INFECTION AND IMMUNITY, May 2009, p. 2065–2075 Vol. 77, No. 50019-9567/09/$08.00�0 doi:10.1128/IAI.01204-08Copyright © 2009, American Society for Microbiology. All Rights Reserved.

Role of LecA and LecB Lectins in Pseudomonas aeruginosa-InducedLung Injury and Effect of Carbohydrate Ligands�

Chanez Chemani,1 Anne Imberty,2 Sophie de Bentzmann,3 Maud Pierre,1,4 Michaela Wimmerova,5Benoît P. Guery,1†* and Karine Faure1†

EA 2689, IFR 114, Faculte de Medecine, Universite de Lille 2 and CHRU de Lille, Lille, France1; CERMAV-CNRS, Grenoble,France2; UPR9027 CNRS, IFR88, Systemes membranaires et pathogenicite chez Pseudomonas aeruginosa, Marseille, France3;

EA 3925, IFR 114, Clinique de Pediatrie, Hopital Jeanne de Flandre, Universite de Lille 2 and CHRU de Lille, Lille, France4;and NCBR and Department of Biochemistry, Masaryk University, Brno, Czech Republic5

Received 29 September 2008/Returned for modification 14 November 2008/Accepted 17 February 2009

Pseudomonas aeruginosa is a frequently encountered pathogen that is involved in acute and chronic lunginfections. Lectin-mediated bacterium-cell recognition and adhesion are critical steps in initiating P. aerugi-nosa pathogenesis. This study was designed to evaluate the contributions of LecA and LecB to the pathogenesisof P. aeruginosa-mediated acute lung injury. Using an in vitro model with A549 cells and an experimental in vivomurine model of acute lung injury, we compared the parental strain to lecA and lecB mutants. The effects ofboth LecA- and Lec B-specific lectin-inhibiting carbohydrates (�-methyl-galactoside and �-methyl-fucoside,respectively) were evaluated. In vitro, the parental strain was associated with increased cytotoxicity andadhesion on A549 cells compared to the lecA and lecB mutants. In vivo, the P. aeruginosa-induced increase inalveolar barrier permeability was reduced with both mutants. The bacterial burden and dissemination weredecreased for both mutants compared with the parental strain. Coadministration of specific lectin inhibitorsmarkedly reduced lung injury and mortality. Our results demonstrate that there is a relationship betweenlectins and the pathogenicity of P. aeruginosa. Inhibition of the lectins by specific carbohydrates may providenew therapeutic perspectives.

Pseudomonas aeruginosa is an opportunistic pathogen in-volved in acute infections, as well as chronic infections, espe-cially in cystic fibrosis patients (7, 20). The therapeutic optionsfor these infections remain limited because this pathogen ex-hibits increasing resistance to many antibiotics (26). Currently,antibiotic research and development are at an all-time low, andfew new antipseudomonal compounds are in the pipeline.Therefore, there is a need for therapeutic approaches otherthan antibiotics.

For P. aeruginosa, as for other pathogenic microorganisms,the ability to adhere to host tissues is essential for initiatinginfection. Adhesion is often mediated by host cell surface gly-coconjugates, which are a specific target for bacterial receptors(13). Such oligosaccharide-mediated bacterium-cell recogni-tion and adhesion have been shown to be crucial in the earlysteps of P. aeruginosa pathogenesis. P. aeruginosa adhesion ismediated by a glycanic recognition pattern involving severaladhesins, including lectins. Only a limited number of the car-bohydrate-binding proteins of P. aeruginosa have been studied,and their role in recognition and adhesion is far from beingelucidated. Two soluble lectins, LecA (PA-IL) and LecB (PA-IIL), specifically binding galactose and fucose, respectively,were initially identified and characterized in the cytoplasm ofP. aeruginosa (9). However, large quantities of both of theselectins are present on the outer membrane of the bacteria,suggesting that lectins may play a role in adhesion (9, 32).

These two lectins, which are produced by the bacteria, are alsoassociated with virulence factors (8) and regulated by bothquorum sensing and the alternative sigma factor RpoS (34),suggesting that they are also parts of the numerous systemsinvolved in P. aeruginosa virulence.

Indeed, several studies suggested that both of these lectinsmay be determinants of virulence. The galactophilic moleculeLecA has been shown to have a cytotoxic effect on respiratoryepithelial cells by decreasing their growth rate, thus contribut-ing to respiratory epithelial injury (2). In addition, it has beendemonstrated that LecA induces a permeability defect in theintestinal epithelium, resulting in increased absorption of exo-toxin A, an important extracellular virulence factor (19). Ad-ditionally, relationships between lectins and other virulencefactors have been shown; for example, LecB was shown to beinvolved in pilus biogenesis and protease IV activity (29).

Although it is established that P. aeruginosa recognizes theglycoconjugates from epithelial and endothelial cells (14, 15),allowing initiation of colonization and infection, the role ofglycoconjugate ligands, such as lectins, in P. aeruginosa patho-genesis is not clearly established. Therefore, the aims of ourstudy were to evaluate the role of LecA and LecB in P. aerugi-nosa pathogenesis. To do this, we evaluated whether theselectins could contribute to the adhesion of P. aeruginosa to lungepithelial cells. We then evaluated whether these moleculeswere cytotoxic in vitro for lung epithelial cells and could con-tribute to epithelial damage. We next demonstrated their rolesin acute lung injury in vivo. Following the previous studiesusing lectin mutant P. aeruginosa strains, we studied whetherpurified soluble lectins of P. aeruginosa could induce the cyto-toxic effect of P. aeruginosa in vitro or pathogenic effects in

* Corresponding author. Mailing address: EA 2689, Faculte de me-decine, 1 Place de Verdun, F-59045 Lille cedex, France. Phone: (33)320 623472. Fax: (33) 320 444942. E-mail: bguery@invivo.edu.

† B.P.G. and K.F. contributed equally to this work.� Published ahead of print on 23 February 2009.

2065

on May 1, 2020 by guest

http://iai.asm.org/

Dow

nloaded from

vivo. Finally, we evaluated if addition of specific lectin-inhib-iting carbohydrates (i.e., the methyl derivatives of galactoseand fucose that mimic terminal sugars of eukaryotic cell sur-face glycoconjugates) could prevent or reduce P. aeruginosa-mediated lung injury.

MATERIALS AND METHODS

Animals. Male BALB/c mice (20 to 25 g) purchased from Charles RiverLaboratories (Domaine des oncins, L’Arbresle, France) were housed in a patho-gen-free unit of the Lille University Animal Care Facility and given food andwater ad libitum. All experiments were performed with the approval of andfollowing the guidelines of the Lille Institutional Animal Care and Use Com-mittee.

Bacterial strains and growth conditions. The strains and plasmids used in thisstudy are listed in Table 1. The strains were cultured overnight in Luria-Bertanimedium at 37°C and in the presence of 2 mM isopropyl-�-D-thiogalactopyrano-side (IPTG) for complementation experiments. Parental strain P. aeruginosaPAO1 and insertional mutants PAO1lecA::Tcr (hereinafter called PAO1::lecA)and PAO1lecB::Tcr (hereinafter called PAO1::lecB) used in this study wereobtained from the comprehensive transposon library generated in the PAO1genetic background (11; http://www.genome.washington.edu). The locations ofthe transposon were mapped at nucleotide positions 48 and 204 for the lecA andlecB genes, respectively. The Escherichia coli TG1 and BL21 strains were used forstandard genetic manipulations.

The lecA and lecB genes were obtained from a comprehensive P. aeruginosagene collection (17), cloned into an entry vector of the Gateway system (Invitro-gen, Cergy Pontoise, France), and then moved into a pDEST14 destinationvector by using L and R lambda phage-specific recombination sites according tothe manufacturer’s instructions. After proper production of each lectin waschecked, the lecA and lecB genes were further subcloned into the broad-host-range vector pMMB67HE at SmaI/SphI sites. Recombinant plasmids were in-troduced into P. aeruginosa using the conjugative properties of pRK2013 (labcollection). Transconjugants were selected on Pseudomonas isolation agar (DifcoLaboratories) supplemented with appropriate antibiotics. The following antibi-otic concentrations were used for E. coli: 50 �g/ml kanamycin and 50 �g/mlampicillin.

P. aeruginosa lectins. Recombinant LecB was purified from E. coli BL21(DE3)containing plasmid pET25pa2l as described previously (23).

The recombinant protein LecA was cloned using the following procedure. ThelecA gene was amplified by PCR using genomic DNA from P. aeruginosa ATCC33347 as the template with the following primers: 5�-CGG AGA TCA CAT ATGGCT TGG AAA GG-3� and 5�-CCG AGA CAA GCT TTC AGG ACT CATCC-3� (NdeI and HindIII restriction sites are underlined). After digestion withNdeI and HindIII, the amplified fragment was introduced into the pET25(b�)vector (Novagen, Madison, WI), resulting in plasmid pET25pa1l.

E. coli BL21(DE3) cells harboring the pET25pa1l plasmid and E. coliBL21(DE3) cells harboring the pET25pa2l plasmid were grown in 1 liter of Luriabroth at 37°C. When a culture reached an optical density (OD) at 600 nm of 0.5to 0.6, IPTG was added to a final concentration of 0.5 mM. Cells were harvestedafter 3 h of incubation at 30°C, washed, and resuspended in 10 ml of loadingbuffer (20 mM Tris-HCl, 100 �M CaCl2; pH 7.5). The cells were disrupted bysonication (Soniprep 150; Schoeller Instruments, Great Britain). After centrifu-gation at 10,000 � g for 1 h, the supernatant was further purified by affinitychromatography on Sepharose 4B (GE Healthcare) for LecA or on D-mannoseagarose (Sigma-Aldrich, United States) for LecB. Lectins were allowed to bindto the immobilized saccharides in the loading buffer and then were eluted withthe elution buffer (loading buffer containing 0.2 M D-galactose or 0.1 M D-mannose). All buffers used for LecB preparation contained an additional 100mM NaCl. The purity of the recombinant proteins was over 98% as determinedby sodium dodecyl sulfate-polyacrylamide gel electrophoresis. The purified pro-teins were intensively dialyzed against distilled water for 7 days for sugar re-moval, lyophilized, and kept at �20°C.

The purified lectins were prepared in solution at a concentration of 100 �g/mlfor in vitro assays and at a concentration of 1 mg/ml for in vivo assays.

Lectin inhibitors. N-Acetyl-D-galactosamine (GalNAc) (Sigma-Aldrich),�-methyl-D-galactoside (Me-�-Gal) (a specific ligand of LecA), and �-methyl-L-fucoside (Me-�-Fuc) (Interchim) (a specific ligand of LecB) were used as inhib-itors. D-Glucose (Glc) was used as an irrelevant control carbohydrate.

Preparation of bacterial inoculum for in vitro and in vivo experiments. P.aeruginosa strains grown in Luria-Bertani medium at 37°C for 16 h with appro-priate antibiotics if needed were centrifuged at 3,000 � g for 10 min. Thebacterial pellets were washed two times in an isotonic saline solution and dilutedin the isotonic saline solution to obtain an optical density of 0.63 to 0.65 asdetermined by spectrophotometry.

In vitro cytotoxicity of P. aeruginosa and its lectins. The human lung epithelialcell line A549 was cultured to confluence in modified Eagle’s medium withEarle’s salts and L-glutamate (Invitrogen, Cergy Pontoise, France) supplementedwith 10% heat-inactivated fetal bovine serum (Dustcher, Vilmorin, France) and1% penicillin-streptomycin at 37°C with 5% CO2. When the cells reached con-fluence, 2 � 104 cells were transferred to 96-well tissue culture plates andincubated overnight. The following day, the cells were exposed for 4 and 6 h to10 �l of each of the three different P. aeruginosa strains (PAO1, PAO1::lecA, andPAO1::lecB; 5 � 108 CFU/ml). Cytotoxicity was quantified by determination ofthe release of lactate dehydrogenase (LDH) into the culture supernatants at 4and 6 h (Cytotox 96; Promega Charbonniers, France). The maximal value(100%) represented the amount of LDH released from cells lysed by 0.8% TritonX-100 for 45 min. Control wells lacking bacteria were used to calculate the back-ground level of LDH released (normalized to 0%). Then the level of cytotoxicity,expressed as a percentage, was calculated as follows: % cytotoxicity � [(OD of assaymixture � OD of cells)/(OD of Triton X-100 � OD of cells)] � 100.

Bacterial adhesion assays. For the adhesion assays, A549 cells were seededinto 96-well microtiter plates at a density of 5 � 104 cells per well and incubatedovernight to obtain confluent monolayers.

Confluent monolayers in 96-well microtiter plates were washed five times with150 �l phosphate-buffered saline (PBS) prewarmed to 37°C. Nonspecific bindingwas blocked by incubation for 1 h at 37°C with 0.5% (wt/vol) bovine serumalbumin before the preparations were rinsed twice with prewarmed PBS. A100-�l portion of the bacteria (108 CFU/ml) was added to A549 cells andincubated for 1 h, 4 h, and 6 h at 37°C. Nonadherent bacteria were removed byrinsing the preparations five times with PBS. Cells were lysed by incubation for30 min at 37°C with a 0.1% (vol/vol) Triton X-100 solution. Serial dilutions wereprepared using PBS, and 100-�l aliquots were plated in duplicate on bromocresolpurple plates and incubated at 37°C for 24 h.

Intratracheal instillation. Mice were briefly anesthetized with inhaled sevoflu-rane (Sevorane; Abbot Laboratories, Queenborough, United Kingdom) andwere placed in a supine position at an angle of approximately 30°. For eachmouse, 50 �l of a bacterial inoculum calibrated to contain 5 � 108 CFU/ml wasinstilled into the lungs through a gavage needle (24-gauge modified animalfeeding needle; Popper & Sons, Inc., New Hyde Park, NY) inserted into trachea

TABLE 1. Strains and plasmids used in this study

Strain or plasmid Relevant characteristicsa Source orreference

E. coli strainsTG1 supE (lac-proAB) thi hsdR5

(F� traD36 rpoA�B� lacIqZM15)Lab

collection

P. aeruginosastrains

PAO1 Wild type 11PAO1lecA::Tcr PAO1 Tn5 mutant with mutation

in the lecA gene11

PAO1lecB::Tcr PAO1 Tn5 mutant with mutationin the lecB gene

11

PlasmidspMMB67-HE Broad-host-range vector, IncQ

ptac lacZ�, GmrLab

collectionpDEST14 Destination vector for gateway

technology, T7 promoter, AprInvitrogen

PMMBlecA lecA gene cloned in pMMB67-HE,Cbr

This study

PMMBlecB lecB gene cloned in pMMB67-HE,Cbr

This study

pRK2013 ColE1 ori tra� mob�, Kmr Labcollection

pDEST14-lecA lecA gene cloned in pDEST14, Apr This studypDEST14-lecB lecB gene cloned in pDEST14, Apr This study

a Gmr, gentamicin resistance; Apr, ampicillin resistance; Kmr, kanamycin re-sistance; Cbr, carbenicillin resistance.

2066 CHEMANI ET AL. INFECT. IMMUN.

on May 1, 2020 by guest

http://iai.asm.org/

Dow

nloaded from

via the oropharynx. Proper insertion of the needle was confirmed by observingthe movement of the solution inside the syringe during the animal’s respiratoryefforts.

In vivo quantification of acute lung injury: alveolar capillary barrier perme-ability. Two different methods were used to assess alveolar capillary barrierpermeability. The first method measures residual 125I-albumin instilled intratra-cheally as an alveolar protein tracer in the lungs and its leakage and accumula-tion in the plasma. The second method measures 125I-albumin injected as avascular protein tracer (following reabsorption after intraperitoneal injection)and its leakage and accumulation in the extravascular spaces of the lungs.

The first method was used to assess capillary barrier injury at 6 h afterinfection as previously described (1). The intratracheal instillate was a mixture of1 �Ci of 125I-labeled albumin (Seralb 125; CIS bio international, Gif-sur-Yvette,France) and 5% bovine albumin with an appropriate quantity of the specified P.aeruginosa or lectins. The total radioactivity in the instillate was measured. Fiftymicroliters of instillate was inoculated into the lungs of each anesthetized mouse.Six hours after instillation, mice were anesthetized with pentobarbital givenintraperitoneally. The blood was collected by carotid arterial puncture, and asternotomy was performed to harvest and measure the radioactivity in the lungs,trachea, and stomach. The quantity of 125I-albumin that leaked into the circu-lation was calculated by multiplying the activity in a blood sample by the volumeof blood.

The second method was used to evaluate the alveolar capillary barrier injuryat 16 h after infection. We calculated the albumin flux across the barrier using apreviously described index (12). Briefly, 2 h before the experiment, 0.5 ml of125I-albumin was injected intraperitoneally. After exsanguination, the lungs wereremoved, and the radioactivity in the blood and the hemoglobin (Hb) concen-tration were measured. Lung weight and radioactivity counts were determinedbefore homogenization and centrifugation. The supernatant Hb content was alsodetermined. Blood and lung homogenate samples were incubated at 40°C for 3days to determine the ratio of lung wet weight to lung dry weight.

The permeability index (PI) was calculated as follows: PI � {[radioactivity countfor lungs � (radioactivity count for intravascular blood per gram of blood � QB)]/(radioactivity count per gram of intravascular blood � weight of mouse)} �100,where QB is the weight of intrapulmonary blood. QB was calculated as follows: QB �(weight of lung plus water � Hb concentration in supernatant � water ratio forhomogenate � 1.039)/(Hb concentration in blood � water ratio for blood).

Measurement of the ratio of lung wet weight to lung dry weight. The ratio oflung wet weight to lung dry weight was used to evaluate the amount of extravas-cular lung water in each group of animals. At the end of the experiment, thelungs were removed, and the wet weight was recorded. The lungs were thendesiccated at 40°C for 3 days, after which the dry weight was recorded. For eachpair of lungs, the ratio of lung wet weight to lung dry weight was calculated.

Quantitative blood culture and pulmonary bacterial load. One hundred mi-croliters of blood was plated on agar plates and incubated for 24 h at 37°C. At theend of the experiment, the lungs were removed and homogenized in 0.9 ml ofsterile isotonic saline, and viable bacteria were counted by plating 0.1-ml portionsof serial dilutions of the homogenates on agar plates and incubating them for24 h at 37°C.

Experimental protocols. (i) In vitro studies. The cytotoxicity of each of the P.aeruginosa strains and lectins studied was evaluated using A549 cells at 4 h and6 h after exposure. The same experiments were performed with addition ofspecific inhibitors at a concentration of 15 mM.

The adhesion of each of the P. aeruginosa strains on A549 cells was alsoevaluated at 1 h, 4 h, and 6 h after exposure.

(ii) In vivo studies. (a) Evaluation of P. aeruginosa pathogenicity in mice.Animals were randomly assigned to the following five groups with a minimumsample size of 10 animals per group for each series of experiments: PAO1 group,PAO1::lecA group, PAO1::lecB group, PAO1::lecA/pMMBlecA group, andPAO1::lecB/pMMBlecB group.

In the first series of experiments, mortality was assessed over a 7-day periodfollowing intratracheal instillation of 50 �l of a lethal inoculum (109 CFU/ml) ofP. aeruginosa.

Lung injury, pulmonary bacterial load, and blood cultures were studied at 6and 16 h following intratracheal instillation of 50 �l of an inoculum calibrated tocontain 108 CFU/ml.

(b) Evaluation of the effect of P. aeruginosa lectins. Two groups of animalswere studied, the LecA group (n � 10) and the LecB group (n � 10). In theseanimals lung injury was evaluated at 6 h after intratracheal instillation of P.aeruginosa lectins.

(c) Evaluation of lectin inhibitors. The following experimental groups werestudied: PAO1 and GalNAc, PAO1 and Me-�-Gal, PAO1 and Me-�-Fuc, PAO1and Glc, LecA and GalNAc, LecA and Glc, LecB and Me-�-Fuc, and LecB and Glc.

Statistical analysis. The results are expressed below as means standarderrors. Data were analyzed by the Kruskal-Wallis one-way analysis of variancetest using Dunn’s method to compare differences between groups. A P valueof �0.05 was considered statistically significant. Survival was analyzed using aKaplan-Meier algorithm (GraphPad Prism, v5.0), and cumulative survival rateswere compared by using a log rank test. A level of 5% was considered statisticallysignificant.

RESULTS

Characterization of lecA and lecB mutants. The locations ofthe transposon insertion in the mutants designed were mappedpreviously using custom-designed primers, and the transposonwas inserted at nucleotide positions 48 and 204 for the lecA andlecB genes, respectively. Alternatively, we designed externaloligonucleotides lecAu (5� CTCCTGCATGAATTGGTAGGC 3�) and lecAd (5� GGGTCAGGAATCGATATTCCC3�) and external oligonucleotides lecBu (5� TAACAATCGAACGAGCCGGC 3�) and lecBd (5� TCAACTGGACAGTCTGGGCG 3�) for the lecA and lecB genes, respectively, andPCR amplification of the corresponding genomic DNA regionin the wild-type strain resulted in DNA fragments consisting of736 and 836 nucleotides for lecA and lecB, respectively. Due tothe PCR conditions and nature of the transposon, whose sizeexceeded 4.5 kbp, the absence of the corresponding bands forthe lecA mutant (Fig. 1A, lane 2) and the lecB mutant (Fig. 1A,lane 5) and the presence of lecA (Fig. 1A, lane 1) and lecB (Fig.1A, lane 4) in the parental isogenic strain, as well as in ourreference PAO1 strain (Fig. 1A, lanes 3 and 6), confirmed thatthe transposon interrupted the lecA and lecB genes.

To check whether lectins were produced in the differentstrains used in this study, production of LecA, for which wehad a suitable polyclonal antibody that bound purified LecAprotein, was assessed parallel to assessment of the bacterialgrowth curve. LecA production was detectable only in the latestationary phase in the parental wild-type strain (Fig. 1B, lanes1 to 3). In the derived isogenic insertional lecA mutant, LecAproduction was undetectable in the late stationary phase (Fig.1B, lanes 4 and 5), and it was fully restored to the parental levelin the late stationary phase when the strain was transcomple-mented with the lecA gene (Fig. 1B, lane 6). As a control,binding of the polyclonal antibody to purified LecA proteinwas checked (Fig. 1B, lane 7). No suitable antibody directedtoward the LecB protein was available, and we were not able toassess LecB production in the different strains.

The growth curves obtained for the parental strain and thelecA and lecB mutants clearly showed that there was no majorgrowth defect in the mutants compared to the parental strain(Fig. 1C).

In vitro cytotoxicity. (i) LecA and LecB lectins are determi-nants of P. aeruginosa cytotoxicity in A549 cells. The cytotox-icities of the strains of P. aeruginosa with A549 cells werecompared in vitro. Cytotoxicity was evaluated by measuring therelease of LDH 4 and 6 h after infection. The amount of LDHreleased was statistically larger for PAO1-infected cells thanfor PAO1::lecA- and PAO1::lecB-infected cells at 4 and 6 h(Fig. 2A).

(ii) Carbohydrate lectin inhibitors decrease in vitro cytotox-icity for A549 cells. The effects of the specific lectin-inhibitingcarbohydrates (GalNAc and Me-�-Gal for LecA and Me-�-Fuc for LecB) on the cytotoxicity of P. aeruginosa and its

VOL. 77, 2009 LECTINS AND VIRULENCE 2067

on May 1, 2020 by guest

http://iai.asm.org/

Dow

nloaded from

lectins were compared to the effect of a nonspecific lectininhibitor (Glc) used as a control.

Addition of specific inhibitors (GalNAc and Me-�-Gal forLecA and Me-�-Fuc for LecB) induced a significant reductionin PAO1-induced cytotoxicity that was observed only after 6 hof incubation compared to the results obtained with Glc (Fig.2B). Similarly, the cell cytotoxicity obtained with the purifiedLecA and LecB lectins was significantly decreased when thespecific inhibitors were added (Fig. 2C). Significant reductionswere observed for the LecA inhibitors GalNAc and Me-�-Gal

and for the LecB inhibitor Me-�-Fuc after 4 h and 6 h ofincubation, respectively (Fig. 2C).

LecA and LecB mediate P. aeruginosa adherence to A549cells. The adherence of each strain of P. aeruginosa to A549cells was assessed at 1, 4, and 6 h during incubation withA549 cells. The number of adherent bacteria was approxi-mately twofold greater for PAO1-infected cells than forPAO1::lecA- and PAO1::lecB-infected cells (Fig. 3).

Analysis of survival. (i) LecA or Lec B mutation does notaffect mortality. Survival studies were performed with thePAO1 wild-type strain and the insertional mutants PAO1::lecAand PAO1::lecB. Instillation of the PAO1 strain was associatedwith a mortality rate of 100% at 4 days, and most of the

FIG. 1. (A) PCR verification of lecA and lecB gene interruptionusing external lecA and lecB oligonucleotide pairs with which PCRamplification of the corresponding DNA region leads in the wild-typestrain to 736- and 836-nucleotide DNA fragments for lecA and lecB,respectively. Lanes 1 and 4, parental PAO1 strain; lanes 2 and 5,PAO1lecA::Tcr and PAO1lecB::Tcr mutants, respectively; lanes 3 and6, reference PAO1 strain. (B) Western blot analysis of LecA produc-tion in the parental strain P. aeruginosa PAO1 (lanes 1 to 3),PAO1lecA::Tcr insertional mutants (lanes 4 to 5), and thePAO1::lecA/pMMBlecA strain (lane 6) with a polyclonal antibody di-rected against the LecA protein (lane 7). The numbers above theWestern blot indicate the growth points at which the production waschecked (1, 2, and 3 indicate aliquots obtained during the exponential,early stationary, and late stationary phases, respectively). (C) Growthcurves for the parental strain P. aeruginosa PAO1 and insertionalmutants PAO1lecA::Tcr and PAO1lecB::Tcr. nt, nucleotides.

FIG. 2. (A) Cytotoxicity of P. aeruginosa strains with lung epithelialcells. A549 cells (2 � 104 cells) were cocultured with each strain at amultiplicity of infection of 250. (B and C) Effects of carbohydrates onthe cytotoxicity of P. aeruginosa (PA) (B) and its lectins (C). A549 cells(2 � 104 cells) were cocultured with P. aeruginosa PAO1 (parentalstrain) at a multiplicity of infection of 250 or with each lectin in thepresence of Glc, GalNAc, Me-�-Fuc, or Me-�-Gal. The carbohydrateswere added at a concentration of 15 mM. The cytotoxicity with lungepithelial cells was evaluated by measuring the release of LDH at 4 and6 h. The values are the averages of three assays for the means (bars)and standard deviations (error bars). �, P � 0.05 for a comparison withPAO1; ��, P � 0.01 for a comparison with PAO1; ���, P � 0.001 fora comparison with PAO1; �, P � 0.05 for a comparison with thecorresponding lectin.

2068 CHEMANI ET AL. INFECT. IMMUN.

on May 1, 2020 by guest

http://iai.asm.org/

Dow

nloaded from

animals died within the first 48 h. Interestingly, although in-stillation of the PAO1::lecA mutant led to decreased 24-h mor-tality and a trend toward increased 4-day survival (12%) (Fig.4A), the difference was not statistically significant. Instillation

of the PAO1::lecB mutant also resulted in mortality rates sim-ilar to those obtained with the parental strain (Fig. 4B). Theuse of complemented strains resulted in mortality rates similarto those obtained with the parental strain.

(ii) Lectin-inhibiting carbohydrates improve survival. Coinstil-lation of specific LecA inhibitors with P. aeruginosa decreasedmortality compared to that observed for both the PAO1 groupand the control group which received Glc (the irrelevant carbo-hydrate control) (Fig. 5). Furthermore, for the lectin-inhibitingcarbohydrates, the rate of survival was statistically highest formice which received a LecA inhibitor, either GalNAc or Me-�-Gal. No difference was observed between the group which re-ceived the LecB inhibitor Me-�-Fuc and the PAO1 group.

In vivo measurements. (i) LecA and LecB increase alveolarcapillary barrier injury. Lung injury was evaluated by measuringthe efflux of the protein tracer 125I-albumin either from the lungsinto the blood at 6 h after intratracheal instillation or from theblood into the lungs 16 h after intraperitoneal injection. The effluxof the protein tracer was statistically greater for the PAO1 groupthan for the PAO1::lecA and PAO1::lecB groups at both 6 and16 h (Fig. 6). The efflux of the protein tracer for the PAO1::lecAand PAO1::lecB groups was restored to the level of the PAO1group through transcomplementation of the lecA gene(pMMBlecA) and of the lecB gene (pMMBlecB) in the corre-sponding mutants at 16 h (Fig. 6B). Likewise, purified lectinsinduced an increase in permeability at 6 h (Fig. 6C).

(ii) LecA and LecB increase the amount of extravascularlung water. The ratios of lung wet weight to lung dry weight weresignificantly greater for the PAO1 group than for both thePAO1::lecA and PAO1::lecB groups at 6 h (Table 2). At 16 h, thevalues for the extravascular lung water were similar to valuesobtained at 6 h, and they remained significantly higher for thePAO1 group than for the PAO1::lecA and PAO1::lecB groups.

(iii) Coinstillation of lectin-inhibiting carbohydrates de-creases lung injury. To evaluate the effects of specific lectininhibitors for preventing P. aeruginosa-induced lung injury, wecoinstilled these molecules with P. aeruginosa. The effect of thespecific lectin-inhibiting carbohydrates (GalNAc and Me-�-

FIG. 4. Survival study. An inoculum containing 5 � 107 CFU wasinstilled into the lungs, and then survival was monitored for 7 days for 20mice per group. (A) Survival of mice after instillation of PAO1::lecAcompared with the survival after instillation of PAO1 (parentalstrain) or PAO1::lecA/pMMBlecA (complemented lecA mutant).(B) Survival of mice after instillation of PAO1::lecB (lecB mutant)compared with the survival after instillation of PAO1 (parentalstrain) or PAO1::lecB/pMMBlecB (complemented lecB mutant).

FIG. 3. Relative attachment of P. aeruginosa strains to A549 cells:numbers of P. aeruginosa PAO1 (parental strain), PAO1::lecA (lecA mu-tant), and PAO1::lecB (lecB mutant) bacteria adhering to A549 cells. Aninoculum containing 108 CFU/ml was used. Bacteria were allowed toattach for 1, 4, and 6 h. The values are the means (bars) and standarddeviations (error bars) of five independent experiments. �, P � 0.05; ��,P � 0.01; ���, P � 0.001 (for a comparison with the PAO1 group).

FIG. 5. Effect of carbohydrates on mortality in mice. Mice wereinoculated intratracheally with a suspension containing 5 � 107 CFUof P. aeruginosa PAO1 (parental strain) in the presence and absence ofGlc, GalNAc, Me-�-Gal, or Me-�-Fuc, and then survival was moni-tored for 7 days. The carbohydrates were used at a concentration of 15mM (20 mice per group). �, P � 0.05 for a comparison with the PAO1group; ��, P � 0.001 for a comparison with the PAO1 group. PA, P.aeruginosa.

VOL. 77, 2009 LECTINS AND VIRULENCE 2069

on May 1, 2020 by guest

http://iai.asm.org/

Dow

nloaded from

Gal for LecA and Me-�-Fuc for LecB) was compared to theeffect of an irrelevant carbohydrate (Glc) used as control.

All of the specific lectin inhibitors decreased injury, as as-sessed by alveolar barrier permeability. Me-�-Gal was morepotent than GalNAc and Me-�-Fuc at 6 and 16 h. At a con-centration of 15 mM, the LecA inhibitor Me-�-Gal was theonly inhibitor which significantly reduced the PAO1-inducedlung permeability disorder (Fig. 7A). An improvement in per-

meability was also observed with GalNAc or Me-�-Fuc at aconcentration of 50 mM but not at a concentration of 15 mMcompared to the results obtained with Glc 6 h after infection(Fig. 7A and 7B). At 16 h, lung injury was significantly de-creased with GalNAc or Me-�-Gal (Fig. 7B).

The combination of purified lectin LecA with GalNAc orpurified LecB with Me-�-Fuc was associated with a significantreduction in lung injury at 6 h (Fig. 7C).

LecA and LecB mutation or inhibition increases lung bac-terial clearance. We assessed the ability of animals to clearbacteria from the lungs. Six hours after instillation of thepathogen, the bacterial loads were not significantly differentfor the PAO1, PAO1::lecA, and PAO1::lecB groups (Fig. 8A).However, after 16 h, the animals infected with PAO1 showeda significantly higher lung bacterial load than the animals in thePAO1::lecA or PAO1::lecB groups (Fig. 8A).

Consistent with these results, coadministration of specificlectin inhibitors with P. aeruginosa increased lung bacterialclearance. At 6 h, the lung bacterial load was significantlydecreased in the group of mice that received Me-�-Fuc (Fig.8B), and the greatest reduction was observed at a concentra-tion of 50 mM. Me-�-Gal at a concentration of 15 mM orGalNAc at a concentration of 50 mM was also associated witha significant decrease in the lung bacterial load 6 h after in-fection compared to the results obtained with the irrelevantcarbohydrate Glc (Fig. 8B). At 16 h, the presence of all inhib-itors (GalNAc and Me-�-Gal for LecA and Me-�-Fuc forLecB) led to a significant reduction in the lung bacterial load(Fig. 8C).

LecA and LecB mutation or inhibition decreases bacterialdissemination. Blood culture analyses were performed at 6 and16 h after instillation of P. aeruginosa. The number of positiveblood cultures was statistically lower for mice instilled withstrains PAO1::lecA and PAO1::lecB than for mice instilled withthe parental PAO1 strain at 6 and 16 h (Table 3).

Coinstillation of the PAO1 strain with the LecA inhibitorMe-�-Gal or with the LecB inhibitor Me-�-Fuc significantlydecreased bacterial dissemination at 6 h compared to the re-sults for the groups without any inhibitor or with the irrelevantcarbohydrate (Glc). At 16 h, the bacterial dissemination re-mained significantly decreased (Table 4). No disseminationwas observed with Me-�-Fuc and Me-�-Gal at that time point(Table 4). Addition of both inhibitors did not further improvethe results.

TABLE 2. Ratio of wet lung weight to dry lung weighta

StrainRatio of wet lung weight to dry lung weight

6 h after instillation 16 h after instillation

Control 3.61 0.11 3.98 0.04PAO1 4.86 0.04 4.79 0.16PAO1::lecA 4.04 0.04 A 4.09 0.07 BPAO1::lecB 4.00 0.28 A 4.08 0.04 A

a The ratio of wet lung weight to dry lung weight was evaluated 6 h and 16 h afterintratracheal instillation of P. aeruginosa PAO1 (parental strain), PAO1::lecA (lecAmutant), and PAO1::lecB (lecB mutant). The data are means standard errors (10mice per group). A, P � 0.05 for a comparison with PAO1; B, P � 0.01 for acomparison with PAO1. The control contained no bacteria.

FIG. 6. Alveolar capillary barrier permeability after intratrachealinstillation of P. aeruginosa PAO1 (parental strain), PAO1::lecA (lecAmutant), PAO1::lecB (lecB mutant), and P. aeruginosa lectins (LecAand LecB). (A and C) Efflux of the protein tracer 125I-albumin fromthe lungs into the blood 6 h after infection. (B) Efflux of the proteintracer 125I-albumin from the blood into the lungs 16 h after intraperi-toneal injection. The data are means (bars) and standards errors (errorbars) for 10 mice per group. °, P � 0.05 for a comparison with thecontrol; °°, P � 0.01 for a comparison with the control; °°°, P � 0.001for a comparison with the control; �, P � 0.05 for a comparison withPAO1; ��, P � 0.01 for a comparison with PAO1; ���, P � 0.001 fora comparison with PAO1; �, P � 0.05 for a comparison with the lecBmutant or lecA mutant; ���, P � 0.001 for a comparison with thelecB mutant or lecA mutant. CTR, control (no bacteria or no lectin).

2070 CHEMANI ET AL. INFECT. IMMUN.

on May 1, 2020 by guest

http://iai.asm.org/

Dow

nloaded from

DISCUSSION

This study was designed to determine the contribution of thelectins LecA and LecB to P. aeruginosa pathogenicity. Using alung epithelial cell line and an experimental murine model oflung injury, we compared three strains of P. aeruginosa: PAO1(the parental strain which produces LecA and LecB) and iso-

genic mutants in which the lecA and lecB gene were inacti-vated. We then evaluated the roles of specific lectin inhibitors.Our results demonstrate that there is a relationship betweenthe lectins and P. aeruginosa pathogenicity.

The participation of lectins, particularly LecA, in the patho-genicity of P. aeruginosa has been previously observed in vitro.

FIG. 7. Effect of carbohydrates on lung injury. Lung injury was evaluated by examining alveolar capillary barrier permeability after intratrachealinstillation of P. aeruginosa PAO1 (parental strain) and its lectins alone or in combination with Glc, GalNAc, Me-�-Gal, or Me-�-Fuc in mice. (Aand C) Efflux of the protein tracer 125I-albumin from the lungs into the blood 6 h after infection. (B) Efflux of the protein tracer 125I-albumin fromthe blood into the lungs 16 h after intraperitoneal injection. The data are means (bars) and standards errors (error bars). The carbohydrates wereused at concentrations of 15 and 50 mM, and there were 10 mice per group. �, P � 0.05 for a comparison with PAO1; ��, P � 0.01 for a comparisonwith PAO1; ���, P � 0.001 for a comparison with PAO1. CTR, control (no bacteria or no lectin); PA, P. aeruginosa.

VOL. 77, 2009 LECTINS AND VIRULENCE 2071

on May 1, 2020 by guest

http://iai.asm.org/

Dow

nloaded from

Bajolet-Laudinat et al. showed that LecA had a cytotoxic effecton human epithelial cells in primary culture (2). The exposureof these cells to concentrations of LecA of �10 �g/ml inhibitedtheir growth and decreased ciliary activity. With higher con-centrations of LecA (100 �g/ml), these authors observed cel-lular lesions. Consistent with these findings, LecA was alsoshown to have a cytotoxic effect on the digestive epithelium(36). Using A549 cells, we demonstrated that the parental

PAO1 strain has a greater cytotoxic effect than both mutantstrains with the lectin genes inactivated. Even if P. aeruginosa-induced cytotoxicity is multifactorial, our observation that pu-rified lectins have a cytotoxic effect further shows that P.aeruginosa cytotoxicity is at least in part a result of the lectinsthemselves rather than a complex result of cross-regulation oractivation of genes due to the inactivation of LecA and LecB.Therefore, lectins may represent virulence factors which can

FIG. 8. Lung bacterial clearance. Mice were infected with a suspension containing 5 � 106 CFU of P. aeruginosa PAO1 (parental strain),PAO1::lecA (lecA mutant), or PAO1::lecB (lecB mutant). The number of viable bacteria remaining in the infected lungs was counted 6 h (H6) and16 h (H16) after instillation (A). The effect of carbohydrates on lung bacterial clearance was evaluated after intratracheal instillation of 5 � 107

CFU of P. aeruginosa PAO1 mixed with Glc, GalNAc, Me-�-Gal, or Me-�-Fuc at 6 h (B) and 16 h (C). Carbohydrates were used at concentrationsof 15 and 50 mM, and there were 10 mice per group. The data are means (bars) and standard errors (error bars). �, P � 0.05 for a comparisonwith PAO1; ��, P � 0.01 for a comparison with PAO1; ���, P � 0.001 for a comparison with PAO1. PA, P. aeruginosa.

2072 CHEMANI ET AL. INFECT. IMMUN.

on May 1, 2020 by guest

http://iai.asm.org/

Dow

nloaded from

lead to severe lung epithelial injury, contributing to lung epi-thelial damage.

We further assessed the in vivo relevance of LecA and LecBas virulence factors by measuring the mortality rate in a murinemodel of P. aeruginosa-induced lung injury. Survival was fol-lowed over a 7-day period. In our model we did not find astatistical difference between survival with the parental strainand survival with the two mutants with the lectin genes inac-tivated. In a different setting, the contribution of LecA tovirulence was evaluated in an intestinal injury model. In thismurine model, the combination of LecA and exotoxin A led toa high rate of mortality at 48 h after inoculation; however, nomortality was observed when these two virulence factors wereinoculated separately (19). These results suggest that LecAacts in synergy with other virulence factors. The results of thesecond part of our study suggest that LecA and LecB are notmajor or direct determinants of mortality but could act ascofactors in virulence nonetheless.

The impact of P. aeruginosa lectins on alveolar capillarybarrier permeability was analyzed further. This parameter isvery sensitive and can quantitatively assess lung injury as wellas the functional consequences of epithelial injury. For thisassessment, the size of the inoculum was reduced to 108

CFU/ml to avoid a mortality bias at 6 and 16 h postinfection.All the animals could therefore be studied. The leakage of theradioactive tracer decreased when mice were instilled withstrains which did not produce either LecA or LecB, and thiswas associated with reduced extravascular lung water com-pared with that in the parental strain. Inoculation of the com-plemented strains led to permeability disorders similar to thoseobserved with the parental strain at 16 h. However, we did notobserve any difference between the strains with lectin genesinactivated and the lectin-complemented strains at 6 h; this wasfound to be related to a slower growth of the complementedstrains (data not shown). We thus demonstrated that LecA andLecB are involved in P. aeruginosa-induced alveolar capillarybarrier injury.

Oligosaccharide-mediated recognition and adhesion are keypoints in the early steps of P. aeruginosa pathogenesis, andlectins probably have a major role in adhesion (14, 15). There-fore, we also aimed at evaluating the role of lectins in clearanceof P. aeruginosa from the lungs. The significant decreases in thelung bacterial loads in the groups instilled with the lecA andlecB mutant strains compared to that in the PAO1 group sup-port our hypothesis that lectins act as virulence factors mainlyin an early phase. Two recent studies have shown that theLecA and LecB lectins were involved in biofilm formation.

Tielker et al. showed that LecB could bind to oligosaccharidepatterns present on the cellular surface and that lecB-deficientmutants were impaired in biofilm formation (32). Similar re-sults were obtained with LecA (6). Thus, these data suggestthat modulation of the expression of LecA and LecB couldpotentially inhibit the initial adhesion of P. aeruginosa andconsequently biofilm formation at a later phase of infection.Our data are consistent with data obtained previously; theincreased bacterial clearance observed with the mutants canprobably be related, at least partially, to decreased adhesion.To confirm this hypothesis, we compared the adhesion of thelectin mutant strains to that of the parental strain. We ob-served significant decreases in the adhesion of the lecA andlecB mutants, supporting the hypothesis that a deficiency inlectin-mediated adhesion allows increased clearance of themutant bacterial strains.

We then focused on the bacterial dissemination into thebloodstream, which we found to be decreased with lecA andlecB mutant strains. Bacterial dissemination depends on sev-eral factors, among which are the severity and extent of alve-olar capillary barrier damage, virulence factors (16), and bac-terial load (27). At 6 h, the bacterial loads were equivalent forthe three groups. The permeability of the alveolar capillarybarrier was, however, significantly increased in the group in-stilled with the parental strain compared to the groups instilledwith the two mutants. This result is consistent with the data ofKurahashi et al. (16), who found a correlation between theincrease in permeability and bacteremia. Plotkowski et al. (25)hypothesized that besides causing permeability disorders, P.aeruginosa could cross the endothelial barrier and adhere tothe endothelial cells to invade intravascular space through theinvolvement of glycanic structures on the surface of the endo-thelial cells. Such glycanic structures represent a potential tar-get for lectins, as recently demonstrated ex vivo (14, 15). Thedecrease in P. aeruginosa dissemination could therefore berelated not only to decreased permeability disorders but also toalterations in cellular glycan-lectin interactions.

P. aeruginosa produces two lectins with well-described car-bohydrate-binding capacities (10). The glycoconjugates fromepithelial and endothelial cell surfaces serve as binding sites

TABLE 3. Pulmonary translocationa

StrainNo. of positive blood cultures/total no. of cultures

6 h after instillation 16 h after instillation

PAO1 9/10 10/10PAO1::lecA 2/10A 2/10APAO1::lecB 3/10B 2/10A

a The results were determined 6 h and 16 h after intratracheal instillation of P.aeruginosa PAO1 (parental strain), PAO1::lecA (lecA mutant), and PAO1::lecB(lecB mutant) (10 mice per group). A, P � 0.01 for a comparison with PAO1; B,P � 0.001 for a comparison with PAO1.

TABLE 4. Effect of carbohydrates on the bacterial disseminationof P. aeruginosaa

Group

No. of positive blood cultures/total no. of cultures

6 h afterinstillation

16 h afterinstillation

PAO1 control 9/10 10/10

PAO1 � Glc 8/10 9/10PAO1 � GalNAc 9/10 1/10APAO1 � Me-�-Fuc 0/10B 0/10BPAO1 � Me-�-Gal 4/10A 0/10B

PAO1 � GalNAc � Me-�-Fuc 5/10 4/10APAO1 � Me-�-Gal � Me-�-Fuc 5/10 3/10A

a The results were determined 6 h and 16 h after intratracheal instillation of P.aeruginosa PAO1 (parental strain) alone or in combination with Glc, GalNAc,Me-�-Gal, or Me-�-Fuc in mice. The carbohydrates were used at a concentrationof 15 mM (10 mice per group). A, P � 0.01 for a comparison with PAO1; B, P �0.001 for a comparison with PAO1.

VOL. 77, 2009 LECTINS AND VIRULENCE 2073

on May 1, 2020 by guest

http://iai.asm.org/

Dow

nloaded from

for P. aeruginosa (15). LecA is a D-galactose-binding lectin withhigh affinity for terminal glycans presenting an �-galactoseresidue at the nonreducing end (4, 18). The LecB lectin has ahigh affinity for L-fucose and its derivatives (24, 35). Severalstudies have suggested that blockade or inhibition of theselectins by specific carbohydrates may be useful for preventionand treatment of P. aeruginosa infections (28, 31). In neonatalmice, aerosolized dextran significantly reduced P. aeruginosapneumonia sequellae (3). Similarly, inhaled galactose and fu-cose successfully reduced P. aeruginosa airway infection (33).

In our study we investigated the effects of specific lectin-inhibiting carbohydrates on P. aeruginosa lung infection in vitroand in vivo. The addition of these inhibitors was associated invitro with reduced cytotoxicity of P. aeruginosa or its purifiedlectins. In vivo, we observed an improvement in survival andreductions in lung injury, lung bacterial load, and bacterialdissemination.

Of the carbohydrates evaluated, only GalNAc and Me-�-Gal, which are specific LecA inhibitors, were associated withan improvement in survival. The beneficial effect of GalNAcon survival has previously been demonstrated in a model of P.aeruginosa induced-intestinal injury (36). The specific inhibitorof LecA, Me-�-Gal, appeared to be more effective thanGalNAc, resulting in a significant improvement in lung in-jury. Similar results were obtained with Me-�-Fuc, a specificinhibitor of LecB. We also demonstrated that these twocarbohydrates were most effective at a concentration of 50mM. However, a combination of the two inhibitors did notfurther improve permeability.

In our study, we observed a significant decrease in the lungbacterial load and bacterial dissemination when specific lectin-inhibiting carbohydrates were coadministered with the wild-type strain. The mechanism probably involves inhibition of thecarbohydrate-lectin interaction. Again, the effect was dose de-pendent with GalNAc and Me-�-Fuc. Coadministration ofspecific LecA inhibitors or LecB inhibitors at a concentrationof 15 mM with the wild-type strain significantly decreased thelung bacterial load at 6 and 16 h after infection. Again, thecombination of inhibitors was not additive or synergistic. Theseresults support the hypothesis that LecA and LecB participatein the adhesion of P. aeruginosa to endothelial cells (25) andthat there is a direct interaction between lectins and endothe-lial cells (14, 15).

Although the pathogenesis of P. aeruginosa is multifactorial,our results suggest that the lectins are key virulence factorsthat play a major role in P. aeruginosa-induced lung injury. Ourresults show that there is a significant correlation between thelectins and the severity of lung injury, lung bacterial load, anddissemination of the pathogen, influencing survival. Adminis-tration of specific lectin inhibitors was remarkably effective.The elucidation of the crystal structures of P. aeruginosa lectinscomplexed with carbohydrate ligands (5, 23), together with asynthetic chemistry effort to produce high-affinity carbohy-drate-based ligands (21, 22), opens new possibilities for lectinsas novel therapeutic targets in P. aeruginosa infections.

ACKNOWLEDGMENTS

This work was supported by French Association Vaincre la Muco-viscidose and the Ministry of Education of the Czech Republic (grantMSM0021622413).

We are grateful for technical assistance provided by Catherine Gau-tier for purification of lectins. We also thank E. Kipnis for correctionof the manuscript.

REFERENCES

1. Ader, F., B. R. Le, K. Faure, P. Gosset, O. Epaulard, B. Toussaint, B. Polack,E. Nowak, N. B. Viget, E. Kipnis, and B. P. Guery. 2005. Alveolar responseto Pseudomonas aeruginosa: role of the type III secretion system. Infect.Immun. 73:4263–4271.

2. Bajolet-Laudinat, O., S. Girod-de Bentzmann, J. M. Tournier, C. Madoulet,M. C. Plotkowski, C. Chippaux, and E. Puchelle. 1994. Cytotoxicity ofPseudomonas aeruginosa internal lectin PA-I to respiratory epithelial cells inprimary culture. Infect. Immun. 62:4481–4487.

3. Bryan, R., M. Feldman, S. C. Jawetz, S. Rajan, E. DiMango, H. B. Tang, L.Scheffler, D. P. Speert, and A. Prince. 1999. The effects of aerosolizeddextran in a mouse model of Pseudomonas aeruginosa pulmonary infection.J. Infect. Dis. 179:1449–1458.

4. Chen, C. P., S. C. Song, N. Gilboa-Garber, K. S. Chang, and A. M. Wu. 1998.Studies on the binding site of the galactose-specific agglutinin PA-IL fromPseudomonas aeruginosa. Glycobiology 8:7–16.

5. Cioci, G., E. P. Mitchell, C. Gautier, M. Wimmerova, D. Sudakevitz, S.Perez, N. Gilboa-Garber, and A. Imberty. 2003. Structural basis of calciumand galactose recognition by the lectin PA-IL of Pseudomonas aeruginosa.FEBS Lett. 555:297–301.

6. Diggle, S. P., R. E. Stacey, C. Dodd, M. Camara, P. Williams, and K. Winzer.2006. The galactophilic lectin, LecA, contributes to biofilm development inPseudomonas aeruginosa. Environ. Microbiol. 8:1095–1104.

7. Fagon, J. Y., J. Chastre, Y. Domart, J. L. Trouillet, and C. Gibert. 1996.Mortality due to ventilator-associated pneumonia or colonization withPseudomonas or Acinetobacter species: assessment by quantitative culture ofsamples obtained by a protected specimen brush. Clin. Infect. Dis. 23:538–542.

8. Gilboa-Garber, N. 1982. Pseudomonas aeruginosa lectins. Methods Enzymol.83:378–385.

9. Glick, J., and N. Garber. 1983. The intracellular localization of Pseudomonasaeruginosa lectins. J. Gen. Microbiol. 129:3085–3090.

10. Imberty, A., M. Wimmerova, E. P. Mitchell, and N. Gilboa-Garber. 2004.Structures of the lectins from Pseudomonas aeruginosa: insight into themolecular basis for host glycan recognition. Microbes Infect. 6:221–228.

11. Jacobs, M. A., A. Alwood, I. Thaipisuttikul, D. Spencer, E. Haugen, S. Ernst,O. Will, R. Kaul, C. Raymond, R. Levy, L. Chun-Rong, D. Guenthner, D.Bovee, M. V. Olson, and C. Manoil. 2003. Comprehensive transposon mutantlibrary of Pseudomonas aeruginosa. Proc. Natl. Acad. Sci. USA 100:14339–14344.

12. Jayr, C., C. Garat, M. Meignan, J. F. Pittet, M. Zelter, and M. A. Matthay.1994. Alveolar liquid and protein clearance in anesthetized ventilated rats.J. Appl. Physiol. 76:2636–2642.

13. Karlsson, K. A. 2001. Pathogen-host protein-carbohydrate interactions asthe basis of important infections. Adv. Exp. Med. Biol. 491:431–443.

14. Kirkeby, S., A. K. Hansen, A. d’Apice, and D. Moe. 2006. The galactophiliclectin (PA-IL, gene LecA) from Pseudomonas aeruginosa. Its binding re-quirements and the localization of lectin receptors in various mouse tissues.Microb. Pathog. 40:191–197.

15. Kirkeby, S., M. Wimmerova, D. Moe, and A. K. Hansen. 2007. The mink asan animal model for Pseudomonas aeruginosa adhesion: binding of the bac-terial lectins (PA-IL and PA-IIL) to neoglycoproteins and to sections ofpancreas and lung tissues from healthy mink. Microbes Infect. 9:566–573.

16. Kurahashi, K., O. Kajikawa, T. Sawa, M. Ohara, M. A. Gropper, D. W.Frank, T. R. Martin, and J. P. Wiener-Kronish. 1999. Pathogenesis of septicshock in Pseudomonas aeruginosa pneumonia. J. Clin. Investig. 104:743–750.

17. Labaer, J., Q. Qiu, A. Anumanthan, W. Mar, D. Zuo, T. V. Murthy, H.Taycher, A. Halleck, E. Hainsworth, S. Lory, and L. Brizuela. 2004. ThePseudomonas aeruginosa PA01 gene collection. Genome Res. 14:2190–2200.

18. Lanne, B., J. Ciopraga, J. Bergstrom, C. Motas, and K. A. Karlsson. 1994.Binding of the galactose-specific Pseudomonas aeruginosa lectin, PA-I, toglycosphingolipids and other glycoconjugates. Glycoconj. J. 11:292–298.

19. Laughlin, R. S., M. W. Musch, C. J. Hollbrook, F. M. Rocha, E. B. Chang,and J. C. Alverdy. 2000. The key role of Pseudomonas aeruginosa PA-I lectinon experimental gut-derived sepsis. Ann. Surg. 232:133–142.

20. Lyczak, J. B., C. L. Cannon, and G. B. Pier. 2002. Lung infections associatedwith cystic fibrosis. Clin. Microbiol. Rev. 15:194–222.

21. Marotte, K., C. Preville, C. Sabin, M. Moume-Pymbock, A. Imberty, and R.Roy. 2007. Synthesis and binding properties of divalent and trivalent clustersof the Lewis a disaccharide moiety to Pseudomonas aeruginosa lectin PA-IIL.Org. Biomol. Chem. 5:2953–2961.

22. Marotte, K., C. Sabin, C. Preville, M. Moume-Pymbock, M. Wimmerova,E. P. Mitchell, A. Imberty, and R. Roy. 2007. X-ray structures and thermo-dynamics of the interaction of PA-IIL from Pseudomonas aeruginosa withdisaccharide derivatives. ChemMedChem 2:1328–1338.

23. Mitchell, E., C. Houles, D. Sudakevitz, M. Wimmerova, C. Gautier, S. Perez,A. M. Wu, N. Gilboa-Garber, and A. Imberty. 2002. Structural basis for

2074 CHEMANI ET AL. INFECT. IMMUN.

on May 1, 2020 by guest

http://iai.asm.org/

Dow

nloaded from

oligosaccharide-mediated adhesion of Pseudomonas aeruginosa in the lungsof cystic fibrosis patients. Nat. Struct. Biol. 9:918–921.

24. Perret, S., C. Sabin, C. Dumon, M. Pokorna, C. Gautier, O. Galanina, S. Ilia,N. Bovin, M. Nicaise, M. Desmadril, N. Gilboa-Garber, M. Wimmerova,E. P. Mitchell, and A. Imberty. 2005. Structural basis for the interactionbetween human milk oligosaccharides and the bacterial lectin PA-IIL ofPseudomonas aeruginosa. Biochem. J. 389:325–332.

25. Plotkowski, M. C., A. M. Saliba, S. H. Pereira, M. P. Cervante, and O.Bajolet-Laudinat. 1994. Pseudomonas aeruginosa selective adherence to andentry into human endothelial cells. Infect. Immun. 62:5456–5463.

26. Rossolini, G. M., and E. Mantengoli. 2005. Treatment and control of severeinfections caused by multiresistant Pseudomonas aeruginosa. Clin. Microbiol.Infect. 11(Suppl. 4):17–32.

27. Sawa, T., M. Ohara, K. Kurahashi, S. S. Twining, D. W. Frank, D. B.Doroques, T. Long, M. A. Gropper, and J. P. Wiener-Kronish. 1998. In vitrocellular toxicity predicts Pseudomonas aeruginosa virulence in lung infec-tions. Infect. Immun. 66:3242–3249.

28. Sharon, N. 2006. Carbohydrates as future anti-adhesion drugs for infectiousdiseases. Biochim. Biophys. Acta 1760:527–537.

29. Sonawane, A., J. Jyot, and R. Ramphal. 2006. Pseudomonas aeruginosa LecBis involved in pilus biogenesis and protease IV activity but not in adhesion torespiratory mucins. Infect. Immun. 74:7035–7039.

30. Reference deleted.

31. Thomas, R., and T. Brooks. 2004. Common oligosaccharide moieties inhibitthe adherence of typical and atypical respiratory pathogens. J. Med. Micro-biol. 53:833–840.

32. Tielker, D., S. Hacker, R. Loris, M. Strathmann, J. Wingender, S. Wilhelm,F. Rosenau, and K. E. Jaeger. 2005. Pseudomonas aeruginosa lectin LecB islocated in the outer membrane and is involved in biofilm formation. Micro-biology 151:1313–1323.

33. von Bismarck, P., R. Schneppenheim, and U. Schumacher. 2001. Successfultreatment of Pseudomonas aeruginosa respiratory tract infection with a sugarsolution—a case report on a lectin based therapeutic principle. Klin. Paedi-atr. 213:285–287.

34. Winzer, K., C. Falconer, N. C. Garber, S. P. Diggle, M. Camara, and P.Williams. 2000. The Pseudomonas aeruginosa lectins PA-IL and PA-IIL arecontrolled by quorum sensing and by RpoS. J. Bacteriol. 182:6401–6411.

35. Wu, A. M., J. H. Wu, T. Singh, J. H. Liu, M. S. Tsai, and N. Gilboa-Garber.2006. Interactions of the fucose-specific Pseudomonas aeruginosa lectin, PA-IIL, with mammalian glycoconjugates bearing polyvalent Lewis (a) and ABHblood group glycotopes. Biochimie 88:1479–1492.

36. Wu, L., C. Holbrook, O. Zaborina, E. Ploplys, F. Rocha, D. Pelham, E.Chang, M. Musch, and J. Alverdy. 2003. Pseudomonas aeruginosa expressesa lethal virulence determinant, the PA-I lectin/adhesin, in the intestinal tractof a stressed host: the role of epithelia cell contact and molecules of thequorum sensing signaling system. Ann. Surg. 238:754–764.

Editor: B. A. McCormick

VOL. 77, 2009 LECTINS AND VIRULENCE 2075

on May 1, 2020 by guest

http://iai.asm.org/

Dow

nloaded from