Rir 10th june_2011_v2

Institut thématique Microbiologie et

Maladies infectieuses

3RD INTERNATIONAL RESEARCH MEETING MICROBIOLOGY & INFECTIOUS DISEASES - HÔTEL MARIGNY,

PARIS, JUNE 10TH, 2011



Laurent Abel and Jean-Laurent Casanova ................................................................................................................................1,2

Matthew Albert.............................................................................................................................................................................7

Matthieu Allez ............................................................................................................................................................................11

Brigitte Autran. ...........................................................................................................................................................................15

Thomas Baumert .......................................................................................................................................................................21

Monsef Benkirane......................................................................................................................................................................25

Nicolas Blanchard......................................................................................................................................................................29

Stéphanie Blandin......................................................................................................................................................................33

Matteo Bonazzi ..........................................................................................................................................................................37

Priscille Brodin ...........................................................................................................................................................................41

Bruno Canard ............................................................................................................................................................................45

Béhazine Combadière................................................................................................................................................................49

François-Loïc Cosset. ................................................................................................................................................................53

François Dabis...........................................................................................................................................................................57

Guillaume Duménil.....................................................................................................................................................................61

Gérard Eberl ..............................................................................................................................................................................65

Hidehiro Fukuyama....................................................................................................................................................................69

Benoit Gamain ...........................................................................................................................................................................73

Yves Gaudin ..............................................................................................................................................................................77

Ivo Gomperts Boneca ................................................................................................................................................................81

Laurent Gutmann.......................................................................................................................................................................85

David Klatzmann........................................................................................................................................................................87

Marc Lecuit ................................................................................................................................................................................91

Eric Leroy ..................................................................................................................................................................................95

Elena Levashina ........................................................................................................................................................................99

Yves Lévy ................................................................................................................................................................................103

Camille Locht ...........................................................................................................................................................................105

Nicolas Manel ..........................................................................................................................................................................109

Robert Ménard.........................................................................................................................................................................113

Tâm Mignot..............................................................................................................................................................................117

Hannu Myllykallio.....................................................................................................................................................................121

Xavier Nassif............................................................................................................................................................................125

Patrice Nordmann....................................................................................................................................................................129

Eric Oswald .............................................................................................................................................................................133

Jean-Michel Pawlotsky.............................................................................................................................................................135

Carole Peyssonnaux................................................................................................................................................................139

Eliane Piaggio..........................................................................................................................................................................143

Marie-Cécile Ploy.....................................................................................................................................................................147

Lluis Quintana-Murci ................................................................................................................................................................151

Didier Raoult ............................................................................................................................................................................155

Jean-Marc Reichhart................................................................................................................................................................157

Felix Rey..................................................................................................................................................................................161

Human Rezaei .........................................................................................................................................................................165

Carla Saleh..............................................................................................................................................................................169

Philippe Sansonetti ..................................................................................................................................................................173

Olivier Schwartz.......................................................................................................................................................................177

Maria-Isabel Thoulouze............................................................................................................................................................181

Eric Vivier - Sophie Ugolini.......................................................................................................................................................185

Contacts of participants............................................................................................................................................................190



Selected publications:

• Germline CYBB mutations that selectively affect macrophages in kindreds with X-linked predisposition to tuberculous mycobacterial disease. Bustamante, J., A.A. Arias, G. Vogt, 24 co-authors, M.C. Dinauer, L. Abel, and J.L. Casanova. Nat Immunol: 2011 Mar; 12(3):213-21.

• Interferon gamma receptor 2 gene variants are associated with liver fibrosis in patients with chronic hepatitis C infection. Nalpas, B., R. Lavialle-Meziani, S. Plancoulaine, 15 co-authors, F. Matsuda, S. Pol, and L. Abel. Gut. 2010;59:1120-1126.

• Two loci control tuberculin skin test reactivity in an area hyperendemic for tuberculosis. Cobat, A., C.J. Gallant, L. Simkin, G.F. Black, K. Stanley, J. Hughes, T.M. Doherty, W.A. Hanekom, B. Eley, J.P. Jais, A. Boland-Auge, P. van Helden, J.L. Casanova, L. Abel, E.G. Hoal, E. Schurr, and A. Alcais. J Exp Med. 2009; 206:2583-2591.

• Stepwise replication identifies a low-producing lymphotoxin-alpha allele as a major risk factor for early-onset leprosy. Alcais, A., A. Alter, G. Antoni, M. Orlova, N. Van Thuc, M. Singh, P.R. Vanderborght, K. Katoch, M.T. Mira, V.H. Thai, N.T. Huong, N.N. Ba, M. Moraes, N. Mehra, E. Schurr, and L. Abel. Nat Genet. 2007; 39:517-522.

• Primary immunodeficiencies: a field in its infancy. Casanova, J.L., and L. Abel. Science. 2007;317:617-619.

• Human genetics of infectious diseases: a unified theory. J.L. Casanova and L. Abel. Embo J. 2007;26:915-922.

• An autosomal dominant major gene confers predisposition to pulmonary tuberculosis in adults. Baghdadi, J.E., M. Orlova, A. Alter, B. Ranque, M. Chentoufi, F. Lazrak, M.I. Archane, J.L. Casanova, A. Benslimane, E. Schurr, and L. Abel. J Exp Med. 2006; 203:1679-1684.

Keywords

• Complex genetic predisposition

• Infectious diseases

• Leprosy

• Tuberculosis

• Human Herpes virus 8 (HHV-8 )

• Human T-lymphotropic vi rus 1 (HTLV-1)

• Hepatitis C Virus (HCV)

• Human gene tics

• Genetic Epidemiology

Major Grants (managed by Inserm France) :

• ANRS “Genome-wide association of HCV related phenotypes”

• ANR “Genetic predisposition to pulmonary tuberculosis”

• NIH 1 U01 AI088685 “Genetic predisposition to tuberculosis in Morocco”

• European Community “Host and Mycobacterial molecular dissection of immunity and pathogenesis of tuberculosis”

• European Community “Spontaneous clearance in patients acutely infected with HCV”

• ERC advanced grants “Human genetics of tuberculosis”

Inserm U980 –Paris Descartes University - Necker Medical School Paris

The Rockefeller University New York

Human genetics of infectious diseases

There are many lines of evidence suggesting that the characteristics of an infectious disease in humans depend l argely on the genetic background of the individual exposed to the specific microbe.

The infectious agent is, of course, necessary, but is generally not sufficient for the development of an infection or the clinical symptoms. The two teams of our laboratory of human genetics of infectious diseases directed by L. Abel and J.L. Casanova, respectively, work together to address the question of genetic susceptibility to rare and common infections, from the perspectives of both complex and single-gene determinism predisposition, to achieve a unified genetic theory of human infectious diseases.

In the past decade, our team has gained leading international expertise in this field of human genetics of common infectious diseases, by identifying several genes associated with susceptibility to leprosy, tuberculosis and predisposition to infection by several oncogenic viruses. Our successful achievements led the Inserm and the Rockefeller University to create an International laboratory of Human genetics of infectious diseases with a Necker branch in Paris and a Rockefeller branch in New-York.

Laurent Abel, M.D, Ph.D

Within the laboratory, our team aims to identify the main genes involved in the determinism of common infectious diseases, mostly in adults. Our studies of infectious diseases focus on infections due to virulent mycobacteria (leprosy and tuberculosis (TB)) and certain oncogenic viruses. The main results obtained during the last years include:

1) Identification by positional cloning of major leprosy susceptibility variants of the PARK2/PACRG and LTA genes, defining new pathophysiological pathways;

2) Mapping of the first major locus conferring predisposition to pulmonary TB, and of the two first major loci controlling TB infection;

3) Identification of the first Medelian cases of severe TB in children;

4) Dissection of intra-familial transmission of HHV-8 (responsible for Kaposi’s sarcoma) in endemic populations, with the detection and mapping of a major gene predisposing to infection by this virus;

5) Demonstration that current Hepatitis C virus (HCV) infection has a strong familial component explained by both specific modes of intra-familial viral transmission and by genetic predisposition to infection;

6) Mapping of two loci conferring predisposition to HTLV-1 infection in childhood.

We will continue our work to further dissect these infections, using the precise identification of the loci we have detected and the initiation of new studies focusing on new phenotypes, and on the severe clinical diseases resulting from these infections. This latter aspect is done with the other team of the unit in order to investigate the Mendelian genetic control of the most extreme forms of these infections (e.g. severe TB, Kaposi’s sarcoma, fulminant hepatitis, herpes simplex encephalitis). This research takes advantage of the recent advances in high-throughput genotyping (we are conducting genome-wide association studies in TB, leprosy, and HCV-related phenotypes) and sequencing (we will search for the role of rare variants in these common infectious diseases). The identification of host genes involved in human infectious diseases will provide new keys to understanding the pathogenesis mechanisms underlying disease development, with potentially major practical implications for the control of infectious diseases.

1



Keywords

• Primary immuno deficiencies


• Herpes simplex encephalitis (HSE)

• Mendelian susc eptibility to mycobacterial disease (MSMD)

• Invasive pneu mococcal disease (IPD)

• Chronic muco cutaneous candidiasis

• Human genetics

• Immunology

Human genetics of infectious diseases

There are many lines of evidence suggesting that the characteristics of an infectious disease in humans depend largely on the genetic background of the individual exposed to the specific microbe.

The infectious agent is, of course, necessary, but is generally not sufficient for the development of an infection or the clinical symptoms. The two teams of our laboratory of human genetics of infectious diseases directed by J.L. Casanova and L. Abel, respectively, work together to address the question of genetic susceptibility to rare and common infections, from the perspectives of both single-gene determinism and complex predisposition, to achieve a unified genetic theory of human infectious diseases.

In the past decade, our team has gained international expertise in this field of human genetics of infectious diseases, by revealing that single genetic lesions in children confer severe and selective vulnerability to certain illnesses, including herpes simplex encephalitis, mycobacterial diseases, and invasive pneumococcal diseases. Our successful achievements led the Inserm and the Rockefeller University to create an International laboratory of Human genetics of infectious diseases with a Necker branch in Paris and a Rockefeller branch in New-York.

Jean-Laurent Casanova, M.D, Ph.D

Our team aims to test the hypothesis that life-threatening infectious diseases in children result from single-gene inborn errors of immunity. We hypothesize that a substantial fraction children with severe infectious diseases suffer from novel primary immunodeficiencies, resulting in a specific susceptibility to one or a few microorganisms. During the last years, we have largely validated this hypothesis with the discovery of the molecular genetic basis of : 1) The syndrome of Mendelian predisposition to mycobacterial disease (MSMD) due to mutations in IFNGR1, IFNGR2, STAT1, IL12B, IL12RB1, NEMO, CYBB and IRF8 (IL-12-IFN-γ circuit); 2) Invasive pneumococcal disease (IPD) due to mutations NEMO, IKBA, IRAK4, MYD88 (NF-kB-dependent TLR and IL-1R pathways); and 3) Herpes simplex encephalitis (HSE) due to mutations in the UNC93B1, TLR3, and TRAF3 (TLR3 pathway).

Using our golden standard complementary approaches, namely candidate gene dissection (hypothesis-based) or genome-wide dissection (hypothesis-free) we have pursued our investigation of these three diseases. Recently, we have discovered mutations in IL17A and IL17F, the first two genetic etiologies of chronic mucocutaneous candidiasis. We have also pioneered whole-exome deep sequencing strategies which, combined with genome-wide linkage have lead to uncovering a mutation in STIM1, responsible for development of lethal Kaposi sarcoma, as well as a mutation in FADD which is, in part, responsible for auto-immune lymphoproliferative syndrome (ALPS).

By combining our standard approaches with novel cutting-edge evolving techniques, our studies over the next years will not merely pursue the lines of research followed over the previous years — they will also explore uncharted territories. We intend to demonstrate not only that MSMD, IPD and HSE result from single-gene variations in most children, but also that other pediatric infectious diseases may as a rule result from single-gene inborn errors of immunity. Our single-gene theory of life-threatening pediatric infectious diseases will have many profound medical and biological implications.

Selected publications :

• Chronic mucocutaneous candidiasis in humans with inborn errors of interleukin-17 immunity. Puel A, Cypowyj S, Bustamante J, Wright J, Liu L, Lim HK, Migaud M, Israel L, Chrabieh M, Toulon A, El-Baghdadi J, Bodemer C, Whitters M, Paradis T, Brooks J, Collins M, Wolfman NM, Al-Muhsen S, Galicchio M, Abel L, Picard C, Casanova JL. Science. 2011 Feb 24.

• Germline but macrophage-tropic CYBB mutations in kindreds with X-linked predisposition to tuberculous mycobacterial diseases. Bustamante J, Arias AA, Vogt G, 24 co-authors, Dinauer MC, Abel L, Casanova JL. Nature Immunology. 2011 Mar;12(3):213-21.

• Human TLRs and IL-1Rs in host defense: natural insights from evolutionary, epidemiological, and clinical genetics. Casanova JL, Abel L, Quintana-Murci L. Annu Rev Immunol. 2011, in press.

• Human TRAF3 Adaptor Molecule Deficiency Leads to Impaired Toll-like Receptor 3 Response and Susceptibility to Herpes Simplex Encephalitis. Pérez de Diego R, Sancho-Shimizu V, Lorenzo L, 17 co-authors. Jouanguy E, Zhang SY, Abel L, Casanova JL. Immunity. 2010 Sep 24;33(3):400-1.

• Pyogenic bacterial infections in humans with MyD88 deficiency. Von Bernuth H, Picard C, Jin Z, 30 co-authors. Abel L, Li X, Chaussabel D, Puel A, Casanova JL. Science. 2008 Aug 1;321(5889):691-6.

• TLR3 deficiency in otherwise healthy children with herpes simplex encephalitis. Zhang, SY, Jouanguy E, Ugolini S, Smahi A, Elain G, Segal D, Sancho-Shimizu V, Lorenzo L, Puel A, Picard C, Chapgier A, Plancoulaine S, Titeux M, Cognet M, von Bernuth H, Ku CL, Casrouge A, Zhang XX, Barreiro L, Hamilton C, Lebon P, Héron B, Vallée L, Quintana-Murci L, Hovnanian A, Rozenberg F, Vivier E, Geissmann F, Tardieu M, Abel L and Casanova JL. Science. 2007; 317:1522-7.

• Herpes simplex virus encephalitis in human UNC-93B deficiency. Casrouge A, Zhang SY, Eidenschenk C, Jouanguy E, Puel A, Yang K, Alcais A, Picard C, Mahfoufi N, Nicolas N, Lorenzo L, Plancoulaine S, Senechal B, Geissmann F, Tabeta K, Hoebe K, Du X, Miller RL, Heron B, Mignot C, de Villemeur TB, Lebon P, Dulac O, Rozenberg F, Beutler B, Tardieu M, Abel L, Casanova JL. Science. 2006; 314:308-12.

Inserm U980 - Paris Descartes University - Necker Medical School Paris

The Rockefeller University New York

Major Grants (managed by Inserm France) :

• March of Dimes “Herpes simplex encephalitis: a novel group of primary immunodeficiencies”

• ANR “Herpes simplex encephalitis: a novel group of primary immunodeficiencies”

2

Institut ThématiqueMicrobiologie etMaladies Infectieuses


and Jean-Laurent Casanova, M.D, Ph.D

Human Genetics of Infectious Diseases

� Objectives:

• Why do some exposed individuals (and not others) develop infectious diseases

• What are the critical immunological pathways in natural conditions of infection?

Immunityto infection

Microbialfactors

Exposure toMicrobe

BiologicalPhenotypes

ClinicalPhenotypes

Non microbialfactors

Non geneticfactors

Geneticfactors

Environment

Host

SampleSample

ToolsTools

PhenotypePhenotype

LargeLargeSmallSmall

Genetic EpidemiologyGenetic EpidemiologyMendelianMendelian Genetics Genetics

Milder/chronicMilder/chronic(adults)(adults)

Severe/acuteSevere/acute(children)(children)

Methods of investigation in humans

Rare mutationsStrong individual effect

Common polymorphismsModest individual effect

� Tools:Using the very last genomic technology advances:

- High throughput genotyping (Genome-wide association studies)

- Deep sequencing (Exome/Genome)

3





Mendelian genetics

Disseminated mycobacterial infections

Impaired production of or response to IFN- γγγγ

Chronic Mucocutaneous Candidiasis

IL12Rββββ1

IFNγγγγR1

IL12p40

IFNγγγγR2STAT1

NEMO

Impaired IL-17 immunity

C. albicans

STAT-3IKK

IL-17AIL-17F

IL-17RAIL-17RA

Impairment of TIR signaling pathway

Mendelian genetics

4





• Extending Mendelian studies to other extreme infectious phenotypes

(eg fulminant hepatitis, severe Flu…).

• Searching for rare variants with stronger effect in common infectious diseases (egTuberculosis, HCV-related phenotypes).

• Extensive use of deep sequencing techniques to achieve these goals

• Using iPS technology for functional studies in specific cells/tissues (eg CNS cells).

Perspectives

Complex predisposition: main studies

DISEASEDISEASE(clinical ph enotypes)(clinical phenotyp es)

INFECTIONINFECTION(biological phenotypes)(biological phenot ypes)

EXPOSUREEXPOSURE

M. leprae Mitsuda reaction Leprosy, subtypes,reversal reactions

M. tuberculosis TST, IGRAs Pulmonary TB,Disseminated TB

HCV serology, RNA Liver fibrosis, Fulminant hepatitis

HHV-8 serology Kaposi sarcoma

5





• Pioneer and leader in the identification of new primary immuno-deficiencies predisposing

selectively to a given microbe

• Unique strong expertise in human genetics of infectious diseases by the synergic

association of genetic immunology and genetic epidemiology teams.

• Define a new frontier in infectious diseases

1. Understanding of the pathogenesis, in immunological and genetic terms.

2. Molecular diagnosis of predisposed individuals, genetic counseling of affected kindreds.

3. Definition of the clinical outcome, in terms of morbidity and mortality.

4. Novel treatment to restore immunity (cytokines, etc.), or to circumvent inborn errors

(vaccines, etc.).

Unique selling points

6



Keywords

• Hepatitis C

• Chikyngunya infection

• BCG & Bladder Cancer

• Dendritic cells

• Type I Interferon

Major Grants

• EURYI (2004)

• ERC – Young Investigators (2008)

• FP7 – Acute HCV Biomarker Discovery (2009)

• ANR – CHIKV infection and Host response (2007, 2010)

• ANRS – HCV disease pathogenesis (2004 - present)

• Ligue Labelled Research Unit (2005 - present)

Host response to infection, Hepatitis C

Our laboratory is interested in defining the role of host immunity in disease pathogenesis with a specific concern for how dying cells influence the establishment of anti-viral responses

Matthew Albert, M.D, Ph.D

Our group’s basic science and clinical research goals are to investigate the cellular and molecular mechanisms underlying the different immunologic outcomes of antigen cross-presentation - cross-priming versus cross-tolerization.

These pathways impact many homeostatic and pathological processes. Specifically the lab focuses on questions of viral and tumour immunity. We aim to identify key points of regulation involved in activating cytolytic T lymphocytes (CTLs) as well as key points of dysregulation where viral and tumor proteins interfere with the generation of specific immunity. Our recent studies in HCV pathogenesis have revealed a surprising and new mechanism implicated in limiting immune-mediated viral clearance.

Specifically, we have demonstrated that as a result of chronic inflammation, a host protease is upregulated, resulting in the rapid NH2-terminal truncation of a key chemokine called interferon-induced protein 10 (IP-10). As a result of this cleavage event, IP-10 is converted from an agonist into an antagonist, resulting in the perturbation of lymphocyte trafficking. These studies, performed in close collaboration with clinical partners within the Ile-de-France region (led by Pr. Stanislas Pol), have provided new diagnostic tools for predicting response to therapy and established a new therapeutic target for enhancing anti-viral immunity.

Institut Pasteur Paris - Inserm U818 Paris


• Evidence for an antagonist form of the chemokine CXCL10 in patients chronically infected with HCV. Casrouge A, Decalf J, Ahloulay M, Lababidi C, Mansour H, Vallet-Pichard A, Mallet V, Mottez E, Mapes J, Fontanet A, Pol S, Albert ML. Journal of Clinical Investigation. 2011 Jan 4;121(1):308-17.

• Circulating plasmacytoid dendritic cells in acutely infected patients with hepatitis C virus genotype 4 are normal in number and phenotype. Mansour H, Laird ME, Saleh R, Casrouge A, Eldin NS, El Kafrawy S, Hamdy M, Decalf J, Rosenberg BR, Fontanet A, Abdel-Hamid M, Mohamed MK, Albert ML, Rafik M. J Infect Dis. 2010 Dec 1;202(11):1671-5.

• Visualizing the functional diversification of CD8+ T cell responses in lymph nodes. Beuneu H, Lemaître F, Deguine J, Moreau HD, Bouvier I, Garcia Z, Albert ML, Bousso P. Immunity. 2010 Sep 24;33(3):412-23.

• Harnessing naturally occurring tumor immunity: a clinical vaccine trial in prostate cancer. Frank MO, Kaufman J, Tian S, Suárez-Fariñas M, Parveen S, Blachère NE, Morris MJ, Slovin S, Scher HI, Albert ML, Darnell RB. PLoS One. 2010 Sep 1;5(9).

• Biology and pathogenesis of chikungunya virus. Schwartz O, Albert ML. Nat Rev Microbiol. 2010 Jul;8(7):491-500.

• Enumeration of human antigen-specific naive CD8+ T cells reveals conserved precursor frequencies. Alanio C, Lemaitre F, Law HK, Hasan M, Albert ML. Blood. 2010 May 6;115(18):3718-25.

• Signal 0 for guided priming of CTLs: NKT cells do it too. Bousso P, Albert ML. Nat Immunol. 2010 Apr;11(4):284-6.

• Type I IFN controls chikungunya virus via its action on nonhematopoietic cells. Clémentine Schilte*, Thérèse Couderc*, Fabrice Chretien, Marion Sourisseau, Anton Kraxner, Florence Guivel-Benhassine, Alain Michault, Fernando Arenzana-Seisdedos, Marco Colonna, Olivier Schwartz, Marc Lecuit and Matthew L. Albert. Journal of Experimental Medicine. 2010 Feb 15;207(2):429-42.

• Autophagy within the antigen donor cell facilitates efficient antigen cross-priming. Martin Uhl*, Oliver Kepp*, Hélène Jusforgues-Saklani, Jose-Miguel Vicencio, Guido Kroemer and Matthew L. Albert. Cell Death & Differentiation. 2009;16(7):991-1005.

• A mouse model for Chikungunya infection: young age and inefficient type-I interferon signaling are risk factors for severe disease. Thérèse Couderc, Fabrice Chrétien, Clémentine Schilte, Olivier Disson, Pierre Roques, Madly Brigitte, Florence Guivel-Benhassine, Michel Huerre, Yasmina Touret, Isabelle Shuffenecker, Philippe Desprès, Fernando Arenzana-Seisdedos, Alain Michault, Matthew L. Albert and Marc Lecuit. Plos Pathogen. 2008;4:2:e29.

• Plasmacytoid dendritic cells initiate a complex chemokine and cytokine network and are a viable drug target in chronic HCV patients. Jérémie Decalf, Sandrine Fernandes, Randy Longman, Mina Alhoulay, Françoise Audat, François Lefrerre, Charles M. Rice, Stanislas Pol and Matthew L. Albert. The Journal of Experimental Medicine. 2007;204:1395-403.

• Dendritic cell maturation alters intracellular signaling networks enabling differential effects of type I IFNs on antigen cross-presentation. Randy S. Longman, Sandra Pelegrini, Charles M. Rice, Robert B. Darnell and Matthew L. Albert. Blood. 2007;109:1113-22.

7


The paradoxical role of type I interferons in hepatitis C disease pathogenesis and treatment

Clinical Investigation Fundamental Human Immunobiology

Mouse Models

Why study HCV Immunopathogenesis?

It offers an example of in vivo cross-priming of T cells and provide an opportunity of uncovering new mechanism of immune evasion.

By understanding the role of the immune system as it responds to HCV infection we may be able to identify strategies to stratify patients receiving treatment and propose alternative immune strategies for increasing the likelihood of clearing the virus (= cure).

It is a major public health problem – 175M infected & leading cause of liver cancer.

Liver / Tissue Lymph organ

iDCs

MHC-I

MHC-II

Activation Signals

mDCs

T4

T8

Immune Complex

αVβ5 CD36

Maturation Stimulus

- Inflammatory cytokines- Pathogen elements

(LPS, ssRNA, dsRNA)

Apoptotic Cell (infected or tumor)

FcR

Pathogen Entry

x

HCV and Antigen Cross-presentationelicits HCV-specific T cell response

Matthew L. Albert, M.D, Ph.D


8

IFNγ / IFNα / TNFα => CXCL10

CXCL10 (IP-10) is an interferon-induced protein of ~10kDa (Luster, J Exp Med 1987)It is produced by hepatocytes during liver inflammation (Zeremski, Hepatology 2008)

CXCR3 expression on NK and T cells induces their migration (Loetscher, J Exp Med 1996)

CXCL10 T cells (CXCR3+) = CXCL10 receptor)

T cells (CXCR3-)

NeutrophilsMonocytesB cellsT cellscDCs

Endothelial cellsKeratinocytesHepatocytes

An unexpected role for CXCL10 in HCV disease pathogenesis

2 0 4 12 24 7248 weeks

IFN+Rib

Observational study: CXCL10 production in response to Peg-IFNα / Ribavirin therapy in chronic HCV patients

HCV Paris cohort g1/g4

Stanislas Pol , Vincent Mallet (Cochin)Jean-Michel Pawlotsky, Christophe Hézode (Mondor)Jacques Denis (Sud-Francilien-Site Louise Michel)Philippe Renard (Argenteuil) Lawrence Serfaty (Saint-Antoine) Hervé Hagège, Isabelle Rosa (Créteil)

sCXCL10 (3-77) in Chronic HCV patients 58% with evidence of

N-terminal truncated CXCL10

Chronicdisease

Spontaneousresolvers

Acute Hepatitis C

Responders Non-Responders

IFNααααIP-10

IP-10 / CXCL10 is best predictor for failure to respond to IFN/Ribatreatment Chronic Cohort (Paris, Genotype 1b)

IP-10

α−2M

EGF

Ferritin

NSH

NSH

NSH

NSH

p < 0.01p < 0.01p = ns

H

NSH

NS

NSH

NSH

Plots (relative expression)*




9

Translational potential of HCV studies

� New plasma biomarker-based algorithms for predicting response to therapy (required to help manage patients and optimize treatment response)

� New drug target to regulate lymphocyte trafficking for improving immunotherapy and therapeutic vaccination

Chemokine antagonism: a new mechanism of immune regulationthat may serve as a tractable drug target for chronic diseases

IL-2

CD4+

T cell

(*) Chronic inflammation alters T cell trafficking, limiting the probability of ‘antigen’ clearance

IL-12

CD4+

Antigen persistence

CD8+

CD4+

Dendritic Cell

IFN-γ

Peripheral Tissue

Lymph Node

CD40 / CD40L

*

An unexpected role for IP-10 in HCV disease pathogenesis

The cleavage of IP-10 by CD26 results in an antagonist form of the molecule that participates in the disruption of T cells trafficking in the liver, accounting in part for the failure to spontaneously clear the virus and a failure to respond to therapy.

IP-10

DPPIV

sIP-10

WE PROPOSE TO RESTORE / STRENGTHEN THE CHEMOKINE GRADIENT BY INHIBITING

DIPEPTIDYLPEPTIDASE IV

IP-10IP-10

DPPIVX

Killer T cells (CXCR3+ = IP-10 receptor)

Unactivated T cells (CXCR3-)

Killer T cells (CXCR3+ = IP-10 receptor)

Unactivated T cells (CXCR3-)




10



Keywords

• Inflammatory bow el diseases • Crohn disease • Mucosal, immunity • T cell antigen

receptor specificity • Antigens, bacterial • NKG2 proteins (NKG2D)

• Cytokines: TNF, IL17

Major Grants

• AVENIR INSERM (2007-2012)

• European grant (IMI, Innovative Medical Initiative): Be the Cure

IMI call topic: inflammation – Translational research and adaptive immunity; Academic coordinators: Tom Huizinga (LUMC, Leiden), Lars Klarekog (Karolinska Institutes)

Matthieu Allez, M.D, Ph.D


• Activation of the Receptor NKG2D Leads to Production of Th17 Cytokines in CD4+ T Cells of Patients with Crohn's disease. Pariente B, Mocan I, Camus M, Dutertre CA, Ettersperger J, Cattan P, Gornet JM, Dulphy N, Charron D, Lémann M, Toubert A, Allez M. Gastroenterology. 2011; in press.

• The efficacy and safety of a third anti-TNF monoclonal antibody in Crohn’s disease after failure of two other anti-TNF antibodies. Allez M, et al. Aliment Pharmacol Ther. 2010;31:92-101.

• CD4+NKG2D+ T cells in Crohn's disease mediate inflammatory and cytotoxic responses through MICA interactions. Allez M, Tieng V, Nakazawa A, Lemann M, Mayer L, Toubert A. Gastroenterology. 2007; 132:2346-58.

• Defects in CD8+ regulatory T cells in the lamina propria of patients with inflammatory bowel disease. Brimnes J, Allez M, Dotan I, Ling S, Nakazawa A, Mayer L. Journal of Immunology. 2005;174:5814-22.

• Regulatory T cells: Peace Keepers in the gut. Allez M, Mayer L. Inflamm Bowel Dis. 2004; 10:666-76.

• Expansion of CD8+ T cells with regulatory function after interaction with intestinal epithelial cells. Allez M, Brimnes J, Dotan I, Mayer L. Gastroenterology. 2002;123:1516-1526.

• Long-term outcome of patients with active Crohn’s disease exhibiting extensive and deep ulcerations at colonoscopy. Allez M, Lémann M, Bonnet J, Cattan P, Jian R, Modigliani R. Am J Gastroenterol. 2002; 97:947-53.

Inserm U940 - Hôpital Saint-Louis, APHP - Paris Diderot University Paris

Immunopathology of inflammatory bowel diseases (IBD). Focus on the aberrant adaptive immune function in IBD, by investigating phenotype, pathways of activation and function of protective- and inflammatory T cell subsets

Our team is focused on the study of mucosal adaptive immunity in the human intestine, on interactions with the microbiota, and on pathogenesis of IBD. We have a strong expertise in isolation and sorting of T and non-T cell subsets (NK, B, DC), and in their phenotypic, molecular and functional analysis. We have access to the mucosal tissue (inflamed and non inflamed areas from surgical specimens or endoscopic biopsies from healthy individuals and IBD patients). Translational research is favoured by a close interaction with our clinical department (Hôpital Saint-Louis, Paris), including an important cohort of IBD patients (>5000 patients) connected with national (GETAID, REMIND) and international (ECCO) networks. We have accesses to cohorts of IBD patients treated with immunosuppressants and/or targeted therapies permits analysis of alterations in T cell biology, as well as products made by these cells, in regards of response to therapies. We coordinate a national biobank on post-operative model (REMIND network).

The immune response triggered following pathogen recognition, though required to clear the infection, can be detrimental if it is produced in excess or fails to resolve promptly. Excessive inflammation contributes to infectious and noninfectious pathologies in the gut (such as inflammatory bowel disease, IBD: Crohn’s disease, CD). IBD are characterized by uncontrolled immune responses towards the intestinal microbiota. T cells contribute significantly to pathology during inflammation. Our objective is to improve the scientific understanding of aberrant immune function in IBD by investigating how generation/expansion, phenotype and function of protective and inflammatory T cell subsets can contribute to mucosal inflammation.

Scientific expertise: isolation and sorting of T and non-T cell subsets from the intestinal mucosa and the periphery, and their phenotypic, molecular and functional analysis. Functional analyses include examination of antigen specificity of T cells to panel of known antigens in IBD, as well as of antigens of microbial origin.

Major data: We have recently identified a subset of CD4+ T cells mediating inflammatory response in CD (Allez et al, Gastroenterology 2007). These cells are characterized by the expression of the stimulatory receptor NKG2D. We have shown that ligand activation of the NKG2D receptor triggers release of Th1 cytokines and induces cytotoxicity. More recently, we have shown that the CD4+ NKG2D+ T cell subset represents a major source of IL17 in CD, and has typical features of Th17 cells (Pariente et al, Gastroenterology 2011). Interactions between NKG2D and its ligands influence IL17 production. Furthermore, we demonstrated that CD4+ NKG2D+ T cells have a highly restricted TCR repertoire (submitted).

Perspectives: To better define the phenotype and functional aberrations of pathogenic and regulatory cell subsets; - To develop novel assays to examine antigen-specificity of T cells to panel of microbial antigens; To understand post-operative relapse and failures of targeted therapies; To identify pathways of activation of pathogenic cells and thus specific targets for novel therapies.

11

� Objectives:

• How generation and function of protective and inflammatory T cell subsets can

contribute to mucosal inflammation?

• Examine antigen-specificity of T cells to panel of microbial antigens

• To understand post-operative relapse and failures of targeted therapies

� Tools:

• Isolation and sorting of T and non-T cell subsets from the intestinal mucosa

• Phenotypic (flow cytometry) and molecular analysis (TCR repertoire, array)

• Functional analyses include examination of antigen specificity of T cells to antigens of

microbial origin.

• Organization and access to cohorts of IBD patients (post-operative outcome,

biotherapies)

Figure 1: Expansion of CD4+ NKG2D+ T cells in CD

Bacterialflora

IEC

Lamina propria

CD4+ NKG2D+ T cells TCRαβαβαβαβ CD28-

CD4

TCR

NKG2D

IFNγγγγTNFααααIL17

MICANKG2D CD4

CD4

CD4

CD4

MHC II

MICA/BULBPs

Matthieu Allez M.D, Ph.D

Immunopathology

of inf lammatory bowel di seases


12

Figure 2 : IL17 producing CD4+ T Cells from Patients with CD highly express NKG2D

3.1%

CD

4

IL17

7 66

9.218

CD

161

NKG2DC

D16

1NKG2D

22 1.6

1.874

Figure 3 : CD4+ pathogenic T cells have a restricted repertoire

(17.1%)

LP CD4+

Rel

ativ

e ex

pres

sion

(%

)

Oligoclonality = 8%

CD

R3

leng

th(a

a)

Rel

ativ

e ex

pres

sion

(%

)

Oligoclonality = 5%

LP CD4+NKG2D-

Vββββ-chain family

LP CD4+NKG2D+

Oligoclonality = 24%


CD4+NKG2D+

CD4+NKG2D-


CD

R3

leng

th(a

a)


Immunopathology

of inflammatory bowel di seases


13

Perspectives

Unique Selling Points

• Identification of factors involved in the generation of pathogenic CD4+ NKG2D+ T cells

• Characterization of cytotoxic properties of pathogenic T cells

• Identification of microbial antigens recognized by inflammatory T cell subsets

• To examine the role of T cells in post-operative relapse

• To analyze inflammatory pathways in failures of targeted therapies (anti-TNF)

• Expertise in mucosal immunology, identification and characterization of protective and

pathogenic intestinal T cells

• Clinical expert in inflammatory bowel diseases (management, clinical trials)

• Organization and access to cohorts of IBD patients (biobank, post-operative relapse,

response to therapies)

• Strong collaborations and participations to national (GETAID) and European networks

(scientific officer of ECCO)

• Bench to bedside: clinical phenotype, characterization of immune responses at tissue

level, sorting of specific subsets, phenotypic and molecular analysis


Immunopathology

of inf lammatory bowel di seases


14



Keywords

• Virus-specific T Cell Immunity

• HIV

• Oncogenic viruses

• HCV

• Herpesviruses

• HPV

• Influenza

• Immunogenomics

• Vaccines

Major Grants

• Europe (FP5, FP6, FP7) RTD projects

Inserm U945 - Pierre and Marie Curie University Paris - APHP

Federative Institute of Research on Immunity – Cancer – Infection - IFR113 Paris

Immunology, Immunity and Immunogenetics to viruses and vaccines

Investigating innovative aspects and biomarkers of immunity and Immunogenetics to viruses and vaccines and developping innovative immune-based interventions for the HIV infection

Brigitte Autran, M.D, Ph.D

Brigitte Autran, Professor of Immunology, in charge of the Immunology Department of Pitié-Salpêtrière Hospital at UPMC School of Medicine, co-chairs the Federative Institute of Research ‘Immunity-Cancer-Infection”. With a 25 years experience on T cell immunity to HIV, she produced several innovative findings with the first demonstrations of Cytotoxic T Lymphocytes directed against HIV (Nature 1987) and of immune reconstitution with antiretroviral therapies (Science 1997) and gains international recognition in the field of immunotherapy and vaccines for HIV and viruses (Nat.Immunol. Rev 2003; Science 2004). She belongs to the Top 1% researchers in the WOS with an H Index of citations of 49.

The B Autran’s research team dedicated to Cellular Immunity and Immunogenetics of viral infections and vaccines » explores tightly interacting domains:

1. Immune responses and Immune-based therapies: Definition of immune correlates of protection against HIV and other viruses (CMV, oncogenic viruses [HHV8 and HCV], influenza) with definition of eQTL in conjunction with the genomics studies;

2. Immunogenomics of chronic viral Infections: with the responsibility of the ANRS genomics platform providing human-genome wide analysis of large cohorts, replacing the prior gene candidate approach in order to define impact of hosts genetic polymorphism on the course of the HIV and HCV infections.

3. Development and evaluation of innovative antiviral immune-based therapies and vaccines in HIV-infected and other immune-suppressed populations, by coordinating national, European and international collaborations and networking.


• Long-term nonprogressors and elite controllers in the ANRS CO5 HIV-2 cohort. Thiébaut R, Matheron S, Taieb A, Brun-Vezinet F, Chêne G, Autran B; for the immunology group of the ANRS CO5 HIV-2 cohort. AIDS. 2011 Mar 27;25(6):865-867.

• Immune reconstitution after a decade of combined antiretroviral therapies for human immunodeficiency virus. Guihot A, Bourgarit A, Carcelain G, Autran B. Trends Immunol. 2011 Mar;32(3):131-7.

• Comprehensive analysis of virus-specific T-cells provides clues for the failure of therapeutic immunization with ALVAC-HIV vaccine. Papagno L, Alter G, Assoumou L, Murphy RL, Garcia F, Clotet B, Larsen M, Braibant M, Marcelin AG, Costagliola D, Altfeld M, Katlama C, Autran B; ORVACS Study Group. AIDS. 2011 Jan 2;25(1):27-36.

• Distinct differentiation profiles of HIV-Gag and Nef-specific central memory CD8+ T cells associated with HLA-B57/5801 and virus control. Xie J, Lu W, Samri A, Costagliola D, Schnuriger A, da Silva BC, Blanc C, Larsen M, Theodorou I, Rouzioux C, Autran B; ALT-ANRS-CO15 study group. AIDS. 2010 Sep 24;24(15):2323-9.

• Control of vaccinia virus skin lesions by long-term-maintained IFN-gamma+TNF-alpha+ effector/memory CD4+ lymphocytes in humans. Puissant-Lubrano B, Bossi P, Gay F, Crance JM, Bonduelle O, Garin D, Bricaire F, Autran B, Combadière B. J Clin Invest. 2010 May 3; 120(5):1636-44.

• Acute hepatitis C in HIV-infected patients: rare spontaneous clearance correlates with weak memory CD4 T-cell responses to hepatitis C virus. Schnuriger A, Dominguez S, Guiguet M, Harfouch S, Samri A, Ouazene Z, Slama L, Simon A, Valantin MA, Thibault V, Autran B; ANRS HC EP21 study group. AIDS. 2009 Oct 23;23(16):2079-89.

• Tuberculosis-associated immune restoration syndrome in HIV-1-infected patients involves tuberculin-specific CD4 Th1 cells and KIR-negative gammadelta T cells. Bourgarit A, Carcelain G, Samri A, Parizot C, Lafaurie M, Abgrall S, Delcey V, Vicaut E, Sereni D, Autran B; PARADOX Study Group. J Immunol. 2009 Sep 15;183(6):3915-23.

• A step ahead on the HIV collaboratory. Murphy RL, Autran B, Katlama C, Brucker G, Debre P, Calvez V, Clotet B, Clumeck N, Costagliola D, Deeks SG, Dorrell L, Gatell J, Haase A, Klein M, Lazzarin A, McMichael AJ, Papagno L, Schacker TW, Wain-Hobson S, Walker BD, Youle M. Science. 2009 Jun 5;324(5932):1264-5.

• Therapeutic vaccines for chronic infections. Autran B, Carcelain G, Combadiere B, Debre P. Science. 2004 Jul 9;305(5681):205-8. Erratum in: Science. 2004 Sep 24;305(5692):1912.

• Therapeutic vaccines against HIV need international partnerships. Autran B, Debré P, Walker B, Katlama C. Nat Rev Immunol. 2003 Jun;3(6):503-8. Review.

15

Federative Institute of Researches: Immunity – Cancer – InfectionBrigitte Autran - Co-Chair with David Klatzmann*

* See scientist specific section

� Objectives: Control of Infectious Diseases

• HIV :

- Immunity to HIV and viruses: (Inserm U945)

- B Autran et al. : Immunity & Immunogenetics to viruses and vaccines

- P Debré & V Vieillard: Innate Immunity to viruses and vaccines

- V Appay & A Moris: Immune control of viruses and Immunosenescence

- Clinical epidemiology, therapeutic strategies and virology in HIV infection: (Inserm U943)

- C Katlama et al.: Innovative Therapeutic strategies

- V Calvez & P Flandre: Antiretroviral Resistance

- D Costagliola : Clinical epidemiology, complications and treatment

• Mycobacteria: V Jarlier et al. (ER 5 UPMC)

• Malaria: D Mazier et al. (Inserm U945)

• Viruses: H Agut et al. (ER1 UPMC)

• Vaccines: B Combadière * et al., B Autran et al. (Inserm U945)

D Klatzmann* et al. (Inserm U959)

Brigitte Autran et al. Immunity and Immunogenetics to Viruses and Vaccines

(Unit Inserm-UPMC 945)

� Objectives:• Immune Correlates & Biomarkers of Virus Control : HIV, HCV & oncogenic

viruses.

• Hosts Genetic determinant of chronic viral infections (HIV, HCV…) progression.

• Vaccines and Therapeutic control of viruses in Immune-suppressed patients

� Tools: for Translational Research:• Networking and Collaborations with

• Pitié-Salpétrière CRIV (Center for Integrated Researches on HIV : see slides 4,5)

• Inserm/UPMC Unit 945 with:

• V Appay, A Moris et al.: Mechanisms of T cell-based control of viruses

• P Debré, V Vieillard et al: Innate immunity to viruses and new vaccines

• B Combadière et al.: Vaccine immunity (see specific presentation)

• International Platforms of Immune-Monitoring

• Cohort studies and Clinical Trials:• HIV+ : Local File [n=4,000]; Chair of the French LTNP Cohort [ANRS-CO15]• Vaccine recipients, Immune-suppressed patients

• Hi-Tech Platforms: Genomics (ANRS), Advanced Flow-cytometry

High sensitivity/High thoughput Virus-specific T cell assays

� Main Achievements (H Index: 49) : see slide N°4

0 102

103

104

105

<PE-Cy5-A>: CD107

0

102

103

104

105

<A

lexa

Flu

or

70

0-A

>: I

FN

g

0.26 1.45

0.4697.8

Autran et al. J Exp Med 2003, 2005Appay et al. Nat. Med 2001

JEM 2000,,2007, Blood 2009

I Theodorou et al. Blood 2000 PLosOne2009..

NK

CD4

+-NKp44

NKp44L

Vieillard et al. PNAS 2008, 09….

B Autran et al. Nat.Rev.Immunol. 2002

Science 1997,2000, 2004, 2009


Immunity – Cancer – Infect ion


16

HIV : «Clinical epidemiology, therapeutic strategies and virology in HIV infection”

(Unit Inserm-UPMC 943)

� Objectives:� D Costagliola (Head of the Research Unit, H Index: 42):

� Clinical epidemiology of HIV infection, its complications and its treatment :

� C Katlama (H Index: 64):

� Innovative Therapeutic strategies against HIV

� V Calvez (H Index: 38):

� HIV Resistance to antiretroviral drugs,

� Main Tools and Resources:� D Costagliola: Chair of

� FHDH (French Hosp. Database on HIV): the world largest (>110 000 patients)

� ANRS Center for monitoring & statistics of clinical trials.

� C Katlama : Chair of:

� Clinical research unit, Pitié-Salpétrière active file (3,000 HIV+ patients), and CRIV

� ORVACS: International Platform promoting and conducting international clinical trials with N. American & European Univ., supported by the Bettencourt Foundation,

� ANRS group for Innovative Antiretroviral Strategies

� V Calvez: Chair of the ANRS group for resistance (www.hivfrenchresistance.org)

� Main Achievements : see slide N°4

The Pitié-Salpétrière Centre de Recherches Intégrées on HIV (CRIV) achievements - In the Heart of HIV Researches:


Immunity – Cancer – Infection


17

HIV: Perspectives: The CRIV Programme HIV Beyond UndetectabilityUMR-S Inserm / UPMC 943 and 945

Novel Cohort

HIV Comorbidities

C Katlama et al&

D Costagliola et al.

ComorbiditiesCancers

Immune control of HIV

& co-infections

B Autran, P Debré&

V Appay, A Moris e t al.

Mechanisms of T cell control of HIV

Immune control of HIV Reservoirs

Antiretroviral resistance mutations

Antiretroviral Resistance to HIV

&

New Drug discovery

V Calvez et al.&

P Flandre et al.

Antiretroviral drug

discovery

To maintain maximal HIV suppression

Innovative Therapiesfor HIV

C Katlama, B Autran,V Calvez, D Costagl iola

et al.

HIV Eradicationstrategies

cART strategies &

HIV reservoirs

Vincent Jarlier et al.Antibiotics, tuberculosis (TB) and other mycobacterial infection

� Axis:• Molecular targets, mechanism of action

• Mechanism of acquired resistance

• In vitro and in vivo evaluation of new antibiotics

• New tools of diagnosis of resistant mycobacteria

• Rates and characteristics of resistance

3D structure of Mtb DNA gyrase. PLoS One, 2010.

� Tools:• Enzymatic and structural study of proteins

• Genetic studies and cell physiology

• Epidemiology of resistance

(National Reference Center, 2 networks)

• Experimental chemotherapy (animal model)

3D structure of Mtb pyrazinamidasePLoS One, 2011.

Evaluation of TMC207 (ATP synthase inhibitor)PLoS One, 2011.

Mtb ATP synthaseScience, 2005.

� Selected Bibliography on Mycobacteria:W. SOUGAKOFF, et al. Clin Microbiol Infect. 2004K. ANDRIES, et al. Science 2005N. VEZIRIS et al. Antimicrob Agents Chemother. 2005E. CAMBAU et al. Clin Infect Dis. 2006N. LOUNIS et al. Antimicrob. Agents Chemother 2006VEZIRIS N. et al. Am J Respir Crit Care Med. 2009PITON J. et al. PLoS One. 2010BROSSIER F. et al. Antimicrob Agents Chemother. 2011PETRELLA S. et al. PLoS One. 2011VEZIRIS N. et al. PLoS One. 2011

(UPMC Unit1541), Pitié-Salpêtrière–C.Foix Hosp., Faculté de Médecine P. M. Curie, UPMC)




18

O Silvie and D. Mazier et al. : Malaria

Identification and pre-clinical validation of novel drug and vaccine targets

� Objectives:• Characterization of host- Plasmodium interactions during liver stages

• Identification of novel vaccines and drugs targets against liver stages

• Pre-clinical validation of anti-malarial vaccines and drugs

� Tools: • In vitro assays: primary hepatocytes (mouse, human), cell lines

• In vivo assays: mouse models (KO, transgenic, humanized mice)

• Human and Rodent parasites (genetically modified transgenic, KO)

• Screening approaches: proteomics, transcriptomics, drug assays

� Main achievements:• Unique expertise for malaria liver stages (including P. falciparum)

• First identification of a host molecule required for parasite entry (Silvie Nat Med 2003)

• Novel anti-malarial compounds (Carraz PLoSMed 2006, Cosledan PNAS 2008 ; Mazier et al Nat Drug Discov 2009)

• Medium/high throughput in vitro screening assays (Gego et al Antimicrob Agents Chemother 2006)

• In vitro model for the study of P. vivax malaria relapses (Dembele et al PLoS One 2011)

• Pre-clinical validation of a virosomal malaria vaccine (Okitsu et al PLoS One 2007)

P Buffet and D Mazier et al. : Malaria:

Deformability & circulation of parasitized red blood cells« Laveran » Research group UMRs945 UPMC & Pitié-Salpêtrière Hospital

2. New tools

1. Principle:

• Micro-bead layers mimic splenic filters (A&B) (Deplaine et al., Blood 2011)

• Spleens filter-out Plasm. Falciparumin fected blood cells

(Buffet et al.Curr Op Hematol 2009, Blood 2008, 2011)

• P. falciparum -infected red bloodcells : equally retained in microbeadfilters & human spleens (A)

•« Pitting»: Spleen and filters canremove altered parasites from host red blood cells (C)

3. Application to the control of malaria Patent National Phase 29/11/10 UPMC/Institut Pasteur/APHP

I. Screen for transmission-blocking compounds inducing retentionof sparasites exual forms (gametocytes) in spleens

II. Analyse the resistance of parasites to reference artemisininderivatives (pitting process)

III. Identify the parasite components altering infected red blood cellsdeformability

4. Specific objectives

I. Adapt prototype (A) to medium throughput screening Collaboration with Discovery Biology (Brisbane)

II. Assess correlation of parasite resistance with pitting rates in microbead filtersCollaboration with Wellcome Trust NIH in South-East Asia

I. Assess correlation between retention rates and expression levelof candidat genesCollaboration with Institut Pasteur

C

(Unit Inserm/UPMC 945)

Silvie O., et al. 2003. Nat Med.; Carraz M., et al. 2006. PLoS Medecine ; Coslédan F., et al. 2008. PNAS

; Siau A., et al. 2008. PLoS Pathogen ; Safeukui I, et al. 2008. Blood; Yalaoui S., et al. 2008. Cell Host

& Microbe; Yalaoui S., et al. 2008. PLoS Pathogen ; Mazier D., et al. 2009. Nature Reviews Drug

Discovery; Deplaine G, et al. 2010 Blood.; Buffet PA, et al. 2011 Blood.

D Mazier et al.: Selected recent referencesUMRs945 Inserm/UPMC: Immunity and Infection, & Pitié-Salpêtrière Hospital


Immu nity – Cancer – Infection


A

19

H. Agut et al.Dynamics, Epidemiology, and Therapy of Viral Infections

ER1 DETIV

� Objectives: • Control of hepatitis virus (HBV, HCV), herpesvirus (HSV, VZV, CMV, EBV, HHV-6, HHV-8)

• Quantification of viral multiplication in vitro and in vivo

• Rate and mechanism of viral transmission in human populations

• Analysis, prediction and prevention of resistance to antivirals in treated patients

� Tools:• Molecular detection, quantitation & genetic analysis of viral genomes in vitro and in vivo• Virus multiplication in cell cultures• Functional enzymatic assays• Molecular imaging• Cohort studies (AIDS, transplant recipients, emerging viral diseases )

� Results :• Kinetics of reactivation of betaherpesviruses (CMV, HHV-6) in immunocompromised patients

• Characterization of resistance of HBV, HHV-6, HSV, and CMV to DNA polymerase inhibitors

• Molecular epidemiology of HSV lung infections in intensive care unit patients

• Differential detection and transmission of HBV genotypes in developing countries

• Burrel S, et al. Anti microb Agents Chemother . 2010 • Hannachi N, et al. J. Virol . 2010• Bonnafous P, et al. H. Antiviral Res . 2010 • Agut H, Future Microbiol. 2009 • Thibault V,et al. J Virol Methods . 2009 • Deback C, et al J Clin Microbiol . 2009• Boutolleau D, et al. Antiviral Res . 2009• Bonnafous P, et al. Antiviral Res . 2008• Schnuriger A, et al J Clin Microbiol . 2006• Palleau S, et al. Clin Infect Dis. 2006

H. Agut et al.: Selected recent referencesDynamics, Epidemiology, and Therapy of Viral Infections

ER1 DETIV




20



Keywords

• Antiviral

• Functional genomics

• Hepatitis C virus

• Transplantation

• Viral entry

• Vaccine

Major Grants

• ERC-2008-AdG-233130-HEPCENT

• EU INTERREG-IV-FEDER-Hepato-Regio-Net

• ANRS

• ANR Chaire d’Excellence

Thomas Bau mert, M.D

Inserm U748 – Strasbourg University - Nouvel Hôpital Civil Strasbourg Strasbourg

Virology Institute

Functional genomics of virus-host interactions, viral hep atitis and liver disease, molecular virology of hepatitis C

Functional genomics of virus-host interactions for discovery of antivirals and vaccines

Hepatitis C virus (HCV) infection is a major cause of liver disease world-wide. A vaccine is not available and

antiviral therapies are limited. Recent advancements in functional genomics, cell culture and animal model

systems have allowed rapid progress in the understanding of the molecular and clinical mechanisms of HCV-

host interactions. HCV entry is the first step in a cascade of interactions between the virus and its target cell

and thus plays a key role for the viral life cycle. Using a functional RNAi screen we have recently identified a

network of receptor tyrosine kinases (RTKs) as HCV entry factors. RTKs mediate HCV entry by regulating

CD81-claudin-1 co-receptor associations and promoting membrane fusion (Lupberger et al. Nature Medicine

2011 in press).

By studying virus-host interactions in unique clinical cohorts we have defined a key role of HCV entry for

evasion from host immune responses and viral persistence (Fafi-Kremer et al., J. Exp. Med. 2010; Haberstroh

et al. Gastroenterology 2008, Pestka et al. PNAS 2007).

Since viral entry is required for the initiation, dissemination and maintenance of infection, it is a promising novel

target for antiviral therapies and vaccines (Zeisel et al. J. Hepatol. 2011). Indeed, our recent data in preclinical

animal models suggest that targeting host entry factors using receptor-specific monoclonal antibodies or small

molecules constitutes a novel antiviral approach for prevention and treatment of HCV infection (Fofana et al.

Gastroenterology 2010; Krieger et al. Hepatology 2010; Lupberger et al. Nature Medicine 2011 in press).

Taken together, the results define key pathways for pathogenesis of viral disease and open new perspectives

for the development of antivirals and vaccines.


• EGFR and EphA2 are host factors for hepatitis C virus entry and targets for antiviral therapy. Lupberger J, Zeisel MB, Xiao F, Thumann C, Fofana I, Zona L, Davis C, Mee CJ, Turek M, Royer C, Zahid MN, Lavillette D, Fresquet J, Cosset FL, Rothenberg SM, Pietschmann, T, Patel A, Pessaux P, Doffoël M, Raffelsberger W, Poch O, McKeating JA, Brino L, Baumert TF. Nat. Med. 2011, in press.

• Viral entry and escape from antibody-mediated neutralization influence hepatitis C virus reinfection in liver transplantation. Fafi-Kremer S, Fofana I, Soulier E, Carolla P, Meuleman P, Leroux-Roels G, Patel AH, Cosset FL, Pessaux P, Doffoël M, Wolf P, Stoll-Keller F, Baumert TF. J. Exp. Med. 2010; 207:2019-31.

• Monoclonal anti-claudin 1 antibodies prevent hepatitis C virus infection of primary human hepatocytes. Fofana I, Krieger SE, Grunert F, Glauben S, Xiao F, Fafi-Kremer S, Soulier E, Royer C, Thumann C, Mee CJ, McKeating JA, Dragic T, Pessaux P, Stoll-Keller F, Schuster C, Thompson J, Baumert TF. Gastroenterology. 2010;139:953-64.

• Inhibition of hepatitis C virus infection by anti-claudin-1 antibodies is mediated by neutralization of E2-CD81-claudin-1 associations. Krieger SE, Zeisel MB, Davis C, Thumann C, Harris HJ, Schnober EK, Mee C, Soulier E, Royer C, Lambotin M, Grunert F, Dao Thi VL, Dreux M, Cosset FL, McKeating JA, Schuster C, Baumert TF. Hepatology. 2010;51:1144-57.

• Sustained delivery of siRNAs targeting viral infection by cell-degradable multilayered polyelectrolyte films. Dimitrova M, Affolter C, Meyer F, Nguyen I, Richard DG, Schuster C, Bartenschlager R, Voegel JC, Ogier J, Baumert TF. Proc Natl Acad Sci U S A. 2008;105:16320-5.

• Rapid induction of virus-neutralizing antibodies and viral clearance in a single-source outbreak of hepatitis C. Pestka JM, Zeisel MB, Bläser E, Schürmann P, Bartosch B, Cosset FL, Patel AH, Meisel H, Baumert J, Viazov S, Rispeter K, Blum HE, Roggendorf M, Baumert TF. Proc. Natl. Acad. Sci. U S A 2007;104:6025-30.

21


Thomas Baumert, M.D

Functional genomics of virus-host interactions

� Objectives:

• Investigation of molecular mechanisms of virus-host interactions using functional

genomics

• Identify key pathways of viral pathogenesis as novel targets for antivirals

• Preclinical and early clinical development of antivirals

� Tools:

• High-throughput RNAi screening platform

• High-throughput HCV infection assay

• State-of-the-art molecular virology

• HCV human chimeric mouse model

• Unique clinical cohorts with well defined clinical isolates

Figure 1: Molecular mechanismsReceptor tyrosine kinases are HCV entry factors and antiviral targets

A. B.

EGFR is a cofactor for HCV entry and antiviral target in human he patocytes

RNAi screen identifies identifies a network of 58 host cell kinases as HCV entry factors

Lupberger / Baumert Nature Medicine 2011, in press

22

Figure 2 : Clinical Impact Mechanisms of viral evasion in HCV-infected patients

B.

A.

HC

Vpp

ent

ry(L

og10

RLU

)

C.

Neu

tral

izat

ion

titer

Fafi-Kremer et al. J. Exp. Med. 2010, Haberstroh et al. Gastroenterology 2008,

Pestka et al. PNAS 2007

HCV variants beforetransplantation

HCV variants 7 daysafter transplantation

• Liver transplantation – unique clinical model to study HC V pathogenesis

• Variants re-infecting the liver graft (A) are characterized most efficient viral entry (B) and poor neutralization by autologous antibodies (C)

• Viral entry plays a key role for viral evasion in acute and chronic HCV infection

• Understanding of virus-host interactions identifies novel targets for antiviral therapy and vaccines

Figure 3 : Technology transferPreclinical development of innovative antivirals and vaccines

Fofana et al. Gastroenterology 2010; Krieger et al. Hepatology 2010; Robinet / Baumert unpublished data 2011

Anti-receptor antibodies block infection of highly infectious escape variants that are resistant to patients’ neutralizing antibodies


Thomas Baumert, M.D


23

Perspectives


• Unravel the molecular mechanism of virus host-interactions and pathogenesis of virus-

induced disease.

• Identify key pathways involved in pathogenesis of disease.

• Develop innovative antivirals and vaccines for viral infections with a major unmet

medical need (viral hepatitis, dengue, HIV).

• Pioneer and leader in HCV-host interactions with unique expertise in viral entry and

pathogenesis

• From molecular tools to clinics : integration and access to all research materials :

molecular constructs, large panel of unique recombinant viruses, state-of-the-art cell

and animal models including key functional assays

• BSL3 high-throughput screening platform, BSL3 animal facility for recombinant

viruses, RNAi screening and systems biology platform (IGBMC)

• Unique patient cohorts, clinical trials with focus on innovative first-in-class

compounds (U Strasbourg Medical Center)

• Strong collaborations with rapid and versatile production of unique antibodies and

antivirals


Thomas Baumert, M.D


24



Keywords

• AIDS

• HIV

• Restriction

• Dendritic cells

• Innate immunity

• Vaccine

Major Grants

• ERCAdv grant 2010-2015

• ANRS • SIDACTION • ANR

Monsef Benkirane, Ph.D

CNRS UPR1142 Montpellier

Institut de Génétique Humaine Montpellier

Mechanisms of HIV replication

Our major aim is to identify cellular factors controlling HIV-1 replication and to understand their mechanism of action

Human Immunodeficiency virus type 1 (HIV-1) infects primarily cells of the immune system. The outcome of

HIV-1 infection results from complex interactions between viral proteins and host cell factors. In most cases,

HIV-1 successfully uses cellular pathways and bypasses cellular restriction factors for optimal replication

leading to continuous rounds of infection, replication and cell death. However, in certain situations virus

replication can be successfully controlled.

First, HAART (Highly Active AntiRetroviral Therapy) treatment revealed the existence of a pool of resting

memory CD4+ T cells harbouring integrated but silent HIV-1 provirus. Although this situation occurs in a small

number of cells, it suggests that intracellular defence mechanisms can be effective against HIV. This long lived

viral reservoir is believed to be the major obstacle against HIV-1 eradication by HAART.

Second, HIV-infected individuals who are able to control their virus to undetectable levels for many years in

absence of any treatment have been identified and referred to as Elite HIV controllers “EC”. Again, this is a rare

situation observed in 0.5% of infected patients. Still, it demonstrates that it is possible to naturally and

effectively control HIV replication and disease progression. A major challenge in the HIV field is to identify the

host factors and define the molecular mechanisms involved in the control of virus replication.

Our lab is interested at identifying cellular factors (chromatin modifiers, microRNA and restriction factors)

involved in HIV-1 silencing and restriction. We will present our recent data which lead us to identify the dendritic

and myeloid cells-specific HIV-1-restriction factor. Our finding is of crucial importance to both the understanding

of the physiopathology of HIV-1 infection and to the design of DC-target vaccines against HIV.


• VIP8 is the dendritic and myeloid cells-specific HIV-1-restriction factor counteracted by Vpx. Nadine Laguette, Bijan Sobhian, Nicoletta Casartelli, Mathieu Ringeard, Christine Chable-Bessia, Emmanuel Ségéral, Stéphane Emiliani, Olivier Schwartz, and Monsef Benkirane. Nature. 2011. In press.

• Competition between Dicer mRNA, pre-miRNA, viral RNA for exportin-5 binding strikes a new regulatory mechanism for Dicer expression. Yamina Bennasser, Christine Chable-Bessia, Robinson Triboulet, Derrick Gibbings, Carole Gwizdek, Catherine Dargemont, Eric J Kremer, Olivier Voinnet and Monsef Benkirane. Nature Structural & Molecular Biology. 2011 Mar;18(3):323-7.

• HIV-1 Tat assembles a multifunctional transcription elongation complex and stably associates with the 7SK snRNP. Sobhian, B., Laguette, N., Yatim, A., Nakamura, M., Levy, Y., Kiernan, R., and Benkirane, M. Mol Cell. 2010;38,439-45 (Faculty of 1000. FF8).

• Suppression of microRNA-silencing pathway by HIV-1 during virus replication. Triboulet, R., Mari, B., Lin, Y.L., Chable-Bessia, C., Bennasser, Y., Lebrigand, K., Cardinaud, B., Maurin, T., Barbry, P., Baillat, V., et al. Science. 2007;315,1579-1582 (Editor choice. Faculty of 1000. FF10).

• Intrinsic ubiquitination activity of PCAF controls the stability of the oncoprotein Hdm2. Linares, L.K., Kiernan, R., Triboulet, R., Chable-Bessia, C., Latreille, D., Cuvier, O., Lacroix, M., Le Cam, L., Coux, O., and Benkirane, M. Nat Cell Biol. 2007;9,331-338(Faculty of 1000. FF8).

• Suv39H1 and HP1gamma are responsible for chromatin-mediated HIV-1 transcriptional silencing and post-integration latency. Du Chene, I., Basyuk, E., Lin, Y.L., Triboulet, R., Knezevich, A., Chable-Bessia, C., Mettling, C., Baillat, V., Reynes, J., Corbeau, P., et al. Embo J. 2007;26:424-435.

25



Infection of Dendrit ic cells: Problem solved

Understanding Interactions between HIV and its host

� Objectives:

• Deciphiring the molecular mechanisms involved in HIV-1 latency

• Role of RN Ai in HIV-1 replication

• Identification of host cell factors involved in HIV-1 replication

� Tools:

• Transcriptional analyses

• Chromatin Immunopecipitation (ChIP)

• ChIP combined with deep sequencing and RNA-seq

• Biochemistry

• Cellular and Molecular imaging

• Primary cells isolated from HIV-patients

Identification of Dendretic and myeloid cells specific HIV-1 restriction factor

Vpx interacts and induces proteasomal degradation of VIP8

MW

F/H

-Vpx

Ctr

l �� VIP8

��

VIP8

F/H-Vpx

F/H-Vpx: +

Flag-IP

DDB1

Cul4A

-

R.S.I. 1 0.05 0.7

VIP8

Tubulin

DDB1

Mg132: - +-VLP-Vpx: + +-

26


VIP8 expression is cell type specific and correlates with HIV-1 susceptibility

N.I.

HIV-LUC-G

VLP-Vpx: - +

VIP8

DDB1

Tubulin

THP-1

Fol

dIn

crea

se

6

0

4

8

10

12

2

VIP8

DDB1

Tubulin

- +

MDDC

b

14

6

0

4

810

12

2

VIP8

DDB1

Tubulin

- +

MDM

6

0

4

8

10

2

shRNA Scr VIP8-3

VIP8-4

Fol

dIn

crea

se

THP-1

x12

x4

02

46

810

1214

Fol

dIn

crea

se

shRNA Scr VIP8VIP8R - - +

VIP8

THP-1

0

5

10

15

20

shRNA Scr VIP8

Fol

din

crea

seV

px/n

o V

px

N.I.

HIV-LUC-G

THP-1

0

2

4

6U937

WT mut-VIP8

Fol

dIn

crea

se

0

0.2

0.40.6

0.8

1

1.2

1.4

VIP8 is an HIV-1-restriction factor counteracted by Vpx


Infection of Dendritic cells: Problem solved

27


VIP8 restricts HIV-1 infection of Dendritic cells

Knock-down of VIP8 renders Dendritic cells permissive to HIV-1.

Scr 1 2

HD3

siRNA

HIV-G

Fol

d in

crea

se

(p24

+ ce

lls)

Scr 1 2

HD4

0

10

20

30

40

VIP8 is the dendritic and myeloid cells-specific HIV-1-restriction factor counteracted by Vpx

• How VIP8 expression is regulated both at the transcriptional and protein stability levels?

• What is the natural function of VIP8 in Macrophages and Dendritic cells?

• Does VIP8 bind to viral nucleic acid or proteins?

• Does VIP8 play role in DC-mediated innate immunity?

Perspectives


Infection of Dendritic cells: Problem solved

28



Keywords

• Toxoplasma gondii

• Intracellula r parasite

• Antigen presentation

Major Grants

• ATIP-Avenir team

Inserm U1043 - CNRS UMR5586 - Toulouse University Toulouse

Immunology, cell biology, parasitology

Using recently identified natural T cell epitopes from intracellular parasites such as Toxoplasma gondii, we study the molecular and cell biological mechanisms controlling antigen processing and presentation by MHC class I molecules

Nicolas Blanchard, Ph.D

Immune cells invaded by infectious microorganisms present fragments of the pathogens (antigens) on their

surface. This leads to stimulation of T lymphocytes expressing receptors that specifically recognize the cognate

antigens. These processes are paramount to eliminate or contain the infection.

Our team focuses on infections caused by intracellular parasites. One fascinating example is the protozoan

parasite Toxoplasma gondii. Toxo replicates in a vacuole inside infected cells and persists definitively within an

individual’s brain. Toxo is the causative agent of toxoplasmosis, an opportunistic disease which can trigger

serious neurological disorders in immunocompromised subjects and can have dramatic consequences on the

fetus if infection occurs during pregnancy. Furthermore, Toxo constitutes an attractive model to better

understand Plasmodium the parasite responsible of malaria.

Using a model of toxoplasmosis in the mouse, we take advantage of our previous discoveries, like the

identification of several natural Toxo antigens, among which an immunodominant antigen inducing large

populations of protective CD8 T cells. Our project addresses 3 main goals:

1. Understand how Toxo proteins are transported and degraded by infected cells

2. Analyze how host cell-parasite interactions influence parasite growth and innate recognition

3. Dissect the first steps of T cell priming in the intestine

Our results may suggest strategies to optimize presentation of antigens from intracellular parasites. Hence

they may facilitate the creation of Toxo vaccines in humans and participate in improving vaccines against other

parasites. By studying inflammation induced by Toxo in the mouse gut, our project may also help to better

understand mechanisms leading to human chronic inflammatory bowel diseases (IBD).


• Topological journey of parasite-derived antigens for presentation by MHC class I molecules. Blanchard N, Shastri N. Trends Immunol. 2010 Nov;31(11):414-21. Review.

• Endoplasmic reticulum aminopeptidase associated with antigen processing defines the composition and structure of MHC class I peptide repertoire in normal and virus-infected cells. Blanchard N, Kanaseki T, Escobar H, Delebecque F, Nagarajan NA, Reyes-Vargas E, Crockett DK, Raulet DH, Delgado JC, Shastri N. J Immunol. 2010 Mar 15;184(6): 3033-42.

• Immunodominant, protective response to the parasite Toxoplasma gondii requires antigen processing in the endoplasmic reticulum. Blanchard N, Gonzalez F, Schaeffer M, Joncker NT, Cheng T, Shastri AJ, Robey EA, Shastri N. Nat Immunol. 2008 Aug;9(8):937-44.

• Coping with loss of perfection in the MHC class I peptide repertoire. Blanchard N, Shastri N. Curr Opin Immunol. 2008 Feb;20(1):82-8. Review.

• ERAAP synergizes with MHC class I molecules to make the final cut in the antigenic peptide precursors in the endoplasmic reticulum. Kanaseki T, Blanchard N, Hammer GE, Gonzalez F, Shastri N. Immunity. 2006 Nov; 25(5): 795-806.

29

Antigen processing and parasite immunityMain parasite model : Toxoplasma gondii (Toxo)

� Objectives:

• How are parasite proteins transported and degraded by infected cells ?

• How does parasite vacuole trafficking affect host-parasite interactions ?

• How are T cells primed in the intestine after Toxo oral infection ?

� Tools:

• Toxo : a genetically tractable model of protozoan parasite

• Focus on natural T cell epitopes (as opposed to model antigens)

• Reporter T cell hybridomas to measure antigen presentation levels

• MHC I and MHC II tetramer reagents to track antigen-specific T cells

• Differential susceptibility of inbred and knock-out mouse strains to toxoplasmosis

• shRNA library targeting host vesicular trafficking (collaboration)

• Flow cytometry, confocal imaging, RP-HPLC, antigen presentation assays

Macrophage infected by fluorescent Toxo

Figure 1:Approach to identify natural T cell epitopes from Toxo

Toxo-specific CD8 T cell hybridomas expressing the NFAT-inducible

�-galactosidase reporter gene were used to screen a

cDNA library from Toxo parasites and identify the cognateantigen(s)



Antigen processing and p arasite immunity

30

Figure 2 : Toxo protein GRA6is an immunodominant and protective CD8 T cell antigen

(A) Antigen : protein from Toxo dense granules (GRA6), secreted in parasite vacuoleFinal epitope : decamer peptide (HF10) presented by H2-Ld MHC I

(B) Large CD8 T cell populations respond to GRA6-derived HF10 peptide afterinfection(C) Immunization with HF10 protects against lethal challenge with Toxo

MHC I tetramer

CD836% 0.33% 1.7%0.09%

Brain HF10 (GRA6) SM9 (GRA4) IF9 (ROP7)YL9 (ctrl)

6 days

Toxo > LD100

Immunization Challenge

Peptide-pulsed BMDCs

Protection

AB

C

Figure 3 :Processing in the host cell endoplasmic reticulum is required for GRA6

presentation

GRA6 presentation by Infected BM-macrophages

0 0.75 1.5 3 6 120.0

0.1

0.2

0.3

MOI

CTgEZ.4 resp

onse

(A595)

+/–

ERAAP–/–

HF10-specificCD8+(%

)

GRA6-specificCD8 T cell response in spleen

Toxo

12 days

0

1

2

3

* ERAAP+/+ & +/–

ERAAP–/–

Test the role of ER aminopeptidase associated with antigen processing(ERAAP )

In vitro In vivo




31

Perspectives


Figure 4 :Fusion between parasite vacuole and host ER favors presentation of

parasite-derived antigen

Blockade of ER-vacuole fusion in dendritic cells was achieved by transduction of shRNA targetinga host ER SNARE protein(A)IF detection of TAP2 in shRNA-transduced DCs after infection with OVA/YFP+ Toxo(B) Presentation of OVA secreted by OVA-expressing or control Toxo 8h post-infection was evaluated by measuring the proportion of CD69+ OT-I TCR-transgenic T cells

Collaboration with A. Savina, Curie Institute, Paris and L.F. Moita, Institute of Molecular Medicine, Lisbon

• Examine role of ER-PV fusion in parasite survival and innate immune recog nition.

• Characterize involvement of Toxo-specific T cells d uring Toxo-induced ileitis (CD8

immunomodulatory functions ?).

• Identify immunodominant T cell epitopes in a mouse model of cerebral malaria and analyze

role of parasite-specific CD8 T cells in disease

• Identified the first natural and immunodominant T cell epitope from Toxo

• Expertise in T cell antigen identification by hybridoma generation and expression cloning

• Unique tools to analyze antigen processing and host-parasite interactions from an

immunological standpoint

• Developping new genetically modified parasites

• Strong collaborations strengthening our research on the parasite and cell biology sides




32



Keywords

• Malaria

• Anopheles mosquitoes , • Plasmodium

parasites • Host-paras ite

interactions, • Comple ment-like

proteins

Major Grants

• ERC starting grant

Inserm U963 - CNRS UPR9022 - Strasbourg University Strasbourg

Antiparasitic responses of the malaria mosquito, Anopheles gambiae

Not all mosquitoes transmit malaria parasites to humans. Our objective is to understand what are the genetic factors that render mosquitoes resistant to malaria parasites, and therefore unable to transmit the disease

Stéphanie Blandin, Ph.D

Anopheles gambiae is a major vector for Plasmodium falciparum, the parasite causing the most severe form of

human malaria. With an estimated 250 million infected people every year and another 3.3 billion at risk, it is

one of the biggest scourges of humanity. The ability of mosquitoes to transmit malaria parasites is highly

variable between individuals, with some mosquitoes fully resistant to the parasites and therefore unable to

transmit the disease. A large part of this variability is determined by genetic factors. We previously

demonstrated that different forms (or alleles) of the gene encoding the complement-like protein TEP1 confer

different degrees of resistance to the rodent malaria parasite Plasmodium berghei. Still, our data show that

other genes are involved.

The objective of our group is to decipher the genetic networks that sustain mosquito resistance to the rodent

malaria parasite P. berghei and the human parasite P. falciparum. For this, we develop new tools based on

next-generation sequencing and high-throughput genotyping to efficiently dissect the genetic basis of complex

traits in A. gambiae. The contribution of the identified genes and networks to vector competence in natural

mosquito populations will be further evaluated in malaria-endemic regions. Because resistance naturally occurs

in mosquito populations, this project has implications for the design of novel strategies and/or for the

improvement of existing ones to reduce malaria transmission.


• Dissecting the genetic basis of resistance to malaria parasites in Anopheles gambiae. Blandin SA, Wang-Sattler R, Lamacchia M, Gagneur J, Lycett G, Ning Y, Levashina EA, Steinmetz LM. Science. 2009;326: 147-150.

• Two mosquito LRR proteins function as complement control factors in the TEP1-mediated killing of Plasmodium. Fraiture M, Baxter RH, Steinert S, Chelliah Y, Frolet C, Quispe-Tintaya W, Hoffmann JA, Blandin SA, Levashina EA. Cell Host Microbe. 2009;5:273-284.

• Antimalarial responses in Anopheles gambiae: from a complement-like protein to a complement-like pathway. Blandin SA, Marois E, Levashina EA. Cell Host Microbe. 2008;3:364-374.

• Mosaic Genome Architecture of the Anopheles gambiae Species Complex. Wang-Sattler R, Blandin S, Ning Y, Blass C, Dolo G, Toure YT, Torre AD, Lanzaro GC, Steinmetz LM, Kafatos FC, Zheng L PLoS ONE. 2007;2:e1249.

• Structural basis for conserved complement factor-like function in the antimalarial protein TEP1. Baxter RH, Chang CI, Chelliah Y, Blandin S, Levashina EA, Deisenhofer J. Proc Natl Acad Sci U S A. 2007;104:11615-11620.

• Evolutionary dynamics of immune-related genes and pathways in disease-vector mosquitoes. Waterhouse RM, Kriventseva EV, Meister S, Xi Z, Alvarez KS, Bartholomay LC, Barillas-Mury C, Bian G, Blandin S, Christensen BM, et al. Science. 2007;316:1738-1743.

33


Stephanie Blandin, Ph.D

Resistance to Malaria par asites

in the mosquito Anopheles gambiae

� Objectives:

• What makes mosquitoes resistant to malaria parasites?

• What are the differences between mosquito responses to human and rodent malaria

parasites?

� Tools:

• Laboratory models of infections

• Next-generation sequencing technologies

• High throughput genotyping

• Forward genetics / QTL mapping

• Functional analysis by RNA interference

• Molecular and cellular biology tools

Susceptible (S) strain

Resistant (R) strainCollins, Science 1986

Mosquito midguts, 8 days post infectionwith GFP expressing parasites

Figure 1 : rasRNAi to assess the contribution of different allelesto a phenotypic trait

Reciprocal allele-specific RNA interference (rasRNAi) can be used to specifically silence one or the other allele of a given gene in the same geneticcontext, in order to compare their contribution to a trait.rasRNAi can be applied to all organisms where RNAi is feasible to dissect complex phenotypes to the level of individual quantitative trait alleles.

Allele-specific dsRNA probes:

F1: R x S

34





Figure 2 : Polymorphisms in TEP1 confer resistance

TEP1 is a mosquito complement-like protein with antiparasitic activity.Polymorphisms in the TEP1 gene affect parasite survival: mosquitoesexpressing only the susceptible form of TEP1 (dsR group) carry more parasites than those expressing only the resistant form (dsS group).

F1: R x S

Figure 3 : Complement-like structure of TEP1

TEP1 protein structure is very close to that of human complement factor C3.

Most differences between the resistant TEP1*R1 and susceptible TEP1*S3 alleles are located in the 3’half, encoding the α-ring thatmediates binding to pathogensurfaces in complement C3.

0

0.1

0.2

0 300020001000 4000

Ka

Nucleotide Position (bp)

*S3/*R1

Average divergence between allelesat non synonymous sites (Ka)

TEP1*R1 vs.TEP1*S3

Humancomplement factor

A. gambiae

35

Perspectives






• Improved tools for genetic analysis in A. gambiae.

• Identification of genetic networks controlling resistance to rodent and human

parasites in laboratory conditions.

• Genetic and environmental factors controlling resistance in field mosquitoes.

• Mosquito-based strategies to limit malaria transmission

• Strong expertise in laboratory models of infection of A. gambiae by Plasmodium

parasites

• New insectary to be built in Strasbourg, including facilities for P. falciparum

infection (Plan Campus)

• Strong expertise in immunology and insect immunity + common environment

with groups studying Drosophila immunity

• Access to imaging and proteomics platforms on site, and to next generation

sequencing and structure analyses through collaborations

• From laboratory models to the field: access to field mosquitoes and

experimental infections in Cameroon through collaboration with IRD laboratory

36



Keywords

• Q fever

• Coxiella burnetii

• Transposon mutagenesis

• Cellular microbiology

• Automated microscopy

Major Grants

• ATIP-Avenir Team

• Programme de mécénat partenariat Aviesan/Sanofi Aventis

CNRS UMR5236 Montpellier

Centre d'études d'agents Pathogènes et Biotechnologie pour la Santé (CPBS)

Bacterial infections

The aim of our research is to investigate and understand Coxiella infections, to understand how this pathogen subverts host functions, design new therapies to cure infections, develop diagnostic tools and vaccines

Matteo Bonazzi, Ph.D

Coxiella burnetii is an obligate intracellular gram-negative bacterium responsible of the zoonosis Q fever, a

disease that manifests as an acute flu-like illness.

Coxiella infects domestic ruminants, pets and arthropods resulting in usually asymptomatic infections but it can

lead to miscarriages and stillbirths.

The main source of infection for human hosts is contaminated aerosols, as a consequence population at risk of

contamination includes farmers, veterinarians, and slaughterhouse workers. Although acute Q fever is not

associated with a high mortality rate (2% approximately) it provokes acute disabling disease and it can lead to

chronic infections that have fatal complications such as endocarditis pneumonia and hepatitis.

As many as 65% of the patients affected by chronic Q fever may die of the disease.

Due to its high infectivity it has been classified as a class B biothreat and is responsible of severe outbreaks

with a very high economic impact on rural areas.

Despite the scientific and economic interest that Coxiella infections raise, its obligate intracellular nature has

hampered the research activity due to the impossibility of genetic manipulation and growth in broth. The

mechanisms of subversion of host functions remain therefore obscure and the number of Coxiella virulence

factors identified is to date very limited. The recent characterization of a specific growth medium that allows

axenic growth of Coxiella opens the way to genetic engineering of the bacterium.

The laboratory of Cell Biology of Bacterial Infections is a newly set up unit at the CPBS in Montpellier. The aim

of this project is the large-scale identification of Coxiella burnetii virulence factors by generating a bank of

mutants by transposon mutagenesis. This will be coupled to the set up of robust high throughput screens to

identify phenotypes that will allow the characterization of virulence factors.

Genes of particular relevance in the infectious cycle of Coxiella will be then sorted and analysed in detail by

common cellular microbiology approach. Our study will contribute significantly to the understanding of Coxiella

pathogenesis and will serve the development of alternative therapeutic strategies and animal vaccines to

prevent future outbreaks.


• Entrapment of intracytosolic bacteria by septin cage-like structures. Mostowy, S. Bonazzi, M. et al. Cell Host Microbe. 2010;8:433-444.

• Listeria monocytogenes internalin and E-cadherin: from bench to bedside. Bonazzi, M., Lecuit, M. & Cossart, P. Cold Spring Harb Perspect Biol. 2009;1:a003087.

• Successive post-translational modifications of E-cadherin are required for InlA-mediated internalization of Listeria monocytogenes. Bonazzi, M., Veiga, E., Pizarro-Cerdá, J. & Cossart, P. Cell Microbiol. 2008;10:2208-2222.

• Invasive and adherent bacterial pathogens co-Opt host clathrin for infection. Veiga, E., Guttman, J., Bonazzi, M. et al. Cell Host Microbe. 2007;2:340-351.

37



Large scale identificati on

of Coxiella burnetii vir ulence factors

� Objectives:

• Understand the cell biology of Coxiella infections

• Identify virulence factors that regulate Coxiella replication within host cells.

• Identify novel host factors involved in the intracellular cycle of Coxiella

� Tools:

• Library of Coxiella mutants generated by transposon

mutagenesis

• Imaging-based high throughput screens

• Eukaryotic genome-wide siRNA libraries

High-throughput screen

of putative Coxiella burnetii virulence factors

Gram negative bacterium

Obligate intracellular

Genome sequenced in 2003

World-wide spread

Causative agent of the zoonosis Q fever(acute and chronic phase)

Coxiella burnetii

a closer look

38





Gram negative bacterium

Obligate intracellular

Genome sequenced in 2003

World-wide spread

Coxiella burnetii

a closer look

Causative age nt of the zoonosis Q fever(acute and chronic phase)

Inhibition of apoptosis

No virulence factors identified to-date

High-throughput screen of putative

Coxiella burnetii virulence factors

Growth curve by fluorescence intensity

Mul

timod

e P

late

Rea

derCm+ RFP Axenic growth Infection of host ce lls in 96-wells plates

Step-by-step analysis of Coxiella intracellular cycle

•Hits validation•Protein tagging•Protein purification•Antibody production•Y2H screens•Interactor/s analysis•Manipulation of host functions

In depth characterization of a gene of interest

39





• Pioneering the cell biology of Coxiella infections in Europe

• Strong expertise in Bacteria-host interactions

• Innovative approaches for high-throughput screening and high-content data analysis

• Extended network of collaborations with leaders in the field of Cell Biology and Cellular

Microbiology

• Access to cutting-edge technology


40



Major Grants

• 2010-2015: ERC-2010-StG-Proposal nº260901

• 2006-2010: Inserm Avenir

Keywords

• Cellular Microbiology

• Chemi cal genomics

• Mycobacterium tuberculosis

• Macrophages

• Automated confocal imaging

Inserm U1019 - CNRS UMR8204 - Institut Pasteur Lille - Lille-Nord de France University Lille

Center for Infection and Immunity of Lille

Cellular Microbiology and chemical genomics of Mycobacterium tuberculosis colonization into host cells

We developed type of assays based on the visualization of mycobacterium replication within host cells and applied it to large scale genome wide screen for the identification of compounds and genes that are involved in intracellular bacterial growth and persistence

Priscille Brodin, Ph.D

Tuberculosis (TB) is an infectious disease caused by the Mycobacterium tuberculosis bacillus that results in millions of deaths annually, and an increasing number of drug resistant cases are being reported each year. New drugs – and new drug targets – are urgently needed.

M. tuberculosis persists and replicates within macrophages (i.e., professional phagocytic cells) using a variety of mechanisms, including inhibition of phagosome maturation, escape to the host cell cytosol, induction of host macrophage apoptosis, and resistance to killing by oxygenated metabolites. Host-pathogen cross-talk is then established, leading to a balance between M. tuberculosis virulence factors and the macrophage antibacterial response, to create a niche favourable to the infection.

Detailed elucidation of the manner in which the host macrophage initiates innate immune responses upon infection by pathogenic mycobacteria, and how the latter escapes immune surveillance, will contribute to a better understanding of tubercle bacillus persistence and latency. To this end, we have been taking unbiased, three-dimensional, large scale approaches using visual phenotypic assays (relying on monitoring by automated confocal fluorescence microscopy) of the trafficking and replication of M. tuberculosis inside macrophages. Screening of an 8,000 member small interfering RNA (siRNA) library, an 11,000 member M. tuberculosis mutant library and 200,000 small chemical molecules has led to the identification of key host and mycobacterial genes involved in the trafficking and replication of M. tuberculosis in mammalian macrophages, as well as chemicals able to prevent bacterial intracellular growth.

Using this set of results, together with automated confocal fluorescence microscopy and cellular microbiology techniques, our project is to further explore the signalling pathways used specifically by M. tuberculosis. On the pathogen side, we will focus on the in depth study of bacterial protein effectors belonging to the ESX and PPE families. On the host side, we will focus on understanding how host cell protein promotes intracellular mycobacterial survival. Lastly, chemicals that target cellular partners of M. tuberculosis could constitute a new starting point for the development of drugs able to counteract host response manipulation without directly targeting the pathogen, thereby overcoming the issue of the emergence of drug-resistant strains.

Altogether, our results will contribute to a better appreciation of the host manipulation exerted by the tubercle bacillus for its successful escape from immune surveillance.


• Ethionamide boosters: Synthesis, Biological Activity and Structure-Activity Relationship of a series of 1,2,4-oxadiazole EthR inhibitors. Flipo M, Desroses M, Lecat-Guillet N, Dirie B, Carette X, Leroux F, Piveteau C, Demirkaya F, Lens Z, Rucktooa P, Villeret V, Christophe T, Jeon HK, Locht C, Brodin P, Deprez BP, Baulard A, Willand N. J Med Chem. 2011 Mar 21.

• High content phenotypic cell-based visual screen identifies Mycobacterium tuberculosis acyltrehalose-containing glycolipids involved in phagosome remodeling. Brodin P, Poquet Y, Levillain F, Peguillet I, Larrouy-Maumus G, Gilleron M, Ewann F, Christophe T, Fenistein D, Jang J, Jang MS, Park SJ, Rauzier J, Carralot JP, Shrimpton R, Genovesio A, Gonzalo-Asensio JA, Puzo G, Martin C, Brosch R, Stewart GR, Gicquel B, Neyrolles O. PloS Pathogens. 2010 Sep 9;6(9). pii:e1001100.

• High-content imaging of Mycobacterium tuberculosis-infected macrophages: an in vitro model for tuberculosis drug discovery. Christophe T, Ewann F, Jeon HK, Cechetto J, Brodin P. Future Medicinal Chemistry. 2010;2(8):1283-1293.

• High content screening identifies decaprenyl-phosphoribose 2' epimerase as a target for intracellular antimycobacterial inhibitors. Christophe T, Jackson M, Jeon HK, Fenistein D, Contreras-Dominguez M, Kim J, Genovesio A, Carralot JP, Ewann F, Kim EH, Lee SY, Kang S, Seo MJ, Park EJ, Skovierová H, Pham H, Riccardi G, Nam JY, Marsollier L, Kempf M, Joly-Guillou ML, Oh T, Shin WK, No Z, Nehrbass U, Brosch R, Cole ST, Brodin P. PloS Pathogens. 2009 Oct; 5(10):e1000645.

• Benzothiazinones Kill Mycobacterium tuberculosis by Blocking Arabinan Synthesis. Makarov, V.; Manina, G.; Mikusova, K.; Mollmann, U.; Ryabova, O.; Saint-Joanis, B.; Dhar, N.; Pasca, M. R.; Buroni, S.; Lucarelli, A. P.; Milano, A.; De Rossi, E.; Belanova, M.; Bobovska, A.; Dianiskova, P.; Kordulakova, J.; Sala, C.; Fullam, E.; Schneider, P.; McKinney, J. D.; Brodin, P.; Christophe, T.; Waddell, S.; Butcher, P.; Albrethsen, J.; Rosenkrands, I.; Brosch, R.; Nandi, V.; Bharath, S.; Gaonkar, S.; Shandil, R. K.; Balasubramanian, V.; Balganesh, T.; Tyagi, S.; Grosset, J.; Riccardi, G. & Cole, S. T. Science. 2009 May 8;32455928-.801-4.

41



Chemical Genomics Approach es

of Intracellular Mycobacterium tuberculosis

� Objectives:

• How does the intracellular replication and survival of Mycobacterium tuberculosis

contribute to tuberculosis pathogenesis?

• What are the molecular and the cellular mechanisms used by virulent M. tuberculosis

to survive inside the macrophage?

• Can small molecules that selectively interfere with intracellular replication of M.

tuberculosis enrich the antituberculosis drug regimen?

� Tools:

• High content imaging and automated confocal microscopy in Biosafety Level 3 (BSL-3)

• Mycobacterium tuberculosis and clinical isolates

• Small animal studies

• Chemical and genetic libraries

Figure 1: High content assay monitoring the replication ofM. tuberculosis inside host macrophages

M. tuberculosis parasitizes and repli cates within host macrophages

InvasionSurvivalReplication

Day 0 1 2 3 5 6

Red-MacrophagesInfected withGreen M. tub

Non-infected

%Infected cells Cell number

Use of %Infected cells as read out for M. tuberculosis intracellular replication

42





Figure 2 : Quantification of early trafficking of M. tuberculosis inside host macrophages

AttenuatedRed-M. tub

Wild type M. tub

Subcellular localisation withinLysosomesLysotr acker signal positiveCell nucleus i n blue

1 2

3 4

Use of Lysotracker signal as a positive read out for M. tuberculosis trafficking into the lysosomes

0 100 200 300 400 500

0

500

1,000

1,500

2,000

Cell nuclei number

Surf

ace

of ly

soso

mes

prox

imal

to

cell

nucl

ei

P55C04

P55D03

Mean

Mean + 3s.d.

43

Perspectives






• A Comprehensive Picture of the Specific Signalling Network of M. tuberculosis

inside the Host cells

• Compounds that selectively inhibit the intracellular tubercle bacillus

• HCS platforms in NSB-3 dedicated to infectious diseases at Institut Pasteur of Lille

• Strong Expertise in M. tuberculosis Durg Discovery:

- High content screening on M.tuberculosis infected macrophages for drugdiscovery project.

- Large scale visual genetic screens on M.tuberculosis trafficking into host macrophages.

• High Content Screening in Biosafety Level 3.

• Strong international collaborations on M.tuberculosis drug discovery (member of the « More Medecines for Tuberculosis » FP7 consortium).

44



Major Grants

• ATIP

• Several european projects (Flavitherapeutics, SAR-DTV, SHIVA, VIZIER (IP, 24 labs, coordinator)

• European I3 Project : « The European Virus Archive (EVA) »

• European Integrated Project (IP) « SILVER »

• European ITN : « EUVIRNA »

• Direction Générale de l’Armement

• Fondation pour la Recherche Médicale

• ANR « Maladies Infectieuses Emergentes » : Nidovirus

Keywords

• Dengue

• West Nile

• Hepatitis C

• HIV

• SARS-Coronavirus

• Chikungunya

• Arenavirus

• Bunyavirus

• Drug design

• Drug resistance

• Structure

• Cristallography

• Replication

• Transcription

• RNA capping

• Mechanism

CNRS UMR6098 - Méditerranée University Marseille

Antiviral research, structural biology, structure-based drug-desig n, viral enzyme mechanisms

Structural and functional characterisation of viral enzymes in order to design antivirals against RNA viruses

Bruno Canard, Ph.D

Research is focusing on emerging RNA virus replication and transcription as targets for drug design. The lab

has established leadership at an international level through a multidisciplinary approach now organized around

the three title fields (structure, mechanisms, and drug design). The main activity of the group is RNA replication

(RNA polymerases, primases, helicases…) and RNA capping (RNA triphosphatases, guanylyltransferases, and

methyltransferases).

Determination of crystal structures of viral enzymes is a centerpiece of our activity, and is key to decipher

molecular mechanisms and inhibition of enzymes with a drug design aim. The group uses intensively inter-viral

family comparison in order to unravel novel mechanisms at work in many viruses such as Dengue, hepatitis C,

HIV, SARS-Coronavirus, Chikungunya, Arenaviruses, Bunyaviruses. The group is running an IBISA labelled

platform dedicated to the screening of antiviral molecules (cellular subgenomic viral replicons and enzyme

tests), with external collaborative expertises in in silico drug screening, and infectious clone studies on clinical

isolates.

The group activity is supported by a solid network of international collaborations, through projects such as FP6-

VIZIER and FP7 SILVER, which have profoundly irrigated the team with exchanges, methodologies,

networking, and data management procedures. Over these years, the group has created its own unique

scientific niche, has published >120 articles in refereed journals, and has deposited >41 structures in the PDB.

Bruno Canard got the William Prusoff prize for antiviral research in 2008.


• The N-terminal domain of the arenavirus L protein is an RNA endonuclease essential in mRNA transcription. Morin B, Coutard B, Lelke M, Ferron F, Kerber R, Jamal S, Frangeul A, Baronti C, Charrel R, de Lamballerie X, Vonrhein C, Lescar J, Bricogne G, Günther S, Canard B. PLoS Pathog. 2010 Sep; 16;6(9).

• In vitro Reconstitution of SARS-Coronavirus mRNA Cap Methylation. Bouvet M, Debarnot C, Imbert I, Selisko B, Snijder EJ, Canard B, Etienne Decroly. PLoS Pathogens. 2010 Apr; 22;6(4):

• RNA-dependent RNA polymerases from flaviviruses and Picornaviridae. Lescar J, Canard B. Curr Opin Struct Biol. 2009;19(6):759-67.

• The crystal structures of Chikungunya and Venezuelan equine encephalitis virus nsP3 macro domains define a conserved adenosine binding pocket. Malet H, Coutard B, Jamal S, Dutartre H, Papageorgiou N, Neuvonen M, Ahola T, Forrester N, Gould EA, Lafitte D, Ferron F, Lescar J, Gorbalenya AE, de Lamballerie X, Canard B. J Virol. 2009;83(13):6534-45.

• The crystal Structure of the Dengue virus RNA-dependent RNA polymerase catalytic domain at 1.85 A resolution. Yap TL, Xu T, Chen YL, Malet H, Egloff MP, Canard B, Vasudevan SG, Lescar J. J Virol. 2007; 81(9):4753-65.

• Crystal structure of the RNA polymerase domain of the West Nile virus non-structural protein 5. Malet H, Egloff MP, Selisko B, Butcher RE, Wright PJ, Roberts M, Gruez A, Sulzenbacher G, Vonrhein C, Bricogne G, Mackenzie JM, Khromykh AA, Davidson AD, Canard B. J Biol Chem. 2007;282(14):10678-89.

45


Bruno Canard, Ph.D

Viral Replication: Str ucture, Mechanisms

and Drug-Design

� Objectives and Strategies

(1)- Structure - to determine three dimensionnal structures of RNA virus proteins involved in replication and transcription of viral RNAs.

methods: X-ray crystallography, EM

(3)- Drug design – to discover and design inhibitors of RNA virus proteins involved in replication and transcription of viral RNAs.

methods: screening, organic synthesis

(2)- Mechanisms – to propose detailed catalytic and regulatory mechanisms of RNA virus proteins involved in replication and transcription of viral RNAs.

methods: kinetics (PSS and SS), mutagenesis, biophysical assays

Viral RNA replication and capping enzymes

EMERGINGVIRUSES

RE-EMERGING & RESISTANCE

1970 1980 1990 2000 2007

HIV VirusRetrovirus

1983, France

EmergingEmerging virusesviruses: : presentpresent and future and future threatsthreats

Hendra VirusParamyxovirus1994, Australia

OutbreakAvian

influenzavirus H5N1

Orthomyxovirus1997, Hong Kong

Ebola VirusFilovirus

1976, Sudan

Sin Nombre Virus

Bunyavirus Hantavirus1993, USA

West Nile VirusFlavivirus

1999, USA NY

ChikungunyaVirus

Togavirus2005-2006 Réunion Island

India

Dengue VirusFlavivirus

70’S

Nipah VirusParamyxovirus1999, Malaysia

SARS CoronavirusCoronavirus2003, China

Most emerging viruses are RNA viruses with a zoonotic origin

46


A new concept: scientific preparedness

Hepatite C polymeraseDengue and West-Nile

polymerasesDengue 2’-O-Methyltransferase

SARS :

Coxsackie Polymerase LCMV Polymerase Chikungunya nsp3

Rougeole P

nsp3 nsp9 nsp10

nsp15 nsp16

Major achievements: viral targets for drug design

Major achievements: SARS Coronavirus proteome

Publications: Canard et al. (2008) Antiviral Research. PNAS, EMBO J, PLoS Pathogens, J. Virol. J. Biol. Chem.,…

nsp16

AFMB

AFMB

AFMB

AFMB

AFMB

The AFMB is the structural

biology lab having solved

the largest number of SARS-

CoV proteins

5 crystal structures, one

complex out of 16

replication proteins

Bruno Canard, Ph.D

Viral Replication: St ructure, Mechanisms

and Drug-Design

47



• Leader in the field of structure-mechanism studies of viral replicases: RNA capping,

RNA replication, complexes

• Unique reactivity in setting up focused research projects

• Access to a dedicated drug discovery screening platform with possible medicinal

chemistry optimization process (small molecule developement, Hit to Lead)

• Strong collaborative network allowing easy access to state-of-the-art know-how and

technologies in the world (EVA, SILVER, EUVIRNA European FP7 projects)

Drug design – Major achievements

Radioactive screen Fluorescent screen

Biomek 3000® 8-channelpipetting head

Biomek NX® 96-channelPipetting head

Wallac MB Trilux ®counter

HTRF FluorimeterSafire 2®

Dedicated database with barcode system

On-going campaigns

An IBISA –certified screening platform dedicated to antiviral research

NO2

SNH

HOOO2N

3438IC50 = 3,7 uM

N NH

OH

OHOH

HO

OH 1231IC50 = 3,3 uM

linkerRR

Hit-to lead: 4 Families of compounds. Parallel synthesis and

purification of more than 100 analogues

Bruno Canard, Ph.D

Viral Replication: St ructure, Mechanisms

and Drug-Design

48



Keywords


• Vaccinatio n

• HIV

• Influenza

• Preclinical studies

• Clinical trials

Inserm U945 - Pierre and Marie Curie University Paris Paris

Innovation in vaccination strategies against infectious diseases

Béhazine Combadière, Ph.D

Easily administrated vaccine is critical priority in overall plan to contain infectious disease in endemic areas that suffer from poor accessibility to drugs and sanitary conditions.

Conventional immunization techniques by intramuscular or intradermal injection shows downsides and hazards including the risk of infection, instability of the vaccine preparation and injury due to improper injection techniques. New approaches addressing methods of cutaneous and mucosal vaccination with the benefits of a needle-free methods, has also brought novel insight in immune responses to vaccines. Among those, targeting of professional antigen-presenting cells (APCs) of the skin and mucosal surface are thus fundamental for rational vaccine design because they initiate, maintain, regulate and orientate adaptive immune responses.

A translational research is therefore critical to propose innovative approaches taking into account past vaccination experience that are rich of successes and failures. Confronted to the complexity of the immune responses to infectious diseases, only combination of our knowledge on basic understanding of infectious diseases, insight on vaccine efficacy and innovative preclinical models will succeed to control and/or eradicate infectious diseases.

We have recently demonstrated that penetration of vaccine compounds via the hair follicular ducts largely surrounded by Langerhans cells (LC) induces potent-cellular responses after transcutaneous (needle-free) application of inactivated influenza vaccine This work was rapidly followed by a Phase clinical trial on an innovative method of transcutaneous (TC) testing an inactivated influenza/tetanus vaccine. This new route has proved to be possibly safe; preferentially inducing CD8 mediated cellular immunity compared to intramuscular route (IM).

The significant enhancement of vaccine-specific CD8 T-cells by TC route has suggested that a similar immunogenicity could be obtained with for other infectious diseases such as HIV, influenza, Malaria. Based on our basic understanding of skin immunology, we aim to understand, innovate and develop vaccination strategies that will succeed in long-term protection to infectious diseases in developed and developing countries.

Major Grants

• EU_FP7 CUT’HIVAC scientific Coordinator (13 partners)

• Fondation pour la Recherche Médicale : Laureat of Therapeutic Team

• EU_FP6 MuNanoVac : WorkPackage leader (4 partners)

• ANR young research investigat

• ANR Bio-emergence

• Joliot-Curie Price selection Women in Research

Immunity and Infection


• Preferential amplification of CD8 effector-T cells after transcutaneous application of an inactivated influenza vaccine: a randomized phase I trial. Combadière B, Vogt A, Mahé B, Costagliola D, Hadam S, Bonduelle O, Sterry W, Staszewski S, Schaefer H, van der Werf S, Katlama C, Autran B, Blume-Peytavi U. PLoS One. 2010 May 26;5(5):e10818.

• Control of vaccinia virus skin lesions by long-term-maintained IFN-gamma+TNF-alpha+ effector/memory CD4+ lymphocytes in humans. Puissant-Lubrano B, Bossi P, Gay F, Crance JM, Bonduelle O, Garin D, Bricaire F, Autran B, Combadière B. J Clin Invest. 2010 May 3;120(5):1636-44.

• Original encounter with antigen determines antigen-presenting cell imprinting of the quality of the immune response in mice. Abadie V, Bonduelle O, Duffy D, Parizot C, Verrier B, Combadière B. PLoS One. 2009 Dec 7;4(12):e8159.

• Infiltration of CD4+ lymphocytes into the brain contributes to neurodegeneration in a mouse model of Parkinson disease. Brochard V, Combadière B, Prigent A, Laouar Y, Perrin A, Beray-Berthat V, Bonduelle O, Alvarez-Fischer D, Callebert J, Launay JM, Duyckaerts C, Flavell RA, Hirsch EC, Hunot S. J Clin Invest. 2009 Jan;119(1):182-92.

• Nanoparticle-based targeting of vaccine compounds to skin antigen-presenting cells by hair follicles and their transport in mice. Mahe B, Vogt A, Liard C, Duffy D, Abadie V, Bonduelle O, Boissonnas A, Sterry W, Verrier B, Blume-Peytavi U, Combadiere B. J Invest Dermatol. 2009 May;129(5):1156-64.

• Transcutaneous anti-influenza vaccination promotes both CD4 and CD8 T cell immune responses in humans. Vogt A, Mahé B, Costagliola D, Bonduelle O, Hadam S, Schaefer G, Schaefer H, Katlama C, Sterry W, Autran B, Blume-Peytavi U, Combadiere B. J Immunol. 2008 Feb 1;180(3):1482-9.

• Trapping and apoptosis of novel subsets of memory T lymphocytes expressing CCR6 in the spleen of HIV-infected patients. Lécureuil C, Combadière B, Mazoyer E, Bonduelle O, Samri A, Autran B, Debré P, Combadière C. Blood. 2007 May 1;109(9):3649-57.

• 40 nm, but not 750 or 1,500 nm, nanoparticles enter epidermal CD1a+ cells after transcutaneous application on human skin. Vogt A, Combadiere B, Hadam S, Stieler KM, Lademann J, Schaefer H, Autran B, Sterry W, Blume-Peytavi U. J Invest Dermatol. 2006 Jun;126(6):1316-22.

49

� Objectives:• Fundamental insight into immunity to infectious diseases that are spreading in

developed and developing countries.

• Discovery of alternative methods of vaccination against infectious diseases in order

to increase their efficacy

• Understanding skin immunological role for initiation and maintenance of immunity

to infectious diseases

• Translation of basic research using novel pre-clinical models into clinical trials for

vaccination

� Tools:• Human skin explants for in vitro vaccine penetration and imaging

• Innovative Pre-clinical mice models for in vivo studies and video imaging

• Human clinical trials for ex vivo studies of vaccine efficacy

SKIN : A HIGHLY RELEVENT TARGET TISSUE FOR VACCINATION

�� !��"� �� #�$%& �� '� ��'#��()* �� + �� #�$%& �� '� ��'#

� ,-. -/0- 1231.34564/23 27 8527.99/236: 634/0.3;85.9.34/30 1.::9 /3 4-. 9</3 4-64 65. 15=1/6: /3 4-.4-. .77/161> 27 ?611/364/23 606/394 /37.14/2=9 @/9.69.9 63@ A294:> 6B9.34 25 64 :2C @.39/4> /3 4/99=.9=9.@ 725 123?.34/236: 52=4. 27 ?611/364/23 D/3456A=91=:65 25 9=B1=463.2=9E


Behazine Combadière, Ph.D

Vaccination

and Immune Memory to Vaccines

50

SKIN : ALTERNATIVE METHODS OF VACCINATION

NeedleSC

Micro-needle

ID

Patch

« Mantoux » methodID

Cyanoacrylate surface stripping« hair-follicular

targeting »Stratum corneum

Epidermis

Dermis

Hypodermis

Langerhanscells

Dermal dentriticcells

Macrophage like

Dendritic cells Lymphatic and bloodcapillary vessels

Monocytes��

Transcutaneous : a needle-free vaccination

�� !"#$%&'(%)"#$%&*+#,+-$./#0"-$ 1 2+ ��+' �� ' �� 3��4��'��+5 �6� ��6 ��+� ! �'�5 �� '��+5 �� 7 8)9 �� +��+' �� '

:;<=> ?@A> BCDE=>F?GH IIJK LIM NOLKP

�4�� " ��+6 ��+� + ��+ �� Q' � (8 ())RS ��T�� U�+�3�� R ())VS W4X(YYVZRV[ %� �� ! � \2$S�� S '��S Q�� S & ��S $'+�� ]^_ Na b c_Jd` Na JPe fJ NN `P gM NJ hLNJ i jM hkM NJPlm n NIJ_ c_Jd` Na JPei GH _OMP JH _ n PP`_KHLNP oK kL II N mpqrsqtquvwvxyq z {|}~��

�,0�"#�,0& ."��&+,#�"+%0� /� ,0+%�"0��#"�"#"0+%,� �!�.�+/+/�%. � ."��& %0)-.+%/0



Vaccination


51

PERSPECTIVES : VACCINATION AND IMMUNE MEMORY TO VACCINES

�-$,0 &�%0"�(�,0+&�-$,0%$$-0" ."��&�,..%0"&��!��3�� + �� S � ��'�� + �� S � ��+ �T�+��T ��'S ��$��

�� ! ��"� !��#"#.�%0%.,� $/)"� �$%&'()'! %(�'*"./0&%+-+%/0 /� �-$,0 &�%0 ,0)�-$,0 %$$-0" ."��&

��('(�&� �*(&�**+,0),#) /("#,+%0� (#/."")-#"/� +#,0&.-+,0"/-& ,((�%.,+%/0�#"#.�%0%.,� $/)"�&


• Unique approach for needle free vaccination by hair follicular targeting

• Strong expertise in cellular immunity to infectious diseases

• Innovative pre-clinical models of humanized mice

• Translational research from basic research to clinical trials

• Innovative vaccine trials for alternative therapeutic and preventive vaccination that

combined routes of immunization and vaccine delivery system

• Strong collaboration with developed and developing countries for clinical trials

implementation : coordination of EU-FP7 (CUT’HIVAC) Cutaneous and Mucosal HIV

vaccination (Germany, France, UK, Spain, Finland, Peru, Mozambique)



Vaccination


52



Keywords

• Hepatitis C • HCV • Neutralizing

antibodies • Viral assembly and

envelopment • Gene therapy • Vaccines • Cell entry • Receptors • Envelope

glycoproteins • Host responses • Screening • Antivirals

Inserm U758 – Lyon I University - Ecole Normale Supérieure de Lyon Lyon

François-Loïc Cosset, Ph.D

Owing to their capacity to mediate functional entry into cells, we have shown that VLPs are easily amenable for development in diagnostics and screening developments, such as, for example, the determination of neutralizing antibody host responses against highly pathogenic viruses in low containment laboratories and the discovery of antiviral molecules or of genes that influence virus entry, respectively.

We have also shown that VLPs are very promising vaccine platforms that combine the advantages of sub-unit vaccines, i.e. their high bio-safety features, and those of inactivated or attenuated viruses, i.e. their strong immunogenicity. Furthermore, since the assembly of VLPs does not require viral replication and propagation, as opposed to true viruses, this offers many possibilities for structural modifications of the displayed antigens through genetic manipulation. Thus, aiming to present epitopes that otherwise would be difficult to reveal in conventional attenuated/inactivated vaccines, we have demonstrated that such engineering can trigger immune responses that may eventually be poorly or not induced naturally.

We are interested in antiviral developments against several different agents (HCV, Dengue, Influenza, hMPV and RSV). Here, we will discuss novel vaccine candidates against highly pathogenic avian influenza viruses (HPAIV) and hepatitis C virus (HCV). VLPs associating envelope glycoproteins derived from HCV and HPAIV induced potent neutralising antibody responses in mice and macaques. Interestingly, VLPs engineered to display the HCV E1 glycoprotein elicited neutralising antibody responses of broad specificity against major HCV genotypes. Likewise, VLPs incorporating appropriately engineered HPAIV hemagglutins induced cross-reactive neutralising antibodies. Vectorization of these novel immunogens induced strong and potent humoral responses that were protective against lethal HPAIV challenge.

Major Grants

• ERC-AdG • FP6 • FP7

Engineering virus-like particles (VLPs): too ls for diagnostics, screening and vaccine developments. Basic research in the biology of enveloped viruses (HCV, retroviruses…): assembly, envelopment, neutralisation and cell entry


• SR-BI mediates different steps of HCV entry into cells, involving ApoE associated to HCV particles and direct or indirect interactions with HCV E2. Dao Thi, VL, C Granier, M Zeisel, J Mancip, O Granio, F Penin, D Lavillette, T F Baumert, M Dreux* and F-L Cosset*. 2011.

• Functions of the scavenger receptor class B type I during HCV entry into cells. Dao Thi, VL, M Dreux* and F-L Cosset*. Expert Reviews in Molecular Medicine. 2011. in press.

• A concerted action of hepatitis C virus p7 and nonstructural protein 2 affects Core subcellular localization and virus assembly. Boson, B, O Granio, R Bartenschlager, F-L Cosset. PLoS Pathog. 2011. In revision.

• Identification of interactions in the E1E2 heterodimer of hepatitis C virus important for cell entry process. Maurin, G., J Fresquet, O Granio, C Wychowski, F-L Cosset* and D Lavillette*. J Virol. 2011. In revision.

• DNA Vaccination with a Single-Plasmid Construct Coding for Viruslike Particles Protects Mice against Infection with a Highly Pathogenic Avian Influenza A Virus. Szecsi, J., G. Gabriel, G. Edfeldt, M. Michelet, H. D. Klenk, and F. L. Cosset. J Infect Dis. 2009;200:181-90.

• Efficient and stable transduction of resting B-lymphocytes and primary chronic lymphocyte leukemia cells using measles virus gp displaying lentiviral vectors. Frecha, C., C. Costa, C. Levy, D. Negre, S. J. Russell, A. Maisner, G. Salles, K. W. Peng, F. L. Cosset*, and E. Verhoeyen*. Blood. 2009;114:3173-3180.

• Receptor complementation and mutagenesis reveal SR-BI as an essential HCV entry factor and functionally imply its intra- and extra-cellular domains. Dreux, M., V. L. Dao Thi, J. Fresquet, M. Guerin, Z. Julia, G. Verney, D. Durantel, F. Zoulim, D. Lavillette, F. L. Cosset*, and B. Bartosch*. PLoS Pathog. 2009; 5:e1000310.

• Stable transduction of quiescent T cells without induction of cycle progression by a novel lentiviral vector pseudotyped with measles virus glycoproteins. Frecha, C., C. Costa, D. Negre, E. Gauthier, S. J. Russell, F. L. Cosset*, and E. Verhoeyen*. Blood. 2008;112:4843-52.

• Characterization of fusion determinants points to the involvement of three discrete regions of both E1 and E2 glycoproteins in the membrane fusion process of hepatitis C virus. Lavillette, D., E.-I. Pécheur, P. Donot, J. Fresquet, J. Molle, R. Corbau, M. Dreux, F. Penin, and F.-L. Cosset. J Virol. 2007;81:8752-8765.

• The exchangeable apolipoprotein APOC-I promotes membrane fusion of hepatitis C virus. Dreux, M., B. Boson, S. Ricard-Blum, J. Molle, D. Lavillette, B. Bartosch, E. I. Pecheur, and F. L. Cosset. J Biol Chem. 2007;282:32357-32369.

• An Acidic Cluster of the Cytoplasmic Tail of the RD114 Virus Glycoprotein Controls Assembly of Retroviral Envelopes. Bouard, D., V. Sandrin, B. Boson, D. Negre, G. Thomas, C. Granier, and F. L. Cosset. Traffic. 2007;8:835-47.

The manipulation of viral genomes and the techniques of viral engineering offer fascinating perspectives in different fields of the bio-medical research, notably for designing gene delivery strategies and for formulating display-platforms useful in diagnostics, screening and vaccine applications

53



Lipid metabolism and bio logy of Hepatitis C Virus:

new functions and therap eutic avenues

54



Lipid metabolism and biology of Hepatitis C Virus:


55



Lipid metabolism and biology of Hepatitis C Virus:


56



Keywords

• Sub-Saharan Af rica

• HIV-1

• HIV-2

• Cancer

• Care and treatment of chronic diseases

• Prevention

Context: HIV infection is a long-term clinical and public health threat throughout the African continent but has become recently amenable to treatment and prevention with the increasing use of antiretroviral drugs (ARVs).

Scientific expertise: We have developed over the past 15 years a multidisciplinary approach (epidemiological, clinical, biological, social) to study comprehensively new HIV prevention and care strategies in resource-constrained settings.

Research strategy: Experimental studies (randomized trials), observational studies (cohorts) and network collaborations for large databases in West and Southern Africa.

Major data: We have identified practical solutions for African populations in the domains of prevention of mother-to-child transmission of HIV, prevention of opportunistic infections and use of ARV combinations. Our findings have been extensively used for the development of national and international (World Health Organization) guidelines for an HIV public health approach. We have developed the first large-scale cohort collaboration on antiretroviral therapy in Africa showing its positive impact on survival and disease burden at population level.

Perspectives: The long-term management of HIV infection is a priority area for global health and a model of chronic disease care in sub-Saharan Africa and should remain studied. We intend also to apply our knowledge and expertise to prevention and control of cancer in the same context. Finally, we are developing in South Africa a research program linking prevention and care by ARVs in populations most heavily affected by HIV in order to reduce HIV incidence with the hypothesis that it could deeply control the epidemic.

Major Grants

• ANRS • EDCTP • NIH (NIAID, NICHD &

NCI) • Sidaction

HIV, cancer and global health in Africa

Inserm U897 – University Victor Segalen Bordeaux II Bordeaux

To propose and evaluate suitable biomedical interventions for the care and prevention of HIV infection and some of its complications in lower-income countries as a model for global health solutions

François Dabis, M.D, Ph.D


• Pregnancy outcomes in women exposed to efavirenz and nevirapine: an appraisal of the IeDEA West Africa and ANRS Databases, Abidjan, Côte d'Ivoire. Ekouevi DK, Coffie PA, Ouattara E, Moh R, Amani-Bosse C, Messou E, Sissoko M, Anglaret X, Eholié SP, Danel C, Dabis F; International Epidemiological Database to Evaluate AIDS West Africa; ANRS 1269 and ANRS 12136 Study Groups in Abidjan. J Acquir Immune Defic Syndr. 2011 Feb 1;56(2):183-7.

• The French national prospective cohort of patients co-infected with HIV and HCV (ANRS CO13 HEPAVIH): early findings, 2006-2010. Loko MA, Salmon D, Carrieri P, Winnock M, Mora M, Merchadou L, Gillet S, Pambrun E, Delaune J, Valantin MA, Poizot-Martin I, Neau D, Bonnard P, Rosenthal E, Barange K, Morlat P, Lacombe K, Gervais A, Rouges F, See AB, Lascoux-Combe C, Vittecoq D, Goujard C, Duvivier C, Spire B, Izopet J, Sogni P, Serfaty L, Benhamou Y, Bani-Sadr F, Dabis F; ANRS CO 13 HEPAVIH Study Group. BMC Infect Dis. 2010 Oct 22;10:303.

• Maternal and nenonatal tenofovir and emtricitabine to prevent vertical transmission of HIV-1: tolerance and resistance. TEmAA ANRS 12109 Study Group, Arrivé E, Chaix ML, Nerrienet E, Blanche S, Rouzioux C, Avit D, Kruy LS, McIntyre J, Say L, Gray G, Ekouévi DK, Dabis F. AIDS. 2010 Oct 23;24(16):2481-8.

• Prognosis of patients with HIV-1 infection starting antiretroviral therapy in sub-Saharan Africa: a collaborative analysis of scale-up programmes. May M, Boulle A, Phiri S, Messou E, Myer L, Wood R, Keiser O, Sterne JA, Dabis F, Egger M; IeDEA Southern Africa and West Africa. Lancet. 2010 Aug 7;376(9739):449-57. Epub 2010 Jul 15.

• HIV drugs for treatment, and for prevention. Dabis F, Newell ML, Hirschel B. Lancet. 2010 Jun 12;375(9731):2056-7. Epub 2010 May 26.

• Effectiveness of multidrug antiretroviral regimens to prevent mother-to-child transmission of HIV-1 in routine public health services in Cameroon. Tchendjou P, Same-Ekobo C, Nga A, Tejiokem M, Kfutwah A, Nlend AN, Tsague L, Bissek AC, Ekoa D, Orne-Gliemann J, Rousset D, Pouillot R, Dabis F. PLoS One. 2010 Apr 29;5(4):e10411.

• Universal antiretroviral therapy for pregnant and breast-feeding HIV-1-infected women: towards the elimination of mother-to-child transmission of HIV-1 in resource-limited settings. Becquet R, Ekouevi DK, Arrive E, Stringer JS, Meda N, Chaix ML, Treluyer JM, Leroy V, Rouzioux C, Blanche S, Dabis F. Clin Infect Dis. 2009 Dec 15;49(12):1936-45. Review.

• Tolerance and viral resistance after single-dose nevirapine with tenofovir and emtricitabine to prevent vertical transmission of HIV-1. TEmAA ANRS 12109 Study group, Arrivé E, Chaix ML, Nerrienet E, Blanche S, Rouzioux C, Coffie PA, Kruy Leang S, McIntyre J, Avit D, Srey VH, Gray G, N'Dri-Yoman T, Diallo A, Ekouévi DK, Dabis F. AIDS. 2009 Apr 27;23(7):825-33.

• Antiretroviral treatment and prevention of peripartum and postnatal HIV transmission in West Africa: evaluation of a two-tiered approach. Tonwe-Gold B, Ekouevi DK, Viho I, Amani-Bosse C, Toure S, Coffie PA, Rouet F, Becquet R, Leroy V, El-Sadr WM, Abrams EJ, Dabis F. PLoS Med. 2007 Aug;4(8):e257.

• Mortality of HIV-1-infected patients in the first year of antiretroviral therapy: comparison between low-income and high-income countries. Braitstein P, Brinkhof MW, Dabis F, Schechter M, Boulle A, Miotti P, Wood R, Laurent C, Sprinz E, Seyler C, Bangsberg DR, Balestre E, Sterne JA, May M, Egger M; Antiretroviral Therapy in Lower Income Countries (ART-LINC) Collaboration; ART Cohort Collaboration (ART-CC) groups. Lancet. 2006 Mar 11;367(9513):817-24. Erratum in: Lancet. 2006 Jun 10;367(9526):1902.

57




The three main objectives of the research team are:

• To optimize the biomedical approach of HIV care and treatment of adults and

children in sub-Saharan Africa

• To prevent the overall risk of mother-to child transmission of HIV-1 (before and

around delivery and during breastfeeding) and sexual transmission by the proper and

enhanced use of antiretrovirals

• To apply our expertise to other research themes either for the control of the HIV

pandemic or for other public health priorities contributing to global health in sub-

Saharan Africa.

� Objectives:

The research team is organized around four different axis:

1- Care and treatment of HIV-infected adultsChair: Xavier Anglaret, tenure position as a researcher (DR2 INSERM)

2- Care and treatment of HIV-infected childrenChair: Valériane Leroy, tenure position as a researcher (DR2 INSERM)

3- Prevention of mother-to-child transmission of HIVChairs: Renaud Becquet, tenure position as a researcher (CR1 INSERM) & François Dabis, Professor of Public Health

4- Prevention of cancerChair: Annie Sasco, tenure position as a researcher (DR2 INSERM)

58




1- Care and treatment of HIV-infected adults

Since the early 2000s, we have been working in three directions:

(i) Antiretroviral therapy strategies

ii) Analysis of the constraints and successes encountered in practice within the major

care programmes for people living with HIV in West Africa

(iii) Contribution of modelling to clinical research

(i) Clinical research on new care strategies for HIV infected children, answering three researchquestions:

- How can early access to a population of HIV-infected children be obtained?

- What are the options for early HIV screening for a paediatric age group in Africa?

- Can paediatric ART be simplified in children treated before the age of 24 months after a successful one-year treatment?

2- Care and treatment of HIV-infected children

(ii) Public health research structured around the guiding of operational programmes providingHIV care to children

59




3- Prevention of mother-to-child transmission of HIV

Our goal is to contribute to the identification of an ARV regimen applicable to all

pregnant and breastfeeding HIV-infected women, irrespective of the stage of HIV

disease and timing of presentation in care, with the potential for eliminating most

paediatric HIV infections and of being a viable option for life-long maternal

treatment in a wide range of resource-limited settings.

The randomized clinical trial ANRS 12200 UMA Universal Maternal ART in Côte

d'Ivoire and Zambia launched in 2010. This trial is registrered under the following

number: NCT00936195 (International Clinical Trials Registration Number,

www.clinicaltrials.gov).

60



Keywords

• Septicemia

• Meningitis

• Endothelial cells

• Meningococcus

• Blood-brain barrier

Major Grants

• ATIP Avenir

Inserm U970 - Paris Descartes University Paris

Paris Cardiovascular Research Center

Blood vessels as a target for infection

A multidisciplinary approach to understand the interaction between deadly pathogens and blo od vessels

Guillaume Duménil, Ph.D

Our group focuses on a subset of infectious diseases that take place in the vasculature. Infections taking place

in the bloodstream are usually extremely severe and often life threatening because they lead to septic choc and

meningitis for instance. We study different such pathogens with a particular focus on the bacterium Neisseria

meningitidis, also called meningococcus, responsible for septicemia and meningitis. Studying these particular

infections requires specific approaches mimicking the conditions found in the human vasculature.

We use a combination of techniques originating from cell biology, microbiology and vascular biology to

reproduce experimentally the interaction between these pathogens and the vascular wall. This strategy allows

us to collect information on the properties of these pathogens and their target during the infection process that

will guide the design of innovative therapeutic approaches.


• Posttranslational Modification of Pili upon Cell Contact Triggers N. meningitidis Dissemination. Chamot-Rooke J, Mikaty G, Malosse C, Soyer M, Dumont A, Gault J, Imhaus AF, Martin P, Trellet M, Clary G, Chafey P, Camoin L, Nilges M, Nassif X, Dumenil G. Science. 2011;331:778-782.

• Articles in the general media: Le Nouvel Oservateur, l’Express, Les Echos, France Info…

• Meningococcal type IV pili recruit the polarity complex to cross the brain endothelium. Coureuil, M., Mikaty, G., Miller, F., Lecuyer, H., Bernard, C., Bourdoulous, S., Dumenil, G., Mege, R. M., Weksler, B. B., Romero, I. A., et al. Science. 2009;325:83-87.

• Dual role for pilus in adherence to epithelial cells and biofilm formation in Streptococcus agalactiae. Konto-Ghiorghi, Y., Mairey, E., Mallet, A., Dumenil, G., Caliot, E., Trieu-Cuot, P., and Dramsi, S. PLoS Pathog. 2009;5:e1000422.

• Structure and Function of Interacting IcmR-IcmQ Domains from a Type IVb Secretion System in Legionella pneumophila. Raychaudhury, S., Farelli, J. D., Montminy, T. P., Matthews, M., Menetret, J. F., Dumenil, G., Roy, C. R., Head, J. F., Isberg, R. R., and Akey, C. W. Structure. 2009;17:590-601.

• Extracellular bacterial pathogen induces host cell surface reorganization to resist shear stress. Guillain Mikaty, Magali Soyer, Emilie Mairey, Nelly Henry, Dave Dyer, Katrina T. Forest, Philippe Morand, Stéphanie Guadagnini, Marie Christine Prévost, Xavier Nassif, and Guillaume Duménil. PLOS Pathogens. 2009;5: e1000314.

• Alternative Neisseria spp. type IV pilin glycosylation with a glyceramido acetamido trideoxyhexose residue. Chamot-Rooke, J., Rousseau, B., Lanternier, F., Mikaty, G., Mairey, E., Malosse, C., Bouchoux, G., Pelicic, V., Camoin, L., Nassif, X., and Dumenil, G. Proc Natl Acad Sci U S A. 2007;104:14783-14788.

• Cerebral microcirculation shear stress levels determine Neisseria meningitidis attachment sites along the blood-brain barrier. Mairey, E., A. Genovesio, E. Donnadieu, C. Bernard, F. Jaubert, E. Pinard, J. Seylaz, J.C. Olivo-Marin, X. Nassif, and G. Dumenil. J Exp Med. 2006;203(8):p.1939-50.



61

Blood vessels as a target for infection,

the Neisseria meningitidis paradigm

� Objectives:

• How can pathogens survive and colonize blood vessels during septicemia ?

• What is the mechanism behind the damage caused to the vessels by these infections

(vascular leak, DIC etc.)?

• How can pathogens exit the vasculature to invade the brain in cases of meningitis ?

N. Meningitidis in a human cerebral capillary. Post mortem histological analysis

� Tools:

• Bacterial genetics, genomics

• Cell culture models of infection

• Flow systems mimicking blood circulation

• Microcirculation models (in vitro and in vivo)

• Xenograft-based humanized mouse models

• Intravital live imaging

• Advanced mass-spectrometry

Brain parenchymacapillary

Bacterial microcolony

Figure 1 : Intensity of blood flow determines the initial site of adhesion in the brain

Schematics of a flow chamber used to mimic the presence of blood flow during the infection (left). Correlation with measures of blood velocity in vivo (right) demonstrates that blood flow determines the site of bacterial adhesion.

Pump

500µm

Live imagingLive imaging




62




Figure 2 : Intense plasma membrane reorganization allows the microcolony to resist shear stress after proliferation

Schematics of bacteria proliferating on the cellular surface (top left). Electron microscopy image showing bacteria entrapped in cellular protrusion (right). Consequence of absence of this response, lack of resistance to blood flow and colony disruption (bottom).

Figure 3 : The bacterial colony sends “scouts” to colonize new sites

Schematics of bacteria proliferating on the cellular surface (top left). The bacterial enzyme PptB is responsible for the detachment step at the molecular level (bottom left). The activity of the enzyme is analyzed by mass spectrometry (right). Patent deposited Jan 2011.

∆pptB

WT

63

Perspectives

Specific competence of the group

• Further characterize the molecular steps involved in the infection process

• Develop an animal model of infection based on xenografts

• Initiate a high throughput pharmacological screen to block the described steps of the infection.

• Apply the same approach with other pathogens targeting blood vessels

Expertise:

• Biology of bacterial pathogens

• The processes of pathogenesis

• Bacterial virulence factors and their targets

• Pathophysiology of blood vessels in the context of infections

• Blood brain barrier

Technical skills available in the group :

• Bacterial genetics and genomics of pathogens

• Primary cell cultures from human samples (tonsils, blood and skin)

• Cellular models taking into account blood flow

• High speed intravital imaging (two-photon and spinning disc confocal)

• Humanized animal models of infection

• Cellular models of blood brain barrier




64



Keywords

• Mucosal Immunology

• Innate i mmunity

• Symbiotic microbes

• Equilibrium

• Probiotics

Major Grants

• EU Excellence Team

• Equipe FRM

• Prix Simone e Cino del Duca

• Mairie de Paris pour la Recherche Médicale et la Santé

• ANR

Institut Pasteur Paris - URA1961 Paris

Mucosal Immunology

Understanding our interaction with symbiotic microbes to promote health

Gérard Eberl, Ph.D

Ontogeny programs the development of lymphocytes and their recruitment to secondary lymphoid tissues.

These tissues collect antigens and mount adaptive immune responses to potential pathogens. The recruitment,

activation and migration of lymphocytes require a highly organized network of stromal and hematopoietic cells

that orchestrate each step in the development of an immune response.

An immune response induces the development of the immune system itself by promoting the generation of new

lymphoid tissues and the differentiation of lymphocytes. In that context, microbes, and more generally injured

cells and tissues, are not only triggers and targets of destructive immunity, but also the architects of a mature

immune system. The best example of such a constructive partnership between microbes and the immune

system is found in the intestine, where billions of bacteria have established a mutualistic relationship with the

host not only for optimal digestion, but also for robust defense against pathogens and injury.

We decipher how symbiotic bacteria induce ‘physiologic infammation’ and the consequent maturation of the

immune system for the maintenance of intestinal homeostasis. In particular, we dissect the role of innate

lymphoid cells and active stromal cells in health and disease of the intestine, and beyond.


• RORgt+ innate lymphoid cells regulate intestinal homeostasis by integrating negative signals from the symbiotic microbiota. S. Sawa, M. Lochner, N. Satoh-Takayama, S. Dulauroy, M. Berard, M. Kleinschek, D. Cua, J.P. Di Santo and G. Eberl. Nat. Immunol. 2011. in press.

• Lineage relationship analysis of RORγt+ innate lymphoid cells. S. Sawa, M. Cherrier, M. Lochner, N. Satoh-Takayama, H.J. Fehling, F. Langa, J.P. Di Santo and G. Eberl. Science. 2010;330:665-669.

• Microbial flora drives interleukin 22 production in NKp46+ cells that provide innate mucosal immune defense. N. Satoh-Takayama, C.A.J. Vosshenrich, S. Lesjean-Pottier, S. Sawa, M. Lochner, F. Rattis, J.J. Mention, K. Thiam, N. Cerf-Bensussan, O. Mandelboim, G. Eberl and J.P. Di Santo. Immunity. 2008; 29:958-970.

• Lymphoid tissue genesis induced by commensals through NOD1 regulates intestinal homeostasis. D. Bouskra, C. Brezillon, M. Berard, C. Werts, R. Varona, I. Gomperts Boneca, and G. Eberl. Nature. 2008; 456:507-510.

• Thymic origin of intestinal ab T cells revealed by fate mapping of RORgt+ cells. G. Eberl and D.R. Littman. Science. 2004; 305:248-251.

• An essential function for the nuclear receptor RORgt in the generation of fetal lymphoid tissue inducer cells. G. Eberl, S. Marmon, M.J. Sunshine, P.D. Rennert, Y. Choi, and D.R. Littman. Nat. Immunol. 2004;5:64-73.



65


Gérard Eberl, Ph.D

Symbionts and intestina l immunity

� Objectives:• How do microbial symbionts influence the development of immunity ?

• How are symbionts selected by immunity ?

• How does innate immunity pre-empt symbiosis?

Attaching symbionts in the small intestine

� Tools:• Transgenic reporter mice models

• Germfree and gnotobiotc mice models

• qRT-PCR-based measure of gene expression

• Flow cytometry of immune cells

• Immunofluorescence histology

• Microbiome pyrosequencing

Figure 1: induction of lymphoid tissue by symbionts

Cervical LN Mesenteric LN Cervical LNParathymic LN

CP iILF mILF

Fetal development of lymphoid tissues is re-capitulated in the intestine uponbacterial colonization

66


Gérard Eberl, Ph.D


Figure 2 : innate lymphoid cells

AD

APT

IVE

IMM

UN

ITY

T cells

Th1

Th2

Treg

Th17

Th22

Th…

RORγγγγtIN

NA

TE IM

MU

NIT

Y

ILCs

ILC-1

ILC-2

ILC-reg

ILC-17

ILC-22

ILC-…

NK cells

Nuocytes

?

LTi cells

NK22 cells

Innate lymphoid cells are programmed to react, while T cells are induced to react

Figure 3 : lymphoid cells pre-empting bacterial colonization

Innate lymphoid cells set the stage for microbial colonization of the intestine

102

103

104

105

106

CD4+T

GFP+ LTi 4 P46

Nb

of L

PL

SPF

GF

GFP+CD3-

Total Total

days after birt h

0

20

40

60

80

100

-28 -14 0 14 28 42 56

% in

GF

P+ C

D3 εε εε

-

C

D

P46

LTi0

LTi4

67


Gérard Eberl, Ph.D


Perspectives


• Understand the dialogue between symbionts and the immune system

• Understand how this dialogue breaks down during pathology

• Manipulate this dialogue to achieve and maintain health

• Leader in intestinal immunity

• Unique strong expertise in intestinal immune read-outs

• Ongoing projects to measure the impact of intestinal homeostasis on host

physiology and health

• Development of pre- and probiotics, and beneficial bacterial compounds

• Strong collaborations to assess intestinal « modifiers »

68



Keywords

• Alzheimer disease

• DNA sensing

• NF-Kb

• In vivo biotinylation proteomics

• Forward genetics

• Vaccine adjuvant

Major Grants

• Avenir Team

Hidehiro Fukuyama, Ph.D


• Patent application: “Antibodies specific for the protofibril form of beta-amyloid protein”. Ravetch JV, Fukuyama H. USPTO #20100209422 (2010).

• Peripheral Abeta subspecies as risk biomarkers of Alzheimer's disease. Schupf N, Tang MX, Fukuyama H, Manly J, Andrews H, Mehta P, Ravetch J, Mayeux R. Proc Natl Acad Sci U S A. 2008 Sep 16;105(37):14052-7.

• Critical role of the p400/mDomino chromatin-remodeling ATPase in embryonic hematopoiesis. Ueda T, Watanabe-Fukunaga R, Ogawa H, Fukuyama H, Higashi Y, Nagata S, Fukunaga R. Genes Cells. 2007 May;12(5):581-92.

• The inhibitory Fcgamma receptor modulates autoimmunity by limiting the accumulation of immunoglobulin G+ anti-DNA plasma cells. Fukuyama H, Nimmerjahn F, Ravetch JV. Nat Immunol. 2005 Jan;6(1):99-106.

• Impaired thymic development in mouse embryos deficient in apoptotic DNA degradation. Kawane K, Fukuyama H, Yoshida H, Nagase H, Ohsawa Y, Uchiyama Y, Okada K, Iida T, Nagata S. Nat Immunol. 2003 Feb;4(2):138-44.

• Requirement of DNase II for definitive erythropoiesis in the mouse fetal liver. Kawane K*, Fukuyama H*, Kondoh G, Takeda J, Ohsawa Y, Uchiyama Y, Nagata S. Science. 2001 May 25;292(5521):1546-9 (* equally contributed).

CNRS UPR9022- University of Strasbourg Strasbourg

Institute of Molecular and Cellular Biology

Innate immunity research using Insect models

Using a powerful Drosophila forward g enetics and proteomic approaches, we focus on identifying pathogenic amyloid beta sensing and clearance factors in Alzheimer disease and DNA sensor for vaccine design

Chronic inflammation influences many human diseases including infectious diseases, autoimmune diseases

and Alzheimer disease. To control inflammation in disease state, it is highly demanded to have better

understandings of mechanisms of inflammation, especially in the aspects of innate immune responses. Similar

to mammals, insects can recognize microbes such as bacteria, fungi, virus and parasites and also can respond

to them by inducing various antimicrobial peptides as effector molecules through NF-kB activation.

By measuring NF-kB activation as an indicator of Drosophila inflammation, genetic approaches have provided

us important insights of molecular events of recognitions and signal transductions during infection, later led to

discoveries of TLRs (Toll-like receptors). Our team starting from 2009 established two Drosophila models for

human chronic inflammatory diseases: Alzheimer disease by overexpressing human amyloid beta and

autoimmune disease caused by DNase deficiency. Both models showed constitutive activation of NF-kB.

Genetic interaction studies demonstrated that Drosophila IMD pathway, similar to mammalian TNF-R signaling

pathway, plays important roles in NF-kB activation in these model animals, and also in phenotypes in the case

of AD model. We are currently performing forward genetics screening for AD modulators and functional

proteomics for identifying DNA sensor. These studies will provide us the basis of therapeutic intervention for

chronic inflammatory diseases and help us to design vaccine adjuvant.

69




Danger signals by endogenous ligands

fly models for human chronic inflammation diseases

� Objectives:• Pathogenic amyloid beta sensing and clearance mechanisms

• Intracellular DNA sensing mechanisms in innate immunity

� Targeting interventions:• AD diagnosis and therapy

• Vaccine adjuvant

� Tools:� Alzheimer disease fly model

� DNase deficiecy-triggering innate inflammation fly model

� Drosophila forward genetics

� Immunodeficient fly stocks

� In vivo biotinylation functional proteomics

Figure 1: Drosophila as animal model

for chronic inflammatory diseases

70

Figure 2: Drosophila Alzheimer disease model and Immunoregulations

Climbing behavior

AD Non-AD

Amyloid β

NF-kB target genes

Beneficial to Drosophila AD

TAK1TAK1

IKKGIKKG

RIPRIP

Immunodeficient AD flies

Cli

mb

ing

ab

ilit

y

Drosophila IMD pathway

(similar to mammalian TNFR

signaling pathway) activation

but not TOLL pathway is

beneficial to AD

RIP

1

IKK

G

WT

Toll-

NF-

kB

NF-kB activation

in Drosophila AD state

Figure 3: DNA sensing

Lysosomal DNase deficiency

DNA accumulation

IFNαααα/ββββ,,,, TNFαααα, CXCL10

DNA sensor

IRF3/7,NF-kB

Anti-microbial peptides

STING

TBK1, IKKp<0.0001

REL(NF-kB)

AUB(STING) ?

IK2(TBK1)?, KEY(IKKG)

Mammals Drosophila

DNaseII-/- mice DNaseIIlo mutant flies

* Currently working in our team

In vivo biotinylation functional

proteomics

Drosophila antimicrobial peptide




71

Perspectives


• Screening for modulators of Alzheimer disease by forward genetics

• Identifying DNA sensors and their innate inflammatory pathway by functional

proteomics

• Testing concepts generated above in mammalian system

• Expertise in both mammalian and insect immunity

• Specialized in the research field of DNA sensing in adaptive and innate immunity

• Developed antibody-mediated AD immunotherapy using mammalian Alzheimer

disease models

• Developed prognosis-oriented ELISA system for human AD

• Developed AD animal models feasible for forward genetics

• Established high-throughput functional proteomics using in vivo biotinylation




72



Keywords

• Malaria

• Plasmodium falciparum

• Adhesion

• Pregnancy

• Vaccine

Major Grants

• 01/07/2010-30/06/2013: ATIP-AVENIR grant co-financed by Sanofi-Aventis

• 01/02/2008-31/07/2011: Scientific director of the "Pregnancy Malaria Structure", project - European Commission 7th Framework programme (6 institutions involved - 2.3M€ – Coordinator Pasteur Institute)

• 01/07/2005-01/07/2008: Coordinator of the “Pregnancy Malaria Vaccine” grant - European Malaria Vaccine Initiative (350K€) - Partner Dr Jurg Gysin, Marseille, France

Molecular mechanisms of placental malaria pathogenesis: from cytoadhesion to host response

Structure function analysis of placental malaria associated adhesive interactions

Benoit Gamain, Ph.D

Each year, 200 to 400 million clinical cases of malaria are reported globally, causing around 1 million deaths,

largely in the sub-Saharan continent. Plasmodium falciparum and, to a much lesser extent, P. vivax are the

main causes of disease and death from malaria. An important difference between P. falciparum and other

human malaria parasites is the way in which P. falciparum modifies the surface of the erythrocyte so that

asexual parasites can adhere to host cells. Adhesion of P. falciparum-infected erythrocytes (PEs) to placental

chondroitin-4-sulfate (CSA) has been linked to the severe disease outcome of pregnancy-associated malaria

(PAM). After multiple pregnancies, women acquire protective antibodies that block CSA-binding and cross-

react with geographically diverse placental isolates suggesting that surface molecule(s) expressed by PAM-

infected erythrocytes have conserved epitopes and that a PAM vaccine may be possible. Although the

interaction between P. falciparum and its host is complex, accumulated evidence strongly supports the idea

that, in the case of PAM, PfEMP1 variant var2CSA expressed by placental parasites are promising targets for

developing new approaches to treat malaria. An effective strategy against PAM would indeed target a

significant section of the vulnerable population in endemic regions of Sub-Saharan Africa and accordingly

would have a significant impact on health and economy.

The overall objective of our work is to understand the functional characteristics of var2CSA and other

molecules expressed by placental parasites at the molecular level. Such knowledge is essential for providing a

rational basis for accelerating vaccine and therapeutic developments to combat this form of malaria.


• Antibodies to a Full-Length VAR2CSA Immunogen Are Broadly Strain-Transcendent but Do Not Cross-Inhibit Different Placental-Type Parasite Isolates. Avril, M., M.J. Hathaway, A. Srivastava, S. Dechavanne, M. Hommel, J.G. Beeson, J.D. Smith, and B. Gamain. PLoS One. 2011;6:e16622.

• Full-length extracellular region of the var2CSA variant of PfEMP1 is required for specific, high-affinity binding to CSA. Srivastava, A., S. Gangnard, A. Round, S. Dechavanne, A. Juillerat, B. Raynal, G. Faure, B. Baron, S. Ramboarina, S.K. Singh, H. Belrhali, P. England, A. Lewit-Bentley, A. Scherf, G.A. Bentley, and B. Gamain. Proc Natl Acad Sci. U S A. 2010;107:4884-4889.

• Investigation of host factors possibly enhancing the emergence of the chondroitin sulfate A-binding phenotype in Plasmodium falciparum. Nunes, M.C., Y. Sterkers, B. Gamain, and A. Scherf. Microbes Infect. 2008;10:928-932.

• Var2CSA DBL6-epsilon domain expressed in HEK293 induces limited cross-reactive and blocking antibodies to CSA binding parasites. Fernandez, P., N.K. Viebig, S. Dechavanne, C. Lepolard, J. Gysin, A. Scherf, and B. Gamain. Malar. 2008;J 7:170.

• How does Plasmodium falciparum stick to CSA? Let's see in the crystal. Bentley, G.A., and B. Gamain. Nat Struct Mol Biol. 2008;15:895-897.

• Disruption of var2csa gene impairs placental malaria associated adhesion phenotype. Viebig, N.K., E. Levin, S. Dechavanne, S.J. Rogerson, J. Gysin, J.D. Smith, A. Scherf, and B. Gamain. PLoS ONE. 2007;2:e910.

• Pregnancy-associated malaria: parasite binding, natural immunity and vaccine development. Gamain, B., J.D. Smith, N.K. Viebig, J. Gysin, and A. Scherf. Int J Parasitol. 2007;37:273-283.

Inserm U665 - Paris Diderot University Paris

Institut National de Transfusion Sanguine

73


Benoît Gamain, Ph.D

Placental malaria pathogen esis

� Objectives:

• Identify the molecular mechanisms involved in placental malaria sequestration

• Determine the high resolution structure of the parasite var2CSA adhesin

• Identify the post-adhesive events leading to placental immunopathology

• Study the interplay between the immune cells and the parasite

• Develop vaccine and therapeutic strategies

Var2CSA expressing CSA-binding parasites

� Tools:

• Recombinant protein expression platform

• Var2CSA knock out and mutant parasites

• X-ray crystallography

• Cryo electron microscopy (cryo-EM)

• Flow adhesion platform

• Monoclonal antibodies

• Camelidae nanobodies (VHH)

Figure 1: A single var gene is involved in CSA adhesion

- Var2CSA is specifically expressed in placental parasites

Var2CSA DBL-5 εεεε DBL-6 εεεε ATSDBL-1X DBL-2X DBL-3X DBL-4 εεεε

-Var2CSA orthologs are conserved among parasite isolates and strains

MIN 69.5 67.3 82.3 84.7 79.7 53.1

MAX 89.2 89.7 91.6 95.4 91.3 82.2

(percentage identity)

0

500

1000

1500

2000

2500

Primer sets

Arb

itrary

geno

mic u

nits

var2CSA

Real-time PCR analysis across 50 IT/FCR3 var genes

ASL housekeepingcontrol

74




Figure 2 : Var2CSA KO parasites are unable to bind to CSA

- Var2CSA disruption impairs parasite binding to CSA and placental cells

Var2CSA : leading candidate for vaccine and therapeutic strategies

- By comparison to wild type parasites, Var2CSA KO parasites can not be reselected for the CSA adhesion binding phenotype or to bind to placental cells

Figure 3 : Var2CSA possess a high affinity CSA binding pocket

SAXS experiments revealed that the recombinant protein possess a compact organization (by comparison to the linear model) forming a high affinity CSA binding pocket

Surface plasmon resonance binding experiments showing that var2CSA binds with high affinity to human placental CSPG.

75




Perspectives


• Identification of the var2CSA minimal CSA-binding region and CSA binding residues

• Structural correlates of the high affinity CSA-binding site of var2CSA

• Identification and validation of new interactions between parasites and placental cells

• Investigation of the molecular mechanism underlying the subversion of immune cells

• Identification of pathways involved in placental malaria pathology

• Design of novel var2CSA based antigens capable of inducing potent neutralising antibodies

• Screening for blocking Camelidae nanobodies (VHH) that could be used for therapeutic

strategies

• Leader in the placental malaria field (Scientific director of a FP7 EU funded project on

placental malaria)

• Strong expertise in malaria parasite cytoadhesion mechanisms

• Strong collaboration with European and American academic partners

• Strong collaboration with Biophysicians (Xray crystallography and Cryo electron

microscopy ) (B. Klaholz IGBMC)

• Access to a flow cytoadhesion platform to screen inhibitory activities of drugs and

vaccine candidates

• Strong internal and external collaborations (VIB) for developing camelidae nanobodies

(VHH)

76



Keywords

• Vesicular stomatitis virus

• Rabies

• Rhabdovirus

• Glycoprotein

• Membrane fusion

• Structure

Major Grants

• ANR Blanc

• ITN network (EC, FP7)

CNRS UPR3296

Laboratoire de Virologie Moléculaire et Structurale Gif-Sur-Yvette, Southwest Paris

Cellular and Structural Virology

We have determined the pre- and post-fusion structures of vesicular stomatitis virus glyc oprotein and characterized its fusion machinery rendering it arguably the best described viral fusion machinery

Yves Gaudin, Ph.D

The entry of enveloped viruses into cells requires the fusion of viral and cellular membranes, driven by

conformational changes in viral glycoproteins. The goal of our work is to obtain a detailed understanding, at the

molecular level, of the fusion pathway using vesicular stomatitis virus (VSV, a rhabdovirus) and its glycoprotein

G as a model system.

It is worth noting that some rhabdoviruses, such as rabies (55000 deaths per year and 6.5 106 vaccine doses

delivered each year) or Chandipura virus, are fatal to human. Others are, or could be, responsible for economic

damages. Our research has thus potential implications in the medical or veterinary field.

Rhabdovirus fusion is triggered during acidification of the endosomal compartment. We have recently

determined the atomic structures of the pre- (high pH) and post-fusion (low pH) states of a soluble form of VSV

G ectodomain. These structures, together with those of herpes- and baculovirus fusion glycoproteins, defined a

new class of viral fusion proteins. We have also used electron microscopy and tomography to characterize

individual fusion events between virions and liposomes. We have shown that fusion is initiated at the flat base

of the viral particle and that glycoproteins located outside the contact zone between virions and liposomes then

reorganize into regular arrays that achieve the fusion reaction by inducing strong membrane constraints.

We are now extending our work to other rhabdovirus glycoproteins, trying to trap and characterize the

intermediates encountered during the fusion process.


• Distinct structural rearrangements of the VSV glycoprotein drive membrane fusion. Libersou S, Albertini AA, Ouldali M, Maury V, Maheu C, Raux H, de Haas F, Roche S, Gaudin Y, Lepault J. J Cell Biol. 2010;191:199-210.

• Structures of vesicular stomatitis virus glycoprotein: membrane fusion revisited. Roche S, Albertini AA, Lepault J, Bressanelli S, Gaudin Y. Cell Mol Life Sci. 2008;65:1716-28.

• Virus membrane fusion. Weissenhorn W, Hinz A, Gaudin Y. FEBS Lett. 2007;581:2150-5.

• Structure of the prefusion form of the vesicular stomatitis virus glycoprotein G. Roche S, Rey FA, Gaudin Y, Bressanelli S. Science. 2007;315:843-8.

• Crystal structure of the low-pH form of the vesicular stomatitis virus glycoprotein G. Roche S, Bressanelli S, Rey FA, Gaudin Y. Science. 2006;313:187-91.

77


Yves Gaudin, Ph.D

Structural organizatio n and working

of rhabdovirus fusion machineries

� Objectives:

• What is the structure of the fusion glycoprotein of rhabdoviruses ?

• How do the fusion glycoproteins cooperate to deform the viral and cellular membranes

during the fusion process ?

� Tools:

• Fluorescent assays for membrane fusion

• Crystallographic studies

• EM studies (negative staining, cryoEM, tomography)

• Use of hybrid methods

• Reverse genetics

Visualization of individual fusion events by cryo-EM

Figure 1: Crystal structures of the pre- and post-fusion of vesicularstomatitis virus glycoprotein G

Overall structure of the pre- and post-fusion forms of VSV glycoprotein G.

The trimers (left) are superimposed on the rigid blocks made of domain I (in red) and part of domain II (in blue) that are kept unchanged during the structural transition. The protomers are superimposed on their fusion domains (in yellow). The dotted lines represent the missing C-terminal segment of the ectodomain that leads to the transmembrane segment.

VSV G Pre-fusion

VSV G Pre-fusion

VSV G Post-fusion

VSV G Post-fusion

Fusion loops

78


Yves Gaudin, Ph.D



VSV GPost-fusion

HSV-1 gB Baculovirus gp64

Figure 2 : Rhabdovirus Glycoprotein defines a third categoryof fusion proteins

Comparison of VSV G, HSV1 gB and baculovirus gp64 structures reveals thatthese proteins have the same fold and are therefore homologous. This was unexpected as the three viral familes are unrelated

Figure 3 : Visualization of individual fusion events by EM

Fusion is a polarizedmultistep event

Virions at pH 7.5 having their typical

bullet shape

Virions incubated at pH 5.5 with liposomesVisualization of individual fusion events

Fusion at the flat base

Formation of a helicoidal network of spikes in their post-fusion conformation

79

Perspectives


• Strong expertise in structural virology

• Longstanding experience on rhabdoviruses (rabies virus, VSV)

• Combination of biophysical approaches (Electron microscopy, X-ray cristallography and SAXS

- the so-called hybrid methods -) allowing access to the determination of the structure and

big complexes and their dynamic behaviour

• Determine the structure of intermediates during the structural transition

• Determine the structure of the full length glycoprotein i.e. with its transmembrane domain

known to play a major role during the late stages of the fusion process

• Extend the structural studies to rhabdoviruses from other genus (rabies virus and bovine

ephemeral virus)

Figure 4 : G ectodomain alone is able to deform membranes

pH 6 pH 5,5 pH 5,2


Yves Gaudin, Ph.D



80



Keywords


• Antibiotic resistance

• Nod1

• Nod2

• Penicillin-binding proteins

• Peptidoglycan hydrolases

• Helicobacter pylori

Major Grants

• ERC starting Grant 2007

• Inserm AVENIR Team 2007

• Institut Pasteur 5 years group

Institut Pasteur Paris IP10175 Paris

Biology and genetics of the bacterial cell wall

The role of peptidoglycan in bacterial cell physiology: new strategies to overcome antibiotic resistance and blo ck host-pathogen interactions

Ivo Gomperts Boneca, Ph.D

Peptidoglycan (PGN) is a major essential and unique component of the cell wall of both Gram-negative and

Gram-positive bacteria. Because of the central role of PGN metabolism in bacterial cell structure and shape, in

antibiotic resistance and in host-microbe interactions. Hence, the study of PGN metabolism is of seminal

importance for developing innovative therapeutic strategies, particularly in the absence of any new

antimicrobials in the pharmaceutical pipelines.

Our research can be divided in two parts, one aimed at studying PGN metabolism to better understand how

bacteria assemble a mature PGN. I use Helicobacter pylori since genome analysis indicates a minimal set of

genes involved in PGN metabolism and assembly suggesting it might be a simpler model to study PGN

metabolism. By characterizing the role of H. pylori PGN synthetases and hydrolases, my aim is to better

understand PGN metabolism and to develop new therapeutic/antimicrobial strategies.

The second part of my research is aimed at studying the role of PGN in host-microbe interactions and its

detection by the recently identified intracellular receptors Nod1 and Nod2. The objective is to understand how

pathogens are able to subvert/modulate the host response by modifying their PGN, with the aim of blocking this

deleterious effect required for virulence. A second objective is to understand the dynamics of PGN sensing in

the host cell during infection and in particular during sepsis: which PGN structures are presented by the

different pathogens, how the host detects them, responds to them and eventually detoxifies them. Thus, we

could develop new diagnostic markers predictive of sepsis outcome.

Selected publications

• Fernandez, E.M., et al. 2010. Gut. In press.

• Bonis, M., et al. Mol Microbiol. 2010. 78. (4): 809-819.

• Thiberge, J.-M., et al. BMC Genomics. 2010. 11:368.

• Eberl, G, & I.G. Boneca. Cur. Opin. Immunol. 2010. 22(4):448-454.

• Grubman, A., et al. Cell Microbiol. 2010. 12. (5):626-639.

• Travassos, L. H., et al. Nature Immunol. 2010. 11. (1): 55-62.

• Chaouche-Drider, N., et al. PLoS One. 2009. 4. (4):e5396.

• Boneca, I.G. Cell Host Microbe. 2009. 5. (2):109-111.

• Bouskra, D., et al. Nature. 2008. 456. (7221): 507-510.

• Boneca, I.G., et al. Applied Environm. Microbiol. 2008. 74. (7): 2095-2102.

• Dubrac, S., et al. J. Bacteriol. 2007. 189. (22): 8257-8269.

• Zawilak-Pawlik, et al. Mol. Microbiol. 2007. 65. (4): 979-994.

• Chaput, C. and I.G. Boneca. Microbes Infect. 2007. 9. (5): 637-647.

• Boneca, I.G., et al. Proc Natl Acad Sci U S A. 2007. 104. (3): 997-1002.

• Chaput, C., A. Labigne and I.G. Boneca. J. Bacteriol. 2007. 189. (2): 422-429.

81


Peptidoglycan(PG) metabolism

Bacterial shape/ physiology

Virulence/Inflammation

Antibiotics resistance

Nod1 Nod2

MTriDAP

HOO

NH

HO

O

OHN

O

ONH

HNO

OOH

O

HO

NH2O

OH

MurNAc

L-Ala

D-Glu

meso-DAP

HOO

NH

HO

O

OHN

O

ONH

HOO

O

HO

MurNAc

L-Ala

D-Glu

MDP

Nod2 agonists

MurNAc

D-Glu

HOO

NH

HO

O

OHN

O

ONH

HNO

OOH

O

HO

NH2O

L-Ala

NH2

Amidatedmeso-DAP

MTriDAPNH2

HOO

NH

HO

O

OHN

O

ONH

HNO

OOH

O

HO

NH2

L-Ala

D-GluL-Lys

MTriLys

MurNAc

The role of PG in host-microbe interactions

Girardin et al. 2003. J. Biol. Chem. 278(11):8869-72Girardin et al. 2003. J. Biol. Chem. 278(43):41702-8Girardin et al. 2003. Science. 300(5625):1584-7Travassos et al. 2004. EMBO Rep. 5(10):1000-6


Role of peptidoglycan in bacterial cell physiology:

from bacterial shape to host-microbe interactions

82


Spiral to coccoid forms

Spirale or bacillaryforms

Coccoidforms

⇒⇒ AmiA is required for coccoid formation & immune escape

�

Chaput et al. 2006. PLoS Pathog. 2(9).e97

in vitro culture

Epithelial cellco-culture




∆pgdAListeria

Nucleus

Phagosome

TypeI interferons

cytokines

Inflammation

Muropeptides

Lysozyme

LTA

∆pgdAListeria

Submucosa

mucosa

mucus

lumen

Macrophages

∆pgdAListeria

∆pgdAListeria

Lysozyme

Nod1

TLR2

CARD NBS

NF-κB

e.g. interferon-ß

e.g. interleukin-6

TIR

Boneca et al. 2007. Proc Natl Acad Sci U S A.

83





in vivo pharmacodynamics of PG

Analysis of theHost response

DNA arrays

wt vsNod1-/-

SPF vs GermFreeGérard

Eberl (IP)

3H-PG ?

Analysis of 3H-PG distribution

with a ß-imager

Mesenteric Lymph Nodes

Peyer’s Patches

Cryptopatches LymphaticsILFs

3H-PG ?

Analysis of 3H-PG Distribution in different organs

with amicro- ß-imager


DNA arrays


DNA arrays

wt vsNod1-/-


Eberl (IP)

3H-PG ?

wt vsNod1-/-


Eberl (IP)

3H-PG ?


with a ß-imager


with a ß-imager


Peyer’s Patches

Cryptopatches LymphaticsILFs

3H-PG ?




Peyer’s Patches

Cryptopatches LymphaticsILFsILFsILFs

3H-PG ?3H-PG ?



New PGN

Peptidoglycanhydrolases Degraded

PGN

Old PGN

Peptidoglycansynthetases

Characterization of PG assembly complexes

In vivocomplex formation

• TAPtag• immunofluorescence

• PBPs conditional mutants• PBPs site directed mutagenesis

• PG synthesis and structure

In vitro complex formation• BIAcore• affinity chromatography• crystallography• complex activity assay• in vitro PG synthesis

�Resistance mechanisms�New therapeutic strategies

84



Keywords

• Cell wall

• Targets of antibiotics

• Medical microbiology

Major Grants

• European grants (6 and 7 PCRD)

• NIH grants since 1995

Inserm U872 - Paris Descartes University - European Hospital Georges Pompidou Paris

Microbiology Cell wall, antibiotic, resistance to antibiotics

Search for new cell wall enzymes and putative target of antibiotics

Laurent Gutmann, M.D

Our laboratory has been working for many years on the mechanism of resistance to antibiotics and try to

understand which enzymes of the cell wall were involved in these resistances. More recently we have

discovered new enzymes (L,D-transpeptidases) of the cell wall which can bypass the regular cell wall enzymes

and lead to high level resistance to beta-lactams the most commonly used antibiotics in the community and the

hospital.

These L,Dt which are present in many bacteria are also present in Mycobacterium tuberculosis and could play

a role in the dormancy of these bacteria. Our goal is to understand the physiological role of these unusual

enzymes and search by different approaches if potent inhibitors could exist and be useful to combat these

bacteria.


• Differences in daptomycin and vancomycin ex vivo behaviour can lead to false interpretation of negative blood cultures. Grohs P, Fantin B, Lefort A, Wolff M, Gutmann L, Mainardi JL. Clin Microbiol Infect. 2010 Dec 31.

• Antibiotic resistance: a world concern in 2010. Gutmann L, Lortholary O. Med Sci (Paris). 2010 Nov;26(11):895-6. French. No abstract available.

• The peptidoglycan of Mycobacterium abscessus is predominantly cross-linked by L,D-transpeptidases. Lavollay M, Fourgeaud M, Herrmann JL, Dubost L, Marie A, Gutmann L, Arthur M, Mainardi JL. J Bacteriol. 2011 Feb;193(3):778-82. Epub 2010 Nov 19.

• Epidemiology and Antimicrobial Resistance of Streptococcus pneumoniae in France in 2007: Data from the Pneumococcus Surveillance Network. Kempf M, Baraduc R, Bonnabau H, Brun M, Chabanon G, Chardon H, Croizé J, Demachy MC, Donnio PY, Dupont P, Fosse T, Gibel L, Gravet A, Grignon B, Hadou T, Hamdad F, Joly-Guillou ML, Koeck JL, Maugein J, Péchinot A, Ploy MC, Raymond J, Ros A, Roussel-Delvallez M, Segonds C, Vergnaud M, Vernet-Garnier V, Lepoutre A, Gutmann L, Varon E, Lanotte P. Microb Drug Resist. 2011 Mar;17(1):31-6. Epub 2010 Sep 1.

• MALDI-TOF mass spectrometry tools for bacterial identification in clinical microbiology laboratory. Carbonnelle E, Mesquita C, Bille E, Day N, Dauphin B, Beretti JL, Ferroni A, Gutmann L, Nassif X. Clin Biochem. 2011 Jan;44(1):104-9. Epub 2010 Jul 8.

• Streptococcus pneumoniae: still a major pathogen. Varon E, Mainardi JL, Gutmann L. Clin Microbiol Infect. 2010 May;16(5):401. No abstract available.

• The beta-lactam-sensitive D,D-carboxypeptidase activity of Pbp4 controls the L,D and D,D transpeptidation pathways in Corynebacterium jeikeium. Lavollay M, Arthur M, Fourgeaud M, Dubost L, Marie A, Riegel P, Gutmann L, Mainardi JL. Mol Microbiol. 2009 Nov;74(3):650-61. Epub 2009 Oct 6.

• Serotype distribution and antibiotic resistance of Streptococcus pneumoniae strains isolated from adults in France: evolution between 2001 and 2003. Roussel-Delvallez M, Vernet-Garnier V, Bourdon S, Brun M, Cattier B, Chanal C, Chardon H, Chomarat M, Croizé J, Demachy MC, Donnio PY, Dupont P, Fosse T, Gravet A, Grignon B, Laurans G, Maugein J, Péchinot A, Prère MF, Thoreux PH, Vergnaud M, Weber M, Coignard B, Gutmann L, Varon E, Ploy MC. Microb Drug Resist. 2009 Sep;15(3):201-4.

• Identification of the L,D-transpeptidases for peptidoglycan cross-linking in Escherichia coli. Magnet S, Dubost L, Marie A, Arthur M, Gutmann L. J Bacteriol. 2008 Jul;190(13):4782-5. Epub 2008 May 2.

• The peptidoglycan of stationary-phase Mycobacterium tuberculosis predominantly contains cross-links generated by L,D-transpeptidation. Lavollay M, Arthur M, Fourgeaud M, Dubost L, Marie A, Veziris N, Blanot D, Gutmann L, Mainardi JL. J Bacteriol. 2008 Jun;190(12):4360-6. Epub 2008 Apr 11.

Identification of the L,D-transpeptidases responsible for attachment of the Braun lipoprotein to Escherichia coli peptidoglycan. Magnet S, Bellais S, Dubost L, Fourgeaud M, Mainardi JL, Petit-Frère S, Marie A, Mengin-Lecreulx D, Arthur M, Gutmann L. J Bacteriol. 2007 May;189(10):3927-31. Epub 2007 Mar 16.

85

86



Keywords

• Neutralizing antibodies

• HCV

• HIV

• Chikunguya

• YFV

• WNV

• Dengue

• Flaviruses

Major Grants

• European Grant:

• FP6: CompuVac; DV3; Epivac.

• FP7: CutiVac

• ANRS

• ANR

David Klatzmann, M.D, Ph.D

Inserm U979 - Pierre and Marie Curie University Paris - CNRS UMR7211 – APHP Paris

Immunology-Immunopathology -Immunotherapy (including vaccine development)

While most researchers and companies are developing vaccine vectors aimed at inducing T cell responses, we have developed a platform aimed at the generation of neutralizing antibody responses

Over 100 years of vaccine development have taught that successful preventive vaccines are those (i) that can

induce good neutralizing antibody responses and (ii) that present the antigens in a particulate form.

We have thus developed a platform of vaccine vectors based on virus-like-particles, capable of presenting a

vast array of different envelope proteins in their wild-type conformation. We used the versatility and simplicity of

retrovirus engineering to design retro-VLPs based on the expression of retroviral gag and pseudotyped

heterologous envelope proteins. These VLPs are safe as they do not express the retroviral enzymes (reverse

transcriptase, protease and integrase) and do not contain a viral genome.

We proved the efficiency (superiority) of these VLPs for inducing neutralizing antibody responses against

Hepatitis C virus, HIV, West Nile Virus and influenza virus. For example, these VLPs are the only immunogens

described so far capable of inducing broadly neutralizing antibody responses against all HCV genotype.

Since virtually all envelope proteins of enveloped viruses can be pseudotyped onto such VLPs, we believe that

they have a broad potential of development, including as boost for vaccine vectors capable of inducing strong

cellular responses.


• E1/E2 pseudotyped retrovirus-derived VLPs have a unique ability to trigger broadly neutralizing antibodies against HCV in macaques. Garrone P, Fluckiger A-C, Mangeot P-E, Gauthier E, Dupeyrot-Lacas P, Mancip J, Cangialosi A, Du Chéné I, Legrand R, Mangeot I, Lavillette D, Bellier B, Cosset F-L, Tangy F, Klatzmann D, Dalba C. Submitted.

• Intranasal DNA Vaccination Induces Potent Mucosal and Systemic Immune Responses and Cross-protective Immunity Against Influenza Viruses. Torrieri-Dramard L, Lambrecht B, Ferreira HL, Van den Berg T, Klatzmann D, Bellier B. Mol Ther. 2011 Mar;19(3):602-11.

• DNA vaccines expressing retrovirus-like particles are efficient immunogens to induce neutralizing antibodies. Bellier B, Huret C, Miyalou M, Desjardins D, Frenkiel MP, Despres P, Tangy F, Dalba C, Klatzmann D. Vaccine. 2009 Sep 25;27(42):5772-80.

• Recombinant retrovirus-like particle forming DNA vaccines in prime-boost immunization and their use for hepatitis C virus vaccine development. Desjardins D, Huret C, Dalba C, Kreppel F, Kochanek S, Cosset FL, Tangy F, Klatzmann D, Bellier B. J Gene Med. 2009 Apr;11(4):313-25.

• Induction of neutralising antibodies by virus-like particles harbouring surface proteins from highly pathogenic H5N1 and H7N1 influenza viruses. Szécsi J, Boson B, Johnsson P, Dupeyrot-Lacas P, Matrosovich M, Klenk HD, Klatzmann D, Volchkov V, Cosset FL. Virol J. 2006 Sep 3;3:70.

• DNA vaccines encoding retrovirus-based virus-like particles induce efficient immune responses without adjuvant. Bellier B, Dalba C, Clerc B, Desjardins D, Drury R, Cosset FL, Collins M, Klatzmann D. Vaccine. 2006 Mar 24;24(14):2643-55.

• Replication-competent vectors and empty virus-like particles: new retroviral vector designs for cancer gene therapy or vaccines. Dalba C, Bellier B, Kasahara N, Klatzmann D. Mol Ther. 2007 Mar;15(3): 457-66. Review.

87



A vaccine vector platfo rm for the induction

of neutralizing antib odies

On neutralizing antibodies and vaccination

� Premises

• A good vaccine should induce cellular and neutralizing antibody responses

� Objectives

• To design immunogens capable of inducing neutralizing antibodies for the development

of preventive and therapeutic vaccines

• To present envelope proteins of enveloped viruses

• in their proper conformation for better neutralizing antibody induction

• in a repetitive/particulate form for better handling by the immune system

� Tools

• Virus like particles (VLPs) derived from retroviruses

• can be formed by the sole expression of retroviral gag proteins

• do not express retroviral enzymes (reverse transcriptase, protease and integrase)

• do not contain a viral genome

• Virtually all envelope proteins of enveloped viruses can be pseudotyped on such VLPs

• Proof of concept against HCV, HIV, Flu, WNV

e-VLPs: engineered enveloped retroviral VLPs… the solution for enveloped viruses!

�� No geneticmaterial

Retroviral Core Protein Particle

ConventionalPhospholipid Envelope

Customisable surface protein(s)Customisable surface protein(s)

88

E2

Cont .

E1E2 Env+

No Env

Control E

nv

E1

GagPurified VLPsWestern blot

Env

�� HCV e-VLPs:

HCV-pseudotyped particle formation





HCV e-VLPs induce cross neutralizing antibodies in macaques

1 3 6 120

25

50

75

100

H77 (1a)CON1 (1b)CG1B (1b)JFH1 (2a)UKN2B (2b)UKN4 (4c)VSVG (control)

Macaque serum at week 22 (dilution 1/50)

% N

eutr

aliz

atio

n

��

Experiment performedby

89

Perspectives






e-VLPs have a broad range of potential applications

Viral infectious diseases• e-VLPs are especially relevant for enveloped viruses

Retroviridae: HIV & other retrovirusesFlaviviridae: HCV, Dengue, WNV, YFV, TBE, JEE, SLEOrthomyxoviridae: Influenza A and BTogaviridae: Chikungunya, Sindbis, SFV, RRV, EEVParamyxoviridae: RSV, PIV, PMV, MeaslesCoronaviridae: SARSFiloviridae: Ebola MarburgArenaviridae: Lassa virus

Non-viral infectious diseases• e-VLPs can be used as platforms for any antigen of interest

Bacterial antigensCancer antigensEtc…

• A proprietary technology:

• Patent Application n° 01 988766.0 and 10/ 415 242, “Synthetic viruses

and uses thereof”

• Validated with four targets

• HCV (mice and macaques, best results worldwide)

• HIV (mice and rabbit)

• Flu (mice)

• WNV (mice)

• Broad application: virtually all enveloped viruses

• An experienced team that can efficiently test new targets, from vector

design to animal experimentation and clinical trial through our Clinical

Investigation Center in Biotherapy

• A Biotech: Epixis SA

David Klatzmann Team: Vaccines inducing neutralizing antibodies

90



Keywords

• Neonatal infections

• CNS infe ctions

• Foodborne infections

• Blood-brain barrier

• Placental barrier

• Intestinal barrier

• Listeria

• Group B streptococcus

• Chikungunya virus

• Arbovirus

Major Grants :

• ERC

• Avenir Inserm Team

• Institut Pasteur 5-year group

• Team FRM

• Team Ville de Paris

• ANR grants

• FP7 grants

• PHRC national

Institut Pasteur Paris - Inserm U604 - Paris Descartes University - APHP - Hôpital Necker-Enfants malades Paris

Pathophysiology of infectious diseases

We are interested in the molecular basis of host, tissue and cell tropisms of microbial pathogens. We are notably interested in understanding how invasive microbes target and cross host barriers such as mucosal barriers, the blood-brain barrier a nd the placental barrier

Marc Lecuit, M.D, Ph.D

Scientific expertise: I am a clinician in infectious diseases and a group leader studying the pathophysiology of infectious diseases. We follow a bench-to-bedside and bedside-to-bench approach and study three human pathogens that induce CNS and neonatal infections: Listeria monocytogenes, Group B streptococcus, and Chikungunya virus.

Research strategy: We combine in vitro, ex vivo and in vivo approaches by using cultured cell lines, primary cells, tissue explants and animal models, and molecular techniques in the fields of microbiology and cell biology. We also generate and use 'humanized' genetically modified animals that take into account the species specificity of human pathogens. We also use the human as a model, including clinical data, clinical microbial isolates, epidemiological data, as well as human cells and tissues, and biopsy tissue samples. The combination of these approaches allows us to investigate cellular microbiology in a tissue context.

Major data: We have discovered the species specificity of Listeria monocytogenes, its molecular basis, generated humanized animal models to address this species specificity, and identified the molecular mechanisms underlying Listeria crossing of the intestinal and placental barriers. We have also recently identified the molecular mechanisms underlying the hypervirulence of a clone of group B streptococcus, the leading cause of neonatal meningitis. We have developed the first animal model to study Chikungunya virus, and identified its cell and tissue tropisms, the critical role of peripheral IFN-I sensing in the control of this infection, and the ability of this virus to induce severe disease, notably in neonates, by disseminating to the CNS.

Perspectives: Our objective is to use infections as a way to address basic biology questions, as well as to develop new ways of combating infections once we have understood their detailed molecular mechanisms. We are also interested in the discovery of new microbes causing emerging infections, and diseases of so far unknown etiology.


• The surface protein HvgA mediates Group B streptococcus hypervirulence and meningeal tropism in neonates. Tazi A, Disson O, Bellais S, Bouaboud A, Dmytruk N, Dramsi S, Mistou M-Y, Khun H, Mechler C, Tardieux I, Trieu-Cuot P, Lecuit M, Poyart C. J Exp Med. 2010 Oct 25;207(11):2313-22.

• Type I IFN controls chikungunya virus via its action on non-hematopoetic cells. Schilte C, Couderc T, Chrétien F, Sourisseau M, Gangneux N, Guivel-Benhassine F, Gruber A, Tschopp J, Higgs S, Michault A, Arenzana-Seisdedos F, Colonna M, Schwartz O, Lecuit M, Albert M. J Exp Med. 2010 Feb 15;207(2):429-42.

• Prophylaxis and therapy of Chikungunya virus infection. Couderc T, Khandoudi N, Grandadam M, Visse C, Gangneux N, Bagot S, Prost JF, Lecuit M. J Infect Dis. 2009 Aug 15;200(4):516-23.

• The Listeria transcriptional landscape from saprophytism to virulence. Toledo-Arana A, Dussurget O, Nikitas G, Sesto N, Guet-Revillet H, Balestrino D, Loh E, Gripenland J, Tiensuu T, Vaitkevicius K, Barthelemy M, Vergassola M, Nahori M-A, Soubigou G, Régnault B, Coppée J-Y, Lecuit M, Johansson J, Cossart P. Nature. 2009 Jun 18;459(7249):950-6.

• Conjugated action of two species-specific invasion proteins for fetoplacental listeriosis. Disson O, Grayo S, Huillet E, Nikitas G, Langa-Vives F, Dussurget O, Ragon M, Le Monnier A, Babinet C, Cossart P, Lecuit M. Nature. 2008 Oct 23;455(7216):1114-8.

• A mouse model for Chikungunya infection: young age and inefficient type-I interferon signaling are risk factors for severe disease. Couderc T, Chrétien F,Schilte C, Disson O, Brigitte M, Guivel-Benhassine F, Touret Y, Barau G, Prévost MC, Schuffenecker I, Desprès P, Arenzana-Seisdedos F, Michault A, Albert ML, Lecuit M. PLoS Pathog. 2008. 4(2):p. e29.

• Multidisciplinary prospective study of mother-to-child chikungunya virus infections on the island of La Réunion. Gérardin P, Barau G, Michault A, Bintner M, Randrianaivo H, Choker G, Lenglet Y, Touret Y, Bouveret A, Grivard P, Le Roux K, Blanc S, Schuffenecker I, Couderc T, Arenzana-Seisdedos F, Lecuit M, Robillard PY. PLoS Medicine. 2008. 5(3):p. e60.

91



Pathophysiology of infe ctious diseases

Microbes and host barriers

� Objectives:

• Determine the molecular bases of microbial host, tissue and cell tropisms

• Decipher the mechanisms of microbial adhesion to host barriers

• Understand how invasive pathogens cross host barriers

• Determine microbial dynamics and fate within the host

• Identify the influences of microbe-elicited host responses on barrier function

� Methods:

• Model microorganisms (Listeria, Group B streptococcus, Chikungunya virus)

• Clinical strains (National Reference Centers)

• Clinical cohorts

• Humanized animal models taking into account microbial species specificity

• Imaging techniques (2-photon and confocal microscopy)

Figure 1: Adhesion to and crossing of host barriers

� A cell biology approach in a tissue context

� Location

Paracellular vs. transcellular passage

Cytosolic access vs. intravacuolar transit

� Barrier function

Cell junction integrity vs. barrier opening

� Transfer

Transcytosis

Exocytosis

� Crossing of basement membranes

Adhesion

Dissociation

92


Figure 2 : Microbial dynamics and fate within the host

Mastroeni et al, 2009, NRM

WITS principle

� A cell biology approach in a tissue context

� Interactions with host cells (locally & distantly)

Fibroblasts, ECM

Leucocytes subpopulations

Vascular and lymphatic endothelial cells

� Transit in the systemic circulation

Free and/or cell-associated

Routing

Dynamics (dissemination, replication)

Distribution (time, space)

� Access to secondary barriers and target organs

Figure 3 : Influences of host responses on barrier function

� The host environment is microbial

Host responses to commensal vs. pathogens

Axenic vs. gnotobiotic hosts

� Neonatal context

Opportunity for commensals to become pathogenic

Microflora being established

Immaturity of host responses to microflora

Local and systemic effects

� Influence of host microflora on host responses,

notably at the barriers’ levels

Barrier maturity and integrity

Cell differentiation and renewal

Barrier function alteration upon infection

germ free isolator


Pathophysiology of infectious diseases

93

Perspectives

Strengths


• Understand infection biology at the molecular, cell and tissue levels

• Improve our basic understanding of tissue barrier biology

• Develop new diagnostic approaches

• Identify new therapeutic targets and strategies

• Investigate beyond infections, tumor cell dissemination and metastasis

• Combined expertise in clinical infectious diseases and basic science

• Recognized contribution in the field of infectious diseases pathophysiology

• Molecular bases of the species specificity of Listeria (EMBO J)

• Humanized animal models for human infectious diseases (Science)

• Mechanisms of Listeria crossing of the intestinal & placental barriers (Nature)

• From bench to bedside: integrative and multidisciplinary approaches, access to in vitro,

ex vivo and in vivo models, patients cohorts and clinical strains

• Critical mass of the Institut Pasteur campus in the field of infectious diseases

• Strong collaboration network


Pathophysiology of inf ectious diseases

94



Keywords

• Viral hemorrhagic fevers: Ebola, Marburg, Crimea-Congo, yellow fever, Lassa fever

• Arbovirus; chikungunya, dengue, zika

• Highly pathogenic viral diseases: H1N1, poliovirus

• Virology (genomic, phylogeny)

• Immunity (ex vivo immune responses)

• Epidemiology during outbreak setting

Major Grants

• FSP (fonds de solidarité prioritaire)

• ANR

• Fondation Rodolphe et Christophe Mérieux (Institut de France)

• IRD

• Total oil compagny

• USAID PREDICT (Co-investigator and lead for Gabon)

• US Department of Defense Global Emerging Infections System (Co-investigator)

• Global Viral Forecasting Initiative

UMR (IRD 224 – CNRS 5290 - UM1) Montpellier

IRD Gabon Franceville, Gabon

Viral hemorrhagic fevers and emerging infec tious diseases

My research focuses on viral hemorrhagic fevers (VHFs), emerging viral diseases, highly pathogenic viral diseases, and all viral diseases that are of public health importance for southern developing nations, especially tropical rainforests of Central Africa. My research program is based on a multidisciplinary approach (One Health) the understanding of the emergence of viruses in human and the mechanisms of cross-species transmissions and dynamics

Eric Leroy, DVM, Ph.D

I have studied VHFs for 10 years in the Central African Congo Basin, with a consistent history of major publications and have successfully competed for funding from France, the Nation of Gabon, and the United States.

Medical context: I lead an Emerging Infectious Diseases Unit of a national public health and research laboratory located in Gabon (Centre International de Recherches Médicales de Franceville), which provides rapid, regionally-based diagnosis of viral hemorrhagic fevers in Central Africa. CIRMF also serves as the National reference laboratory for the diagnosis of several clinical syndromes that affect human populations in the Central African forest region, such as febrile, diarrheic, respiratory and neurological syndromes. Of note, my group has served as the World Health Organization focal point and primary responders, for identifying all Filovirus epidemics occurring in Central Africa since 1995, as well as the outbreaks of Chikungunya that have occurred consistently in Gabon since 2007 and recently, the poliovirus outbreak in the Republic of Congo in 2010.

Scientific expertise, research strategy: My unit operates a high-containment laboratory with a virus isolation unit enclosed in highly secure facilities, which is one the only two sites in Africa in which it is possible to work on a Bio-Safety Level 4 agent. My research program focuses on the understanding of viral diseases emergence and the fundamentals of cross-species transmission using multidisciplinary approaches. Our strategy is to monitor the human-animal interfaces in Gabon and to capitalize on the diverse expertise or my own team at CIRMF, as well as international partners with varies skill sets. Our “One Health” approach has led the early and rapid detection of both highly pathogenic agents (such as Ebola), as well as viral agents that result in significant public health disease burden.

Major data: I have characterized the viral strains associated with all Ebola outbreaks occurred between 1996 and 2007 and developed new epidemiological models of Ebola epidemics, based on the identification of several independent epidemic chains. I have carried out immunological studies in patients, demonstrating the destruction of immune cells by apoptosis. I have provided the demonstration of asymptomatic Ebola virus.

I have elucidated the major elements of the circulation of the virus in its natural environment: contamination of humans by contact with infected carcasses, natural contamination of great apes and the occurrence of major, devastating epidemics in natural populations; the massive, simultaneous contamination of great apes by the reservoir, according to a multi-emergence model, and identification of the reservoir of Ebola virus and Marburg virus. Finally, I recently identified concurrent infections of Chikungunya and dengue viruses.

Perspectives: My research program is subdivided into two parts: The first part consists in carrying out an inventory of the viruses that have emerged in the human population, and viruses that are hosted by animals and are likely to be transmitted to humans. The main goal here is to describe the "viral biodiversity" of the tropical rainforests of the Central African Congo Basin. The second part of the program consists in studying the factors implicated in the three steps that lead to the emergence of a virus in humans. (i) The first step will study the natural cycle of viruses in the environment, including the circulation within the natural host, the crossing to intermediary animal species, and finally the transmission to humans. (ii) The second step will study the cellular and immunological mechanisms involved in human infections. (iii) The third step will study the epidemiological aspects of the diffusion of a virus within the human population.

Selected p ublications

• Human Fatal Zaire Ebola Virus Infection Is Associated with an Aberrant Innate Immunity and with Massive Lymphocyte Apoptosis. Wauquier N, Becquart P, Padilla C, Baize S, Leroy EM. PLoS Neg. Trop. Dis. 2010;4(10): e837.

• High Prevalence of both Humoral and Cellular Immunity to Zaire ebolavirus among Rural Populations in Gabon. Becquart B, Wauquier N, Mahlakõiv T, Nkoghe D, Padilla P, Souris M, Ollomo B, Gonzalez J-P, De Lamballerie X, Kazanji M, and Leroy EM. PLoS ONE. 2010;5(2): e9126.

• Concurrent Chikungunya and Dengue virus infections during simultaneous outbreaks, Gabon, 2007. Leroy EM, Nkoghe D, Ollomo B, Nze-Nkogue C, Becquart P, Grard G, Pourrut X, Charrel R, Moureau G, Ndjoyi-Mbiguino A, De Lamballerie X. Emerg. Infect. Dis. 2009;15(4): 591-593.

• A new malaria agent in African hominids. Ollomo B, Durand P, Prugnolle F, Douzery E, Arnathau C, Nkoghe D, Leroy E, Renaud F. PLoS Pathog. 2009;5(5): e1000446.

• Human Ebola outbreak resulting from direct exposure to fruit bats in Luebo, Democratic Republic of the Congo, 2007. Leroy EM, Epelboin A, Pourrut X, Mondonge V, Gonzalez JP, Muyembe-Tamfum JJ, Formenty P. Vector-Borne and Zoonotic Dis. 2009;9(6): 723-728.

• Isolates of zaire ebolavirus from wild apes reveal genetic lineage and recombinants. Wittmann T, Biek R, Hassanin A, Rouquet P, Yaba P, Pourrut X, Real L, Gonzalez J-P, Leroy EM. Proc. Natl. Acad. Sci. USA. 2007;104 (43):17123-17127.

• Marburg virus infection detected in a common African bat. Towner JS, Pourrut X, Albarino C, Nze Nkogue C, Bird BH, Grard G, Ksiazek TG, Gonzalez J-P, Nichol ST, Leroy EM. PLoS ONE. 2007;2 (8): e764.

95

� Objectives:

• To study Viral biodiversity of the Central African tropical rainforest

• To understand the emergence of human viral diseases

• To assess the fundamentals of cross-species transmission

� Tools:

• Molecular virology

• In vivo immunological studies (luminex, flow cytometry, cytotoxicity …)

• Cohort studies

• Animal trapping

• Outbreak Field investigations

• Entomological studies

• Multi-emergence into great apes and/or humans with spill over events from the reservoirs

• Massive outbreaks in wild great ape populations with subsequent dramatic population decline

in several areas of the Basin Congo

Figure 1: Genomic and phylogenetic of Ebola virus

• Genetic characterization of 16 strains of Ebola

zaire types, among the18 known

• First identification and characterization of Ebola

virus from dead great apes

• First evidence of filovirus recombination


Eric Leroy, D.V.M., Ph.D

Emerging Viral Diseases

• Fruit bat species as reservoir

for Ebola and Marburg viruses

• Likely direct transmission from

bats to great apes & humans

direct physical contact

Figure 2: The natural history of Ebola virus

outbreaklikely

Lineage A

Recombinant viruses

Lineage B

Viral strains isolated fromgorillas and chimpanzees

96

Figure 3: Deep immunosuppression during Ebola virus infection

CTL

CD3+CD4+ CD3+CD8+

DCD

SURV

12.3% 5.4%

46.2% 24.1

%

43.6% 22.4%

• Aberrante innate immunity characterized

by the absence of IFN I responses and a

"cytokine storm"

• Immunosuppression associated with

massive apoptosis of T4 and T8

lymphocytes

Figure 4: Human Asymptomatic Ebola virus infection

7 9 16 23

Days since first exposure to infection

• EBOV RNA+ detection in PBMC for two weeks

• EBOV -IgG and -IgM detection three weeks post

infection

• Strong and early inflammatory responses

• Identical viral strain as for survivors and

deceased

• High overall EBOV -IgG prevalence in Gabon

• Association with forested areas and with age

• T lymphocyte memory responses

EBOV RNA+


Eric Leroy, DVM, PhD


97

Perspectives


• To characterize "viral biodiversity" of the tropical rainforests of Central Africa

• viruses that emerged in the human population

• Viruses hosted by animals and likely to be transmitted to humans

• To study the factors implicated in the process that lead to the emergence of a virus in

humans.

• Describe and understand the natural cycle of the viruses

• Study the cellular and immunological mechanisms involved in human infections

• Encompass the epidemiological aspects of a virus diffusion within the human population

• Pioneer and leader in Ebola haemorrhagic fever and in other exotic emergent diseases

• WHO collaborative center for the diagnosis of viral haemorrhagic fevers

• Unique strong expertise in working on highly pathogenic agents in BSL4 conditions

• Strong experience in field operations during outbreaks of highly pathogenic agents

• Multidisciplinary approach in the understanding of the emergence of viruses: from

cellular system to ecosystem and patient cohort

• Strong collaborations allow quick viral discovery


Eric Leroy, DVM, PhD


98



Keywords

• Malaria

• Insect immunity

• Pharm acogenomics

• RNAi

Major Grants

• International Research Scholar of Howard Hughes Medical Institute (HHMI)

• 3 grants within the EC FP7 :

Coordination of one HEALTH project MALVECBLOK Cluster leadership in INFRASTRUCTURES project INFRAVEC Cluster leadership in NETWORKS of EXCELLENCE EVIMALAR

Elena Levashina

Inserm U963 – CNRS UPR9022 Strasbourg

Immune response and development in insects

Modulation of crucial aspects of vector biology, including immune responses and reproduction, offer s excellent opportunities for development of new generation of active molecules for vector control

Mosquitoes of the Anopheles genus, exclusive vectors of malaria, represent a major threat for human health

and pose major socio-economic problems. A series of biological features, collectively known as vectorial

capacity, renders Anopheles species very efficient vectors for Plasmodium parasites, the causative agents of

malaria. These include a genetically determined preference for blood meals on a human host for egg

development, a high reproductive rate and a long life span, combined with the innate ability to support parasite

development. Therefore modulation of vector-parasite interactions, host-seeking behaviour, reproductive

biology, and longevity offer key opportunities for interfering with malaria transmission.

Our group is studying the mechanisms of parasite recognition and killing in the mosquito midgut. Previously, we

identified the mosquito hemocyte-specific complement-like protein TEP1 and showed that it is required to

control parasite development. Using expressional profiling of loss- and gain-of-function TEP1-transgenic

mosquitoes and functional gene analysis by dsRNA silencing, we are characterizing gene networks that are

regulated by TEP1 and involved in parasite killing. Our results point to an important role of mosquito blood cells

in orchestrating immune responses in the midgut epithelium. Using functional analysis of candidate genes and

specific markers for blood and midgut cells, we are dissecting blood-cell signaling pathways activated by

parasite infection and are following the responses of the midgut cells that result in parasite killing. These

studies have implications for the development of novel vector control strategies and should provide new

paradigms for immunity, cell biology, and parasitology.


• The major yolk protein Vitellogenin interferes with the anti-Plasmodium response in the malaria mosquito Anopheles gambiae. Rono M, Whitten MMA, Oulad-Abdelghani M, Levashina EA, Marois E. PLoS Biology. 2010;8(7):e1000434.

• Two Mosquito LRR Proteins Function as Complement Control Factors in the TEP1-Mediated Killing of Plasmodium. Fraiture M, Baxter R.H.G., Steinert S., Chelliah Y., Frolet C., Quispe-Tintaya W., Hoffmann J.A., Blandin S.A., and Levashina EA. Cell Host and Microbe. 2009;5:273-284.

• Molecular and cellular components of the mating machinery in Anopheles gambiae females. Rogers DW, Whitten MM, Thailayil J, Soichot J, Levashina EA, Catteruccia F. Proc. Nat. Acad. Sci. 2009;105:19390-19395.

• Fz2 and cdc42 mediate melanization and actin polymerization but are dispensable for Plasmodium killing in the mosquito midgut. Shiao SH, Whitten MM, Zachary D, Hoffmann JA, Levashina EA. PLoS Pathog. 2006;2: e133.

• Boosting NF-kappaB-dependent basal immunity of Anopheles gambiae aborts development of Plasmodium berghei. Frolet C, Thoma M, Blandin S, Hoffmann JA, Levashina EA. Immunity. 2006;25:677-685. .

• In Vivo Identification of Novel Regulators and Conserved Pathways of Phagocytosis in A. gambiae. L.F. Moita, R. Wang, K. Michel, S. Blandin, T. Zimmermann, E.A. Levashina and F.C. Kafatos. Immunity. 2005;23: 65-73.

• Complement-like protein TEP1 is a determinant of vectorial capacity in the malaria vector Anopheles gambiae. Blandin S, Shiao S.-H, Moita L.F., Janse C.J., Waters A.P., Kafatos F.C., Levashina E.A. Cell. 2004;116:661-670.

99


Elena A. Levashina, Ph.D

Vector biology of the ma laria mosquito

� Objectives:

• What makes up a malaria vector?

• What are processes that regulate mosquito-parasite interaction?

• How bacteria and environment are influencing mosquito biology and interactions

with Plasmodium?

� Tools:

• Construction of a mosquito immune cDNA library

• Development of HTP larval screens

• In vivo functional analysis by RNAi

• Development of transgenic approaches for gene exchange

• Cellular imaging

• Studies in natural populations (microbiota, gene polymorphism)

Figure 1: Mosquito efficiently kills Plasmodium at the ookinete stage

100


Figure 2 : Plasmodium killing is regulated by TEP1 gene:

development of P. berghei in TEP1 transgenic mosquitoes

Figure 3 : Development of transgenic mosquito reporter lines for

high throughput analysis of vectorial capacity


Vector biology of the malaria mosquito

101

Perspectives



• Development of pharmaco-genetics based screens for mosquito larvae.

• Identification of pathways involved in immune responses in the mosquito

larvae and adults.

• Screening for modulators of immune responses and other biological processes

in the mosquito larvae with the aim to develop new generation of biologically

active molecules with insecticidal activities

• Leader in the field of insect immunity

• Unique strong expertise in functional gene analyses

• From molecular tools to interventions: integration and access to all the

research materials : molecular constructs, biochemical tools, cell and

animal models, strong collaborative links with laboratories in Africa

• Development of a drug discovery screening platform with possible medicinal

chemistry optimization process (small molecules and RNAi developement)

• Strong collaborations allow quick testing of laboratory findings


Vector biology of the malaria mosquito

102



Keywords

• HIV physiopathogenesis

• Vaccinology

• Systems biology

• Immunotherapy

Major Grants

• Total grants 2005-2010: 22

• ANRS

• Inserm

• NIH

• Sidaction

• ANR

• AP-HP

• University (UPEC)

• Industry

• ERC (FP7)

Inserm U955 - University of Paris-Est Créteil - CHU Henri Mondor - APHP Créteil, East Paris

HIV physiopathogenesis from upstream to translational researches in the field of immune interventions and vaccines

The group has extensively published on the topic of Immune-Based Therapies, HIV physiopathology, Vaccine researches, in addition to more basic work on T cell homeostasis and mechanisms of cell death.

Yves Lévy, M.D, Ph.D

Our mission is to understand the mechanisms of T cell depletion/dysfunction and immune responses to HIV in support of the development of new immune interventions and vaccines against HIV. Three axes of research are being developed with the objective to understand: i) mechanisms of T cell restoration from the thymus and how HIV interferes with early stages of T cell development; ii) the regulation of effector T cell responses with a specific focus on Regulatory T cells in the periphery and mucosal in individuals infected with HIV/SIV; iii) mechanisms of immune protection and identification of markers of disease progression. In support of this effort, an immunomonitoring platform was created to perform integrated and extensive phenotypic, functional and genomic analyses of immune responses according to international standards.

The team is closely linked to the department of clinical immunopathology where more than 20 clinical trials are ongoing which provide a unique opportunity to join basic and clinical approaches addressing both prevention and effective treatment of HIV disease.

Three close and complementary axes of research characterize our scientific activities. For all axes, we are combining basic and applied scientific questions and the comparison between physiologic conditions and how pathogens may interfere with normal pathways. The team benefits from a number of equipments and an organization that has been rationalized for basic and translational researches.

The first axis is aimed at understanding mechanisms of T cell restoration from the thymus. Studies are performed using in vitro and in vivo approaches. The effects of immunotherapeutic strategies aimed at restoring T cells in HIV infected patients, such as cytokines or growth hormones. We have recently reported results from the first study of repeated doses of IL-7 in HIV infected patients showing an increase in the pool of naïve CD4 and CD8 T cells and Recent Thymic Emigrants (RTE) and the expansion of mature T cells.

The second axis is aimed at understanding the regulation of effector T cell responses with a specific focus on Regulatory T cells (Treg) in the periphery and mucosal. This approach is aimed at better understanding the role of Treg in physiopathology but also in the modulation of effector responses in vaccinated individuals. Our group was among the first to show an HIV-driven expansion of Treg in chronically and acutely HIV-infected patients.

The third axis is aimed at identifying correlates of immune protection or markers of disease progression in various clinical conditions. For this, the team has developed highly sensitive and quantitative assays to phenotype the different populations of immune cells, assess their functionality, and identify differentially-expressed genes, proteins and mediators responsible for immune protection. The platform (Mondor Immunology Center; M.I.C) , fills an urgent need for immunology laboratory services to perform key end-point immune assays aimed to evaluate human immune responses in immunotherapeutic and vaccine clinical trials. More than 15 clinical and physiopathological studies are running.


• Maraviroc-containing regimen suppresses HIV replication in the cerebrospinal fluid of patients with neurological symptoms.Melica G, Canestri A, Peytavin G, Lelievre JD, Bouvier-Alias M, Clavel C, Calvez V, Lascaux AS, Katlama C, Levy Y. AIDS. 2010 Aug 24;24(13):2130-3.

• Immunogenicity and Safety of an HIV-1 Lipopeptide Vaccine in Healthy Adults: ANRS VAC18 Phase 2 Placebo-Controlled Trial. Salmon-Céron D*, Durier C*, Desaint C, Cuzin L, Surenaud M, Ben Hamouda N, Lelièvre J-D, Bonnet B, Pialoux G, Poizot-Martin I, Aboulker J-P, Lévy Y, and Launay O, for the ANRS VAC18 trial group. *Co-authors. AIDS. 2010;24(14):2211-23. • AIDS progression is associated with the emergence of IL-17-producing cells early after simian

immunodeficiency virus infection. Campillo-Gimenez L, Cumont MC, Fay M, Kared H, Monceaux V, Diop O, Müller-Trutwin M, Hurtrel B, Lévy Y, Zaunders J, Dy M, Leite-de-Moraes MC, Elbim C, Estaquier J. J Immunol. 2010;184(2):984-92. • In vivo expansion of naive and activated CD4+CD25+FOXP3+ regulatory T cell populations in interleukin-2-

treated HIV patients. Weiss L, Letimier FA, Carriere M, Maiella S, Donkova-Petrini V, Targat B, Benecke A, Rogge L, Levy Y. Proc Natl Acad Sci U S A. 2010;107(23):10632-7. • Interleukin-2 therapy in patients with HIV infection: results of the ESPRIT and SILCAAT Trials. Abrams D*,

Lévy Y*, Losso MH*, Babiker A, Collins G, Cooper DA, Darbyshire J, Emery S, Fox L, Gordin F, Lane HC, Lundgren JD, Mitsuyasu R, Neaton JD, Phillips A, Routy JP, Tambussi G, Wentworth D. *Co-authors. N Engl J Med. 2009;361(16):1548-59. • Enhanced T cell recovery in HIV-1-infected adults through IL-7 treatment. Lévy Y, Lacabaratz C, Weiss L,

Viard J-P, Goujard C, Lelièvre J-D, Boué F, Molina J-M, Rouzioux C, Avettand V, Croughs T, Beq S, Thiébaut R, Chêne G, Morre M, Delfraissy J-F. J Clin Invest. 2009;119(4):997-1007. • Regulatory T cells modulate differentially the maturation and apoptosis of human CD8-T cell subsets.

Nikolova M, Lelièvre JD, Carriere M, Bensussan A, Lévy Y. Blood. 2009;113(19):4556-65.

103

104



Keywords

• Respiratory infections

• Tuberculosis

• M. pertussis

• Diagnostics

• Vaccines

• Therapeutics

Major Grants

• FP7 EU grant : Child-Innovac (C. Locht = coordinator) : vaccine development against pertussis

• FP7 EU grant : NewTB-VAC : vaccine development against tuberculosis

• FP7 EU grant : HomiTB : identification of tuberculosis latency drug and vaccine targets

Inserm U1019 - CNRS UMR8204 - Institut Pasteur Lille - Lille-Nord de France University Lille

Center for Infection and Immunity of Lille

Bacterial respiratory infections

We study the molecular and cellular mechanisms of bacterial respiratory infections in order to develop novel diagnostic, prophylactic (vaccine) and therapeutic strategies

Camille Locht

Respiratory infections are among the first causes of mortality and morbidity world-wide. We study in particular the mechanisms of tuberculosis and pertussis, a chronic and acute disease, respectively.

Both diseases are neglected, even forgotten, although close to 10 million tuberculosis and 45 million pertussis cases are recorded annually, leading to 2 million and 300,000 yearly deaths, respectively.

After 25 years of basic research, our understanding of these diseases has now come to a point where novel diagnostics, vaccines and therapeutic compounds can be rationally designed.

This area of applied research is currently at different stages of development:

(i) Novel molecular typing systems for Mycobacterium tuberculosis have been developed, are commercialized and widely used;

(ii) A novel live attenuated nasal pertussis vaccine has been developed and is now in phase I clinical trials. Preclinical studies have shown that it protects not only against pertussis, but also against other respiratory diseases due to its anti-inflammatory properties;

(iii) A strongly protective M. tuberculosis antigen has been discovered and is now in pre-clinical development both for diagnosis of latent tuberculosis and for vaccine development;

(iv) A novel strategy to increase the sensitivity of M. tuberculosis to anti-tuberculosis drugs has been designed, and a first series of chemical compounds is in pre-clinical development.


• Synthetic EthR inhibitors boost antituberculous activity of ethionamide. Willand, N., Dirié, B., Carette, X., Bifani, P., Singhal, A., Desroses, M., Leroux, F., Willery, E., Mathys, V., Déprez-Poulain, R., Delcroix, G., Frénois, F., Aumercier, M., Locht, C., Villeret, V., Déprez, B., Baulard, A.R. Nat. Med. 2009;15:537-544.

• Live attenuated B. pertussis as a single-dose nasal vacine against whooping cough. Mielcarek, N., Debrie, A. S., Raze, D., Bertout, J., Rouanet, C., Younes, A. B., Creusy, C., Engle, J., Goldman, W. E., and Locht, C. PLoS Pathog. 2006;2:e65.

• Methylation-dependent T cell immunity to Mycobacterium tuberculosis heparin-binding hemagglutinin. Temmerman, S., Pethe, K., Parra, M., Alonso, S., Rouanet, C., Pickett, T., Drowart, A., Debrie, A.-S., Delogu, G., Menozzi, F. D., Sergheraert, C., Brennan, M. J., Mascart, F., and Locht, C. Nat. Med. 2004;10:935-941.

• The Heparin-binding haemagglutinin of Mycobacterium tuberculosis is required for extrapulmonary dissemination. Pethe, K., Alonso, S., Biet, F., Delogu, G., Brennan, M. J., Locht, C., et Menozzi, F. D. 2001. Nature. 2001;412:190-194.

• Homologous and heterologous protection after single intranasal administration of live attenuated recombinant Bordetella pertussis. Mielcarek, N., Riveau, G., Remoué, F., Antoine, R., Capron, A., et Locht, C. Nature Biotechnology. 1998;16:454-457.

• Identification of a heparin-binding hemagglutinin present in mycobacteria. Menozzi, F. D., Rouse, J. H., Alavi, M., Laude-Sharp, M., Muller, J., Bischoff, R., Brennan, M. J., et Locht, C. J. Exp. Med. 1996.184:993-1001.

• Site-specific alterations in the B oligomer that affect receptor-binding activities and mitogenicity of pertussis toxin. Lobet, Y., Feron, C., Dequesne, G., Simoen, E., Hauser, P., et Locht, C. J. Exp. Med. 1993;177:79-87.

• Identification of amino acid residues essential for the enzymatic activities of pertussis toxin. Locht, C., Capiau, C., et Feron, C. Proc. Natl. Acad. Sci. U S A. 1989;86:3075-3079.

• Pertussis toxin gene: nucleotide sequence and genetic organization Locht, C., et Keith, J. M. Science. 1986; 232:1258-1264.

105


Camille Locht, Ph.D

Center for Infection & Immunity of Lille

Objectives

Continuum : Fundamental Research- Applications

EpidemiologyEpidemiology

MolecularMolecular BiologyBiology

Cellular Cellular BiologyBiology

-- OmicsOmics

Structural Structural BiologyBiology

ImmunologyImmunology

Clinical ResearchClinical Research

TherapeuticsTherapeutics

PreventionPrevention

DiagnosisDiagnosis

14,000,000 deaths due to infections /year

4,400,000 respiratory infections

2,600,000 HIV

2,000,000 Tuberculosis

1,500,000 Malaria

Tuberculosis and whooping-cough

0.4

0.8

1.2

1.6

2.0

Mor

talit

é20

06 (

en m

illio

ns)

TB Coq

8

16

24

32

40

Cas

2006

(en

mill

ions

)

TB Coq

20

40

60

80

100

%

TB Coq

Inf

Ad/Ad

< 6

m.

> 5

y.

106


Boosting anti-TB drugs

M. tuberculosis

DRUGS pro-DRUGS

Antibiotic Target

EthambutolRifampicineFluoroquinolones

IsoniazidPyrazinamideEthionamideThiacetazoneIsoxylPA824

Bio-activation

Willand et al., Nat. Med., 2009

Improve TB diagnosis and anti-TB vaccine

Aerosol

Primary infection 5%

Active TB

95%

Latent infection

5%

Reactivation

?

Controls LTBI TB

n = 11 n = 42 n = 40

IFN

−− −− γγ γγ (

pg/m

l)

0200400600800

1000120014001600180020005000

100001500020000250003000035000

P < 0.0001

Temmerman, Petheet al., Nat.Med., 2004

Camille Locht, Ph.D


107


One BPZE1 dose induce betterprotection than 2 i.p. doses of aPV

naive BPZE1 aPV

107

CF

U/p

oum

on

106

105

104

103

102

101

100

P<1x10-4

P=9x10-3

i.p. aPV i.p. aPVEpreuveB. pertussis

j0 j71 mois1 mois

i.n. BPZE1Protocole :

Souris de 3 semaines

Mielcareket al., PLoS Pathogens, 2006

Improve anti-whooping-cough vaccine

Sur

vie

(%)

aprè

s ép

reuv

eH

3N2

Jours après épreuve

Li et al., J. Virol., 2010

Protection against flu induced by BPZE1000

020406080

100120

0 2 4 6 8 10

C

Camille Locht, Ph.D


108



Keywords

• AIDS

• HIV

• Dendritic cells

• Innate immunity

• Interferon response

• Vaccine

• Adjuvants

Major Grants

• ATIP-Avenir 2010

• Ville de Paris Programme "Emergence" 2010

Institut Curie Paris - Inserm U932 Paris

Immunology, Virology

We investigate innate immunity in humans using HIV as a model

Nicolas Manel, Ph.D

Innate, or non-clonal, immune responses orchestrate the induction of protective immunity, for instance during

infection or vaccination. The molecular regulations of these responses and their immunological correlates are

poorly understood. As a consequence, our ability to utilize the principles of innate immunity in the clinic has

remained limited.

Our group is interested in understanding mechanisms of innate immunity in humans using the Human

Immunodeficiency Virus (HIV-1) as a model. We focus on dendritic cells, which are immune cells that bridge

innate and adaptive immunity. While DCs express a large array of pathogen detectors, DCs are insensitive to

HIV-1 and do not normally sense the virus. We have found that an innate immune response to HIV actually

exists in dendritic cells (DCs), and that this response is normally inactive – cryptic – because the virus is

usually unable to infect DCs (Manel et. al, Nature 2010 467:214).

Our lab focuses on determining the molecular mechanisms of this response. Our central approach is to identify

the viral and cellular factors involved in the process. We also focus on determining the clinical features of this

response and on developing molecular tools to target it. We propose that manipulation of this response may be

important to induce a protective immunity against HIV-1. Our research contributes, in a larger sense, to a global

understanding of the molecular mechanisms of immunity.


• A cryptic sensor for HIV-1 activates antiviral innate immunity in dendritic cells. Nicolas Manel, Brandon Hogstad, Yaming Wang, David E. Levy, Derya Unutmaz, Dan R. Littman. Nature. 2010;467:214.

• Susceptibility of Human Th17 Cells to Human Immunodeficiency Virus and Their Perturbation during Infection. Aimee El Hed, Alka Khaitan, Lina Kozhaya, Nicolas Manel, Demetre Daskalakis, William Borkowsky, Fred Valentine, Dan R. Littman, Derya Unutmaz. The Journal of Infectious Diseases. 2010;201: 843.

• Induction of intestinal Th17 cells by segmented filamentous bacteria. Ivaylo I. Ivanov, Koji Atarashi, Nicolas Manel, Eoin L. Brodie, Tatsuichiro Shima, Ulas Karaoz, Dongguang Wei, Katherine C. Goldfarb, Clark A. Santee, Susan V. Lynch, Takeshi Tanoue, Akemi Imaoka, Kikuji Itoh, Kiyoshi Takeda, Yoshinori Umesaki, Kenya Honda, Dan R. Littman. Cell. 2009;139: 485.

• Specific Microbiota Direct the Differentiation of IL-17-Producing T-Helper Cells in the Mucosa of the Small Intestine. Ivaylo I. Ivanov, Rosa de Llanos Frutos, Nicolas Manel, Keiji Yoshinaga, Daniel B. Rifkin, R. Balfour Sartor, B. Brett Finlay, Dan R. Littman Cell Host & Microbe. 2008;4:337.

• Human TH-17 cell differentiation requires transforming growth factor-β and induction of the nuclear receptor RORγT. Nicolas Manel, Derya Unutmaz, Dan R Littma. Nature Immunology. 2008;9:641.

• The ubiquitous glucose transporter GLUT-1 is a receptor for HTLV. Nicolas Manel, Felix J. Kim, Sandrina Kinet, Naomi Taylor, Marc Sitbon, Jean-Luc Battini. Cell. 2003;115:449.

109


Nicolas Manel, Ph.D

Human Innate Immunity and HIV

� Objectives:

• Define mechanisms, tools and markers of immunity in humans

• Identify mechanisms of protection, beyond induction of an immune response

• HIV-1 infection and dendritic cells as a model

HIV particles (green) interacting withhuman dendritic cells

� Tools:• Combine human immunology and virology

• Primary human cells from blood

• RNAi in primary human cells (T cells, dendritic cells)

• Polarization of human T helper subsets (e.g. Th17)

• Infections with HIV-1 and HIV-2 vectors

• Access to samples from infected patients

Figure 1: A cryptic innate immune response to HIV in humandendritic cells

• Unrestricted HIV infection of dendritic cells activates a crypticinnate sensor

• HIV thus behaves as an autonomous cell-intrinsic adjuvant

0 102 103 104 105

0

102

103

104

105 2.57 1.05

3.992.50 102 103 104 105

0

102

103

104

105 4.22 1.15

0.9793.7Det

ectio

n (C

D86

)

HIV (GFP)

ControlHIV

(normal restricted)

0 102 103 104 105

0

102

103

104

105 9.74 77.3

111.99

HIV(unrestricted)

110

Figure 2: Engagement of adaptive anti-viral responses

CFSE in T cells

ControlHIV-activated

DC

• Activation of lymphocytes, bypassing cross-presentation

• Inhibition of CD4+ T cellsinfection

GFP in CD4+ T cells(HIV)

ControlHIV-activated

DC

MHC-peptide

Costimulation

(CD86)Cytokines,

Interferon

CD4+ T cell CD8+ T cellB cell

HIV

DENDRITIC CELL

Antigen presentation

CACypA

Figure 3: A new paradigm for induction of anti-HIV immune responses

• An integrated immune response instructeddirectly by the virus

• Based on a CypA-IRF3 pathogen recognition pathway


Nicolas Manel, Ph.D


111

Perspectives


• Mobilize a natural pre-existing antiviral system, but currently « cryptic »

• Establish novel markers that correlate with protection (HIV and general)

• Develop novel "vaccine" concepts (HIV and general)

• Combined expertise in (retro)virology and immunology

• Experiments in primary human cells

• RNAi and gene expression in primary cells (dendritic cells, T lymphocytes)

• Manipulation of HIV infection in dendritic cells

• Collaboration & network

• Multidisciplinary scientific environment


Nicolas Manel, Ph.D


112



Keywords

• Malaria

• Plasmodium parasites

• Pre-erythrocytic phase

• Imaging

• Molecular genetics

• Vaccination

Major Grant

• Howard Hughes Medical Institute International Program (2000-2010)

Institut Pasteur Paris Paris

Pre-erythrocytic phase of malaria

A new paradigm of the pre-erythrocytic phase of malaria allows a rational approach to the dis covery of protective antigens

Robert Ménard, M.D, Ph.D

Malaria, a major global health issue, is due to the multiplication of Plasmodium parasites inside erythrocytes.

Our research focuses on the pre-erythrocytic phase (PEP) of the disease, which starts with the inoculation of

sporozoites by a mosquito. Until recently, the PEP was viewed as the rapid migration of sporozoites from the

skin to the liver and their subsequent invasion of, and differentiation inside hepatocytes. Much of PEP research

was immunological; following the discovery in the 1960s that injection of radiation-attenuated sporozoites

(RAS, unable to complete intrahepatocytic development) could protect against a challenge by infectious

sporozoites and prevent blood infection, in rodents and humans. Since the use of RAS was not considered an

option for large-scale human vaccination, vaccine research has mainly aimed at testing various sub-unit

delivery systems of sporozoite antigens, often selected randomly. So far no such vaccine has shown efficacy

similar to that generated by RAS.

In the last years, we and others have developed new technologies to study the PEP in rodents. Intravital

imaging has revealed that most inoculated sporozoites do not reach the liver but remain in the skin or end up in

the draining lymph node, where they can differentiate at least partially. In fact, we now know that injection of

RAS in the skin can induce protection and that the main effectors of protection, the CD8+ T cells, are primed in

the draining lymph node. Molecular genetic tools now permit to generate parasite mutants arrested at any step

of infection, and have already helped demonstrate that genetically-attenuated sporozoites (GAS) arrested

during intracellular development are also protective.

We are using the powerful combination of new tools in the rodent system to systematically dissect the

RAS/GAS-mediated protection after skin vaccination. We want to test whether protection is associated with a

particular set of protective parasites, their location (skin or draining lymph node), developmental stage (extra or

intracellular, stage of intracellular arrest) and protein profile, with the help of appropriate deficient mutants and

quantitative bioluminescence scoring of protection. This basic research should guide a rational path toward the

most protective GAS, which might turn out to be suitable for mass vacination, or to more protective antigens,

for inclusion in sub-unit vaccines. It should also help optimize the vaccine delivery route/system, via the

identification of the host tissues and immune cells that are involved in the protective response.


• Flp/FRT-mediated conditional mutagenesis in pre-erythrocytic stages of Plasmodium berghei. Lacroix C, Giovannini D, Combe A, Spath S, Panchal D, Tawk L, Thiberge S, Barale JC, Bhanot P, Ménard R. Nature Protocols. 2011. In press.

• Development of malaria parasites in the skin of the mammalian host. Gueirard P, Tavares J, Thiberge S, Bernex F, Ishino T, Franke-Fayard B, Milon G, Ménard R, Amino R. Proceedings of National Academy of Sciences U S A. 2010 ;107:18640-18645.

• Clonal conditional mutagenesis in malaria parasites. Combe A, Giovannini D, Gil Carvalho T, Spath S, Boisson B, Loussert C, Lacroix C, Gueirard P, Ménard R. Cell Host & Microbe. 2009 ;5:386-96.

• Host cell traversal is important for progression of the malaria parasite from the dermis to the liver. Amino R, Giovannini D, Thiberge S, Gueirard P, Dubremetz JF, Prévost MC, Ishino T, Yuda M, Ménard R. Cell Host & Microbe. 2008;3:88-96.

• In vivo imaging of malaria parasites in the murine liver. Thiberge S, Blazquez S, Baldacci P, Renaud O, Shorte S, Ménard R, Amino R. Nature Protocols. 2007;2 :1811-1818.

• Imaging malaria sporozoites in the dermis of the mammalian host. Amino R, Thiberge S, Blazquez S, Baldacci P, Renaud O, Shorte S, Ménard R. Nature Protocols. 2007; 2 :1705-1712.

• Quantitative imaging of Plasmodium transmission from mosquito to mammal. Amino R, Thiberge S, Martin B, Celli S, Shorte S, Frischknecht F, Ménard R. Nature Medicine. 2006;12:220-224.

113



Immunobiology of the Pr e-Erythrocytic Phase

of Malaria

Scientific Objectives:

. Better Understand the Biology of and Infection by Plasmodium PE Stages

. Better Understand the Basis of Protection Induced by Attenuated PE Stages

. Develop New Vaccination Strategies Against the Malaria PE Phase

Research Tools:

. Rodent Model of Malaria Infection

. Intravital Fluorescence Imaging of Plasmodium PE Stages in Rodents

. Bioluminescence Imaging of Plasmodium PE Stages in Rodents

. Molecular Genetic Techniques for Creating Any Plasmodium Mutant of Interest

. Model of Complete Protection Against Plasmodium PE Stages

Figure 1: Imaging the Malaria PE Phase in Rodents

30%15%

55%

QuickTime™ et undécompresseur

sont requis pour visionner cette image.

QuickTime™ et undécompresseur

sont requis pour visionner cette image.

DRAINING LYMPH NODE LIVER

SKIN

SPZEP

CD11cParasite (SPZ)

K5 (Keratinocytes)

Parasite (EEF) Parasite (EEF)

Blimp-1 (seb gl)

Red-BSAParasite (EEF)

Parasite

DAPI Auto-fluo

Intravital imaging of fluorescent P. berghei in rodents reveals a tripartite fate of sporozoites (SPZ). Prior to our imaging work, all SPZ were thought to end up and develop (into an exo-erythrocytic form, EEF) in the liver. We found that, while only 30% leave the skin site via the blood and reach the liver, 15% leave the skin via lymphatic vessels and are degraded in the draining lymph node, and >50% stay and may develop in the skin. The erythrocytic phase (EP) of malaria can be initiated by parasites released from hepatocytesor skin cells.

114




of Malaria

Figure 2: Protection Model against the PE Phase

Sterile protection after inoculation of irradiated Plasmodium SPZ in the skin. Prior to our work, protection against virulent SPZ by attenuated (irradiated) SPZ, known to be mostly CD8+ T cell-mediated, was thought to be mounted in the liver lymphoid tissue. Wenow know that it is possible to obtain sterile protection after injection of attenuated SPZ in the skin of mice, in which case protection ismounted in the cutaneous draining lymph node. The figure shows the protection, measured by bioluminescence imaging, to IV injection of 300000 bioluminescent SPZ conferred by 3 subcutaneous injections of 50000 irradiated SPZ.

2h 6h 18h 24h 48h 72h

�� !� �"# $ %&&%&&

Imm

unis

edN

on im

mun

ised

Figure 3: Site-Directed Mutagenesis of Parasite PE Stages

Development of techniques for generating site-directed mutants of PE stages of Plasmodium. We have developed techniques to create site-directed mutants of the parasite, including in any essential gene of the PE stages of the parasite, which provide the meansnot only to dissect the molecular basis of the important steps of the PE phase, but also to generate PE stages unable to perform specificsteps of the SPZ journey or attenuated at different stages of development inside host cells.

FlpLSPZ-

specific

SPZ

Targetless Mutant during PEP

FlpLSPZ-

specific

PEPEP

FRT FRT

FRT

TARGET

115

Perspectives

Strong Points




of Malaria

A rationale path to understanding the basis of protection mediated by attenuated Plasmodium

parasites

• Creating Parasite mutants defective in different steps of the PE phase, by

systematic mutagenesis of sporozoite secreted products

• Identifying Parasite Correlates of Protection in the rodent model by comparing the

in vivo infectivity and protective capacity of the relevant mutants. The use of mutants

impaired in specific steps of the PEP (eg, unable of reaching the DLN or the liver,

impaired in motility or host cell traversal in the skin, etc…) or blocked at various stages

of intracellular development should help define what is important for protection

• Expression cloning of protective antigens, by screening using CD8+ T cells

• Unique strong expertise in Plasmodium molecular genetics

• Unique strong expertise in Plasmodium in vivo imaging

• Unique collection of tools (eg, parasite and mouse mutants) allowing for integrative

studies, from protein function in vitro to parasite population behavior in vivo

• Access to a dedicated mosquito rearing and infection facility (CEPIA) and imaging

platform (PFID) at IP

• Strong collaborations with immunologists at IP

• International visibility: 10 year (2000-2010) funding by the Howard Hughes Medical

Institute international Scholar Program

116



Keywords

• Motility

• Spatial regulation

• Molecular motor

• Biofilm

• G-protein

• Cytoskeletion

• Bacterial cell biology

Major Grants

• ERC Starting Grant 2011-2015

• HFSP “cross disciplinary grant” 2008-2011

• ANR “Programme jeune chercheur-jeune chercheuse” 2007-2011

CNRS UPR9043 - Institut de Microbiologie de la Méditerranée Marseille

Bacterial cell biology and genetics

Using integrated approaches to elucidate a mysterious and widespread mechanism of bacterial motility

Tâm Mignot, Ph.D

Bacterial motility and chemotaxis is at the heart of health-threatening processes including pathogenesis and

antibiotic-resistant biofilm formation. However, many bacteria are able to move across surfaces by a

mechanism that has remained mysterious despite decades of research. To study this mechanism, we have

applied cutting-edge physics and cell biology methods. We discovered that motility is driven by focal adhesion

complexes that distribute along the cell body and coordinate molecular motors to surface adhesion and the

bacterial actin cytoskeleton. Unexpectedly, this mechanism is reminiscent of gliding motility in Apicomplexa, a

class of parasites that move along and penetrate eukaryotic cells.

Using a computational approach, we successfully characterized the motility gene set, opening new avenues for

functional characterization. We also studied how motility is regulated and found that the motility complexes are

recruited by a bacterial Ras-like G-protein. This protein, MglA, controls the polarity of the cell dynamically.

Thus, bacterial motility is unexpectedly similar to eukaryotic cell motility and may provide attractive new models

to understand this fundamental process. In the long term, our research aims to elucidate how thousands of

bacterial cells coordinate their motility to form a highly structured biofilm. Such systems level analysis may

provide insight into cell migration mechanism responsible for development or cancer metastasis.


• Motor-driven Intracellular Transport Powers Bacterial Gliding Motility. Sun, M., Wartel, M., Cascalès, E., Shaevitz, J. and Mignot, T. PNAS. 2011. In press.

• A bacterial Ras-like small GTP-binding protein and its cognate GAP establish a dynamic spatial polarity axis to control directed motility. Zhang, Y., Franco, M., Ducret, A., and Mignot, T. PLoS Biol. 2010;8(7):e1000430.

• Bacterial motility complexes require the actin-like protein, MreB and the Ras homologue. MglA. Maurellio, E., Mouhamar, F., Nan, B., Ducret, A., Dai, D., Zusman, D. and Mignot, T. Embo J. 2010;29:315-326.

• A microscope automated fluidic system to study bacterial processes in real time. Ducret, A., Maisonneuve, E., Notareschi, P., Grossi, A., Mignot, T. and Dukan, S. PLoS One. 2009;4:e7282.

• Evidence that focal adhesion complexes power bacterial gliding motility. Mignot, T., Shaevitz, J.W., Hartzell, P.L., and Zusman, D.R. Science. 2007b;315:853-856.

117


Tâm Mignot, Ph.D

Cell Biology of Bacteri al Motility

Cell motility mechanism and behaviors leading to multicellular developmentin bacteria

• Objectives:• How do bacterial cells move across surfaces?• How is motility regulated directionally?• How do thousands of cells coordinate their motility to achievemulticellular development, a fundamental process in developmentalbiology?

• Tools:• Genetics and mutant analysis• Live cell motility assays and fluorescence microscopy• Force microscopy and quantitative physics• Surface chemistry• Bioinformatics and phylogenomics

118


Tâm Mignot, Ph.D


119


Tâm Mignot, Ph.D


• Pursue the molecular study of Bacterial motility

• Understand how the motility machinery evolved in bacteria

• Integrate regulation studies in a multicellular context to understand programmed cellular

assembly networks.

Perspectives

Significance

• Perspectives for general bacterial cell biology

• New simple model to study cell motility

• Systems level understanding of multicellular behaviors with applications in the biology of

antibiotic-resistant biofilms and cancer metastasis

120



Keyw ords

• Ulcer • Tuberculosis

• Enzyme inhibitors

• Thymidylate synthase ThyX

Major Grants

• ANR Emergence • Inserm AVENIR • Fondation Bettencourt-

Schueller • European Union

Hannu Myllykallio, Ph.D

Inserm U696 - CNRS UMR7645 - Ecole Polytechnique Palaiseau, South Paris

Laboratoire d'Optique et Biosciences

New antimicrobial compounds

Discovery of anti-microbial compounds targeting a novel enzyme family discovered in the laboratory

Using bioinformatics strategies on complete genome sequences of pathogenic bacteria and diverse

experimental approaches, we have identified a novel family of thymidylate synthases, ThyX, essential enzymes

that are required for the synthesis of the letter T in DNA in a large number of bacterial pathogens. While ThyX

proteins are present in species including Helicobacter pylori and Mycobacterium tuberculosis, they are absent

in humans that use a classical thymidylate synthase ThyA for DNA replication. As ThyX and ThyA proteins are

structurally and mechanistically very distinct, ThyX provides an ideal target for the selective inhibition of

microbial growth.

Our target-based screening approach led to identification of selective ThyX inhibitors that possess potent

antimicrobial activity against Helicobacter and non-pathogenic Mycobacteria species. Our structural and

functional data do allow now rational optimization of the potency and pharmokinetics of ThyX inhibitors towards

biomedical applications (international patent extension). The efficiency of our molecules will also be tested

against clinical strains of Mycobacterium tuberculosis that have been isolated by our collaborators in Uganda

(Epicentre Research Station, Médecins sans Frontières and l'Université de Science et Technologie de

Mbarara) and thus to tackle a major public health concern, the problem of anti-biotic resistance


• Flavin-dependent thymidylate synthase X limits chromosomal DNA replication.Escartin F, Skouloubris S, Liebl U, Myllykallio H. Proc Natl Acad Sci. U S A. 2008;105(29):9948-52.

• Design, synthesis and evaluation of potent thymidylate synthase X inhibitors. Esra Onen F, Boum Y, Jacquement C, Spanedda MV, Jaber N, Scherman D, Myllykallio H, Herscovici J. Bioorg Med Chem Lett. 2008 Jun 15;18(12):3628-31.

• Functional analysis of the Mycobacterium tuberculosis FAD-dependent thymidylate synthase, ThyX, reveals new amino acid residues contributing to an extended ThyX motif. Ulmer JE, Boum Y, Thouvenel CD, Myllykallio H, Sibley CH. J Bacteriol. 2008 Mar;190(6):2056-64.

• Catalytic mechanism and structure of viral flavin-dependent thymidylate synthase ThyX. Graziani S, Bernauer J, Skouloubris S, Graille M, Zhou CZ, Marchand C, Decottignies P, van Tilbeurgh H, Myllykallio H, Liebl U. J Biol Chem. 2006 Aug 18;281(33):24048-57.

• Functional evidence for active site location of tetrameric thymidylate synthase X at the interphase of three monomers. Leduc D, Graziani S, Lipowski G, Marchand C, Le Maréchal P, Liebl U, Myllykallio H. Proc Natl Acad Sci . U S A. 2004 May 11;101(19):7252-7.

• An alternative flavin-dependent mechanism for thymidylate synthesis. Myllykallio H, Lipowski G, Leduc D, Filee J, Forterre P, Liebl U. Science. 2002 Jul 5;297(5578):105-7.

121



New antimicrobial compoun ds

� Objectives:

• Discovery of novel enzymes of DNA metabolism in pathogenic bacteria

• Identification of new anti-microbial compounds

• Optimization of already identified inhibitors of the alternative thymidylate

synthase discovered in the laboratory

� Tools:

• A collection of target enzymes from a variety of pathogenic bacteria

• Validated automated activity tests for ThyX proteins

• Advanced spectroscopic tools and structural information for structure-function

relationships of ThyX proteins

• Specific inhibitors of the alternative thymidylate synthase ThyX

• Animal models of infections for Helicobacter pylori

• Molecular imaging

• Clinical strains of Mycobacterium tubercolusis

Figure 1: DNA synthesis is targeted by many drugs

-Thymidylate (dTMP) is preferentially needed for DNA replication in rapidly dividing cells-Several clinically used drugs specifically target canonical thymidylate synthase ThyA(synthesis of letter T in DNA)-ThyA proteins were assumed to be universally conserved in all free living organismsbut we noticed the absence of these enzymes in many pathogenic bacteria .

122


Figure 2 : Discovery of the second class of thymidylate synthases

The absence of canonical thymidylate forming enzymes in many pathogenic bacterialed to our discovery that Nature has established two structurally and mechanisticallydistinct ways of producing an essential DNA precursor. As ThyX proteins are present in many pathogenic bacteria but absent in humans, selective inhibition of microbial growth by targeting ThyX proteins is highly feasible .

Figure 3 : Activity based screening for ThyX inhibitors

Performing approximately 25 000 individual enzymatic tests led to discovery of potent ThyX inhibitor series with an efficient and selective anti-microbial activityagainst Helicobacter pylori and non-pathogenic Mycobacteria sp.


New antimicrobial compounds

123

Perspectives



• Optimization of ADMET properties of

already identified ThyX inhibitors

• Improving binding affinity of ThyX

inhibitors towards evolutionary

conserved binding site

• Obtaining in vivo proof of concept for

mouse infection models

• We discovered ThyX proteins and their potential as anti-microbial target

• Our mechanistic understanding on ThyX proteins is very advanced in comparison to

the competition

• The binding configuration of lead series at the active site of ThyX proteins is

unexpected

• International patent on anti-microbial activity of the most promising class of ThyX

inhibitors

• Multidisciplinary scientific environment of the Ecole polytechnique research center

(biology, physics, chemistry)


New antimicrobial compou nds

124



Keywords

• Neisseria meningitidis

• Meningitidis

• Blood brain barrier

• Endothelial cells

• beta-adrenergic receptor

Major Grants

• Several grants from french governemental agencies and the European Union

Inserm U1002 - Paris Descartes University - APHP Paris

Pathogenenesis of systemic infections

Our expertise is on the crossing of the blood brain barrier by extra-cellular bacterial pathogens

Xavier Nassif , M.D, Ph.D

Extra-cellular bacterial pathogens are the main cause of infections in developed countries and are often

responsible for nosocomial infections. Paradoxically these bacteria are mostly commensal, and become

invasive only in certain circumstances. Among the great variety of commensal bacteria that colonize a human,

only few strains are able to disseminate. Furthermore some of these bacteria once septicemic can cross the

blood-brain barrier and be responsible for meningitis.

Our goal is, using Neisseria meningitidis, the bacterium causing cerebrospinal meningitis, to identify the

mechanisms by which:

(i) A bacteria can stop being a commensal and disseminate from its normal niche, and

(ii) Once it is septicemic how it can cross the blood brain barrier. N.meningitis is responsible for

septicemia and meningitis. Meningococcal meningitis remain a health threat in both developed

and developing countries, and there is an urgent need for the development of a new vaccine

strategy.

Our team has shown that following pili-mediated adhesion to human brain endothelial cells, N. meningitidis,

initiates signaling cascades, which eventually result in the opening of intercellular junctions, allowing meningeal

colonization. The signaling receptor activated by the pathogen remained unknown. We report that N.

meningitidis specifically stimulates a biased β2-adrenoceptor, β-arrestin signalling pathway in human brain

endothelial cells, which ultimately traps β-arrestin interacting partners, such as cytoskeletal and junctional

proteins under bacterial colonies. These molecules are progressively depleted from endothelial cell junctions

resulting in anatomical gaps likely used by bacteria to penetrate into tissues. Pharmacological activation of β-

adrenoceptors with specific agonists that induce their endocytosis, prevents signaling events downstream of N.

meningitidis adhesion and inhibits bacterial crossing of endothelial cell monolayers. These results reveal a

novel strategy used by a pathogen for hijacking host cell signalling machineries and open new perspectives for

treatment and prevention of meningococcal infection.


• Meningococcus Hijacks a β2-adrenoceptor/β-Arrestin pathway to cross brain microvasculature endothelium. Coureuil M, Lécuyer H, Scott MG, Boularan C, Enslen H, Soyer M, Mikaty G, Bourdoulous S, Nassif X, Marullo S. Cell. 2010 Dec 23;143(7):1149-60.

• Meningococcal type IV pili recruit the polarity complex to cross the brain endothelium. Coureuil M, Mikaty G, Miller F, Lécuyer H, Bernard C, Bourdoulous S, Duménil G, Mège RM, Weksler BB, Romero IA, Couraud PO, Nassif X. Science. 2009;325:83-87.

• Extracellular bacterial pathogen induces host cell surface reorganization to resist shear stress. Mikaty G, Soyer M, Mairey E, Henry N, Dyer D, Forest KT, Morand P, Guadagnini S, Prévost MC, Nassif X, Duménil G. PLoS Pathogens. 2009;5:1000314.

• 3D structure/function analysis of PilX reveals how minor pilins can modulate the virulence properties of type IV pili. Helaine S, Dyer DH, Nassif X, Pelicic V, Forest KT. PNAS. 2007;40:5888-5893.

• Alternative Neisseria spp. type IV pilin glycosylation with a glyceramido acetamido trideoxyhexose residue. Chamot-Rooke J, Rousseau B, Lanternier F, Mikaty G, Mairey E, Malosse C, Bouchoux G, Pelicic V, Camoin L, Nassif X, Duménil G. PNAS. 2007;104:14783-14788.

125


Xavier Nassif, M.D, Ph.D

Crossing of the blood- brain barrier

by a bacterial pathogen

� Objectives:

• To understand how the bacterial pathogen, Neisseria meningitidis, opens the

blood brain barrier

• To engineer new therapeutical approaches allowing the delivery of drugs into the

CNS using a strategy similar to that of N.meningitidis

Crossing of the blood-brain barrier by a bacterial pathogen

Main results (1)

-Neisseria meningitidis opens the blood brain barrier following adhesion and signaling to brain

endothelial cells

-This signaling is responsible for the delocalization of the junctional components (adherens and

tight junctions) at the site of bacterial adhesion onto brain

endothelial cells

-This delocalization is responsible for a depletion of the junctional molecules between brain

endothelial cells

-This depletion of the junctional components opens the paracellular route allowing the crossing

of the blood brain barrier by the bacteria

126


Xavier Nassif, M.D, Ph.D

Crossing of the blood- brain barrier

by a bacterial pathogen

Crossing of the blood-brain barrier by a bacterial pathogen

Main results (2)

-The bacterial component responsible for the signaling to endothelial cells are the pili

-The pili interact with the N-terminal part of the beta2 adrenergic receptor

-The pili-adrenoreceptor interaction leads to the recruitement of the beta arrestin

and to the subsequent signaling and delocalization of the junctional proteins

Perspectives

• Identify the precize ligand on pili interacting with the Beta2-adrenergic

receptor.

• Identify the mechanism of the interaction leading to the recruitement of the

beta-arrestin and dowstream signaling leading to the delocalization of the

junctional components.

• Reproduce with purified pili components this signaling and the opening of the

paracellular route.

127

128



Keywords


• Bacteria

• Antibiotic

• Resistance

• Molecular biology

• Diagnostic

Major Grants

• FP7 grants:

- TROCAR: 2009-2011

Translational Research on Combating Antimicrobial Resistance

- TEMPOTEST: 2010-2013

-An Integrated Tool-Kit for the Clinical Evaluation of Microbial Detection and Antibiotic Susceptibility Point-of-Care Testing Technologies

Emerging Antibiotic Resistance in Bacteria

Discovering novel antibiotic resistance determinants that are emerging worldwide, analyzing their genetic background and development of diagnostic tools for their clinical detection

Patrice Nordmann , M.D, Ph.D

Antibiotic resistance in bacteria is a key topic of interest due to the escalation of resistance mechanisms in

clinical isolates -dissemination of multi-drug resistance in community-acquired and nosocomial pathogens is

now emerging worldwide. Curtailing their spread will require rapid identification as well as recognition of genetic

elements responsible for spreading the resistance genes. Accordingly, we have established a worldwide-

recognized center for antibiotic resistance that has identified (biochemistry and genetics) many novel

mechanism of resistance which are nowadays highly prevalent. Bacterial species consist of the most clinically-

relevant Gram negative rods (Enterobacteriaceae, Pseudomonas aeruginosa, Acinetobacter baumannii) and

their resistance to extended spectrum ß-lactams fluoroquinolones and aminoglycosides.

We are analyzing the genetic plasticity responsible for gene acquisition in Gram-negative bacteria, its role in

gene expression and factors that may influence mobility. This largely involves studies on transposition and

recombination events responsible for the spread of clinically relevant antibiotic resistance genes.

We have contributed to the detail analysis of the entire genome of several multidrug resistant clinical isolates including lately the “superbug NDM-1” which is resistant to almost all antibiotic available by producing many

unrelated resistance determinants. Finally we have participated in close cooperation with the industry to the

development of novel genetic tools for clinical detection of emerging antibiotic resistance.


• Evaluation of a DNA microarray (Check-MDR CT102) for the rapid detection of TEM, SHV, CTX-M extended-spectrum ß-lactamases (ESBLs) and of the KPC, OXA-48, VIM, IMP and NDM carbapenemases . Naas T, Cuzon G, Bogaerts P, Glupczinski Y, Nordmann P. J. Clin. Microbiol. 2011. in press.

• How to detect NDM-1 producers? Nordmann P, Poirel L, Toleman M, Walsh TR. J. Clin. Microbiol. 2011;49: 718-721.

• Characterization of DIM, an integron-encoded metallo ß-lactamase from a Pseudomonas stutzeri clinical isolate in the Netherlands. Poirel L, Rodriguez-Martinez JM, Al Naiemi N, Debets-Ossenkopp YJ. Nordmann P. Antimicrob. Agents Chemother.2010;54:2420-2424.

• Wordwide dissemination of the blaOXA-23 carbapenemase gene of Acinetobacter baumannii. Mugnier PD, Poirel L, Naas T, Nordmann P. Emerg. Infect. Dis. 2010;16:35-40.

• Integration-mobilization unit as a source of mobility of antibiotic resistance genes. Poirel L, Carrer , Pitout JD, Nordmann P. Antimicrob Agents Chemother. 2009;53:2492-2498.

• The real threat of Klebsiella pneumoniae carbapenemase-producing bacteria. Nordmann P, Cuzon G, Naas T. Lancet Infect Dis. 2009;9:228-236.

Inserm U914 - Hôpital Bicêtre - APHP Le Kremlin Bicêtre, South Paris

South Paris Medical School and University

129


Patrice Nordmann, M.D, Ph.D

Emerging Antibiotic Resist ance

� Objectives:

• Discovering any novel resistance determinants emerging worldwide

in clinically-significant bacteria, mostly Gram negatives; Enterobacteriaceae

Pseudomonas aeruginosa and Acinetobacter baumannii (resistance to

ß-lactams, fluoroquinolones, aminoglycosides…..)

• Epidemiology, genetics and biochemistry of antibiotic resistance determinants

• Identification of novel genetic elements as a vector of spread of antibiotic resistance

genes

• Development of novel diagnostic tools

• Evaluation and development of novel antibiotic molecules

A worlwide-located sentinel network on emerging antibiotic resistances

Publications in collaboration; 2006-2011

130




1-

The example of the EMERGING SUPERBUGS NDM-1 (2010))A novel carbapenem-resistance mechanism in Gram negative rods

Identification of a novel multidrugresistance phenotype

2-

4-

Biochemical analys is

Genetic structures a t the origin ofacquisition and expression of NDM-1

Genetic structures; NDM-1 and novel NDM variant with extendedspectrum of activity, NDM-3

3-

ISEC33 blaNDM-1

�ISAba125 ISSen4�

�Ph.ribosyl

anthranilate

isomerase

E. colibleomycin

resistance

protein

Poirel et al. Antimicrob Agents Chemother, 54,4914-16. Poirel et al. Antimicrob Agents Chemother. 55, 447-8. Poirel et al, Antimicrob Agents Chemother, 2011,in press.

5-

6-

7-

Wordwide identification of NDM-1 producers (2010/2011 )

Clonal spread of NDM-1 producers.Identification in A. baumanniiand its genetics

Development of screening techniques and moleculartools for its identification

blaNDM

-1

ISAba125 bleomycin

resistance

protein

A. baumannii

Poirel et al. J Antimicrob Chemother. 2011; 66,304-6. Poirel et al. Antimicrob Agents Chemother.2011; 55, 934-6. Nordmann et al. J Clin Microbiol 49;718-21Pfeiffer et al. Antimicrob Agents Chemother, 2011; 55,1318-9. Poirel et al. Antimicrob Agents Chemother? 2011 in press. (2)Poirel et al. Lancet Infect Dis., 2010; Naas et al. J Clin Microbiol 2011, in press; Poirel et al. Diagn Microbiol Infect Dis. 2011, in press.

131





Identification of a novel target; crystallography analysis of NDM-1 (in collaboration)

9 -

8 -

Evaluation of nov el antibiotics molecules; ß-lactamase inhibitors, terpenoids….

• Pioneer and leader in discovering antibiotic resistance determinants (P.N., ISI Web of

Knowledge Microbiology; 26 th/2530)

• Unique strong expertise in antibiotic resistance mechanisms: genetics, biochemistry,

epidemiology. Extreme reactivity towards any emerging resistance mechanisms.

• Strong collaborations with worldwide located reference labs in antibiotic resistance

• On-line access to any resistance determinants emerging worldwide; a sentinel lab.

• From resistant bacteria in clinics to genetics; development of novel microbiology-

and molecular-based diagnostic tools

• Access to a unique collection of resistant bacteria with defined mechanisms of

resistance; development of novel targets; evaluation of the efficacy of novel antibiotic

molecules

132



Molecular and cellular pathogenesis of Esch erichia coli infections

Eric Oswald DVM, Ph.D

E. coli belongs to the initial microflora colonizing the gut of human beings and most warm-blooded animals.

However, E. coli is also a highly versatile bacterial species with considerable pathogenic potential. E. coli is one

of the most frequent causes of bacterial infections, including, bacteremia, urinary tract infections, diarrhea, and

other clinical infections such as neonatal meningitis, hemorrhagic colitis or hemolytic uremic syndrome (HUS).

About 10 to 20 percent of women have had at least one episode of cystitis due to E. coli in their lifetime, and 80

percent of this group has had it recurrently. E. coli causes 10-50% of nosocomial infections. E. coli is also an

emerging foodborne pathogen which is now recognized as the most common cause of life-threatening acute

kidney failure in childhood. E. coli is also a leading cause for infant acute diarrhea and the primary cause of

travelers' diarrhea.

The research carried on by the team focuses on the knowledge and control of commensal or pathogenic

bacteria from both a direct human health perspective (diarrhea, sepsis, cancer…) and veterinary public health

perspective (zoonoses, food safety). In order to achieve this goal, new scientific and technological knowledge

have been acquired in different aspects of E. coli infections, gut colonization and ecology.

We will illustrate the scientific highlights of the research performed by our team by using one example showing how certain E. coli strains damage human DNA and what are the consequences on host health.


• Pathogenic bacteria target NEDD8-conjugated cullins to hijack host-cell signaling pathways. Jubelin, G., F. Taieb, D. M. Duda, Y. Hsu, A. Samba-Louaka, R. Nobe, M. Penary, C. Watrin, J. P. Nougayrede, B. A. Schulman, C. E. Stebbins, and E. Oswald. PLoS Pathog. 2010. 6:e1001128.

• Escherichia coli induces DNA damage in vivo and triggers genomic instability in mammalian cells. Cuevas-Ramos, G., C. R. Petit, I. Marcq, M. Boury, E. Oswald, and J. P. Nougayrede. Proc Natl Acad Sci U S A. 2010. 107:11537-11542.

• Escherichia coli induces DNA double-strand breaks in eukaryotic cells. Nougayrede, J. P., S. Homburg, F. Taieb, M. Boury, E. Brzuszkiewicz, G. Gottschalk, C. Buchrieser, J. Hacker, U. Dobrindt, and E. Oswald. Science. 2006. 313:848-851.

• Bacterial toxins that modulate host cell-cycle progression. Oswald, E., J. P. Nougayrede, F. Taieb, and M. Sugai. Curr Opin Microbiol. 2005. 8:83-91.

• Identification of the secretion and translocation domain of the enteropathogenic and enterohemorrhagic Escherichia coli effector Cif, using TEM-1 beta-lactamase as a new fluorescence-based reporter. Charpentier, X., and E. Oswald. Journal of Bacteriology. 2004. 186:5486-5495.

• Enteropathogenic and enterohaemorrhagic Escherichia coli deliver a novel effector called Cif, which blocks cell cycle G(2)/M transition. Marches, O., T. N. Ledger, M. Boury, M. Ohara, X. L. Tu, F. Goffaux, J. Mainil, I. Rosenshine, M. Sugai, J. De Rycke, and E. Oswald. Molecular Microbiology. 2003. 50:1553-1567.

• Role of Tir and intimin in the virulence of rabbit enteropathogenic Escherichia coli serotype O103:H2. Marches, O., J. P. Nougayrede, S. Boullier, J. Mainil, G. Charlier, I. Raymond, P. Pohl, M. Boury, J. De Rycke, A. Milon, and E. Oswald. Infection and Immunity. 2000. 68:2171-2182.

• Typing of intimin genes in human and animal enterohemorrhagic and enteropathogenic Escherichia coli: Characterization of a new intimin variant. Oswald, E., H. Schmidt, S. Morabito, H. Karch, O. Marches, and A. Caprioli. Infection and Immunity. 2000. 68:64-71.

• A new cytolethal distending toxin (CDT) from Escherichia coli producing CNF2 blocks HeLa cell division in G2/M phase. Peres, S. Y., O. Marches, F. Daigle, J. P. Nougayrede, F. Herault, C. Tasca, J. DeRycke, and E. Oswald. Molecular Microbiology. 1997. 24:1095-1107.

• Cytotoxic Necrotizing Factor Type-2 Produced by Virulent Escherichia coli Modifies the Small Gtp-Binding Proteins-Rho Involved in Assembly of Actin Stress Fibers. Oswald, E., M. Sugai, A. Labigne, H. C. Wu, C. Fiorentini, P. Boquet, and A. D. Obrien. Proc Natl Acad Sci U S A. 1994. 91:3814-3818.

Inserm U1043 - USC INRA UMR1225 - Toulouse Purpan Medical School and Toulouse CHU

Laboratoire de Bacteriologie-Hygiene - Ecole Nationale Veterinaire de Toulouse Toulouse

133

134



Keywords


• Hepatitis B virus

• Direct acting antiviral drugs

• Hepatocellular carcinoma

Major Grants

• ViRgil Network of Excellence, 6th Framework Programme of the European Commission

• Label “Equipe FRM” from the Fondation pour la Recherche Médicale

• ANRS grants

Pathophysiology and therapy of chronic viral hepatitis

The research of my lab is focused on two aspects of chronic viral hepatitis (principally but not exclusively hepatitis C): 1/ antiviral drug and vaccine development and unravelling of the mechanisms of antiviral treatment success and failure, including viral resistance; 2/ understanding of the mechanisms underlying virus-induced hepatocarcinogenesis

Jean-Michel Pawlotsky, M.D, Ph.D

Hepatitis C virus (HCV) infects 170 million individuals worldwide, whereas 350 million are chronically infected with hepatitis B virus (HBV). Chronic viral infections are the main cause of chronic liver disease in most areas of the world. They account for a large number of cirrhosis, end-stage liver disease and hepatocellular carcinomas, the incidence of which is increasing everywhere in the world due to HBV and HCV infections. More than one million people die every year from either chronic HBV or HCV infection. My research laboratory covers various aspects of chronic hepatitis research, including clinical trials, clinical virology and basic research in a true translational perspective. The lab focuses on two main research topics:

1/ Antiviral drug and vaccine development and unravelling of the mechanisms of antiviral treatment success and failure, including viral resistance. A number of studies have been performed to understand the mechanisms of HCV treatment failure with interferon alpha and ribavirin. In parallel, models have been developed for anti-HCV drug screening and have led to the identification of entirely novel candidate antiviral drugs (two patents have already been deposited), the development of which is ongoing. A genotypic and phenotypic platform has been established to understand the mechanisms of antiviral treatment success and failure at the era of direct acting anti-HCV drugs, in particular the role of viral resistance in treatment failures. In addition, the lab is part of the “Vaccine Research Institute” and involved in the development of a vaccine approach for hepatitis C, the only viable option for areas of the world where HCV is endemic and new therapies far too expensive for reasonable use.

2/ understanding of the mechanisms underlying virus-induced hepatocarcinogenesis: our lab benefits from the development of original mouse models for the study of liver carcinogenesis in the presence of HCV protein expression. These models include mice transgenic for the full viral open reading frame and mice transgenic for sequences of the HCV NS5A protein with high or low transactivation properties. Mouse models are being used, together with cell culture approaches, to understand the direct role played by HCV in triggering primary liver cancers. The approach will be extended to HBV and coinfections by the two viruses.

Inserm U955 - University of Paris-Est-Créteil-Val-de-Marne - Hôpital Henri Mondor Créteil, East Paris

Institut Mondor de Recherche Biomédicale (IMRB)


• High-dose pegylated interferon alfa and ribavirin in non-responder hepatitis C patients and relationship with IL28B genotype. Chevaliez S, Hézode C, Soulier A, Costes B, Bouvier-Alias M, Rouanet S, Foucher J, Bronowicki JP, Tran A, Rosa I, Mathurin P, Alric L, Leroy V, Couzigou P, Mallat A, Charaf-Eddine M, Babany G, Pawlotsky JM. Gastroenterology. 2011; in press.

• Downregulation of Gadd45 beta expression by hepatitis C virus leads to defective cell cycle arrest. Higgs MR, Lerat H, Pawlotsky JM. Cancer Res. 2010;70:4901-4911.

• Characterization of V36C, a novel amino acid substitution conferring hepatitis C virus (HCV) resistance to telaprevir, a potent peptidomimetic inhibitor of HCV protease. Barbotte L, Ahmed-Belkacem A, Chevaliez S, Soulier A, Hézode C, Wajcman H, Bartels DJ, Zhou Y, Ardzinski A, Mani N, Rao G, George S, Kwong A, Pawlotsky JM. Antimicrob Agents Chemother. 2010;54:2681-2683.

• Silibinin and related compounds are direct inhibitors of hepatitis C virus RNA-dependent RNA polymerase. Ahmed-Belkacem A, Ahnou N, Barbotte L, Wychowski C, Brillet R, Pohl RT, Pawlotsky JM. Gastroenterology. 2010;138:1112-1122.

• Hepatitis C virus (HCV) genotype 1 subtype identification in new HCV drug development and future clinical practice. Chevaliez S, Bouvier-Alias M, Brillet R, Pawlotsky JM. Plos One. 2009;4:e8209.

• Hepatitis C virus (HCV) proteins induce lipogenesis and defective triglyceride secretion in transgenic mice. Lerat H, Kammoun HL, Hainault I, Merour E, Higgs MR, Callens C, Lemon SM, Foufelle F, Pawlotsky JM. J Biol Chem. 2009;284:33466-74.

• Complex dynamics of hepatitis B virus resistance to adefovir dipivoxil. Pallier C, Rodriguez C, Brillet R, Nordmann P, Hézode C, Pawlotsky JM. Hepatology. 2009;49:50-59.

• Morphological changes in intracellular lipid droplets induced by different hepatitis C virus genotype core sequences and relationship with steatosis. Piodi A, Chouteau P, Lerat H, Hézode C, Pawlotsky JM. Hepatology .2008;48:16-27.

• The nonstructural 5A (NS5A) protein of hepatitis C virus genotype 1b does not contain an “interferon sensitivity determining region“. Brillet R, Penin F, Hézode C, Chouteau P, Dhumeaux D, Pawlotsky JM. J Infect Dis. 2006;195:432-441.

• Dynamics of hepatitis B virus resistance to lamivudine. Pallier C, Castéra L, Soulier A, Hézode C, Nordmann P, Dhumeaux D, Pawlotsky JM. J Virol. 2006;80:643-653.

135



Pathophysiology and therap y

of chronic viral hepati tis

• Unraveling the mechanisms of HCV treatment success and failure (in particular,

mechanisms of antiviral drug résistance to direct acting antivirals)

• Developing new HCV drugs with novel structures and inhibitory mechanisms

• Understanding the mechanisms underlying virus-induced hepatocarcinogenesis

Major scientific questions and research perspectives

Surface and ribbon views of predicted binding modes of two aurones in RdRp Thumb Pocket I of a reported X-ray structure (PDB id: 2dxs) from docking studies with Autodock. (A) For compound 1, involved in five hydrogen bonds: two with Arginine 503 (1.9 Å and 2.5 Å), one withGlycine 493 (1.8 Å) and two with Leucine 392 (2.0 Å and 2.0 Å). (B) For compound 51, involvedin three hydrogen bonds: two with Arginine 503 (1.8 Å and 2.0 Å) and one with Glycine 493 (2.2 Å). The pictures were built with Pymol software.

136

V36C, a novel amino acid substitution conferingresistance to telaprevir, a potent HCV serine protease inhibitor, in vivo.





FL-N/35

C E1 E2 p7NS2 NS3 4ANS5A NS5B

Albumin promoter SV40 polyA

HCV Genotype 1b isolate N2

1 cm

1 cm

HCC

137

• Translational approach of hepatitis virus related liver disease including clinical, clinical

virology and basic research integrated in the same team.

• Original models and approaches

• International leadership of the team leader

• A strong network of collaboration with chemists, biochemists, structuralists,

pharmacologists, etc

• Member of the Labex “Vaccine Research Institute”

Strengths of the laboratory





wt FL-N/35

RNAProtein

n=4n=4

< Gadd45β

> Lamin A/C

wt

FL-

N/3

5

NS

p = 0.018

NS

NS

Gadd45β Gadd45α Gadd45γ Gadd153

Rel

ativ

e ge

ne e

xpre

ssio

n

0

1

2

3

4wtFL-N/35

Inhibition of Gadd45-beta transcription and expression in FL-N/35 transgenic mice expressingthe full HCV open reading frame

138



Keywords

• HIF

• Hepcidin

• Iron metabolism

• Helicobacter pylori

• Cancer

Major Grants

• ERC starting grant

• ANR “jeune chercheur”

Inserm U1016 - CNRS UMR 8104 - Institut Cochin Paris Paris

Iron metabolism, hypoxia, infection, cancer

Based on conditional knockout models, we aim to determine whether HIF and hepcidin could be missing links between iron metabolism, infection and cancer

Carole Peyssonnaux, Ph.D

HIF transcription factors, central mediators of cellular adaptation to critically low oxygen levels (=hypoxia), have

been largely studied for their crucial role during cancer development. Our recent findings have unveiled two

new major roles of HIF 1) in innate immunity and infection 2) in iron metabolism by regulating the liver

synthesis of the iron regulatory hormone, hepcidin. Based on unique mouse models of conditional HIFs and

hepcidin knockout, our projects aim to:

1. Define the physiological roles of HIFs and hepcidin in different key organs involved in maintaining

body iron homeostasis. A detailed understanding of the regulation of iron-related proteins is a

prerequisite in the development of therapeutics for iron diseases, which pose a major problem

worldwide.

2. Study the role of hepcidin during bacterial infections, where iron is critically required for the

proliferation of the pathogens, and in the anemia of inflammation, which is a common complication in

millions of patients with cancer, rheumatoid arthritis, inflammatory bowel disease and other chronic

diseases.

3. Determine the contribution of HIFs in the initiation of tumor development in response to infection.

Ourfindings that HIF is stabilized by bacteria, even under normal levels of oxygen, and is an essential

component of the inflammatory response, led us to speculate that HIFs may be a missing link

between infection and cancer by triggering a high chronic inflammatory response. For that, we will

use the model of the gastric cancer, whose the initiating event is an infection by Helicobacter Pylori.


• HIF-2alpha, but not HIF-1alpha, promotes iron absorption in mice. Mastrogiannaki M, Matak P, Keith B, Simon MC, Vaulont S, Peyssonnaux C. Journal of Clinical Investigation. 2009;119(5):1159-66.

• Essential Role of Hypoxia Inducible Factor-1a in Development of LPS-Induced Sepsis. Peyssonnaux C, Cejudo-Martin P, Doedens A, Zinkernagel A, Nizet V, Johnson RS. Journal of Immunology. 2007;178(12): 7516-9.

• Regulation of iron homeostasis by the hypoxia inducible transcription factors (HIF). Peyssonnaux C, Zinkernagel A, Schuepbach R, Rankin E, Vaulont S, Haase V, Nizet V, Johnson RS. Journal of Clinical Investigation. 2007;117(7):1926-32.

• A Z-DNA-forming microsatellite directs HIF-1α-dependent heritable variation in SLC11A1 allele expression phenotypes. Bayele H, Peyssonnaux C, Giatromanolaki A, Arrais-Silva W, Mohamed H, Collins H, Giorgio S, Koukourakis M, Nizet V, Blackwell J, Johnson RS & Srai S. Blood. 2007;110(8):3039-48.

• TLR-4 Dependent Hepcidin Expression by Myeloid Cells in Response to Bacterial Pathogens. Peyssonnaux C, Zinkernagel A, Datta V, Lauth X, Johnson RS, Nizet V. Blood. 2006;107:3727-3732.

139



HIF and hepcidin : missi ng links between iron

metabolism, infection and cancer ?

� Objectives:

� Physiological roles of HIF and hepcidin in different key iron related organs

� Role of hepcidin and HIF in innate immunity and tumorigenesis

� HIF : missing link between infection and cancer

� Tools:

� Conditional knock-out mice

� Cancer -based mouse models

� Molecular signaling

� Molecular imaging

� Tissue microarray

HIF lox/lox

Hepcidin lox/lox

myeloid cre

liver creX

other tissues cre

Figure 1: critical roles of HIF (Hypoxia Inducible Factors) and hepcidin in iron homeostasis

Liver hepcidin (regulated by various effectors) is secreted and acts to limit ironabsorption and macrophagic iron release. HIF transcription factors regulate liverhepcidin gene expression and iron absorption in the duodenum.

IRON entryin the organismHEPCIDIN

intestineliverIRON recycling

from macrophages

Red blood cells

macrophages

HIFHIF

INFECTIONINFLAMMATION

HYPOXIA / ANEMIA

140





Figure 2 : Hepcidin in innate immunity

Hepcidin mRNA is expressed by macrophages stimulated with P aeruginosa (PA), S typhimurium(ST), LPS, or Group A Streptococcus (GAS) through a Tlr4-dependant pathway

Hep

cidi

nm

RN

A

WT

Tlr4Lps-d

PseudomonasAeruginosa

-0

10

20

30

40

LPS

P<0.0001

P<0.0001

P<0.0001

P<0.0001

Gram - Gram +

Salmonellatyphimurum

Group AStreptococci

hepcidin

+ Group AStreptococci

+ PBS

Subcutaneous injection

Hepcidin Immunohistochemistryon tissue sections of skin subcutaneously injected with PBS or Group A Streptococci

Figure 3 : HIF-1 in innate immunity

LOCAL INFECTION

HIF-1

NO/TNF-ααααcathelicidins

proteases

HIF-1

myeloid cells

SYSTEMIC INFECTION

HIF-1α

bloodstream

HIF-1

HIF-1

HIF-1

TNF-αααα

IL-6IL-1αααα

IL-1ββββ

LPS- hypoxia GAS MRSA ST PA

WTHIF-/-

Time (hours)

Sur

viva

l per

cent

age

0 50 1000

25

50

75

100

P=0,0001

HIF, stabilized by Group A streptococci (GAS), Methylicin resistant Staphylococcus Aureus(MRSA) or Pseudomonas aeruginosa (PA) increases the bactericidal activity of macrophages and neutrophils by inducing Nitric oxyde (NO), protease and cathelicidin production

Myeloid HIF-1 contributes to the LPS-induced sepsis by triggering the production of pro-inflamatory cytokines.Deletion of myeloid HIF-1 is protective against LPS-induced lethality

GRAM + GRAM -

PATENT (WO/2006/084210)

bact eria

141

Perspectives






HIFs are expressed in iron-related organs (intestine, liver, macrophages …)

• Physiological roles of HIF in these different tissues

Iron is required for bacterial proliferation

Hepcidin is induced in response to inflamation and infection

• Role of hepcidin in innate immunity and anemia of inflamation

HIF is stabilized by bacteria even under normoxia

• HIF = link between infection and initiation of tumoral development ?

Model : gastric cancer induced by Helicobacter pylori

• Pioneer in the discovery of a role of HIF in innate immunity (patent

WO/2006/084210)

• Leader in HIF and iron metabolism landscape

• From molecular tools to clinics : integration and access to molecular constructs,

biochemical tools, cell and animal models, patient biopsies

• Unique conditional knock-out models

• ERC starting grant 2011-2015

142



Keywords

• Oral vaccine

• Universal oral vaccine platform


• Mucosal drug delivery

• Adjuvant

• Flu

Major Grants

• Inserm-Transfert: Maturation envelope, 2010 (Eliane Piaggio)

• Argentinean Ministry of Science and Productive Innovation (Eliane Piaggio/Hugo Lujan)

• Guggenheim Foundation (2011) (Hugo Lujan)

• PICT Bicentenario Category V N° PICT-2010 (Hugo Lujan)

Eliane Piaggio, Ph.D

CNRS UMR7211 - Pierre and Marie Curie University Paris - Inserm U959 - Pitie Salpetriere Hospital Paris

*Project co-developped with Hugo Lujan (Head of the Laboratory of Biochemistry and Molecular Biology, CONICET, Argentina)

Translational research in Immunology and Immunotherapy. VLP-based oral vaccination. Autoimmunity, System Immunology

We have developed an universal platform for oral delivery of vaccines based on fusion proteins or viral like particles (VLP) made of a candidate antigen and the variant-specific surface proteins (VSPs) of the intestinal parasite Giardia lamblia which resist proteolytic digestion, low pH, and changes in temperature, and can induce a strong immune response when given by the oral route without causing immune tolerance

Despite the impact of worldwide vaccination programs, there is still a great necessity to develop efficient and safe innovative vaccination strategies. Oral administration of vaccines is non invasive and suitable for mass vaccination. However, orally administered antigens are easily destroyed or potentially capable of inducing immune tolerance. Here, we combine the technology and knowledge of two international laboratories to validate an oral vaccination platform: (i) The intestinal parasitic protozoan Giardia lamblia expresses variable surface proteins (VSPs) that are resistant to low pH and to intestinal proteases and that are able to induce potent mucosal and systemic immunity against this parasite upon immunization via the oral route; (ii) retrovirus-based VLPs given by injection are efficient immunogens to induce both cellular and humoral responses.

To obtain a proof of principle and to develop a potential vaccine candidate, we used flu hemaggluttinin (HA) as a vaccinal antigen. We produced our vaccines composed of VSP-HA fusion proteins or VLPs covered with VSPs and HA and showed that HA and VSPs proteins maintained their biochemical and immunological properties in both constructs. Then, we immunized mice with three oral doses of the VSP-based HA vaccines and showed that contrary to the oral administration of the HA protein, combination of HA with VSP either as a fusion protein or as a VLP induced systemic HA-specific T and B cell response.

The development of this universal platform for oral delivery of vaccines offers a breakthrough in this field and should have a broad application to different infectious diseases.


• Intranasal DNA Vaccination Induces Potent Mucosal and Systemic Immune Responses and Cross-protective Immunity Against Influenza Viruses. Torrieri-Dramard L, Lambrecht B, Ferreira HL, Van den Berg T, Klatzmann D, Bellier B. Mol Ther. 2011 Mar;19(3):602-11. Epub 2010 Oct 19.

• IL-2 reverses established type 1 diabetes in NOD mice by a local effect on pancreatic regulatory T cells. Grinberg-Bleyer Y, Baeyens A, You S, Elhage R, Fourcade G, Gregoire S, Cagnard N, Carpentier W, Tang Q, Bluestone J, Chatenoud L, Klatzmann D, Salomon BL, Piaggio E. J Exp Med. 2010 Aug 30;207(9):1871-8. Epub 2010 Aug 2.

• Disruption of antigenic variation is crucial for effective parasite vaccine. Rivero FD, Saura A, Prucca CG, Carranza PG, Torri A, Lujan HD. Nat Med. 2010 May;16(5):551-7, 1p following 557.

• New insights regarding the biology of Giardia lamblia. Carranza PG, Lujan HD. Microbes Infect. 2010 Jan;12(1):71-80. Epub 2009 Sep 20. Review.

• DNA vaccines expressing retrovirus-like particles are efficient immunogens to induce neutralizing antibodies. Bellier B, Huret C, Miyalou M, Desjardins D, Frenkiel MP, Despres P, Tangy F, Dalba C, Klatzmann D. Vaccine. 2009 Sep 25;27(42):5772-80. Epub 2009 Aug 3.

• Recombinant retrovirus-like particle forming DNA vaccines in prime-boost immunization and their use for hepatitis C virus vaccine development. Desjardins D, Huret C, Dalba C, Kreppel F, Kochanek S, Cosset FL, Tangy F, Klatzmann D, Bellier B. J Gene Med. 2009 Apr;11(4):313-25.

• Antigenic variation in Giardia lamblia is regulated by RNA interference. Prucca CG, Slavin I, Quiroga R, Elías EV, Rivero FD, Saura A, Carranza PG, Luján HD. Nature. 2008 Dec 11;456(7223):750-4.

• Replication-competent vectors and empty virus-like particles: new retroviral vector designs for cancer gene therapy or vaccines. Dalba C, Bellier B, Kasahara N, Klatzmann D. Mol Ther. 2007 Mar;15(3):457-66. Epub 2007 Jan 23. Review.

• Identification of variant-specific surface proteins in Giardia muris trophozoites. Ropolo AS, Saura A, Carranza PG, Lujan HD. Infect Immun. 2005 Aug;73(8):5208-11.

143



Development of an Oral Vaccine Platform based on

surface proteins of the intestinal parasite Giardia lamblia

� Objective:

• Our major aim was to obtain the proof of principle that variant-surface proteins

of the intestinal parasite Giardia lamblia (VSP) constitute an effective carrier to

shuttle candidate antigens for oral vaccines. To accomplish this goal, we have

initially chosen one candidate antigen, the flu hemagglutinin (HA) antigen.

� Tools:

• Development of specific mAbs against different Giardia VSPs

• VSP/HA fusion proteins

• retroviral particles pseudotyped with VSP and HA at the surface and the SFE

peptide inside the particle

• In vitro validation of the immunogenicity of the different constructions

• Characterization of the immune response anti-HA generated in mice orally

immunized with the different VSP/HA constructs

Uninfected Orally immunized

Trypsin

concentration WB-9B10 GS/M-H7

PC IFA PC IFA

100 µg/ml

200 µg/ml

pH WB-9B10 GS/M-H7

PC IFA PC IFA

1

3

5

8

A

B

Figure 1: Giardia lamblia VSPs: an ideal carrier for oral vaccination.

VSPs are resistant to proteolytic digestion and variable pHs and attach

to the intestinal m ucosa.

A, B) Monoclonal antibodies against two particular VSPs (mAb G10/4,

recognizing VSPH7, and mAb 9B10, recognizing VSP9B10) were used on

clonal trophozoite populations by indirect immune fluorescence (IFA). A)

Parasites were treated for 90 min with concentrations of trypsin similar of

those found in the upper small intestine. B) Parasites were resuspended at

variable pHs (from 1 to 10, only pH 1,3,5 and 10 are shown) for 90 min. In all

cases the epitope remains intact as determined by IFA. The antibodies

agglutinate the trophozoites and label the surface of the parasites. PC: Phase

Contrast.

C) Immuno-histochemistry of intestinal sections of uninfected gerbils (left) or

orally immunized (right) with the entire repertoire of VSPs purified from

transgenic trophozoites. Sections were incubated with mAb anti-VSP9B10,

secondary Ab, developed with DAB (brown label), and counterstained with

H&E. A strong difference on the label of the surface of the gut epithelialcells

between immunized compared to uninfected animal can be observed.

B

C

144





Figure 2: Biochemical and immune characterization of the VSP-HA fusion proteins and the retroviral particles (VLP) pseudotyped with VSP and HA at

the surface.�VSP-HA recombinant protein: Western blot using anti-His mAb . HA was derived from

Influenza A H5N1 (Hong Kong), the transmembrane domain deleted and fused to the VSP.�VLPs made from a Gag and pseudotyped with VSP, HA and NA : For pseudotyping VSP1267 onto the VLPs, the extracellular domain of the VSP was

fused to the transmembrane domain (TM) of the G protein of vesicular stomatitis virus (VSV-G) which is efficiently pseudotyped onto newly formed

pseudoviral particles. To generate recombinant retroviral particles, 293T cells were transfected with the expression vectors (Gag, VSP1267-VSV-G).

Supernatants containing particles were concentrated and purified by ultracentrifugation and by FPLC. ��Gag-

VSP1267+Gag

Production of VLPs: IFA of 293 T cells transfected with the plasmids encoding the VSP1267-VSV-G (revealed with anti-VSP1267 mAb, in red) and plasmid encoding Gag (revealed with anti-Gag mAb, in green).

Western blot of VLPs produced using VSP1267-VSV-G and Gag.

1/2

1/4

1/8

1/16

1/32

1/64

1/128

1/256

1/512

Sample

Dilution

VLP- HA

VLP -GAG-GFP

VLP-VSP-HA-GAG

PBS

1/2

1/4

1/8

1/16

1/32

1/64

1/128

1/256

1/512

Sample

Dilution

VLP- HA

VLP -GAG-GFP

VLP-VSP-HA-GAG

PBS

Hemagluttinatination test: Chicken red blood cells (RBC) were incubated with serial dilutions of different VLPs to evaluate agglutination in presence of a good conformational HA protein. Control(+): VLP-HA; Control(-): VLP-Gag-GFP. The VLP-VSP-HA that we have developed induces RBC agglutination.

Figure 3 : Characterization of the immune response anti-HA generated by oral immunization with different VSP/HA constructs.� � �� !"# Groups:

-PBS (oral)-HA (recombinant protein) (oral)-HA-VSP (recombinant fusion protein) (oral)-HA in Al(OH)3 s.c. (control +).-VLP-HA (oral)-VLP-VSP-HA (oral)-VLP-VSP-HA in Al(OH)3 s.c. (control +)

VLP-HA

VLP-VSP-H

AVLP-V

SP-HA +

Alu

Immunological assays: Balb/c mice were orally

immunized with the different VSP-HA constructions as

shown in A. At day 17 HA-specific T cell response was

measured by an IFN-γ ELISPOT assay (B) and B cell

response was detected by Hemagglutination inhibition

(HI) antibody responses in sera (C). Symbols represent

individual mice of a representative experience and

horizontal lines represent the geometric mean of each

group. *p< 0.05, **p< 0.01.

A

B

VLP-HA

VLP-VSP-H

AVLP-V

SP-HA +

Alu

C

145

Perspectives






• Scientific:

• To optimize and scale up the system.

• To produce VSP fusion proteins and/or particle-based vaccines, namely VSP-MLV

Gag derived VLPs, for immunization against different diseases.

• Commercialization:

• Starting of a new company, licensing of the technology for specific projects,

building an industrial partnership to continue the development of candidate oral

vaccines.

• Of note: the Argentinean Ministry of Science and Technology, the CONICET (INSERM

equivalent in Argentina) and the INSERM together with the French Embassy in Argentina

have started negotiations and allocated funds to create a bi-national laboratory, based on

this collaborative project.

• A successful development of the project will be a major scientific breakthrough as (i) we

will have found an oral immunization modality that can generate efficient mucosal and

systemic immune response, and

• (ii) a major technological breakthrough as we will have designed and validated a versatile

oral vaccine platform applicable to a broad variety of vaccination needs.

• We are proposing the development of a novel tool that will represent a step forward in

the currently scarce technologies permitting oral vaccination and the consequent impact

in quality of life and human health.

• Strong collaboration between an Argentinean laboratory expert in Molecular Biology and

Parasitology and a French Laboratory expert in immunology and VLP-based vaccination.

• Leaders in Giardia lamblia and VSP biology

• Unique expertise in monoclonal antibody production.

146



Keywords

• Antibiotic

• Resistance

• Gene transfer

• Integrons

• New targets

Major Grant

• Avenir team in 2007

Inserm EA3175 - Limoges University Limoges

Antibiotic resistance, genetic vehicles of resistance, especially integrons, Clinical research on early resistance detection

We work on the characterization of the modes of antibiotic resistance acquisition via integrons in order to describe new potential targets

Marie-Cécile Ploy, Ph.D

Bacterial resistance is a major problem in the clinical setting. Horizontal gene transfer has contributed to the

dissemination of antibiotic resistance among bacteria.

Our team studies how bacteria recruit antibiotic resistance genes to react rapidly to antibiotic selective

pressure.

Firstly, we focused on integrons which participate in the dissemination of antibiotic resistance genes. Integrons

are natural cloning and expression systems that can incorporate gene cassettes, and convert them into

functional genes. An integrase is able to incorporate gene cassettes by site-specific recombination. The

integron platform is thus able to stock multiple gene cassettes in a single array structured as a multiresistant

operon. We study the regulation of integrase expression and the recruitment of antibiotic resistance gene

cassettes within an integron in conditions of controlled antibiotic selective pressure.

We demonstrated for the first time that acquisition and expression of antibiotic resistance could be regulated by

the antibiotic itself via SOS response and that there was equilibrium between resistance expression and gene

cassettes rearrangement within integrons.

This showed that bacteria possess a “fitness cost-effective” system in which resistance genes are kept in

reserve and their expression is induced, only when needed, by integrase-mediated recruitment.

Furthermore, on a more long view, our research could lead to develop strategies to inhibit the integrase-

mediated events and then inhibit the recruitment of antibiotic resistance genes.


• Prevalence of SOS-mediated control of integron integrase> expression as an adaptive trait of chromosomal and mobile integrons. Cambray G., Sanchez-Alberola N., Campoy S., Guerin E., Da Re S., Gonzalez-Zorn B., Ploy M.C., Barbé J., Mazel D., Erill I. Mobile DNA. 2011. in press.

• Quantitative multiplex real-time PCR for detecting class 1, 2 and 3 integrons. Barraud O., Baclet M.C., Denis F., Ploy M.C. J. Antimicrob. Chemother. 2010;65:1642-1645.

• Inverse correlation between promoter strength and excision activity in class 1 integrons. JOVE T., Da Re S., Denis F., Mazel D., Ploy M.C. PLoS Genetics. 2010;6:e1000793.

• The SOS response controls integron recombination. Guerin E., Cambray G., Sanchez-Alberola N., Campoy S., Erill I., Da Re S., Gonzales-Zorn B., Barbe I., Ploy M.C., Mazel D. Science. 2009;324:1034.

• The SOS response promotes qnrB quinolone-resistance determinant expression. Da Re S., Garnier F., Guerin E., Denis F., Ploy M.C. EMBO reports. 2009;10:929-933.

• Genetic environment of the quinolone resistance gene qnrB2 in a complex sul1-type integron in the newly described Salmonella serovar Keurmassar. Garnier F., Raked N., Gassama A., Denis F., Ploy M.C. Antimicrob. Agents Chemother. 2006;50:3200-3202.

147



Antibiotic-resistant in tegrons

� Objectives:

� How is regulated the integron-mediated resistance acquisition?

� Role of the SOS response on antibiotic resistance expression

� What is the role of antibiotics in this acquisition ?

� New targets to fight the resistance?

� Tools:

� In vitro (biofilm) and in vivo (mouse) models of antibiotic resistance genes acquisition and

exchange

� Collection of human and animal strains

Integrondetectionin clinicalsetting

Integrondetectionin clinicalsetting

Detection of integrons in humanand animal

Detection of integrons in humanand animal

Emergence of antibiotic resistant bacteriaEmergence of antibiotic resistant bacteria

Role of SOS

response

In vivo studiesIn vivo studies

New therapeuticstrategies

New therapeuticstrategies

Study of cassette recruitment and

expression

Study of cassette recruitment and

expression

148


IntI

LexA

RecA

Pint

-35 -10

SiteLexA

intI

Stress /

SOS bacterialresponsePin

t

-35 -10

SiteLexA

intI

Antibiotics

BamHIaadA2intI1

sul1qacE∆∆∆∆1

orf513 sapA-like qacE∆∆∆∆1sul1 orf513 dfrA19

IRiqnrB2

BamHI ��GTATAAAACACGGACAAAAAAATATGTCATTACCGCAGTACCATTTGGGACTACTCCAATACGCAGTTT��

Dynamics of cassettes exchanges between

bacteria

Acquisition/

re-arrangement of resistance cassettes

Integrase

Antibiotics

In vitro: Biofilm In vivo: murine model

Perspectives


Antibiotic-resistant integrons

149


P

-35-10

LexA

intIattI

LexA site

RecA

IntI1active protein

Oxidative orATB stress

ssDNA-35-10

LexA

intI

SOS system

Inhibition of the ATB stress

Inhibition of intI gene transcription

Inhibition of integrase activity

Effects onIntI1 expression

Effects onIntI1 activity

New targets ?

• Strong expertise in the integrons field

• From bench to bedside: close collaboration with a clinical investigation center in

the Limoges hospital, working with a national sepsis network allowing translational

reserach

• Access to genomic, proteomic, cytometry imagery platforms

• Strong collaborations in the antibiotic resistance field



Antibiotic-resistant integrons

150



Keywords

• Innate immunity

• Microbial sensors

• Human and population genetics

• Toll-like receptors

• Nod-like receptors

• RIG-I-like receptors

Major Grants :

• ANR Young Researcher Grant “Human adaptation to pathogens: a genomic approach”, PI, 2005-2008

• ANR MIE “Evolsensors: Evolutionary genomics of innate immunity microbial sensors: the human NLR, RLR and type-II CLR families” PI, 2009-2012

• FRM Equipes 2008 “Evolutionary Genomics of Innate Immunity Microbial Sensors”, PI 2009-2011

• CNRS - Infectious Diseases and Environment, PI 2010

• Foundation Simone & Cino del Duca Research Grant, PI 2010-2012

Institut Pasteur Paris - CNRS URA3012 Paris

Human genetics

Our laboratory uses population-based and evolutionary genetics approaches to identify genes and immunity-related mechanisms playing a major role in host defense and pathogen resistance

Lluis Quintana-Murci, Ph.D

Our laboratory is interested in the different factors shaping the variability of the human genome. Specifically,

our research activities focus on the study of diversity in genomic regions involved in the immune response,

particularly innate immunity genes, with which we can unmask the footprints of natural selection. Inferences

concerning the action of natural selection in the human genome provide a powerful tool for predicting regions of

the genome associated with disease. Our goals are:

(i) To explore the extent to which infectious agents have exerted selective pressures on human

genes

(ii) To identify the genes that have played a major biological role in host survival and

(iii) To delineate the redundant and non-redundant role of immunity-related genes in the natural

setting. In this context, we have recently studied a family of innate immunity receptors, the Toll-

like receptors (TLRs).

We have shown that the TLRs sensing nucleic acids, which are principally involved in viral recognition, fulfil an

essential function in host defense, in contrast with the cell-surface TLRs that display higher levels of

immunological redundancy. Using the same population genetics approach, we are now extending our studies

to other major families of microbial sensors, such as Nod-Like receptors (NLRs), RIG-I-like receptors (RLRs)

and C-type lectin receptors (CLRs). These studies will provide important insights into immunological defence

mechanisms and host pathways that have been critical in pathogen resistance.


• From evolutionary genetics to human immunology: how selection shapes host defence genes. Barreiro LB, Quintana-Murci L. Nat Rev Genet. 2010;11:17-30.

• Signatures of purifying and local positive selection in human miRNAs. Quach H, Barreiro LB, Laval G, Zidane N, Patin E, Kidd KK, Kidd JR, Bouchier C, Veuille M, Antoniewski C, Quintana-Murci L. Am J Hum Genet. 2009;84:316-327.

• Positively selected G6PD-Mahidol mutation reduces Plasmodium vivax density in Southeast Asians. Louicharoen C, Patin E, Paul R, Nuchprayoon I, Witoonpanich B, Peerapittayamongkol C, Casademont I, Sura T, Laird NM, Singhasivanon P, Quintana-Murci L, Sakuntabhai A. Science. 2009;326:1546-1549.

• Evolutionary dynamics of human Toll-like receptors and their different contributions to host defense. Barreiro LB, Ben-Ali M, Quach H, Laval G, Patin E, Pickrell JK, Bouchier C, Tichit M, Neyrolles O, Gicquel B, Kidd JR, Kidd KK, Alcais A, Ragimbeau J, Pellegrini S, Abel L, Casanova JL, Quintana-Murci L. PLoS Genet . 2009;5:e1000562.

• Natural selection has driven population differentiation in modern humans. Barreiro LB, Laval G, Quach H, Patin E, Quintana-Murci L. Nat Genet. 2008;40:340-345.

• Immunology in natura: clinical, epidemiological and evolutionary genetics of infectious diseases. Quintana-Murci L, Alcais A, Abel L, Casanova JL. Nat Immunol. 2007;8:1165- 1171.

151


Lluis Quintana-Murci, PhD

Human Population Geneti cs of Infection

� Objectives:

� How have pathogens shaped the diversity of the human genome ?

� Which genes or immunological pathways play a major role in host resistance to

infection ?

� How variable is the immune response among individuals and populations, and

how this variation is under genetic control?

� Tools:

� Population Genetic Diversity

� Cohorts of healthy donors from diverse population backgrounds

� Genome-wide genotyping

� Whole genome sequencing

� Cellular genomics approaches

� Bioinformatic and Computational analyses

Figure 1 : Innate immunity - TLRs and their varyingbiological relevance in host defense

Intracellular TLRs, which sense nucleic acids mostly present in virus, are under strong constraints, being essential and non-redundant in host defenses. Variation in these genes in most likely responsible for severe, Mendelian disorders (eg TLR3)

�� Cell-surface TLRs can accumulate missense and non-sense mutations at high frequency in the human population. They are more redundant in host defense (eg TLR5, TR10)

152




Figure 2: Immunity-related genes under strong selection

Meta-analyses of selection in the human genome. These 187 immunity-related genes have conferred different selective advantages in different human populations. They are excellent candidates to be involved in differential susceptibility to, or pathogenesis of, infection diseases.

Figure 3 : Selection, infection and inflammation

Pro

port

ion

of p

ositi

vely

sel

ecte

d S

NP

s

Mutations that have been associated to immunity-related diseases (infectious, inflammatory or auto-immune) have been targeted by natural selection. Interestingly, mutations that have conferred a selective advantage against infection may increase risk today to inflammatory or auto-immune disorders.

153

Perspectives





• Determine the natural variability of immune responses to infection (and vaccines)

in the human population, using cellular genomic approaches

• Correlate genome-wide genetic variation in different populations, using exome

and whole genome resequencing, with immunological phenotypes (e.g.

circulating proteins, gene and miRNA expression)

• Determine how immune response variation is under genetic/epigenetic control

• Pave the way for new strategies in personalized medicine

• Pioneer and leader in the human population genetics of infection

• Unique strong expertise in evolutionary and statistical genetics

• Strong multidisciplinary approach, integrating human genetics, population

genetics, immunology, and epidemiology

• Unique expertise in both molecular biology and bioinformatic analyses, including

development of new statistical methods to analyze genome-wide data

• Strong and long-standing collaborations with international scholars working in

various fields.

154



2009-2010 Honors

• 2010 Grand Prix Inserm (Paris, France)

• 2010.Price Excellence in medicine, Nijmegen, Netherlands

• 2009 Prix Eloi Collery, National Academy of Medicine (France)

• 2009 Khwarizmi International Award (KIA), Téhéran, Iran.

CNRS UMR6236 – IRD – University of the Mediterranean Aix-Marseille II Marseille

Infectious and tropical emergent diseases

Didier Raoult, M.D, Ph.D


• Long-term outcome of Q fever endocarditis: a 26-year personal survey. Million M, Thuny F, Richet H, Raoult D. Lancet Infect Dis. 2010 Aug;10(8):527-35.

• Giant Marseillevirus highlights the role of amoebae as a melting pot in emergence of chimeric microorganisms. Boyer M, Yutin N, Pagnier I, Barrassi L, Fournous G, Espinosa L, Robert C, Azza S, Sun S, Rossmann MG, Suzan-Monti M, La Scola B, Koonin EV, and Raoult D. Proc Natl Acad Sci U S A. 2009;106(51):21848-53.

• Redefining viruses: lessons from Mimivirus. Raoult D, Forterre P. Nat Rev Microbiol. 2008 Apr;6(4):315-9.

• The virophage as a unique parasite of the giant mimivirus. La Scola B, Desnues C, Pagnier I, Robert C, Barrassi L, Fournous G, Merchat M, Suzan-Monti M, Forterre P, Koonin E, Raoult D. Nature. 2008;455(7209):100-4.

• The 1.2-megabase genome sequence of Mimivirus. Raoult D, Audic S, Robert C, Abergel C, Renesto P, Ogata H, La Scola B, Susan M, Claverie JM. Science. 2004; 306(5700):1344-1350.

• Genome-based design of a cell-free culture medium for Tropheryma whipplei. Renesto P, Crapoulet N, Ogata H, La Scola B, Vestris G, Claverie JM, Raoult D. Lancet. 2003;362:447-449.

• Tropheryma whipplei Twist: a human pathogenic Actinobacteria with a reduced genome. Raoult D, Ogata H, Audic S, Robert C, Suhre K, Drancourt M, Claverie JM. Genome Res. 2003;13:1800-9.

• A giant virus in amoebae. La Scola B, Audic S, Robert C, Jungang L, De Lamballerie X, Drancourt M, Birtles R, Claverie JM, Raoult D. Science. 2003;299(5615):2033.

• Rickettsia africae, a tick-borne pathogen in travelers to sub-Saharan Africa. Raoult D, Fournier PE, Jensenius M, Prioe T, de Pina JJ, Caruso G, Jones N, Laferl H, Rosenblatt JE, Marrie TJ. N Engl J Med. 2001;344:1504-10.

• Mechanisms of evolution in Rickettsia conorii and R. prowazekii. Ogata H, Audic S, Renesto-Audiffren P, Fournier PE, Barbe V, Samson D, Roux V, Cossart P, Weissenbach J, Claverie JM, Raoult D. Science. 2001;293:2093-2098.

• Cultivation of the bacillus of Whipple's disease. Raoult D, La Scola B, Fournier PE, Enea M, Lepidi H, Roux V, Piette JC, Vandenesch F, Vital-Durand D, Marrie TJ. New Engl J Med. 2000;342:620-625.

• Molecular identification by suicide PCR of Yersinia pestis as the agent of Medieval Black Death. Raoult D, Aboudharam G, Crubezy E, Larrouy G, Ludes B, Drancourt M. Proc Natl Acad Sci U S A. 2000;97:12800-12803.

155


Didier Raoult, M.D, Ph.D

Infectious and Tropica l Emergent Diseases

Microorganisms isolated and/or characterized in the UMR6236

and the discovery diseases

Translational Research : - 26 patents / 15 licencied- creation of a start-up: INODIAG (2003)

156



CNRS UPR9022 Strasbourg

Insect models of innate Immunity

We study the Innate Immune system using Drosophila as a model

Jean-Marc Reichhart , Ph.D

We have been working since 1985 on the innate immune system using Drosophila as a model. One hallmark of

the drosophila immune response is the rapid inducible synthesis of powerful antibiotic peptides. A genetic

analysis of the regulation of this inducible response has led to the identification of the important role played by

the Toll receptor. This result led to the discovery of the Toll-like Receptors (TLRs) in mammals, opening new

perspectives in the field of Innate Immunity.

The strength of our laboratory resides in the use of genetic screens in a simple and genetically tractable model

to isolate new genes involved in the immune response.

Recently, we have isolated Akirin, a novel conserved gene involved in the innate immune response, which acts

in parallel to the NF-κB transcription factor. Knockout of Akirin in mice shows that it is required downstream of

TLR, TNFα and Il-1β signalling for the production of cytokines such as IL-6. We are currently investigating the

role of Akirin as a selector for the expression of a subset of NF-κB-dependent target genes.

Other aspects of our work concern the antiviral defence, with the aim of identifying novel genes involved in

pathways of antiviral immunity, the analysis of host-pathogen interaction in the digestive tract, and the

development of models to genetically dissect sterile inflammation in drosophila.

Keywords

• Innate Immunity

• Toll Receptor

• TLRs

• Antibacterial peptides

• NF-Κb

• Antiviral

Major Grants

• ERC

• FRM team

• NIH Program Grant

• ANR

• ATIP Avenir


• Genome-wide RNAi screen identifies genes involved in intestinal pathogenic bacterial infection. Cronin SJ, Nehme NT, Limmer S, Liegeois S, Pospisilik JA, Schramek D, Leibbrandt A, Simoes Rde M, Gruber S, Puc U, Ebersberger I, Zoranovic T, Neely GG, von Haeseler A, Ferrandon D, Penninger JM. Science. 2009;Vol 325, 340-3.

• The DExD/H-box helicase Dicer-2 mediates the induction of antiviral activity in drosophila. Deddouche S, Matt N, Budd A, Mueller S, Kemp C, Galiana-Arnoux D, Dostert C, Antoniewski C, Hoffmann JA, Imler JL. Nat Immunol. 2008;Vol 9 :1425-32.

• Akirins are highly conserved nuclear proteins required for NF-kappaB-dependent gene expression in Drosophila and mice. Goto A, Matsushita K, Gesellchen V, El Chamy L, Kuttenkeuler D, Takeuchi O, Hoffmann JA, Akira S, Boutros M, Reichhart JM. Nat Immunol. 2008;Vol 9 :97-104

• Sensing of 'danger signals' and pathogen-associated molecular patterns defines binary signaling pathways 'upstream' of Toll. El Chamy L, Leclerc V, Caldelari I, Reichhart JM. Nat Immunol. 2008;Vol 9 :1165-1170.

• Genetic analysis of resistance to viral infection. Beutler B, Eidenschenk C, Crozat K, Imler JL, Takeuchi O, Hoffmann JA, Akira S. Nat Rev Immunol. 2007;Vol 7 :753-766.

• The Drosophila systemic immune response: sensing and signalling during bacterial and fungal infections. Ferrandon D, Imler JL, Hetru C, Hoffmann JA. Nat Rev Immunol. 2007;Vol 7:862-874.

• ATP-sensitive potassium channels mediate survival during infection in mammals and insects. Croker B, Crozat K, Berger M, Xia Y, Sovath S, Schaffer L, Eleftherianos I, Imler JL, Beutler B. Nat. Genet. 2007;Vol 39:1453-1460.

• Dual Detection of Fungal Infections in Drosophila via Recognition of Glucans and Sensing of Virulence Factors. Gottar M, Gobert V, Matskevich AA, Reichhart JM, Wang C, Butt TM, Belvin M, Hoffmann JA, Ferrandon D. Cell. 2006;Vol 127:1425-37.

157


Jean-Marc Reichhart, PhD

Molecular infectiology i n insect models

� Objectives:

� How is infection sensed by the innate immune system?

� What are the effector molecules controlling infectious microorganisms (bacteria,

fungi, parasites, viruses)?

� How are immune responses and host physiology integrated in complex

environment such as the digestive tract?

� Tools:

� Genome-wide unbiased genetic screens

� Collection of Drosophila mutant lines

� Libraries of mutant microorganisms

� Molecular imaging

� Proteomic analysis of molecular complexes

Figure 1: Sensing molecular patterns and infectious danger

158




Figure 2 : Akirins vs infections

Akirins regulate NF-kB-dependent gene expression in response to infection

In mice, Akirin2 is required for Pro-inflammatory gene expression (IL6, Rantes and BCL3), but not anti-inflammatory genes such as Ikαααα or Ik�

.

Figure 3 : antiviral immunity

wildwild--typetype

JAK/STAT JAK/STAT (hop)(hop)

Surv

ival

(%)

Surv

ival

(%)

100100

8080

4040

2020

Time (days)Time (days)

1 2 3 4 5 6 7 8 9 10 11 1 2 3 4 5 6 7 8 9 10 11 12 13 14 1512 13 14 15

RNAi RNAi (Dicer(Dicer--2)2)

RNA interference and the JAK/STAT signaling pathways contribute to antiviral resistance in flies, but also in vector mosquitoes

159

Perspectives





• Decipher the mode of action of critical infection modulators (e.g. Psh; Akirin; RNAi pathway) .

• Screening for novel genes and pathways regulating host-defense.

• Develop and investigate drosophila models of gut immune homeostasis

• Antiviral defenses against arthopode-borne viruses (I2MC)

• Pioneer and leader in innate immunity and TLR field (FRM, Balzan, Koch, Keio, Gaidner Prizes to JAH)

• International funding (NIH, ERC)

• Unique strong expertise in Drosophila and Insect Immunity

• Strong collaborations with leading immunologists to translate discoveries intomammalian models (S. Akira, B. Beutler, C. Sasakawa)

160



Keywords

• Viral glycoproteins

• Viral ribonucleoprotein complexes

• Membrane fusion

• X-ray crystallography

• Chikungunya virus

• Bronchiiolitis virus


Major Gr ants

• ATIP in 1995, “Chaire Serono” in 2005 • Several ANR grants • Several EU contracts

over the years

Institut Pasteur Paris – CNRS URA3015 Paris

Structural virology

We study the 3-dimensional organization of virus particles at the atomic level, and the int eractions with proteins of the cell that act as virus receptors. These studies provide very important insight to design molecules that specifically interfere with the infection by a virus

Felix Rey, Ph.D

Our expertise is in X-ray crystallography and combination with electron microscopy. Our strategy consists in

making recombinant viral proteins in large amounts for structural studies. We use the robotized crystallization

faciclity at the Pasteur Institute and the European synchrotrons (ESRF in Grenoble, SLS in Switzerland, SOEIL

in the Paris area) to collect diffraction data from our crystals.

With this approach, we have recently discovered the atomic organization of the chikungunya virus particle,

revealing the 3D structure of the epitopes that are targeted by neutralizing antibodies. This study also revealed

the regions of the virus particle that interacts with receptors to infect a cell (Voss et al, Nature, 2010).

We have also recently provided major results on the organization of the RNA of the respiratory syncytial virus

(responsible for bronchiolitis in infants). This is the first visualization of the way the genomic RNA is presented

to the viral transcription machinery, providing important new targets for the development of antivirals (Tawar et

al, Science, 2009).

Another recent important result of our laboratory was the description of the tertiary organization of the hepatitis

C virus major surface glycoprotein, which is the most important determinant for virus entry and for

neutralization by antibodies (Krey et al, PLoS Pathogens, 2010).


• Glycoprotein organization of Chikungunya virus revealed by X-ray crystallography Voss, J.E., Vaney, M.C., Duquerroy, S., Vonrhein, C., Girard-Blanc, C., Crublet, E., Thompson, A., Bricogne, G. & Rey, F.A. Nature. 2010;468:709-712.

• The disulfide bonds in glycoprotein E2 of hepatitis C virus reveal the tertiary organization of the molecule. Krey, T., d'Alayer, J., Kikuti, C.M., Saulnier, A., Damier-Piolle, L., Petitpas, I., Johansson, D.X., Tawar, R.G., Baron, B., Robert, B., England, P., Persson, M.A.A., Martin, A. & Rey, F.A. PLoS Pathog. 2010;6:e1000762.

• Structure of a core fragment of glycoprotein H from pseudorabies virus in complex with antibody. Backovic, M., DuBois, R.M., Cockburn, J.J., Sharff, A.J., Vaney, M.C., Granzow, H., Klupp, B.G., Bricogne, G., Mettenleiter, T.C. & Rey, F.A. Proc Natl Acad Sci U S A. 2010;107:22635-22640.

• Crystal Structure of a Nucleocapsid-Like Nucleoprotein-RNA Complex of Respiratory Syncytial Virus Tawar, R.G., Duquerroy, S., Vonrhein, C., Varela, P.F., Damier-Piolle, L., Castagne, N., Maclellan, K., Bedouelle, H., Bricogne, G., Bhella, D., Eleouet, J.F. & Rey, F.A. Science. 2009;326:1279-83.

• The HIV-1 capsid protein C-terminal domain in complex with a virus assembly inhibitor. Ternois, F., Sticht, J., Duquerroy, S., Krausslich, H.G. & Rey, F.A. Nat Struct Mol Biol. 2005;12:678-82.

• The birnavirus crystal structure reveals structural relationships among icosahedral viruses. Coulibaly, F., Chevalier, C., Gutsche, I., Pous, J., Navaza, J., Bressanelli, S., Delmas, B. & Rey, F.A. Cell. 2005;120:761-72.

• Conformational change and protein-protein interactions of the fusion protein of Semliki Forest virus. Gibbons DL, Vaney MC, Roussel A, Vigouroux A, Reilly B, Lepault J, Kielian M and Rey FA. Nature. 2004;427:320-325.

161


Félix Rey, Ph.D

The molecular organization of viruses

� Objectives:• How are virus particles assembled?

• How does their structure relates to function?

• How do the replicate to form new infectious particles?

� Tools:• Recombinant production of viral proteins and virus-like

particles

• Biochemical characterization and crystallization

• X-ray crystallography, synchrotron radiation

• 3D structure determination, model building on computer graphics

• Molecular imaging, comparison with database, structure based mutagenesis, molecular dynamics

Figure 1: Conformational change to induce membrane fusion

pH<6.2FUSION OF VIRAL AND ENDOSOMAL MEMBRANE

FUSION OF VIRAL AND ENDOSOMAL MEMBRANE

Fusion

��

��

��

��

��

��

��

��

��

��

��

��

��

��

��

��

��

��

��

��

��

��

162


Figure 2 : Fusion protein trimers associate on membranes

Figure 3 : Mechanism of membrane fusion

Félix Rey, Ph.D

The molecular organization of viruses

163

Perspectives



• Identify small molecules interfering with conformational change

• Characterize fusionprotein from other pathogenic viruses

• Use the information provided by viruses to understand fusion between

cells (during organogenesis, for instance).

� Discovery of the « class II » viral fusion proteins

• Unique strong expertise in crystallization of viral glycoproteins

• Understanding the mechanism by which viruses infect cells can provide a handle

to combat pathogenic viruses

• Extension to cellular fusogenic molecules, the misfunction of which are

associated with disease

• The production of recombinant viral antigens for crystallization also provides a

way to obtain neutralizing antibodies by using them for immunization, as well as

for developping diagnostic tools.

Félix Rey, Ph.D

The molecular organizatio n of viruses

164



Prion and infectious pathology linked to p rotein misfolding

Keywords

• Prion

• Infectious amyloidosis

• Rational drug design

• Structural targeting

• Protein misfolding

• Prion infectivity bioassays

• Chemiotech screening

Major Grants

• ANR

• Royal Society

• Alliance Bio Secure foundation

• INRA - Avenir- Team

• European Network of Excellence (Neuroprion)

• European Grants

As the Prion and other infectious amyloids belong to the unconventional infectious agents, we develop a multidisciplinary approach which address the molecular basis of this type of pathology for finally allow to set up a rational drug design strategy

Human Rezaei, Ph.D

Prion diseases are deadly infectious neurodegenerative diseases affecting human and other mammalian

species. The etiology of prion disease differs from the conventional infectious diseases and leads to introduce

the general concept of infectious amyloidosis. Our main field of investigation addresses the molecular

mechanism of structural information transference during mammalian prion replication. Our investigations cover

a broad panel of expertises: from physical-chemistry and drug design to the molecular characterisation of the

Prion propagation on transgenic mice. We also intensively contribute to the development of new methodology

and tools in the field of infectious proteins.

The most percussive results obtained by our group address major topics in Prion field. We identified the

minimal structural perturbation that ignites the replication process and established a relation between infectivity

and size of PrPSC assemblies. The accumulation of fundamental knowledge leads us to design ligand that

inhibits the prion replication ex-vivo. The modelling of the prion passage from animals to human was one of the

important topics that we also addressed using “humanised” transgenic mouse models. Beside these results,

our group intensively built gateways between prion disease and other amyloidosis as Alzheimer and type 1

Parkinson. As our group has a multidisciplinary approach our perspective is to gain from fundamental research

to go further in the etiology of infectious amyloidosis and rational drug design.

INRA

Unité Virologie et Immunologie Moléculaires Jouy-En-Josas, Southwest Paris


• Prion fibrillization is mediated by a native H2H3 structural element. Adrover, M., Pauwels, K., Prigent, S., Chiara, C., Xu, Z., Chapuis, C., Pastore, A., and Rezaei, H. J Biol Chem. 2010. Accepted.

• The oligomerization properties of prion protein are restricted to the H2H3 domain. Chakroun, N., Prigent, S., Dreiss, C., Noinville, S., Chapuis, C., Fraternali, F., and Rezaei, H. FASEB Journal. 2010. Accepted

• Vesicle permeabilization by purified soluble oligomers of prion protein: a comparative study of the interaction of oligomers and monomers with lipid membranes. Chich, J.F., C. Chapuis, C. Henry, J. Vidic, H. Rezaei, and S. Noinville. J Mol Biol. 2010;397(4):p. 1017-30.

• Neuroglobin and prion cellular localization: investigation of a potential interaction. Lechauve, C., H. Rezaei, C. Celier, L. Kiger, M. Corral-Debrinski, S. Noinville, C. Chauvierre, D. Hamdane, C. Pato, and M.C. Marden, J Mol Biol. 2009;388(5):p. 968-77.

• In vitro and in vivo neurotoxicity of prion protein oligomers. Simoneau, S., H. Rezaei, N. Sales, G. Kaiser-Schulz, M. Lefebvre-Roque, C. Vidal, J. G. Fournier, J. Comte, F. Wopfner, J. Grosclaude, H. Schatzl and C. I. Lasmezas. PLoS Pathog. 2007;3(8): e125.

• Diversity in prion protein oligomerization pathways results from domain expansion as revealed by hydrogen/deuterium exchange and disulfide linkage. Eghiaian, F., T. Daubenfeld, Y. Quenet, M. van Audenhaege, A. P. Bouin, G. van der Rest, J. Grosclaude and H. Rezaei. Proc Natl Acad Sci U S A. 2007; 104(18): 7414-9.

165


Human Rezaei, Ph.D

Prion Pathology and rel ated Amyloidosis

Transmissible Spongiform Encephalopathy

� Objectives:

� What is the molecular basis of prion conversion and propagation?

� How prion transmit structural information during the conversion ?

� What is the relation between prion structural diversities and prion strain

phenomenon?

� Are other amyloidosis are infectious?

� Tools:

� transgenic Mouse and cell models reproducing the in vivo Prion replication

� In vitro replication system for biophysical investigations

� PrP mutants presenting specific conversion behaviours

� New methodology and tools for fundamental research in prion-like diseases

Figure 1: Relation between PrP assemblies and prion strain phenomenom

�� Conformer 1

Conformer 2

Conformer 2Conformer 1

166


Human Rezaei, Ph.D


Figure 2: The diversity of PrP conversion pathway: the molecular basis of prion strain phenomenon

8 10 12 14 16 18 20 22 24 26 28

0,0

0,1

0,2

0,3

0,4

0,5

0,6

norm

aliz

ed U

nits

Volume (ml)

N

U1

U2

U3

P1

P2

P3

Fibrils

P1P1P1N P3

��

1 2

3

P1,P2P3

N

Figure 3 : identification of PrP domain involved in prion replication leads to a rational drug design

��

1

2

3

167

Perspectives



Human Rezaei, Ph.D


• The molecular mechanisms of Prion information transference

• Cellular cofactor involved in Prion replication

• The role of PrP assemblies in neuronal death

• Prion-like propagation of other amyloidosis

The arrow indicates the localisation of PrPsc

patch (in green) on astocytes cells

• Leader in Europe in mammalian prion conformational dynamic

• Unique expertise in prion oligomers characterization and folding

• From molecular investigation to animals : multidisciplinary approaches encompassing

physical-chimistry to prion physiopathology investigations

• Uniqueness of biophysical tools leading to explore Prion-like propagation of other

amyloidosis

• Strong collaborations allow quick and versatile transgenic mouse production

(humanized or not)

168



Keywords

• RNA interference (RNAi)

• Host-pathogen interactions

• Antiviral mechanisms

• Arboviruses

• Infectious emergent diseases

Major Grants :

• ERC Starting Grant

• ANR JCJC

• Institut Pasteur – 5 years group

• Institut Carnot Pasteur maladies infectieuses

CNRS URA3015 - Institut Pasteur Paris Paris

RNAi-mediated antiviral immunity in insects

Host-pathogen interaction during arboviral infection: the insect’s point of view

Carla Saleh, Ph.D

Upon infection by viruses, insects mount a unique immune response whose hallmark is RNA interference

(RNAi). The antiviral RNAi response of invertebrates is adaptive, potent and rapid and is able to seek out and

destroy viral RNA.

My laboratory studies the mechanisms that mediate the RNAi-based antiviral response in insects. By

combining biochemical, cellular, molecular and genomic approaches, both in vivo and in cell culture, we

analyze the mechanisms underlying viral tropism, systemic propagation of the antiviral signal and the basis of

the persistence of the antiviral state in the model organism Drosophila melanogaster.

Furthermore, we examine whether RNAi antiviral immunity is conserved in mosquitoes and its relationship with

the capacity of this vector insect to transmit a virus. This comprehensive approach aim to tackle how this

nucleic acid-based immunity works in insects to generate an anti-viral stage. A better understanding of the role

of RNA interference in insects during virus infection will allow the exploitation of this pathway for improvement

of public health related problems such as arbovirus emergent infectious disease.


• Of Insects and Viruses: The Role of Small RNAs in Insect Defence. Vodovar N and Saleh MC. Advances in Insect Physiology. 2011. In press.

• RNAi-mediated immunity provides strong protection against the negative-strand RNA vesicular stomatitis virus in Drosophila. Mueller S, Gausson V, Vodovar N, Deddouche S, Troxler L, Perot J, Pfeffer S, Hoffmann JA, Saleh MC, Imler JL. Proc Natl Acad Sci. U S A. 2010;107(45):19390-5

• Antiviral immunity in Drosophila requires systemic RNA interference spread. Saleh MC, Tassetto M, van Rij RP, Goic B, Gausson V, Berry B, Jacquier C, Antoniewski C, Andino R. Nature. 2009 Mar 19; 458(7236):346-50. Epub 2009 Feb 8.

• The RNA silencing endonuclease Argonaute 2 mediates specific antiviral immunity in Drosophila melanogaster. Van Rij RP, Saleh MC, Berry B, Foo C, Houk A, Antoniewski C, Andino R. Genes Dev. 2006; 20:2985-2995.

• The endocytic pathway mediates cell entry of dsRNA to induce RNAi silencing. Saleh MC, van Rij RP, Hekele A, Gillis A, Foley E, O'farrell PH, Andino R. Nat Cell Biol. 2006; Aug;8(8):793-802. Epub 2006 Jul 23.

• RNA silencing in viral infections: insights from poliovirus. Saleh MC, Van Rij RP, Andino R. Virus Res. 2004 Jun; 102(1):11-7.

169


Carla Saleh, Ph.D


� Objectives:

• Does RNAi function against all viruses?

• How does RNAi modulate virus – host interactions?

• Is antiviral RNAi conserved among insects?

Molecular tracking of viruses and dsRNA

� Tools:

• Drosophila

• Panel of RNAi mutants

• dsRNA inoculation in vivo

• Deep sequencing in vivo

• Molecular biology and biochemistry

• Access to wild mosquitoes populations

Figure 1 : Systemic RNAi is required for antiviral defense

170


Carla Saleh, Ph.D


Figure 2: Inoculation of dsRNA protects flies from infection

Protection is sequence-specific and dependent on the RNAi machinery.

Figure 3 : vsiRNA profiling in different hosts

• Virus-derived siRNAs match along the entire viral genome

• RNAi cleaves the entire genomeof RNA viruses regardless of theirpolarity

171

Perspectives



Carla Saleh, Ph.D


First study addressing host-pathogen interaction in vivo under RNAi pressure:

• Novel components and effectors of RNAi will be discovered

… key pan-eukaryotic regulator of gene expression

• Insect immune system will be unravelled

… could be relevant in mammals

• Control of viral replication in the vector may be achieved

…with major implication for human health and economics

• Leader in the RNAi field

• Strong expertise in RNAi-mediated viral immunity in insects

• Next generation tools: deep sequencing, profiling,RNA seq ...

• Discovery of revolutionary strategies to fight against viruses transmitted by insects

172



Molecular, cellular and immunological study of i nfectious diseases and role of the symbiotic microbiota on gut homeostasis

Keywords

• Gut epithelium

• Respiratory tract

• Pathogenesis

• Cellular microbiology

• Immunology

• Homeostasis

• Vaccination

• Therapeutics

• Microbiota

• Shigella

• Klebsiella

Major Grants :

• Advanced ERC grant “Homeoepith” coordinated by Philippe Sansonetti

• EU grant “Stopenterics” dedicated to the development of novel anti-Shigella and ETEC vaccines

• Participation to and work package direction of a EU network, “Tornado”, aimed at understanding the exact impact of the gut microbiota on human health.

• Several ANR grants : microbial anti-inflammatory strategies, epigenetic regulation of inflammatory genes regulation by Shigella effectors, microbiota/intestinal permeability/metabolic syndrome, one on the differential impact of commensal microorganisms on the mucosal immune system, and one on novel “smart probes” for imaging infected tissues.

• Several contracts with industrials including: Sanofi-Pasteur, Institut Mérieux, Danone Research

Our research is aimed at deciphering the molecular mechanisms by which bacterial pathogens disrupt, invade and cause inflammatory destruction of the gut barrier, and how the resident microbiota achieves an homeostatic balance with this same barrier. On these bases, we rationally develop novel vaccine and therapeutic strategies

Philippe Sansonetti, M.D

Our laboratory works on deciphering the pathogenic and homeostatic mechanisms of interaction between bacteria and mucosal surfaces, particularly the intestinal and the respiratory epithelium.

Pathogenesis: with Shigella, we study how a bacterial pathogen achieves rupture, invasion, and inflammatory destruction of the intestinal epithelium. We also decipher how this pathogen subverts innate immune mechanisms and orients the adaptive immune response to its benefit. This multidisciplinary approach has been a source of important discoveries, such as the basic interaction of a pathogen with epithelial cells, and the mechanisms of intracellular sensing of bacteria. Our current work strongly focuses on three research lines: (i) how bacteria adapt to host defence systems at epithelial surface, (ii) what is the enzymatic activity and actual function of Shigella “anti-immunity” effectors, (iii) how Shigella subverts the adaptive immune response. These approaches are increasingly moving from infected cells to infected tissues with strong investment in intravital 2-photon imaging of bacteria-cell and cell-cell interactions in epithelial and lymphoid structures.

With Klebsiella, by comparing the differential processes of infection of the respiratory tract by K. pneumoniae and K. rhinoscleromatis, we wish to fully decipher the molecular, cellular and immunological mechanisms that support a key decision making process that decides upon acute destructive infection of the lung with the former pathogen, and quick switch to granuloma formation and chronic infection with the latter pathogen. We also take advantage of these infectious models to develop novel methods for imaging the infected lung and detect the causative pathogen.

Homeostasis : This is a new ambitious program that aims at three essential goals: (i) to identify a “crypt-specific core microbiota” in the mammalian gut that is expected to defend this sanctuary that is essential for gut epithelial proliferation and restitution, and maintain its homeostasis; (ii) to decipher these homeostatic mechanisms, particularly how bacterial motives (i.e. PAMP), regulate epithelial cell differentiation and proliferation from the crypt (I.e.: stem cells) to the proliferative compartment; (iii) to identify how certain bacterial species (i.e. pathobionts) may disrupt these subtle homeostatic mechanisms and cause colonic cancer.

Vaccine development: Following the development of Shigella live attenuated vaccine candidates, some of which went successfully through phase 1 and 2 clinical trials, we are now developing a new generation of vaccines based on conjugated synthetic polysaccharides, and on proteins that are key in pathogenesis, in order to achieve cross protection against all serotypes.

Therapeutic developments: We are currently deciphering the mechanisms of regulation of epithelial antimicrobial peptide expression and develop reporter systems in order to screen for molecules of libraries that strongly induce expression of these peptides without inducing strong deleterious inflammation. The aim is to solve issues such as bacterial intestinal translocation in immunosuppressed patients, and to help the host cope with his microbiota in inflammatory bowel diseases.

Institut Pasteur Paris - Inserm U786 Paris

Selected Publications

• Modulation of Shigella virulence in response to available oxygen in vivo. Marteyn B, West NP, Browning DF, Cole JA, Shaw JG, Palm F, Mounier J, Prévost MC, Sansonetti P, Tang CM. Nature. 2010. May 20;465(7296):355-8.

• Galectin-3, a marker for vacuole lysis by invasive pathogens. Paz I, Sachse M, Dupont N, Mounier J, Cederfur C, Enninga J, Leffler H, Poirier F, Prevost MC, Lafont F, Sansonetti P. Cell Microbiol. 2010 Apr 1;12(4):530-44.

• Shigella phagocytic vacuolar membrane remnants participate in the cellular response to pathogen invasion and are regulated by autophagy. Dupont N, Lacas-Gervais S, Bertout J, Paz I, Freche B, Van Nhieu GT, van der Goot FG, Sansonetti PJ, Lafont F. Cell Host Microbe. 2009 Aug 20;6(2):137-49.

• A synthetic carbohydrate-protein conjugate vaccine candidate against Shigella flexneri 2a infection. Phalipon A, Tanguy M, Grandjean C, Guerreiro C, Bélot F, Cohen D, Sansonetti PJ, Mulard LA. J Immunol. 2009 Feb 15;182(4):2241-7.

• Safety and immunogenicity of SC599, an oral live attenuated Shigella dysenteriae type-1 vaccine in healthy volunteers: results of a Phase 2, randomized, double-blind placebo-controlled trial. Launay O, Sadorge C, Jolly N, Poirier B, Béchet S, van der Vliet D, Seffer V, Fenner N, Dowling K, Giemza R, Johnson J, Ndiaye A, Vray M, Sansonetti P, Morand P, Poyart C, Lewis D, Gougeon ML. Vaccine. 2009 Feb 18;27(8):1184-91.

• The IpaC carboxyterminal effector domain mediates Src-dependent actin polymerization during Shigella invasion of epithelial cells. Mounier J, Popoff MR, Enninga J, Frame MC, Sansonetti PJ, Van Nhieu GT. PLoS Pathog. 2009 Jan;5(1):e1000271. Epub 2009 Jan 23.

• Virulent Shigella flexneri subverts the host innate immune response through manipulation of antimicrobial peptide gene expression. Sperandio B, Regnault B, Guo J, Zhang Z, Stanley SL Jr, Sansonetti PJ, Pédron T. J Exp Med. 2008 May 12;205(5):1121-32.

• Cytoplasmic targeting of IpaC to the bacterial pole directs polar type III secretion in Shigella. Jaumouillé V, Francetic O, Sansonetti PJ, Tran Van Nhieu G. EMBO J. 2008 Jan 23;27(2):447-57. Epub 2008 Jan 10.

• Type III secretion effectors of the IpaH family are E3 ubiquitin ligases. Rohde JR, Breitkreutz A, Chenal A, Sansonetti PJ, Parsot C. Cell Host Microbe. 2007 Mar 15;1(1):77-83.

• An injected bacterial effector targets chromatin access for transcription factor NF-kappaB to alter transcription of host genes involved in immune responses. Arbibe L, Kim DW, Batsche E, Pedron T, Mateescu B, Muchardt C, Parsot C, Sansonetti PJ. Nat Immunol. 2007 Jan;8(1):47-56. Epub 2006 Dec 10.

173


Philippe J. Sansonetti, M.DWhat symbiotic (microbiota) and pathogenic bacteria

« teach » us upon manip ulating

host innate and adaptive immune responses

Unité de Pathogénie Microbienne Moléculaire, Institut Pasteur, INSERM U786, Collège de France, HHMI. Major lines of research and

their funding

Claude Parsot et al.: Expression and function of Shigella flexneri type III secretion effectors

Laurence Arbibe et al.: Innate immune subversion by chromatin modification: deciphering Shigella

flexneri strategies of host manipulation (ANR)

Armelle Phalipon et al.: Games played by Shigella with DC, B and T cells (ANR)

Régis Tournebize et al.: Understanding Klebsiella pneumonia infections (ANR & EU-FP7 EraNetPathogenomics)

Philippe Sansonetti et al.: From homeostasis to disease: how commensals and pathogens adapt to the gut environment and differentially affect the crypt-villous axis and innate epithelial defences(ERC, EU-FP7, ANR)

Philippe Sansonetti et al. : Novel strategies to develop Sjhigella vaccines,synthetic polysaccharide conjugates and virulence protein-based vaccines(EU-FP7 & Sanofi-Pasteur)

MicrobesCommensals

Innate immunitySurveillance/Tolerance- Rupture of homeostasis = IBD- Dysbiosis = obesity, diabetes,metabolic syndrome

Recognition network:TLRs,NLRs,

Rig1, MDA5…Danger signals:

(uric acid, ATP, cytochrome C,etc..)

PathogensPossibly smallinfectious dose

Innate immunityInflammation

Microbe & tissue destruction

Amplification loop:TREM, HMGB1, Gal3, etc..

Severe sepsisSeptic shock

Regulation

Loss of control

Adaptive immunityPathogens recognition,capture, completion of

eradication process, protection: scavenging receptors,

C-type lectins, etc..

Sansonetti, 2004, Nature Rev. Immunol.Sansonetti, 2006, Nat. Immunol.Sansonetti & Di Santo, 2007, ImmunityPédron & Sansonetti, 2008, Cell Host and MicrobeSansonetti & Medzhitov, 2009, CellSansonetti, 2010, Mucosal ImmunologyKufer & Sansonetti, 2011, Nature Immunology

Human colon: 1011 CFU / g feces

Up to 30,000 species...

Fighting ignorance, learning tolerance, responding to threats, the paradox that

forged the immune system.

174

Colon

Follicle-associatedepithelium

Small intestine

Mucus

Pro

lifer

ativ

eco

mpa

rtm

ent(

PC

)D

iffer

entia

ting

com

part

men

t(D

C)

Desquamatingcells

Cell cyclearrest

Stem cells (SC) compartment Stem cells compartment

Cell cyclearrest

PC

DC

Paneth cellCrypt-Based Columnar (Lgr5+) SC

+4 Radiation-resistant SCCrypt-Based Columnar (Lgr5+) SCPaneth cells ?

M cellsDendritic cellsMacrophages

T lymphocytes

B Lymphocytes

IEC

Paneth

cell

Goblet c

ell

Enteroc

hromaf

fince

ll

The 4 gut epithelial lineagesPro

lifer

ativ

epr

ogen

itors

Abs

orbt

ive

secr

etor

yce

lls

Lieberkühn’scrypt

How microbes (symbionts/pathogens) affect the homeostasis of the gut crypt-villous axis

War (pathogenicity) and Peace (mutualism) at mucosal surfaces

Manipulation of host responses A transition from pioneering work on cellular microbiology of gut epithelium invasion by the model organism Shigella to new microbial interfaces with gut development/restitution and immunity.

Molecular cross-talks between microbial symbionts/pathogens and the gut epithelial surface- Emission of danger signals (bacterial effectors, mediators, signals, patho-phenotypes)- Regulation of inflammation - Expression of antimicrobial factors (antimicrobial peptides)- Repair mechanisms (microbiota - homeostasis of the crypt-villus axis)

« In depth » manipulation of host responses:Molecular cross-talks between symbionts/pathogens and the immune system- Fonctions/survival of immune/phagocytic cells and antigen presentation(APC:apoptosis, pyroptosis,…)- Lymphocyte functions (orientation: Th1 - Th17 - Th2/Treg)- Lymphocytes trafficking and interaction with APCs(polarized motility, immunological synapse)





175

Ongoing medical translation:

1 – Chronic tropical enteropathies secondary to recurrent enteric infections in the pediatric population of the most impoverished areas of the planet causing stunting, psycho-motor retardation, and resistance to orally-administered vaccines

2 - Acute necrotizing enteropathies in premature newborns ?

3 – Prevention of deadly bacterial translocation across the intestinal barrier in patients undergoing complex myelo/immunosuppressive chemotherapies for cancer, leukemia, bone marrow transplantation, etc...

4 – Prevention / treatment of diseases now recognized partly or totally linked to « mishandling » of the microbiota by the host, particularly the gut microbiota (i.e.: inflammatory bowel diseases, insulin resistannce, obesity, type II diabetes, etc...)

5 – Development of novel approaches for the vaccination against enteric infections (shigellosis / bacillary dysentery as a model).

��

Applied research

Shigella vaccine development:First-generation va ccines : live attenuated microorganisms (rational design of mutations/deletions based upon pathogenesis studies, phase 1 / phase 2 trials completed in USA and Europe)

New-generation vaccines : 1 – Synthetic polysaccharides (serotypic O-antigen) conjugated to protein carriers.Armelle Phalipon & Laurence Mulard (Institut Pasteur). Phase 1 in preparation,Funded by FP7-STOPENTERICS, Phiilippe Sansonetti, coordinator2- Virulence-associated proteins, cross-serotype protective immunity (neutralizing Ab).Basic research and R & D stage. Funded by FP7-STOPENTERICS and Sanofi-Pasteur,Geneviève Renauld (SP) & Philippe Sansonetti (IP)

Molecules that activate expression of innate anti-infectious molecules at mucosalsurface. Analysis of genetic/epigenetic mechanisms of regulation of expression of epithelialantimicrobial molecules, high-throughput screening for inducers. Collaboration Institut Pasteur Korea. Funded by AVIESAN-Sanofi-Aventis (in preparation) and Institut Mérieux. Philippe Sansonetti, coordinator.

Novel targets for development of anti-inflammatory drugs based upon Shigella strategiesto dampen innate and adaptive immune responses. Funded by ANR, « Programme Thématique Inflammation », Philippe Sansonetti coordinator.





176



Keywords

• HIV

• AIDS

• Nef

• Virological synapse

• Antiviral drugs

• Vaccine candidates

Major Grants :

• FP7 european contract • Two ANR grants • Two ANRS grants • Sidaction grant • Institut Pasteur grant


Analysis of HIV multiplication and interaction with the immune system

Our aim is to understand how HIV spreads from one cell to another, and how the immune system attempts to block the virus

Olivier Schwartz, Ph.D

Thirty years after being discovered, AIDS and HIV remain a major health issue worldwide. Our work focuses on

cellular and molecular aspects of HIV-1 replication, and on the mechanisms of recognition of HIV-infected cells

by the immune system.

Three close and complementary axes of research characterize our scientific activities:

• The first axis is aimed at understanding the impact of HIV-1 infection on the biology of the cells.

• The second axis consists of the study of viral spread, with a focus on cell-to-cell viral transfer and on the

mechanisms of virological synapse formation. Virological synapses correspond to the contact zone between

one infected cell and one target cell, where viral materials accumulate on one side and cellular receptors on

the other side, thus facilitating viral spread.

• The aim of the third axis is a better understanding of the interplay between viruses and the immune system

of the host.

For these 3 axes, we are combining basic and applied scientific questions. From a basic standpoint, we

unveiled important cellular and viral components regulating HIV replication and interaction with the immune

system. From an applied standpoint, our aim is to identify, through cell screening assays, novel antiviral

compounds, targeting unexplored steps of the viral life cycle: cell-to-cell viral transfer, and the HIV protein Nef,

a regulatory protein protecting infected cells against the immune system. We also belong to the ANRS HIV

Vaccine Network, and we are evaluating the effect of HIV candidate vaccines in our cell culture systems.


• Innate sensing of HIV-infected cells. Lepelley A, Louis A, Sourisseau M, Pothlichet J, Schilte C, Chaperot L, Plumas J, Randall RE, Si-Tahar M, Mammano F, Albert ML & Schwartz O. Plos Pathogens. 2011;7: e100128.

• Tetherin restricts productive HIV Cell-To-Cell Transmission. Casartelli N, Sourisseau M, Feldmann, J, Guivel-Benhassine F, Mallet A, Marcelin, AG, Guatelli J, Schwartz O. Plos Pathogens. 2010; 6:e1000955.

• Biology and pathogenesis of chikungunya virus. Schwartz, O., and Albert, M.L. Nature Reviews Microbiology. 2010;8:491-500.

• The antiviral factor APOBEC-3G improves CTL recognition of HIV infected T cells. Casartelli N, Guivel-Benhassine F, Bouziat R, Brandler S, Schwartz O and Moris A. Journal of Experimental Medicine. 2010; 207(1):39-49

• Simultaneous HIV Cell-to-Cell transmission to multiple targets through polysynapses. Rudnicka, D., J. Feldmann, F. Porrot, S. Wietgrefe, S. Guadagnini, M. C. Prevost, J. Estaquier, A. Haase, N. Sol-Foulon, and O. Schwartz. Journal of Virology. 2009;83:6234-46.

• News & Views: Intrusive HIV-1 infected cells. Rudnicka, D and O. Schwartz. Nature Immunology. 2009; 9:933-4.

177



HIV replication

and interact ion with th e immune system

� Objectives:

• Basic Science:

• HIV replication and cell-to-cell spread

• Recognition of HIV-infected cells by the immune system

• Applied Science:

• Targeting HIV cell-to-cell transfer

• Targeting the HIV Nef protein

• Preclinical analysis of HIV vaccine candidates

� Tools:

• Cell culture systems to assess viral replication

• Real-time imaging of HIV cell-to-cell transfer

• Culture of CTLs

HIV cell-to-cell transmission is the major mode of viral spread

2007

0

20

40

60

80

100

0 10 20 30 40 50

Direct cocultureTranswell

Free virus

Time (h)

% g

ag+

cells

am

on

g t

arg

ets

HIV GagActinTarget cell

178



HIV replication


InfectionViability

InterferonCytokines

1

10

100

1000

10000

100000

NS

MT4C5 NI

MT4C5 HIV

Flu

Free HIV

NS

IFN (pg/mL)

Recognition of HIV-infected cells by the immune system

2011

HIV-infected cells

Target blood cells

Target blood cellsproduce large amounts of type-I Interferon (IFN)when they encounter HIV-infected cells

Targeting the HIV Nef protein:

Nef is a pathogenic factor enhancing viral replication in vivo

Viral multiplication

Signal transduction

CD4MHC-I CD4 and MHC-I

down-regulation

Nef

MHC-I

- Nef + Nef

CD4 MHC-I

- Nef

+ Nef

179

Perspectives




HIV replication


• Characterization of the innate immune response to HIV infection

• Identification of cellular pathways involved in HIV replication

• Screening for modulators of HIV cell-to-cell transfer.

• Screening for modulators of Nef function

• From basic to applied science

• From cellular tools to clinics : integration and access to all the research

materials : molecular constructs, biochemical tools, cell and viruses,

patients cohorts

• Access to a dedicated drug discovery screening platform

180



Keywords

• Viruses

• Bio film

• HTLV-1

• HIV-1

• Lymphocyte

• Virological synapse

• Immunological synapse

• Virus dissemination

• Viral pathogenesis

Major Grants :

• Agence Nationale de Recherche sur le SIDA (ANRS)

• Agence Nationale de Recherche (ANR MIME)

• La Ligue Contre le Cancer

• Fundação para a Ciência e a Tecnologia, Portugal

• The European Commission Marie Curie

• Actions Early Stage Training Program Intrapath EMBO and Sidaction

• The Unit is supported by Institut Pasteur and CNRS fundings


Subversion of T lymphocyte biology by human retroviruses

Characterization of a new extra-cellular infectious entity, the “viral biofilm”, related to a new mechanism for viral transmission and persistence in the host

Maria-Isabel Thoulouze, Ph.D

Until now, free viral particles and infected cells have been the only identified infectious targets for the design of

vaccines and anti-viral treatments. Our recent discovery that a human retrovirus, HTLV-1, encases itself in an

extracellular matrix “cocoon”, enabling its efficient and protected transfer between cells, opens fully novel

perspectives. This leads to the definition of a new extra-cellular infectious entity, the “viral biofilm”, and to the

characterization of a new mechanism for viral transmission. Targeting this new infectivity mode may lead to find

innovative ways to fight viral infections.

These structures are strikingly reminiscent of bacterial biofilms. Similarly, viral biofilms concentrate the

infectious capacity of viruses, enhance their transmission efficiency and could constitute microbial reservoirs

less accessible to the immune response, participating to the development of chronic infections. We believe that

these infectious viral entities could also be generated by (many) other viruses, including those responsible of

chronic infections such as HIV-1 retrovirus and Herpesviruses.

As suggested by our observations on HTLV-1 biofilms, reversing viral biofilm generation or adhesiveness, or

allowing the accessibility of viral particles to the immune system may provide new ways of treating some viral

chronic diseases. Compared to other strategies, such an antiviral strategy would have the advantage of being

synergistic with the immune response already developed by chronically infected patients. In addition, the

existence of viral biofilms that keep viral particles into a protective microenvironment could also explain the

failure of some current antiviral strategies, including boosting immune response.

Publications

• Can viruses form biofilms? Thoulouze M.-I. and Alcover. A. Trends in Microbiology, in press.

• Biofilm-like extracellular viral assemblies mediate HTLV-1 cell-to-cell transmission. Pais-Correia A.M., Sachse M., Guadagnini S., Robbiati V., Lasserre R., Gessain A., Gout O., Alcover A. and Thoulouze M.-I. Nature Medicine. 2010;16(1):83-9.

• Vesicle traffic to the immunological synapse. A multifunctional process targeted by lymphotropic viruses. Alcover A and Thoulouze M.-I. Current Topics in Microbiology and Immunology. 2010;340:191-207.

• ZAP-70 kinase regulates HIV cell-to-cell spread and virological synapse formation. Sol-Foulon N., Sourisseau M., Porrot F., Thoulouze M.I., Trouillet C., Nobile C., Blanchet F., di Bartolo V., Noraz N., Taylor N., Alcover A., Hivroz C. and Schwartz O.EMBO Journal. 2007;26(2):51.

• T cell polarization and the formation of the immunological synapse: from antigen recognition to virus spread. Pais-Correia A. M., Thoulouze, M. I., Alcover A. Curr. Immunol. Revs. 2007;3:107-188. (Review).

• Human Immunodeficiency Virus type-1 infection impairs the formation of the immunological synapse. Thoulouze, M.I., Sol-Foulon, N., Blanchet F., Dautry-Varsat A., Schwartz O. and Alcover A. Immunity. 2006;24(5):547-561.

181



« Viral biofilms »

182




183

Perspectives



• Determine the composition of viral biofilms

• Screen for compounds that inhibit biofilms formation or alter their structure in order

to favor viral particles accessibility during chronic infections

• Identification of other viruses forming viral biofilms:

- Viruses involved in chronic infections (herpesviruses, HIV-1)

- Respiratory viruses (influenza, RSV)




184


Maladies infectieuses Immunology

Keywords

• Innate immunity

• Natural Killer cel ls

• Viral infections

• Genetics

• Inflammation

• Innovative therapies

Major Grants

• ERC advanced

• ANR

• Institut Universitaire de France

Inserm U631 - CNRS UMR6102 - University of the Mediterranean Marseille

CIML Marseille-Luminy

Our expertise is on the role of innate immunity and inflammation in the control of microbial infections

Eric Vivier, DVM, Ph.D Sophie Ugolini, Ph.D

Our laboratory is focused on Natural Killer (NK) cells, not only to better understand their function and hence to

control their activity in vivo, but also as a system model of innate immunity. We propose to follow our previous

studies and focus on four main questions:

• How NK cells are educated?

• How NK cells distinguish their targets from normal cells?

• How NK cells participate to immunological memory?

• How NK cells can be used in therapy?

The combination of our imaging and genetic approaches is aimed to create ideal experimental conditions to

draw an integrated view of the complexity of innate immune responses at molecular, cellular and organism

levels.

In addition to nanoscopic approaches, we are developing two types of genetic screens: a random germline

mutagenesis in the mouse via ENU (N‐Ethyl‐N‐Nitrosourea) and an RNAi screen. We are also generating a

series of novel mice lines, based on the use of NKp46‐CRE knock‐in mice that express the CRE recombinase

under the control of NK cell‐specific regulatory regions.

We hope that our work will open new scholar horizons in reassessing the role and mode of action of innate

immune responses. In a translational perspective, we also think that this project will help to design innovative

NK cell‐based therapies.

Selected recent ref: Vivier et al. Science 2011, Nature Reviews Immunology 2010, Nature Immunology 2008;

Guia et al. Science Signaling 2011; Luci et al., Nature Immunology 2009; Sola, PNAS 2009; Brandt et al. J.

Exp. Med.

Publications

• Activating receptor confinement at the plasma membrane controls Natural Killer cell tolerance. Guia S., et al. Science Signaling. 2011 in press.

• Innate or adaptive immunity? The example of Natural Killer cells. Vivier E. et al. Science. 2011;331:44-49.

• Genetic and antibody-mediated reprogramming of natural killer cell missing-self recognition in vivo. Sola C., et al. Proc. Natl. Acad. Sci. U S A. 2009;106:12879-12884.

• Interleukin-22-producing innate immune cells: new players in mucosal immunity and tissue repair? Vivier E., et al. Nature Reviews Immunology. 2009;9:229-234.

• Natural killer cells remember. Ugolini S., Vivier E. Nature. 2009;457:544-545.

• Influence of the transcription factor RORγt on the development of NKp46+ cell populations in gut and skin. Luci C., et al. Nature Immunology. 2009;10:75-82.

• Functions of Natural Killer cells. Vivier E., et al. Nature Immunology. 2008;9:503-510.

• Natural killer cell trafficking in vivo requires a dedicated sphingosine 1-phosphate receptor. Walzer T., et al. Nature Immunology. 2007;8:1337-1344.

• Walzer T, et al. Proc. Natl. Acad. Sci. USA. 2007;104:3384-3389.

• Human NK cell education by inhibitory receptors for MHC class I. Anfossi N., et al. Immunity. 2006;25:331-42.

• Natural Killer cell and Macrophage cooperation in MyD88-dependent innate responses to Plasmodium falciparum. Baratin M., et al. Proc. Natl. Acad. Sci. U S A. 2005;102:14747–14752.

• Natural killer cell signaling pathways. Vivier E., et al. Science. 2004;306:1517-9.

185


Eric Vivier, DVM, Ph.D

and Soph ie Ugolini, Ph.D

Natural Killer cells and Innate Immunity

� Objectives:

• How NK cells are educated?

• How NK cells distinguish their targets from normal cells?

• How NK cells participate to immunological memory?

• How NK cells can be used in therapy?

� Tools:

• ENU mutagenesis

• Nanoscopy

• In vivo imaging

• Novel transgenic and knock-in mice

• Mouse to Human studiesDTR IRES GFP

IRES Cre

TagGFP

NKp46/Ncr1

NKp46/Ncr1

Figure 1: Functions of Natural Killer cells

Tumors (elimination)

Hematopoietic stem cell transplantation (improved grafing, control of GvHD,

GvT)

Reproduction (remodeling of uterine spiral arteries)

NK cells

Viruses(early control of Herpesviruses)

Autoimmunity

Asthma

Parasites(P. falciparumT. gondiiT. cruziL. major)

HIV

Organ transplantation ?

?

?

?

?

Vivier et al., Nature Immunol. 2008

186





Figure 2 : NK cells and the immune response

Vivier et al., Science 2011

Figure 3 : NK cell distribution

Uterus

LungLiver

Thymus

Skin

NKp46+

CD3-

Gut

NCR+ innate lymphoid cellsNKp46 RORγγγγt B220 Sytox

Bone marrow

Lymph nodes

Spleen

Blood

187

Perspectives





Figure 4 : Genetics and Nanoscopy

accessible size

optical diffraction limit

spot area0

free diffusion

t0 < 0

meshwork

t0 > 0

dynamic partition

(self-assembling)

WT G3 mice

% γ

-inte

rfer

on+

NK

cel

ls

Nanoscopic observation of membrane topologyCollaboration Didier Marguet, CIML

ENU random mutagenesis in the mouse

• Détermine the role of NK cells in the control of microbial infections

• Identification of pathways involved in the recognition of stressed cells by NK cells

• Rationale basis for the development of innovative NK cell-based therapies


• Leadership in NK cell biology (E.V. ERC advanced in 2010)

• From nanoscopy to the organism: integration and access to molecular constructs, imaging tools, cell and animal models

• Unique strong expertise in monitoring NK cells from mouse to patients

188

189



CONTACTS OF PARTICIPAN TS

190



Laur ent Abel Inserm U980, Paris France, EU Paris Descartes University, Paris, France, EU - Necker Medical School, Paris, France, EU

The Rockefeller University, New York, NY, USA E-Mail: [email protected]

Jean-Laurent Casanova Inserm U980, Paris France, EU Paris Descartes University, Paris, France, EU - Necker Medical School, Paris, France, EU The Rockefeller University, New York, NY, USA

E-Mail: [email protected]

Matthew Albert Institut Pasteur Paris - Inserm U818 E-Mail: [email protected]

Matthieu Allez Inserm U940 - Hôpital Saint-Louis, APHP - Paris Diderot University E-Mail: [email protected]

Brigitte Autran Inserm U945 - Pierre and Marie Curie University Paris

Federative Institute of Research on Immunity - Cancer - Infection (IFR113 Co-Chair) E-Mail: [email protected]

Thomas Baumert Inserm U748 – Strasbourg University - Nouvel Hôpital Civil Strasbourg Virol ogy Institute Strasbourg E-Mail: [email protected]

Monsef Benkirane Institut de Génétique Humaine Montpellier - CNRS UPR1142


Nicolas Blanchard Inserm U1043 - CNRS UMR5586 - Toulouse University E-Mail: [email protected]

Stéphanie Blandin Inserm U963 - CNRS UPR9022 - Strasbourg University E-Mail: [email protected]

Matteo Bonazzi CNRS UMR5236

Centre d'études d'agents Pathogènes et Biotechnologie pour la Santé (CPBS) - Montpellier E-Mail: [email protected]

Priscille Brodin Inserm U1019 - CNRS UMR8204 - Institut Pasteur Lille, Center for Infection and Immunity of Lille - Lille-Nord de France University E-Mail: [email protected]

Bruno Canard CNRS UMR6098 - Méditerranée University - Marseille


191



Béhazine Combadière Inserm U945 - Pierre and Marie Curie University Paris E-Mail: [email protected]

François-Loïc Cosset Inserm U758 – Lyon I University - Ecole Normale Supérieure de Lyon


François Dabis Inserm U897 – University Victor Segalen Bordeaux II E-Mail: [email protected]

Guillaume Duménil Inserm U970 - Paris Descartes University - Paris Cardiovascular Research Center E-Mail: [email protected]

Gérard Eberl Institut Pasteur Paris - URA1961


Hideiro Fukuyama CNRS UPR9022- University of Strasbourg Inst itute of Molecular and Cellular Biology Strasbourg E-Mail: [email protected]

Benoit Gamain Inserm U665 - Paris Diderot University - Institut National de Transfusion Sanguine E-Mail: [email protected]

Yves Gaudin CNRS UPR3296 - Laboratoire de Virologie Moléculaire et Structurale - Gif-sur-Yvette E-Mail: [email protected]

Ivo Gomperts Boneca Institut Pasteur Paris IP10175 E-Mail: [email protected]

Laurent Gutmann Inserm U872 - Paris Descartes University - European Hospital Georges Pompidou E-Mail: [email protected]

David Klatzmann Inserm U979 - Pierre and Marie Curie University Paris - CNRS UMR7211 - APHP


Marc Lecuit Institut Pasteur Paris - Inserm U604 - Paris Descartes University - APHP - Hôpital Necker-Enfants malades E-Mail: [email protected]

Eric Leroy UMR (IRD 224 – CNRS 5290 - UM1) – Montpellier

IRD Gabon - Franceville E-Mail: [email protected]

192



Elena Levashina Inserm U963 – CNRS UPR9022 Strasbourg E-Mail: [email protected]

Yves Lévy Inserm U955 - University of Paris-Est Créteil - CHU Henri Mondor - APHP E-Mail: [email protected]

Camille Locht Inserm U1019 - CNRS UMR8204 - Institut Pasteur Lille - Lille-Nord de France University Center for Infection and Immunity of Lille


Nicolas Manel Institut Curie Paris - Inserm U932 E-Mail: [email protected]

Robert Ménard Institut Pasteur Paris E-mai l: [email protected]

Tâm Mignot CNRS UPR9043 - Institut de Microbiologie de la Méditerranée - Marseille


Hannu Myllykallio Inserm U696 - CNRS UMR7645 - Ecole Polytechnique Labo ratoire d'Optique et Biosciences - Palaiseau E-Mail: [email protected]

Xavier Nassif Inserm U1002 - Paris Descartes University - APHP E-Mail: [email protected]

Patrice Nordmann Inserm U914 - Hôpital Bicêtre APHP - South Paris Medical School and University - Le Kremlin Bicêtre, South Paris E-Mail: [email protected]

Eric Oswald Inserm U1043 - USC INRA UMR1225 - Toulouse Purpan Medical School and Toulouse CHU Labo ratoire de Bactériologie-Hygiène - Ecole Nationale Vétérinaire de Toulouse E-Mail: [email protected]

Jean-Michel Pawlotsky

Inserm U955 - University of Paris-Est-Créteil-Val-de-Marne - Hôpital Henri Mondor Créteil, East Paris - Institut Mondor de Recherche Biomédicale (IMRB)


Carole Peyssonnaux Inserm U1016 - CNRS UMR 8104 - Institut Cochin Paris E-Mail: [email protected]

193



Eliane Piaggio CNRS UMR7211 - Pierre and Marie Curie University Paris - Inserm U959 - Pitie Salpetriere Hospital Paris


Marie-Cécile Ploy Inserm EA3175 - Limoges University E-Mail: [email protected]

Lluis Quintana-Murci Institut Pasteur Paris - CNRS URA3012 E-Mail: [email protected]

Didier Raoult CNRS UMR6236 – IRD – University of the Mediterranean Aix-Marseille II


Jean-Marc Reichhart CNRS UPR9022 – Strasbourg E-Mail: [email protected]

Félix Rey Institut Pasteur Paris – CNRS URA3015 E-Mail: [email protected]

Human Rezaei INRA - Unité Virologie et Immunologie Moléculaires, Jouy-en-Josas, Southwest Paris E-Mail: [email protected]

Carla Saleh Institut Pasteur Paris - CNRS URA3015 E-Mail: [email protected]

Philippe Sansonetti Institut Pasteur Paris - Inserm U786 E-Mail: [email protected]

Olivier Schwartz Institut Pasteur Paris - CNRS URA3015 E-Mail: [email protected]

Maria-Isabel Thoulouze Institut Pasteur Paris - CNRS URA1961


Eric Vivier CIML Marseille-Luminy - Inserm U631 - CNRS UMR6102 - University of the Mediterranean Marseille E-Mail: [email protected]

194

Documents

Rir 10th june_2011_v2