkinElmer Life Sciences). Amplification was

performed in a final volume of 30 µl, containing 2 µg of cDNA, primer mixture (0.6 µl each of

sense and antisense primers), 11.3 µl of DI water and 12.5 µl 2x SYBR Green Master Mix (Bio-

Rad Laboratories Cat# 170-8882). The standard amplification program included 40 cycles of two

steps, each comprising heating to 95 °C and heating to 60 °C. Fluorescent product was detected

at the last step of each cycle. In order to verify the purity of the products, a melting curve was

produced after each run. The relative quantitation of gene expression was determined by Delta-

Delta CT METHOD using the following calculation56, 57

–

• ΔCT = target – reference (control)

• ΔCT = target – reference (experiment)

• Difference = ΔCT – ΔCT = ΔΔCT

• Fold change = 2 ΔΔCT

Table 3: Primers used for real-time PCR

GENE SEQUENCE PRODUCT (bp)

hTRPC1 GATGCATTCCATCCTACACT

TACACAGTCCTTCTGCTCCT

249

hTRPC3 CAAGAATGACTATCGGAAGC

GCCACAAACTTTTTGACTTC

201

hTRPC4 GGACTTCAGGACTACATCCA

ACGCAGAGAACTGAAGATGT

201

hTRPC5 CCACCAGCTATCAGATAAGG

CGAAACAAGCCACTTATACC

159

hTRPC6 TGAAGTGAAATCAGTGGTCA

AAATTTCCACTCCACATCAG

175

hTRPC7 CATAGCCTATTGGATTGCTC

GGTAGTCTGTGAAGGTTTCG

176

Hes1 CGGACATTCTGGAAATGACA

CATTGATCTGGGTCATGCAG 155

Hes5 CTCAGCCCCAAAGAGAAAAAA

TAGTCCTGGTGCAGGCTCTT 183

GAPDH AGCCACATCGCTCAGACACC

GTACTCAGCGGCCAGCATCG 169

29

2.7 Western Blots –

Western blotting was carried on as previously described39

. Cells were lyzed in the lysis buffer

(50 mM Tris–HCl, pH 7.4, 150 mM NaCl, 1% NP-40, 1x protease inhibitor cocktail). Cell

extracts were collected by centrifugation. The protein concentration in the cell extracts was

determined using the Bio-Rad Protein Assay reagents (Bio-Rad), according to the manufacturer’s

instructions. Samples were then analyzed by SDS-4-12% polyacrylmide gel electrophoresis

(PAGE) and blotted to PVDF membrane. Nonspecific sites were saturated with 5% milk+PBS-T

before exposure overnight to an anti-HIF-1 (mouse monoclonal Abcam # ab463), NICD (Rabbit

polyclonal activated Notch1 antibody, Abcam # ab8925), TrpC6 (Rabbit polyclonal, Prosci Inc

# 3899) and GAPDH (mouse monoclonal Sigma# 4967) antibodies. This was followed by 3

washes with PBS-T, each lasting 10 min. The membrane was then probed using horseradish

peroxidase (HRP)-conjugated donkey anti-rabbit IgG (Amersham Life Science Cat# NA934)

antibodies and horseradish peroxidase (HRP)-conjugated donkey anti-mouse IgG (Amersham

Life Science Cat# NXA931) antibodies, followed by 3 more washes with PBS-T, each lasting 15

min. The membrane was developed using the ECL reagents (Amersham Biosciences Corp Cat#

RPN2132).

2.8 Immunocytochemistry –

U373 MG cells were seeded at a density of 4 x 104/ml of experimental medium in an eight-well

Lab-Tek II chamber slide. The cells were then incubated for 3,6 and 12 h under 100µm CoCl2.

Cells were washed with PBS, fixed with cold methanol for 5 min, and permeabilized for 5 min in

0.1% Triton-PBS followed by three PBS washes. Nonspecific sites were saturated with 5% goat

serum before exposure overnight to an anti-HIF-1 (mouse monoclonal Abcam # ab463), NICD

30

(Rabbit polyclonal activated Notch1 antibody, Abcam # ab8925) and TrpC6 (Rabbit polyclonal,

Prosci Inc # 3899) antibodies. Negative controls were obtained by omitting the primary

antibody. The cells were washed twice in PBS and incubated for 45 minutes with suitable

secondary IgG Alexa 488 (1:500 in PBS; Molecular Probes, Invitrogen). Cell nuclei were

counterstained with 4',6-diamidino-2-phenylindole (DAPI). Images were acquired by using

Nikon Eclipse E600 fluorescence microscope. Images were processed by using SPOT advance

software, Diagnostic Instruments, Sterling Heights, MI and Photoshop 7.0 (Adobe Systems, San

Jose, CA), with the input levels adjusted to span the range of acquired signal intensities exactly.

2.9 Cell migration assay –

U373 cells were plated in a 24-well dish at a density of 0.8x106 cells. The cells were transfected

with 20 pmoles of siRNA and exposed to hypoxia for 6 hrs. The cells were then trypsinized and

then used for cell migration analysis. Cell migration analysis was performed using Transwell

membrane filters (Corning Costar) containing a polycarbonate filter with 8 µm pores as

previously reported58

. Briefly, the bottom chambers of transwells were filled with complete

growth medium containing chemoattractant growth factors. 1x104 transfected cells in a total

volume of 0.2 ml were seeded into the top well of the inserts in serum free medium along with

CoCl2 (100 µM). and allowed to migrate for 6 hours. At the end of the incubation, non-migrated

cells remaining in the transwell insert were removed. The migrated cells (on the outer bottom of

the transwell) were fixed with methanol and stained with hematoxylin and eosin, and the stained

cells were counted in 5 or more random 100X fields. Each experiment was performed in

triplicate, and the experiment was repeated twice. Growth correction was not applied because no

increase in the cell number was observed during the incubation period of 6 hours.

31

Figure 8: Transwell insert for migration assay

2.10 In-vitro tube morphogenesis on Matrigel –

U373 cells were plated in a 24-well dish at a density of 0.8x106 cells. The cells were transfected

with 20 pmoles of siRNA and exposed to hypoxia for 6 hrs. The conditioned media from these

plates were collected and used for angiogenesis. The vessel morphogenesis assay was done as

previously described58, 59

. HMEC-1 cells were adjusted to a density of 3 x 104 cells in 200 µL of

10% conditioned medium, collected from U373 cells treated with either control (empty vector),

CoCl2 or TRPC6 siRNA with 0.5% FBS and conditioned added to the wells of eight-well

chamber slides precoated with growth factor–depleted Matrigel (7 µg/mL; BD BioSciences,

Bedford, MA). The slides were incubated at 37°C for 18 to 20 hours. The medium was then

removed gently without disturbing newly formed tubules. The images were captured at a 40x

magnification on Nikon Optiphot II microscope. Total tube length of each well was measured

using IP Lab Image Analysis Program (Scanalytics, Inc., Arlington, VA).

32

2.11 MTT assay for cell proliferation –

U373 cells were plated in a 24-well dish at a density of 0.8x106 cells. The cells were transfected

with 20 pmoles of siRNA and exposed to hypoxia for 6 hrs. The cells were then trypsinized and

then used for MTT assay. The cells were replated in 96-well plates and allowed to grow in

serum-free media containing CoCl2 for 1, 2 or 3 days. Then MTT assay was carried on in

accordance with the manufacturer’s protocol (ATCC Cat# 30-1010K). Briefly, following

incubation with CoCl2 for designated time, 10 µL of MTT reagent was added to each well and

further maintained @ 37°C for another 2 hrs until purple precipitate could be seen. This was

followed by addition of 100 µL of detergent reagent and incubation in the dark for 2 hrs. After

that, the absorbance was recorded at 570nm using a spectrophotometer. The number of viable

proliferating cells was determined based on the OD reading.

2.12 Soft Agar Colony formation assay –

Soft agar assays were performed as described previously60

. An underlay of 0.5% agar in DMEM

containing 5% fetal calf serum was prepared by mixing equal volumes of 1% agarose and

2x

DMEM 10% fetal calf serum. Two milliliters of this mixture were pipetted into the wells of six-

well plates and allowed to set. Cells (5 x10

3) were seeded in each well of a

six-well culture dish

containing 0.3% top low-melt agarose. The agarose was allowed to set, and the plates were

incubated in a humidified chamber at 37 C for 14 d. Colonies were counted

in a blinded manner

using an x10 objective on a Nikon inverted microscope. Colonies with a diameter

larger than 20

µm were scored. Data are expressed as average number of colonies formed as well as the average

diameter of colonies.

33

2.13 Brdu-Incorporation assay -

U373-MG cells were seeded in an 8-well chamber slide at a density of 2.5x104 cells/well. Then

the cells were transfected with 20 pmoles of siRNA, incubated in transfection media for 24 hrs

and then maintained in serum-free Locke’s media with 100 µM CoCl2 for 6 hrs. The cells were

also exposed to 10 µM Brdu for 3 hrs before overnight fixing with 4% PFA. The DNA of the

cells was degraded by treatment with 2N HCL for 30min, then the acidity was neutralized by

incubating with borate buffer for 15 min followed by 3 washes with PBS. Non-specific sites

were blocked with PBS+0.1% Triton x+3% donkey serum followed by overnight incubation with

anti-Brdu primary antibody. The cells were then washed thrice with PBS and incubated with

anti-rat, TRITC-conjugated secondary antibody for 1 hr. Nuclei were counterstained with DAPI.

Images were acquired by using Nikon Eclipse E600 fluorescence microscope. Images were

processed by using SPOT advance software, Diagnostic Instruments, Sterling Heights, MI and

Photoshop 7.0 (Adobe Systems, San Jose, CA), with the input levels adjusted to span the range

of acquired signal intensities exactly.

34

CHAPTER 3: RESULTS AND DISCUSSION

3.1 Expression of Notch, HIF1-alpha and TrpC6 increases in U373-MG and GBM primary

culture cells under hypoxic conditions:

In order to see the effect of hypoxia on Glioblastoma cells, we carried on expression analysis of

Hes1 and Hes5 (downstream mediators of Notch) and all the TrpC isoforms mRNA. Quantitative

PCR analysis revealed that expression of Hes5, but not Hes1 increases under hypoxic conditions

and the expression of only two of the six TrpC channels expressed in brain change significantly.

These two are TrpC3 and TrpC6. The change in TrpC6 was however more pronounced and

prolonged than TrpC3 (Fig 9A and 9C). Therefore our focus from hereon will be on TrpC6. This

data was supplemented by the results of mRNA expression analysis in GBM primary culture

obtained from a patient (Fig 9B and 9D). Changes were detected at protein level also. Increased

levels of NICD, HIF1-alpha and TrpC6 were detected by western blotting (Fig 10A) and

immunocytochemistry (Fig 9E). This result concurs with the observations made by several other

workers in glioblastoma and also in other type of cancer cells.

0.0

2.5

5.0

7.5

10.0

12.5

Hes5

TRPC6

Fo

ld I

ncre

ase

0

60

120

180

240

300

360

Hes5

TRPC6

Fo

ld I

ncre

ase

A B

35

TRPC1

TRPC3

TRPC4

TRPC5

TRPC6

TRPC7

Hes

1

Hes

5

0

5

10

15

20

25TRPC1

TRPC3

TRPC4

TRPC5

TRPC6

TRPC7

Hes1

Hes5

Fo

ld I

ncre

ase

TRPC1

TRPC3

TRPC4

TRPC5

TRPC6

TRPC7

Hes

1

Hes

5

0

10

20

30

40

50

60TRPC1

TRPC3

TRPC4

TRPC5

TRPC6

TRPC7

Hes1

Hes5

Fo

ld I

ncre

ase

Figure 9: Expression analysis of Notch, HIF1 and TrpC channels

A – Quantitative Real-Time PCR showing expression of TrpC6 channels and Hes5 in U373 cells

under hypoxia. The cells were treated with CoCl2-containing serum-free media to induce

hypoxia. The cells were exposed to hypoxia for 3 hrs, 6 hrs and 12 hrs before being harvested.

B – Quantitative Real-Time PCR showing expression of TrpC6 channels and Hes5 in GBM

primary culture under hypoxia. The cells were treated with CoCl2-containing serum-free media

to induce hypoxia. The cells were exposed to hypoxia for 3 hrs, 6 hrs and 12 hrs before being

harvested.

C – Quantitative Real-Time PCR showing expression of all TrpC channels, Hes1 and Hes5 in

U373 cells under hypoxia. The cells were treated with CoCl2-containing serum-free media to

induce hypoxia. The cells were exposed to hypoxia for 3 hrs, 6 hrs and 12 hrs before being

harvested.

D – Quantitative Real-Time PCR showing expression of all TrpC channels, Hes1 and Hes5 in

GBM cells under hypoxia. The cells were treated with CoCl2-containing serum-free media to

induce hypoxia. The cells were exposed to hypoxia for 3 hrs, 6 hrs and 12 hrs before being

harvested

C D

36

E – Immunocytochemistry showing the effect of hypoxia on expression of NICD, TrpC6 and

HIF1 in U373 cells. Three time-points, 3 hrs, 6 hrs and 12 hrs, were chosen for analysis.

3.2 Hypoxia-induced response of Notch involves cross talk with the HIF1 pathway:

Since Notch is a very important response element in hypoxic conditions, we want to check

whether it acted via HIF1-alpha. Therefore, we blocked Notch and HIF1 one at a time and

checked the expression of the other. Notch activity was blocked by treating the cells with DAPT,

which blocks the enzyme gamma-secretase, which is involved in the last trans-membrane

cleavage of Notch, resulting in reduced NICD production. Immunoblotting with anti-HIF1

antibody revealed decreased HIF1 levels, confirming the fact that Notch interacts positively with

E

37

HIF1-alpha (Fig 10B). Our next step was to check which of these proteins was upstream.

Immunoblotting with anti-notch after blocking HIF1 with HIF1-Inhibitor did not change the

expression of NICD (Fig 10C). Thus NICD is probably upstream of HIF1.

0

1000

2000

3000

4000

CoCl2

DAPT+CoCl2

HIF1+CoCl2

HIF-1

Pro

tein

/GA

PD

H r

ati

o

0

500

1000

1500

2000

2500

CoCl2

DAPT + CoCl2

HIF1-I + CoCl2

NICD

Pro

tein

/GA

PD

H r

ati

o

0

1000

2000

3000

CoCl2

DAPT + CoCl2

HIF1-I + CoCl2

TRPC6

Pro

tein

/GA

PD

H R

ati

o

Figure 10: Effect of CoCl2, DAPT and HIF1-Inhibitor on the expression of Hif1, NICD and TrpC6:

A – U373 cells were grown in serum-free media containing CoCl2 for 2, 4, 8 and 16 hrs to

induce hypoxia. The lysates were run in SDS-PAGE, transferred to PVDF membrane and then

probed with GAPDH, HIF1-alpha, NICD and TrpC6 B – U373 cells were pre-treated with DAPT in Opti-MEM for 2 hrs and then grown in serum-

free media containing CoCl2 for 2, 4, 8 and 16 hrs to induce hypoxia. The lysates were run in

SDS-PAGE, transferred to PVDF membrane and then probed with GAPDH, HIF1-alpha, NICD

and TrpC6

C – U373 cells were pre-treated with HIF1-inhibitor in Opti-MEM for 2 hrs and then grown in

serum-free media containing CoCl2 for 2, 4, 8 and 16 hrs to induce hypoxia. The lysates were

run in SDS-PAGE, transferred to PVDF membrane and then probed with GAPDH, HIF1-alpha,

NICD and TrpC6

D,E,F – Densitometry analysis of HIF1-alpha, NICD and TrpC6 expression based on the

intensity of band in the western blots.

B A C

D E F

38

3.3 TrpC6 is the downstream mediator of Notch-mediated pathway:

Expression of TrpC6 was affected by blocking Notch and HIF1 (Fig 9B and 9C). Thus it is the

downstream mediator of both these proteins. Role of TrpC6 in the pathway was further

confirmed by knocking down TrpC6 using specific siRNA. Abrogation of TrpC6 after

transfection with siRNA confirmed the specificity and efficiency of the siRNA (Fig 10A and Fig

10B).

C2 S2 C4 S4 C6 S6 C8 S8 C16 S160

500

1000

1500

2000

2500

3000

3500

Fo

ld C

han

ge

Figure 11: Test for siRNA transfection efficiency:

A – Quantitative Real-Time PCR to check of efficiency of TrpC6 siRNA transfection. U373

cells were either transfected with TrpC6 siRNA (S2, S4, S6, S8, S16) or not transfected with

siRNA (C2, C4, C6, C8, C16), exposed to hypoxia for 2, 4, 6, 8 and 16 hrs and then harvested

for PCR.

B – Western blots showing the expression levels of TrpC6 to check for the efficiency of TrpC6

siRNA. U373 cells were either transfected with TrpC6 siRNA (S2, S4, S8, S16) or not

transfected with siRNA (C2, C4, C8, C16), exposed to hypoxia for 2, 4, 8 and 16 hrs and then

harvested for western blot analysis. GAPDH was used as loading control.

B

A

39

The next step was to see the effect of TrpC6 siRNA on the different stages of tumor metastasis.

Therefore we conducted a series of experiments. These include –

Migration assay to check the invasive property of the cells (Fig 11)

In-vitro tube morphogenesis on matigel assay to check for the role of TrpC6 in the

angiogenesis process (Fig 12)

MTT assay for cell proliferation (Fig13)

Brdu-incorporation assay for cell proliferation (Fig14)

Soft agar colony formation assay to check for the tumorigenic ability of the cells (Fig 15)

For all these experiments, U373 cells were used and four experimental conditions were chosen,

– Group 1: Control cells that were not exposed to any treatment

– Group 2: Cells treated with CoCl2 but not transfected with anything

– Group 3: Cells transfected with scrambled RNA and also treated with CoCl2

– Group 4: Cells transfected with siRNA and also treated with CoCl2

Scrambled+CoCl2 acted as control for transfection efficiency.

For all the experiments, the metastatic activity being tested was significantly increased in Group2

(CoCl2-only) and Group 3 (Scrambled+CoCl2). Group 1 (Control) cells showed normal activity.

However in Group 4 (siRNA+CoCl2) the metastatic activity was significantly reduced. These

results prove beyond doubt that TrpC6 is indeed required for the metastasis of these cells.

40

Contr

ol

CoC

l2

Scr

amble

d+CoC

l2

siRNA

0

40

80

120

160 *

*

*

% I

nvasio

n C

ell

s

Figure 12: Invasion/Migration assay:

The transfected cells were incubated in transfection media for 24 hrs. Cells treated with CoCl2

were exposed to hypoxia for 6 hrs. The cells were then trypsinized and used for migration assay.

A – Picture of the tube-formation showing the number of new blood vessels formed.

B – Graphical representation of percentage of branching points.

A

B

41

Contr

ol

CoC

l2

Scram

bled+C

oCl2

siRNA+C

oCl2

0

2

4

6

8

Bra

nc

h P

oin

ts X

Nu

mb

er

of

Bra

nc

he

s/F

ield

(x

10

00

)

Figure 13: In-Vitro tube morphogenesis on matrigel:

The transfected cells were incubated in transfection media for 24 hrs. Cells treated with CoCl2

were exposed to hypoxia for 6 hrs. The conditioned media from these cells were collected and

used for angiogenesis assay.

A – Picture of the tube-formation showing the number of new blood vessels formed.

B – Graphical representation of percentage of branching points.

A

B

42

0 1 2 3

0.00

0.25

0.50

0.75

1.00

Control

CoCl2

Scrambled+CoCl2

siRNA+CoCl2

Time (in days)

OD

at

570 n

m

Figure 14: MTT assay

The transfected cells were incubated in transfection media for 24 hrs. Cells treated with CoCl2

were exposed to hypoxia for 6 hrs. The cells were then trypsinized and used for MTT assay. For

MTT assay the cells were incubated for 1, 2, or 3 days.

A – Graphical representation of OD readings from MTT assay which corresponds to the number

of live, proliferating cells.

A

43

Contr

ol

CoC

l2

Scr

amble

d+CoC

l2

siRNA+C

oCl2

0

25

50

75

100* *

*%

Brd

u p

os

itiv

e c

ell

s

Figure 15: Brdu-incorporation assay

U373 cells were transfected with siRNA and maintained in transfection media for 24 hrs. Then

they were exposed to hypoxia for 6 hrs by treating with CoCl2. During the last 3 hrs of

incubation with CoCl2, the cells were treated with Brdu. Then the cells were fixed with 4%

paraformaldehyde and stained.

A – Immunocytochemistry for Brdu-incorporation assay. Blue represents the nucleus of Brdu-

negative cells and pink represents Brdu-positive cells.

B – Graphical representation of average percentage of Brdu-positive cells which corresponds to

the number of proliferating cells.

A

B

44

Con

trol

CoC

l2

Scr

ambled+C

oCl2

siRNA+C

oCl2

0

20

40

60

80

100

120

* *

*Nu

mb

er o

f co

lon

ies

Control

CoCl2

Scr

ambled+C

oCl2

siRNA+C

oCl2

0

25

50

75

100

125

150

175 * *

*Averag

e C

olo

ny

Dia

mete

r (

um

)

Figure 16: Soft agar colony formation assay

The transfected cells were incubated in transfection media for 24 hrs. Cells treated with CoCl2

were exposed to hypoxia for 6 hrs. The cells were then trypsinized and used for soft agar

colonogenic assay.

A – Picture of the colony growth.

B – Graphical representation of the number of colonies formed.

C – Graphical representation of the average diameter of the colonies formed.

A

B C

45

CONCLUSIONS

A schematic representation of the projected pathway based on our findings is shown in Fig 16.

The main hypothesis and aim of our project is to establish and provide evidence for the role of

TrpC6 channels in metastasis of glioblastoma. Increased expression of NICD, HIF1-alpha and

TrpC6 and also the knowledge that we have from the literature lead us to deduce that Notch,

HIF1 and TRPC6 are required for cellular response to hypoxia and these can induce malignancy

in tumor cells. Therefore we set out to establish a link between these three proteins. Dependence

of HIF1-alpha expression on Notch activity explains how Notch and HIF1 pathways are

integrated as a response to hypoxia. Reduced expression of TrpC6 upon inhibition with either

DAPT or HIF1-inhibitor proved that both NICD and HIF1-alpha cooperate and act via TrpC6.

Knocking down of TrpC6 resulted in considerable reduction in various steps of metastasis

including migration, angiogenesis, cell proliferation and tumorigenesis, This perfectly fits in our

puzzle proving that it is indeed the downstream mediator of hypoxia-induced metastasis of

Glioblastoma. This role of TrpC6 in metastasis of cancer cells opens up new horizons in cancer

research and can act as a target for pharmacological intervention. We are further extending our

study by looking at the downstream of TrpC6. Evidences show the involvement of NFAT in

TrpC6-mediated pathways. Thus we are trying to confirm if NFAT is involved in this role of

TrpC6 in metastasis of Glioblastoma as well.

46

Figure 17: Schematic representation of projected pathway for notch response to hypoxia in cancer cells

47

References

1. George J. Augustine, David Fitzpatrick, William C. Hall, Miguel Nicolelis, Anthony-

Samuel LaMantia, Larry Katz & Dale Purves. (2001) Neuroscience. .

2. [Anonymous]. (2007) United States Cancer Statistics: 2004 Incidence and

Mortality, Publication Year 2007. PB2008107612, 684. .

3. Davis F. G., McCarthy B. J. & Berger M. S. (1999) Centralized databases available

for describing primary brain tumor incidence, survival, and treatment: Central Brain

Tumor Registry of the United States; Surveillance, Epidemiology, and End Results;

and National Cancer Data Base. Neuro-Oncology 1, 205-211. .

4. Mayo Foundation for Medical Education and Research. Information on Brain

tumors. .

5. Brain tumor research center. (2008) Information about brain tumors - Non-gliomas.

.

6. International Radiosurgery Association. Understanding brain tumors. 2008, .

7. Jemal A., Murray T., Samuels A., Ghafoor A., Ward E. & Thun M. J. (2003) Cancer

statistics, 2003. CA: A. Cancer. Journal for. Clinicians 53, 5-26. .

8. Holland E. C. (2000) Glioblastoma multiforme: the terminator. Proceedings of the

National Academy of Sciences of the United. States of America 97, 6242-6244. .

9. John W. Henson. Glioblastoma multiforme and anaplastic gliomas- MGH Brain

Tumor Center. 2008, .

10. Benjamin R., Capparella J. & Brown A. (2003) Classification of glioblastoma

multiforme in adults by molecular genetics. Cancer. Journal (Sudbury, Mass. ) 9, 82-

90. .

11. Answers.com. Metastasis:definition from answers.com. .

12. Bruce J. N. Glioblastoma multiforme review. .

48

13. Yarbro, C. H., Frogge, M. H. & Goodman, M. (2005). Cancer nursing: Principles

and practice. Sudbury, Mass. : Jones and Bartlett Publishers, c2005., .

14. Höckel M., Vaupel P. (2001) Tumor hypoxia: definitions and current clinical,

biologic, and molecular aspects. Journal of the National Cancer. Institute 93, 266-

276. .

15. Duffy J. P., Eibl G., Reber H. A. & Hines O. J. (2003) Influence of hypoxia and

neoangiogenesis on the growth of pancreatic cancer. Mol. Cancer. 2, 12. .

16. Hockel M, Schlenger K, Aral B, Mitze M, Schaffer U, Vaupel P. (1996)

Association between tumor hypoxia and malignant progression in advanced

cancer of the uterine cervix.. Cancer Res 56, 4509–15. .

17. David M. Brizel2, Sean P. Scully, John M. Harrelson, Lester J. Layfield, Joseph

M. Bean, Leonard R. Prosnitz and Mark W. Dewhirst. (1996) Tumor Oxygenation

Predicts for the Likelihood of Distant Metastases in Human Soft Tissue Sarcoma 56

(5): 941 -- Cancer Research. Cancer Research 56, 941-943. .

18. Sundfør K., Lyng H. & Rofstad E. K. (1998) Tumour hypoxia and vascular density

as predictors of metastasis in squamous cell carcinoma of the uterine cervix. British

Journal of Cancer. 78, 822-827. .

19. Höckel M., Schlenger K., Höckel S., Aral B., Schäffer U. & Vaupel P. (1998)

Tumor hypoxia in pelvic recurrences of cervical cancer. International Journal of

Cancer. Journal International Du Cancer. 79, 365-369. .

20. Stefan Walenta, Michael Wetterling, Michael Lehrke, Georg Schwickert, Kolbein

Sundfør, Einar K. Rofstad and Wolfgang Mueller-Klieser. (2000) High Lactate Levels

Predict Likelihood of Metastases, Tumor Recurrence, and Restricted Patient Survival

in Human Cervical Cancers. Cancer Research 60, 916-921. .

21. Cuvier C., Jang A. & Hill R. P. (1997) Exposure to hypoxia, glucose starvation

and acidosis: effect on invasive capacity of murine tumor cells and correlation with

cathepsin (L + B) secretion. Clin. Exp. Metastasis 15, 19-25. .

49

22. Graham C. H., Forsdike J., Fitzgerald C. J. & Macdonald-Goodfellow S. (1999)

Hypoxia-mediated stimulation of carcinoma cell invasiveness via upregulation of

urokinase receptor expression. Int. J. Cancer 80, 617-623. .

23. Young S. D., Marshall R. S. & Hill R. P. (1988) Hypoxia induces DNA

overreplication and enhances metastatic potential of murine tumor cells. Proc. Natl.

Acad. Sci. U. S. A. 85, 9533-9537. .

24. Brizel D. M., Sibley G. S., Prosnitz L. R., Scher R. L. & Dewhirst M. W. (1997)

Tumor hypoxia adversely affects the prognosis of carcinoma of the head and neck.

Int. J. Radiat. Oncol. Biol. Phys. 38, 285-289. .

25. Jang A., Hill R. P. (1997) An examination of the effects of hypoxia, acidosis, and

glucose starvation on the expression of metastasis-associated genes in murine

tumor cells. Clin. Exp. Metastasis 15, 469-483. .

26. Michael Höckel2, Karlheinz Schlenger, Susanne Höckel and Peter Vaupel. (1999)

Hypoxic Cervical Cancers with Low Apoptotic Index Are Highly Aggressive 59 (18):

4525 --. Cancer Research 59, 4525-4528. .

27. Graeber T. G., Osmanian C., Jacks T., Housman D. E., Koch C. J., Lowe S. W. &

Giaccia A. J. (1996) Hypoxia-mediated selection of cells with diminished apoptotic

potential in solid tumours. Nature 379, 88-91. 10.1038/379088a0.

28. Charlotte Y. Kim, Mitchell H. Tsai, Cynthia Osmanian, Thomas G. Graeber, Jong

Eun Lee, Rona G. Giffard, Joseph A. DiPaolo, Donna M. Peehl and Amato J.

Giaccia. (1997) Selection of Human Cervical Epithelial Cells That Possess Reduced

Apoptotic Potential to Low-Oxygen Conditions. Cancer Research 57, 4200-4204. .

29. Samali A., Cotter T. G. (1996) Heat shock proteins increase resistance to

apoptosis. Exp. Cell Res. 223, 163-170. 10.1006/excr.1996.0070.

30. Zhivotovsky B., Joseph B. & Orrenius S. (1999) Tumor radiosensitivity and

apoptosis. Exp. Cell Res. 248, 10-17. 10.1006/excr.1999.4452.

31. D. Alan Anthoney, Amanda J. McIlwrath, William M. Gallagher, Angela R. M.

Edlin, Robert Brown. (1996) Microsatellite Instability, Apoptosis, and Loss of p53

Function in Drug-resistant Tumor Cells. Cancer Research 56, 1374-1381. .

50

32. Sethi T., Rintoul R. C., Moore S. M., MacKinnon A. C., Salter D., Choo C.,

Chilvers E. R., Dransfield I., Donnelly S. C., Strieter R. & Haslett C. (1999)

Extracellular matrix proteins protect small cell lung cancer cells against apoptosis: a

mechanism for small cell lung cancer growth and drug resistance in vivo. Nat. Med.

5, 662-668. 10.1038/9511.

33. Hickman J. A., Potten C. S., Merritt A. J. & Fisher T. C. (1994) Apoptosis and

cancer chemotherapy. Philos. Trans. R. Soc. Lond. B. Biol. Sci. 345, 319-325.

10.1098/rstb.1994.0112.

34. Rice G. C., Hoy C. & Schimke R. T. (1986) Transient hypoxia enhances the

frequency of dihydrofolate reductase gene amplification in Chinese hamster ovary

cells. Proc. Natl. Acad. Sci. U. S. A. 83, 5978-5982. .

35. Pouyssegur J., Dayan F. & Mazure N. M. (2006) Hypoxia signalling in cancer and

approaches to enforce tumour regression. Nature 441, 437-443.

10.1038/nature04871.

36. Bolós V., Grego-Bessa J. & de la Pompa,José Luis. (2007) Notch signaling in

development and cancer. Endocrine Reviews 28, 339-363. .

37. Biocarta. Signaling pathway of notch. .

38. Purow B. W., Haque R. M., Noel M. W., Su Q., Burdick M. J., Lee J., Sundaresan

T., Pastorino S., Park J. K., Mikolaenko I., Maric D., Eberhart C. G. & Fine H. A.

(2005) Expression of Notch-1 and Its Ligands, Delta-Like-1 and Jagged-1, Is Critical

for Glioma Cell Survival and Proliferation. Cancer Res. 65, 2353-2363. .

39. Zhang X., Zheng G., Zou L., Liu H., Hou L., Zhou P., Yin D., Zheng Q., Liang L.,

Zhang S., Feng L., Yao L., Yang A., Han H. & Chen J. (2008) Notch activation

promotes cell proliferation and the formation of neural stem cell-like colonies in

human glioma cells. Mol. Cell. Biochem. 307, 101-108. 10.1007/s11010-007-9589-0.

40. Sahlgren C., Gustafsson M. V., Jin S., Poellinger L. & Lendahl U. (2008) Notch

signaling mediates hypoxia-induced tumor cell migration and invasion. Proc. Natl.

Acad. Sci. USA 105, 6392-6397. .

51

41. Soares R., Balogh G., Guo S., Gaertner F., Russo J. & Schmitt F. (2004)

Evidence for the Notch Signaling Pathway on the Role of Estrogen in Angiogenesis.

Mol. Endocrinol. 18, 2333-2343. .

42. Gustafsson M. V., Zheng X., Pereira T., Gradin K., Jin S., Lundkvist J., Ruas J.

L., Poellinger L., Lendahl U. & Bondesson M. (2005) Hypoxia requires notch

signaling to maintain the undifferentiated cell state. Developmental Cell. 9, 617-628. .

43. Zheng X., Linke S., Dias J. M., Zheng X., Gradin K., Wallis T. P., Hamilton B. R.,

Gustafsson M., Ruas J. L., Wilkins S., Bilton R. L., Brismar K., Whitelaw M. L.,

Pereira T., Gorman J. J., Ericson J., Peet D. J., Lendahl U. & Poellinger L. (2008)

Interaction with factor inhibiting HIF-1 defines an additional mode of cross-coupling

between the Notch and hypoxia signaling pathways. Proc. Natl. Acad. Sci. USA 105,

3368-3373. .

44. Clapham D. E., Runnels L. W. & Struebing C. (2001) The TRP ion channel family.

Nat. Rev. Neurosci. 2, 387-396. .

45. Dietrich A., Gudermann T. (2007) Trpc6. Handbook of Experimental

Pharmacology 125-141. .

46. Bomben V. C., Sontheimer H. W. (2008) Inhibition of transient receptor potential

canonical channels impairs cytokinesis in human malignant gliomas. Cell.

Proliferation 41, 98-121. .

47. Guilbert A., Dhennin-Duthille I., Hiani Y. E., Haren N., Khorsi H., Sevestre H.,

Ahidouch A. & Ouadid-Ahidouch H. (2008) Expression of TRPC6 channels in human

epithelial breast cancer cells. BMC Cancer 8, 125-125. .

48. Yao X., Garland C. J. (2005) Recent developments in vascular endothelial cell

transient receptor potential channels. Circulation Research 97, 853-863. .

49. Wang J., Weigand L., Lu W., Sylvester J. T., Semenza G. L. & Shimoda L. A.

(2006) Hypoxia inducible factor 1 mediates hypoxia-induced TRPC expression and

elevated intracellular Ca2+ in pulmonary arterial smooth muscle cells. Circulation

Research 98, 1528-1537. .

52

50. El Boustany C., Bidaux G., Enfissi A., Delcourt P., Prevarskaya N. & Capiod T.

(2008) Capacitative calcium entry and transient receptor potential canonical 6

expression control human hepatoma cell proliferation. Hepatology (Baltimore, Md. )

47, 2068-2077. .

51. Schneider B. P., Radovich M., Sledge G. W., Robarge J. D., Li L., Storniolo A. M.,

Lemler S., Nguyen A. T., Hancock B. A., Stout M., Skaar T. & Flockhart D. A. (2008)

Association of polymorphisms of angiogenesis genes with breast cancer. Breast

Cancer Res. Treat. 111, 157-163. 10.1007/s10549-007-9755-9.

52. Hayashi H., Nakagami H., Takami Y., Sato N., Saito Y., Nishikawa T., Mori M.,

Koriyama H., Tamai K., Morishita R. & Kaneda Y. (2007) Involvement of gamma-

secretase in postnatal angiogenesis. Biochemical and Biophysical Research

Communications 363, 584-590. .

53. Roy M., Pear W. S. & Aster J. C. (2007) The multifaceted role of Notch in cancer.

Curr. Opin. Genet. Dev. 17, 52-59. 10.1016/j.gde.2006.12.001.

54. Thebault S., Flourakis M., Vanoverberghe K., Vandermoere F., Roudbaraki M.,

Lehen'kyi V., Slomianny C., Beck B., Mariot P., Bonnal J., Mauroy B., Shuba Y.,

Capiod T., Skryma R. & Prevarskaya N. (2006) Differential role of transient receptor

potential channels in Ca2+ entry and proliferation of prostate cancer epithelial cells.

Cancer Res. 66, 2038-2047. .

55. Fowler M. A., Sidiropoulou K., Ozkan E. D., Phillips C. W. & Cooper D. C. (2007)

Corticolimbic expression of TRPC4 and TRPC5 channels in the rodent brain. PLoS

ONE 2, e573. .

56. Soboloff J., Spassova M., Xu W., He L., Cuesta N. & Gill D. L. (2005) Role of

Endogenous TRPC6 Channels in Ca super(2+) Signal Generation in A7r5 Smooth

Muscle Cells. J. Biol. Chem. 280, 39786-39794. .

57. [Anonymous]. Calculations of real-time PCR. .

58. Chigurupati S., Arumugam T. V., Son T. G., Lathia J. D., Jameel S., Mughal M.

R., Tang S., Jo D., Camandola S., Giunta M., Rakova I., McDonnell N., Miele L.,

Mattson M. P. & Poosala S. (2007) Involvement of notch signaling in wound healing.

PLoS ONE 2, e1167. .

53

59. Chigurupati S., Kulkarni T., Thomas S. & Shah G. (2005) Calcitonin stimulates

multiple stages of angiogenesis by directly acting on endothelial cells. Cancer.

Research 65, 8519-8529. .

60. Thomas S., Chigurupati S., Anbalagan M. & Shah G. (2006) Calcitonin increases

tumorigenicity of prostate cancer cells: evidence for the role of protein kinase A

and urokinase-type plasminogen receptor. Molecular Endocrinology (Baltimore,

Md. ) 20, 1894-1911. .