S

R

MP

a

ARRAA

KTTI

TstTfppi6cgmTtdfveTma

s

v

0d

Virus Research 160 (2011) 435–438

Contents lists available at ScienceDirect

Virus Research

journa l homepage: www.e lsev ier .com/ locate /v i rusres

hort communication

NA2 of TRV SYM breaks the rules for tobravirus genome structure

uhammad Ashfaq1, Wendy McGavin, Stuart A. MacFarlane ∗

lant Pathology Programme, James Hutton Institute, Invergowrie, Dundee DD2 5DA, UK

r t i c l e i n f o

rticle history:eceived 11 May 2011eceived in revised form 7 July 2011ccepted 11 July 2011vailable online 26 July 2011

a b s t r a c t

Currently, all of the RNA2 molecules described for all of the more than thirty sequenced isolates of thethree tobraviruses, Tobacco rattle virus (TRV), Pea early-browning virus (PEBV) and Pepper ringspot virus(PepRSV), have the virus coat protein (CP) gene located in the 5′ proximal position. However, sequencingof the RNA2 of the SYM isolate of TRV revealed that this isolate has a unique genome structure in which thevirus CP gene is located in the central region of RNA2 downstream of three completely novel open reading

eywords:obacco rattle virusRV SYMnfectious clone

frames (ORFN1, ORFN2 and ORFN3). An infectious clone of SYM RNA2 was constructed and mutationswere introduced separately into each of the novel genes to interrupt their translation. However, noneof the mutations resulted in any noticeable change in the ability of TRV RNA1 or RNA2 to replicate andmove systemically in the leaves or roots of infected plants. In addition, individual expression of the novelORFs either from a Potato virus X (PVX) vector or from a binary plasmid in Agrobacterium tumefaciens didnot reveal any potential function.

Tobacco rattle virus (TRV), the type species of the genusobravirus, has an extremely wide host range, including many wildpecies, ornamental plants and crop plants, of which potato ishe most economically important (Harrison and Robinson, 1986).RV is transmitted between plants by root-feeding nematodesrom the genera Trichodorus and Paratrichodorus and, in somelant species, via infected seed. The viral genome comprises two,ositive-sense, single stranded RNAs that are packaged separately

n rod-shaped particles. The larger genomic RNA, RNA1, is about790 nucleotides (nt) in size, depending on the virus isolate, highlyonserved in sequence, and encodes four genes; the 5′ proximalene is translated to produce the 134K protein which containsethyltransferase and RNA helicase domains (MacFarlane, 1999).

ranslational readthrough of the 134K protein stop codon produceshe 194K protein that has an RNA-dependent RNA polymeraseomain in its C-terminal region. These proteins are expected toorm the viral replicase. The third gene encodes the 29K putativeirus movement protein (MP), and the fourth, 3′ proximal genencodes the 16K protein that is a suppressor of RNA silencing. AsRV RNA1 encodes all the proteins involved in virus replication and

ovement, it can cause systemic infection of plants in the complete

bsence of RNA2.

∗ Corresponding author. Tel.: +44 0 844 928 5428; fax: +44 0 844 928 5429.E-mail addresses: mashfaq1642@gmail.com (M. Ashfaq),

tuart.macfarlane@hutton.ac.uk (S.A. MacFarlane).1 Current address: Department of Plant Pathology, PMAS-Arid Agriculture Uni-

ersity, Rawalpindi 46300, Pakistan. Tel.: +92 51 9062627.

168-1702/$ – see front matter © 2011 Elsevier B.V. All rights reserved.oi:10.1016/j.virusres.2011.07.007

© 2011 Elsevier B.V. All rights reserved.

The smaller genomic RNA, RNA2, varies considerably in sizeand sequence depending on the virus isolate, ranging from 1905 ntfor isolate PSG to 3926 nt for isolate PaY4. All RNA2 moleculessequenced to date encode the coat protein (CP) gene in the 5′ prox-imal position, with additional partial or complete genes locateddownstream. These genes may include the putative 9K gene, the2b and 2c genes (known to be involved in nematode transmission),and partial or complete copies of the RNA1-encoded 29K and 16Kprotein genes that are derived by a recombination that replaces the3′ part of RNA2 with 3′ terminal sequences from RNA1.

A number of isolates have been used for studies of TRV biology,with the CAM strain (now recognised as an isolate of Pepper ringspotvirus) and PRN strain being most widely used in the earlier experi-ments (Frost and Harrison, 1967; Miki and Okada, 1970; Robinson,1974). The spinach yellow mottle (SYM) strain of TRV was isolatedin 1979 from spinach plants in the south of England (Bailis andOkonkwo, 1979; Kurppa et al., 1981). This isolate was reported todiffer from three other tested TRV isolates (CAM, PRN and OR) bybeing able to infect systemically Chenopodium amaranticolor andC. quinoa plants. Also, purification of TRV SYM from infected plantsyielded virus particles of four predominant sizes – L (long) particlesof 188 nm length, S (short) particles of 101 nm length and VS (veryshort) particles of 45 and 58 nm length (Kurppa et al., 1981). Thisdiffers from, for example, purified particles of TRV PRN, which are ofonly two predominant lengths 191 nm (L) and 78 nm (S) (Harrisonand Woods, 1966). The two TRY SYM VS particles were later found

to contain two RNAs, of about 1750 and 1550 nt, that were trans-lated in vitro to produce, respectively, the virus CP and a 29,000 kDamolecular weight protein, which is probably the virus MP that isencoded by RNA1 (Robinson et al., 1983). The nucleotide sequence

436 M. Ashfaq et al. / Virus Resear

Fa

owt

vpPapsltetUG

Oladaatotoistif2osPnTmtplwwn

patEutitFA(3(

the SYM ORFN1, ORFN2 and ORFN3 genes were amplified by PCR

ig. 1. Genome diagram of TRV SYM RNA2. Open boxes represent virus ORFs, lengthsre drawn to scale.

f RNA1 of TRV SYM has been determined, the first TRV isolate forhich this was achieved (Hamilton et al., 1987), however, until now

he RNA2 of TRV SYM has not been sequenced and characterised.TRV SYM was obtained as a freeze-dried sample from the SCRI

irus collection and inoculated to Nicotiana clevelandii plants forropagation. Full-length cDNA of SYM RNA2 was amplified by RT-CR from RNA extracted from infected plants using primers 171nd 180 as described before (MacFarlane, 1996), and cloned intoGemT (Promega). Three clones were obtained and two were fullyequenced, revealing TRV SYM RNA2 to be 3898 nt in size, the thirdargest RNA2 reported to date, after TRV PaY4 and PhB1-28. Thewo cDNA clones were 99.79% identical (8 base differences) andach encoded five open reading frames (ORFs) of at least 150 nthat are flanked by translation start (AUG) and stop (UAA, UAG,GA) codons (Fig. 1). The SYM RNA2 sequence was deposited inenBank with the accession number FR854197.

The 5′ proximal ORF, which we have designated ORFN1 (NovelRF 1), is 174 nt in size, begins at the 7th AUG codon which is

ocated at nt 539, extending to nt 712, and encodes a 58 aminocid (aa) protein of calculated molecular weight 6.6 kDa. The pre-icted protein has a hydrophobic N-terminus, that could includetransmembrane domain/signal sequence (as predicted using thenalysis programmes TMpred and SignalP), and a hydrophilic C-erminus. BLAST searches did not identify similar proteins in anyf the sequence databases. ORFN2 extends from nucleotides 819o 1631, encoding a protein of 271 aa (29.9 kDa). ORFN3 partiallyverlaps ORFN2, extending from nucleotides1520 to 2071, encod-ng a protein of 184 aa (20.7 kDa). BLAST searches and protein motifearches (InterProScan suite, http://www.ebi.ac.uk/) did not iden-ify similarities to any other proteins in the sequence databases ordentify any putative functional domains within predicted proteinsrom these ORFs. The fourth ORF extends from nucleotides 2232 to876, encoding the virus CP (215 aa, 24 kDa). The greatest homol-gy was found between the SYM and TRV S19 CPs (89% amino acidequence identity), and 88% identity with the CPs of TRV isolatesSG, PpK20 and PepRSV isolate CAM. The fifth ORF extends fromucleotides 3013 to 3420, encoding a protein of 136 aa (15.8 kDa).his predicted protein has limited identity (34%, with gaps added toaximise alignment) to the N-terminal c. 150 aa of the 2b (nema-

ode transmission) protein of TRV strain OR2. Compared to 2broteins from other TRV strains, the SYM 2b protein is truncated,

acking the C-terminal half of the protein. RT-PCR amplificationith gene-specific primers of RNA extracted from plants infectedith uncloned TRV SYM confirmed the presence and location of theovel ORFs in this virus.

The sequenced clones of TRV SYM RNA2 include a T7 RNAolymerase promoter at the 5′ end, and a SmaI restriction sitet the 3′ end, and can be used as a template for the produc-ion of infectious transcripts (using Ambion MEGAscript T7 andpicentre Biotechnologies ScriptCap kits according to the man-facturers’ instructions). To examine the possible functions ofhe novel ORFs, early stop mutations were introduced separatelynto the ORFN1 and ORFN3 open reading frames (ORFs) usinghe QuikChange Site-Directed Mutagenesis Kit (Stratagene).or ORFN1, forward primer 1447 (5′ GATATCGGTACTCTCTT-CCCTAGGTGTTTAAGATTATGAATGG 3′) and reverse primer 1448

5′CCATTCATAATCTTAAACACCTAGGGTAAGAGAGTACCGATATC′) were used to insert a translation stop codonbold) and diagnostic AvrII site (underlined) into

ch 160 (2011) 435–438

the gene. For ORFN3, forward primer 1449 (5′

CAAACTTCCTCCACTCAGGAAGCTAGCCTGATACTTTTCTTATGTTCG-TG3′) and reverse primer 1450 (5′CACGAACATAAGAAAAGTATCAGGCTAGCTTCCTGAGTGGAGGAAGTTTG3′) were used to insert atranslation stop codon (bold) and diagnostic NheI site (underlined)into the gene. The entire full-length clone of SYM RNA2 was re-sequenced after the I-PCR treatments to ensure that no additionalmutations had been introduced into either of the molecules. Twodifferent frame-shift mutations were introduced into ORFN2 bythe digestion of the full-length clone with either XbaI (position983) or EcoRI (position 1065), followed by blunting with Klenowpolymerase and re-ligation of the molecule. These mutations werelocated towards the 5′ end of ORFN2, upstream of the region whereORFN2 overlaps ORFN3. A similar mutation was introduced intothe truncated 2b ORF by digestion, blunting and religation at aunique BamHI site (position 3087). Transcripts were producedfrom each of the mutated SYM RNA2 cDNA clones as described forthe un-mutated clone (above).

TRV SYM RNA1 was obtained by inoculating C. amaranticolorplants with highly diluted water extracts from virus-infected N.clevelandii plants, so that only a few, well separated necrotic lesionsdeveloped on each inoculated leaf. Some of these lesions containedonly RNA1 and were used to infect further N. clevelandii plants.Subsequently, total plant RNA, containing TRV RNA1, was isolatedfrom these infected plants, collected by ethanol precipitation andstored at −20 ◦C for later use. This material can be used as a sourceof “pure” TRV RNA1, containing no contaminating TRV RNA2.

About 10 �g of total plant RNA containing TRV RNA1 and 4 �gof RNA2 transcript were mixed and manually inoculated ontotwo carborundum-dusted leaves of small N. benthamiana plants.In some infection experiments, transcript-inoculated plants wereanalysed for virus replication and spread. In other experiments,transcript-inoculated leaves were homogenised in tap water atseven days post inoculation (dpi), the extracts were stored frozenat −20 ◦C, and used subsequently as a source of virus inoculum.RNA was isolated from inoculated (I) leaves, upper, non-inoculated(systemically infected, S) leaves, and roots (R) at 7 dpi, 14 dpi and14 dpi, respectively, using TRI-Reagent, according to the supplier’sinstructions (Ambion). About 5 �g of each RNA was analysed bynorthern blotting as described before (Liu et al., 2002), using alka-line phosphatase-labelled (AlkPhos, GE Healthcare) TRV-specificcomplementary-strand RNA probes. For RNA1 the probe was c.1.5 kb covering the MP gene, 16K gene and 3′ untranslated (UTR)region. For SYM RNA2 the probe was c. 1 kb covering the trun-cated 2b gene and 3′ UTR. These probes would be able to detectall genomic and subgenomic RNAs produced by the virus.

These experiments showed that co-inoculation of TRV SYMRNA1 and RNA2 resulted in a systemic infection in N. benthami-ana plants, and that mutation of the novel ORFs in RNA2 did notimpair accumulation or spread of TRV (Fig. 2A and B). The stabilityof the introduced mutations during virus infection was confirmedby restriction digestion of RT-PCR fragments amplified from the siteof each mutation. ORFN1 and ORFN3 mutants carried new restric-tion sites (AvrII and NheI, respectively), and ORFN2 mutants lackedeither XbaI or EcoRI sites.

Other studies have shown that expression of virus pathogenic-ity proteins from a PVX vector may result in increased symptomseverity of the recombinant PVX (Liu et al., 2002). In related exper-iments, transient expression of some virus pathogenicity proteinsusing Agrobacterium tumefaciens has been used to demonstrate RNAsilencing suppression activity (Thomas et al., 2003). For cloninginto the PVX expression vector, P3C2S(402) (Chapman et al., 1992),

to introduce flanking EagI and NsiI restriction sites. The recom-binant PVX clones were linearised at the virus 3′ terminus bydigestion with SpeI, and capped T7 RNA polymerase transcripts

M. Ashfaq et al. / Virus Researc

Fig. 2. Northern blots of TRV SYM RNAs detected in infected N. benthamiana RNAsamples. Panel A. Leaf samples. I is inoculated leaf, S is systemically infected leaf.Panel B. Root samples. Arrows show position of genomic RNA1 and RNA2, and CPswi

wNRpdRardm

icaCsgrSsT

FoO

gRNA 2a. Samples are in sets of 3 plants inoculated with RNA1 and transcript ofild type (WT) or mutated RNA2. rRNA shows 28S and 18S ribosomal RNAs present

n each sample, stained with ethidium bromide. H is uninoculated plant.

ere prepared as described above. Transcripts were inoculated to. benthamiana plants, symptom expression was examined andNA samples were isolated for Northern blotting, using a com-lementary strand RNA probe labelled using the AlkPhos kit (asescribed above). However, in experiments, none of the novel SYMNA2 genes caused any reproducible effect on the accumulationnd spread (Fig. 3), or symptom production (data not shown) ofecombinant PVX. Similarly, no silencing suppression activity wasetected for any of the TRV SYM ORFs using standard A. tumefaciens-ediated patch infiltration assays (Johansen and Carrington, 2001).Although the CP gene is 5′ proximal in RNA2 of all tobravirus

solates except for TRV SYM, the gene is preceded by a long non-oding region of about 500–700 bases. The non-coding region (NCR)lways contains multiple (5 or more) AUG codons, upstream of theP AUG codon, that could potentially direct expression of numerousmall peptides. This region inhibits translation of the CP gene fromenomic RNA2 in vitro (Mueller et al., 1997) and probably plays aole in the regulation of CP gene expression during virus infection.

imilarly, TRV SYM RNA2 contains 6 AUG codons upstream of thetart codon of ORFN1, encoding potential peptides of 27 aa or less.o circumvent the inhibitory sequences in the 5′ NCR, the tobravirus

ig. 3. Northern blot of PVX carrying the TRV SYM ORFs detected in systemic leavesf N. benthamiana plants. ORFN1-stop is PVX carrying the early stop mutant of SYMRFN1.

h 160 (2011) 435–438 437

CP is translated not from the genomic RNA2 (as is the case for the 5′

proximal gene of all other viruses) but from a subgenomic (sg)RNAthat is transcribed from a promoter located downstream from theinhibitory AUG codons. Because the TRV SYM CP gene is locatedmore than 2 kb downstream of the 5′ terminus of RNA2, it producesa sgRNA that is less than half the size of the genomic RNA2. ThissgRNA is clearly visible in the northern blots (Fig. 2A and B), andis encapsidated to form the characteristic VS particles that weredescribed in earlier papers (Robinson et al., 1983).

Several tobravirus CP sgRNAs have been cloned and sequenced(Cornelissen et al., 1986; Wallis, 1992), showing that they initiatewith the first A residue that is present in a GCAUA motif that isimmediately preceded by a stem-loop structure. A mutation studyof the PEBV CP sgRNA promoter showed that the stem structurebut not its sequence were important for CP expression (Mooney,1998). For the TRV SYM CP gene the GCAUA motif is present atnucleotides 2120–2124, and is preceded by a partial inverted repeatsequence that could form a stem loop structure. Interestingly, thenovel, 5′ proximal, ORFN1 is also preceded by a partial invertedrepeat sequence and GCAUA motif (nucleotides 474–478) suggest-ing that it could be expressed in the same manner as the CP gene.The northern blots (Fig. 2A) show an RNA that runs slightly fasterthan genomic RNA2, and this is possibly the sgRNA for ORFN1. Ingeneral the other RNA2-encoded genes of tobraviruses do not havethe same, clearly identifiable promoter and their sgRNAs have notbeen cloned and sequenced. Likewise, the novel ORFs 2 and 3 do nothave an obvious subgenomic promoter, and their potential modeof expression is not clear.

The TRV SYM RNA2 is unique in encoding three, novel ORFsupstream of the CP gene, adding further variation to the alreadyhighly variable structure of TRV RNA2. Neither sequence analysisnor our experiments in planta have revealed any functions for thesenew genes and further work is required to answer this question.

Acknowledgements

The JHI is grant-aided by the Scottish Government. MA wasfunded by the Pakistan Higher Education Commission (HEC). Wethank Dr. Maud Swanson and Tanja Lemmermeyer for assistancewith this work.

References

Bailis, K.W., Okonkwo, V.N., 1979. Virus infection of spinach (Spinacia oleracea L.) inBritain. Journal of Horticultural Science 54, 289–297.

Chapman, S., Kavanagh, T.A., Baulcombe, D.C., 1992. Potato virus X as a vector forgene expression in plants. Plant Journal 2, 549–557.

Cornelissen, B.J.C., Linthorst, H.J.M., Brederode, F.T., Bol, J.F., 1986. Analysis of thegenome structure of tobacco rattle virus strain PSG. Nucleic Acids Research 14,2157–2169.

Frost, R.R., Harrison, B.D., 1967. Comparative effects of temperature on the multipli-cation in tobacco leaves of two tobacco rattle viruses. Journal of General Virology1, 455–464.

Hamilton, W.D.O., Boccara, M., Robinson, D.J., Baulcombe, D.C., 1987. The completenucleotide sequence of tobacco rattle virus RNA-1. Journal of General Virology68, 2563–2575.

Harrison, B.D., Woods, R.D., 1966. Serotypes and particle dimensions of tobacco rattleviruses from Europe and America. Virology 28, 610–620.

Harrison, B.D., Robinson, D.J., 1986. Tobraviruses. In: van Regenmortel, M.H.V.,Fraenkel-Conrat, H (Eds.), The Plant Viruses, vol. 2. Plenum Press, New York,pp. 339–369.

Johansen, L.K., Carrington, J.C., 2001. Silencing on the spot. Induction and suppres-sion of RNA silencing in the Agrobacterium-mediated transient silencing system.Plant Physiology 126, 930–938.

Kurppa, A., Jones, A.T., Harrison, B.D., Bailiss, K.W., 1981. Properties of spinach yellowmottle, a distinctive strain of tobacco rattle virus. Annals of Applied Biology 98,243–254.

Liu, H., Reavy, B., Swanson, M., MacFarlane, S.A., 2002. Functional replacement ofthe tobacco rattle virus cysteine-rich protein by pathogenicity proteins fromunrelated plant viruses. Virology 298, 232–239.

MacFarlane, S.A., 1996. Rapid cloning of uncharacterised tobacco rattle virus isolatesusing long template (LT) PCR. Journal of Virological Methods 56, 91–98.

4 esear

M

M

M

M

38 M. Ashfaq et al. / Virus R

acFarlane, S.A., 1999. The molecular biology of the tobraviruses. Journal of GeneralVirology 80, 2799–2807.

iki, T., Okada, Y., 1970. Comparative studies on some strains of tobacco rattle virus.Virology 42, 993–998.

ooney, A.L., 1998. Investigation of the role of PEBV RNA2 5′ noncoding sequencesin RNA replication and protein expression. Ph.D. Thesis, University of Dundee,

UK.

ueller, A.-M., Mooney, A.L., MacFarlane, S.A., 1997. Replication of in vitro tobravirusrecombinants shows that the specificity of template recognition is determinedby 5′ non-coding but not 3′ non-coding sequences. Journal of General Virology78, 2085–2088.

ch 160 (2011) 435–438

Robinson, D.J., 1974. Early events in local infection of Chenopodium amaranticolorleaves by mutant and wild-type strains of tobacco rattle virus. Journal of GeneralVirology 24, 391–394.

Robinson, D.J., Mayo, M.A., Fritsch, C., Jones, A.T., Raschké, J.H., 1983. Origin andmessenger activity of two small RNA species found in particles of tobacco rattlevirus strain SYM. Journal of General Virology 64, 1591–1599.

Thomas, C.L., Leh, V., Lederer, C., Maule, A.J., 2003. Turnip crinkle virus coat proteinmediates suppression of RNA silencing in Nicotiana benthamiana. Virology 306,33–41.

Wallis, C.V., 1992. The molecular biology of pea early browning virus RNA2. Ph.D.Thesis, University of Birmingham, UK.