Upload
lindsey
View
73
Download
0
Tags:
Embed Size (px)
DESCRIPTION
The 2nd International Symposium „VERA JOHANIDES” BIOTECHNOLOGY IN CROATIA by 2020 Zagreb, May 10-11, 2013. Role of S-layer proteins in probiotic activity of Lactobacillus strains. Jasna Beganović, Ksenija Uroić, Andreja Leboš Pavunc, Blaženka Kos, Jagoda Šušković - PowerPoint PPT Presentation
Citation preview
Role of S-layer proteins in probiotic activity Role of S-layer proteins in probiotic activity of of Lactobacillus Lactobacillus strainsstrains
Jasna Beganović, Ksenija Uroić, Andreja Leboš Pavunc, Blaženka Kos, Jagoda Šušković
Laboratory for antibiotic, enzyme, probiotic and starter cultures technology Department of Biochemical Engineering
Faculty of Food Technology and Biotechnology, University of Zagreb, Croatia
The 2nd International Symposium „VERA JOHANIDES”BIOTECHNOLOGY IN CROATIA by 2020
Zagreb, May 10-11, 2013
Strategy for the selection of probiotic strains inLaboratory for antibiotics, enzymes, probiotics and starter cultures technology
(Šušković et al., 1992.)
Accurate taxonomic
identifications
Biosafety
Resistance to pH, gastric juicebile, pancreatic juice
(Antibiotic susceptibility)
Activity and viability
Adherence to intestinal epithelium/tissue
Antimicrobial activityAntagonism to pathogens
Stimulation immune response
Influencingmetabolic activities
General
Technological(production/processing)
Functionalaspects
GRAS (Generally Regarded As Safe, according US FDA) status of selected strains
PhD Thesis (Šušković, 1996)
PhD Thesis (Šušković, 1996)Master Thesis (Kos, 1995)PhD Thesis (Uroić, in progress)
PhD Thesis (Šušković, 1996)Master Thesis (Frece, 2003)PhD Thesis (Leboš Pavunc, 2012)
PhD Thesis (Kos, 2001)PhDThesis (Uroić, in progress )PhD Thesis (Beganović, 2008)
PhD Thesis (Šušković, 1996)PhD Thesis (Kos, 2001) PhD Thesis (Leboš Pavunc, 2012)
PhD Thesis (Frece, 2007)PhD Thesis (Beganović, 2008)PhD Thesis (Uroić, in progress)
BCCM confirmed taxonomic nomenclature of our 9 selected strains: Lactobacillus helveticus M92, L. plantarum L4, L. brevis D6, L. brevis ZG1, L. brevis SF9B, L. paraplantarum SF15B, L. fermentum A8, Enterococcus faecium L3, E. faecium A7…
• monomolecular crystalline arrays composed of (glyco)proteins• located on external side of cell envelope • identified in different microorganisms from the domains of Bacteria and Archaea• detected in just a few strains among 117 know Lactobacillus species:
– lower MW : 25-71 kDa– highly basic proteins (pI = 9.35-10.4) – mostly non-glycosylated – signal peptide (N- terminal secretion signal ) typical for Sec pathway (25-30 AA)
S-layer
cell membrane cell wall
S-layer present on the L. brevis D6 cell surfaceperformed by transmission electron microscopy (PhD in progress, Ksenija Uroić)
Characteristics of Lactobacillus S-layer proteins
1. L. helveticus M922. L. plantarum L4S- DNA standard
1 2 S
PCR analysis with the specific primers ATGAAGAAAAATTTAAGAAT and
CACCGATCTTGTAGTA.
slpA gene (GenBank acession number HM140425)
Detection of S-layer proteins of Lactobacillus strains from Laboratory of antibiotics, enzymes, probiotics and starter cultures technology
S-layer proteins:1. L. paraplantarum SF15B 2. L. brevis D63. L. brevis ZG14. L. brevis SF9B
SDS-PAGE surface protein profiles
L. helveticus M92 S-layer protein identified by SDS-PAGE coupled to LC-MS/MS
SlpA protein
Peptide sequences assigned to SlpA protein by Bioworks 3.2.
S – low MW protein standard;1 – S-layer, purified by dialysis
S 1
Nano HPLCPeptide separation
(LC-MS/MS) nESI linear ion trap-MS
Beganović et al., (2010) Journal of Proteomic Research, 9 (2): 677-688Beganović et al., (2011) Antonie van Leeuwenhoek, 100 (1): 43-53
1. Adhesion of Lactobacillus strains to IPEC-1 cell line (porcine intestinal epithelial cells)
Lactobacillus strains are labeled by thymidine and the radioactivity of the samples was measured by liquid scintillation (L. helveticus M92 as reference strain)
Role of S-layer proteins in probiotic activity of Lactobacillus strains
2. Inhibition of adhesion of enterotoxigenic Echerichia coli to IPEC-1 cell line by Lactobacillus strains
- - COMPETITIONCOMPETITION - -simultaneous addition of
Lactobacillus and E. coli ERL 2055
- - DISPLACMENTDISPLACMENT - -addition of Lactobacillus
after incubation of E. coli ERL 2055
- - EXCLUSIONEXCLUSION - -addition of Lactobacillus
before incubation of E. coli ERL 2055
Role of S-layer proteins in probiotic activity of Lactobacillus strains
3. Imunomodulation mediated by Lactobacillus purified S- layer proteins
1 - L. brevis GRL12 - L. amylovorus GRL 11103 - L. amylovorus GRL 11114 - L. amylovorus GRL 11125 - L. helveticus M926 – L. plantarum D6
• Extraction of S-layers from Lactobacillus cell surface1 2 3 4 5 6
Role of S-layer proteins in probiotic activity of Lactobacillus strains
Induction of IL-1, IL-6, IL-10, IL-12, TNF cytokines production in human monocyte-derived dendritic cells with Lactobacillus strains and purified
S-layer proteins - determined by cytokine specific ELISA
Stimulation of HEK Blue cell lines -TLR2, TLR4, TLR5 and NOD2- with Lactobacillus strains and purified S-layer proteins
Maturation of dendritic cells in response to Lactobacillus bacterial cells and purified S-layer proteins analysed by Flow Cytometric Analysis (FACS)
Bacteria/S-layer proteins induced expression of moDC maturation markers HLA class II, CD86 and CD83
Biotechnological protocol in Laboratory for antibiotics, enzymes, probiotics and starter cultures technology,
for probiotic and starter culture production technology
Inoculation
Inoculum
Phenotypic characterisation probiotic strain / starter culture
Collection of lactic acid bacteria (ZBMK) over than 300 characterised LAB strains
Growth
Nutrient medium removal
Wet biomass of probiotic / starter culture
LYOPHILIZATION
Probiotic bacterium/ starter culture
functionality control
Growth medium
Sterilisation
Production process control: - microbiological control - genetic control
lyoprotectant addition
MIKROENCAPSULATION
MICROENCAPSULATION
microbiological control genetic control
microbiological control genetic control
o National scientific project “Probiotics, prebiotics and functional starter cultures” No. 058- 1990-
2007
o International project SEE-ERA.NET PLUS: PSALAB No. 195/1
Project leader: PhD Jagoda Šušković, full prof.
o Collaborative project with research team of PhD Airi Palva, prof., University of Helsinki, Finland
SCIENTIFIC PROJECTS & COLLABORATIONS: