Rickettsia conorii Autotransporter Protein Sca1 Promotes ...The pathogenesis of spotted fever group (SFG) Rickettsia species, including R. conorii and R. rickettsii, is acutely dependent

INFECTION AND IMMUNITY, May 2010, p. 1895–1904 Vol. 78, No. 50019-9567/10/$12.00 doi:10.1128/IAI.01165-09Copyright © 2010, American Society for Microbiology. All Rights Reserved.

The Rickettsia conorii Autotransporter Protein Sca1 PromotesAdherence to Nonphagocytic Mammalian Cells�†

Sean P. Riley,‡ Kenneth C. Goh,‡ Timothy M. Hermanas, Marissa M. Cardwell,Yvonne G. Y. Chan, and Juan J. Martinez*

Department of Microbiology, University of Chicago, 920 E. 58th Street, Cummings Life Sciences Center,707A, Chicago, Illinois 60637

Received 15 October 2009/Returned for modification 3 November 2009/Accepted 12 February 2010

The pathogenesis of spotted fever group (SFG) Rickettsia species, including R. conorii and R. rickettsii, is acutelydependent on adherence to and invasion of host cells, including cells of the mammalian endothelial system.Bioinformatic analyses of several rickettsia genomes revealed the presence of a cohort of genes designated sca genesthat are predicted to encode proteins with homology to autotransporter proteins of Gram-negative bacteria.Previous work demonstrated that three members of this family, rOmpA (Sca0), Sca2, and rOmpB (Sca5) areinvolved in the interaction with mammalian cells; however, very little was known about the function of otherconserved rickettsial Sca proteins. Here we demonstrate that sca1, a gene present in nearly all SFG rickettsiagenomes, is actively transcribed and expressed in R. conorii cells. Alignment of Sca1 sequences from geographicallydiverse SFG Rickettsia species showed that there are high degrees of sequence identity and conservation of thesesequences, suggesting that Sca1 may have a conserved function. Using a heterologous expression system, wedemonstrated that production of R. conorii Sca1 in the Escherichia coli outer membrane is sufficient to mediateattachment to but not invasion of a panel of cultured mammalian epithelial and endothelial cells. Furthermore,preincubation of a recombinant Sca1 peptide with host cells blocked R. conorii cell association. Together, theseresults demonstrate that attachment to mammalian cells can be uncoupled from the entry process and that Sca1is involved in the adherence of R. conorii to host cells.

Spotted fever group (SFG) Rickettsia species are Gram-negative obligate intracellular bacteria that are the etiologicagents of many severe emerging infectious diseases that occurthroughout the world, including Rocky Mountain spotted fever(RMSF) and Mediterranean spotted fever (MSF), which arecaused by R. rickettsii and R. conorii, respectively. These bac-teria are transmitted to human hosts through the salivary glandcontents of infected ticks and occasionally lice or mites. Ex-pansion of the bacterial population and horizontal cell-to-celltransmission near the inoculation or arthropod feeding siteresults in localized dermal and epidermal necrosis and thecharacteristic eschar or tache noir (58). Once established in thehost, SFG Rickettsia infects primarily the endothelial lining ofthe vasculature (36, 46, 55). Damage to this tissue and infiltra-tion of perivascular mononuclear cells often cause fluid leak-age and the diagnostic macropapular dermal rash (6, 10, 24).While these unusual symptoms are good predictors for appro-priate diagnosis and treatment, they are often accompanied bynondescript fever and flu-like symptoms, and often they do notoccur at all (6). Even in areas of the United States whereawareness of RMSF is high, approximately 60% to 75% ofpatients receive an alternate diagnosis during their first visit formedical care (26, 39). Misdiagnosis of SFG Rickettsia infection

is associated severe manifestations, including acute renal fail-ure, pulmonary edema, interstitial pneumonia, neurologicalmanifestations, and other multiorgan manifestations (6, 24).The mortality rates for untreated Mediterranean and RockyMountain spotted fevers are estimated to be as high as 20%,but appropriate treatment drastically decreases the risk (9, 11,23, 35). The severity of these diseases and the potential foraerosol transmission have led to classification of Rickettsiaspecies as category B and C priority pathogens by the U.S.Centers for Disease Control and Prevention (CDC) (40).

Rickettsiae are strict intracellular parasites that require hostcells to replicate. In order to survive, the bacteria must invadeand reside exclusively in mammalian or arthropod host cells(60). Intracellular bacteria escape from vacuoles (44, 56, 65)and move intra- and intercellularly by means of actin-basedmotility (20, 21, 25, 50), which leads to infection of neighboringcells and possibly to release into the vasculature. SFG rickett-siae must, therefore, perform a series of regimented patho-genic steps in widely diverse environments in order to surviveand thrive in their hosts.

A critical initial step in SFG rickettsia pathogenesis is bac-terial recognition of and attachment to target cells. In vivo,SFG rickettsiae are first exposed to and primarily infect thehost endothelium, but they are known to enter a wide spectrumof normally nonphagocytic cells in vitro (7, 42, 46, 47, 53, 61, 63,64, 66, 67). This entry can be divided into two distinct events,adherence and invasion. Rickettsia can adhere to all types ofcells that have been tested, including endothelial cell ghoststhat lack any form of chemical membrane gradients (66). Thisprocess does not absolutely require energy as adherence stilloccurs if either the bacteria or the host cells are killed. How-

* Corresponding author. Mailing address: Department of Microbi-ology, University of Chicago, 920 E. 58th Street, Cummings Life Sci-ences Center, 707A, Chicago, IL 60637. Phone: (773) 834-4556. Fax:(773) 834-8150. E-mail: [email protected].

† Supplemental material for this article may be found at http://iai.asm.org/.

‡ S.P.R. and K.C.G. contributed equally to this work.� Published ahead of print on 22 February 2010.

1895

ever, adherence is at least partially temperature dependent andappears to require receptors present in cholesterol-enrichedmembrane segments (29, 34, 41, 57, 61).

In contrast to adherence, rickettsial invasion is an activeprocess that has been defined as “induced phagocytosis.” Sev-eral studies of rickettsia invasion have shown that this processis morphologically and mechanistically related to a “zipper-like” invasion strategy, whereby localized receptor-ligand in-teractions induce cytoskeletal arrangements around the bacte-rium (20, 21, 25, 32, 49). More recent detailed analyses ofinternalization mechanisms revealed that R. conorii invasion isdependent on the actin nucleating protein complex, Arp2/3, aswell as many host signaling events, including those mediated byc-Cbl, clathrin, caveolin 2, Cdc-42, phosphoinositide 3-kinase,c-Src, and other kinases (5, 20, 25, 32). Since adherence andinvasion are absolutely vital for survival of SFG Rickettsia andsince these pathogenic processes are not sheltered from intra-cellular protection, they provide pronounced targets for ther-apeutic interposition.

Bioinformatic analysis of SFG Rickettsia has identified afamily of predicted outer surface proteins designated Sca (sur-face cell antigen) proteins (2). These proteins, including Sca1,belong to a family of Gram-negative proteins called autotrans-porters, many of which are virulence factors (27, 28). Membersof this protein family have modular structures, including anN-terminal signal sequence, a central passenger peptide, and aC-terminal “translocation module” (�-peptide) (28). Follow-ing translation, the peptide is initially secreted across the in-ner membrane using information in the N-terminal signal se-quence. The C-terminal peptide then inserts into the outermembrane to form a �-barrel-rich transmembrane pore throughwhich the passenger peptide passes, which exposes the passengerpeptide to the extracellular environment (28). Four predictedrickettsial autotransporter proteins, Sca0 (rOmpA), Sca1, Sca2,and Sca5 (rOmpB), are conserved across the spotted fever group(2, 37, 38, 45). Three of these proteins, rOmpA, rOmpB, and Sca2have been shown to mediate attachment to host cells and topotentially elicit protective host immunity (4, 5, 12, 17, 18, 31, 34,54). However, very little is known about the function(s) of theother Sca proteins.

In this study, we examined sca1 transcription and demon-strated that Sca1 is present on the surface of R. conorii isolatedfrom infected mammalian cells. Using a heterologous systemto express Sca1 at the outer membrane of Escherichia coli, wedetermined that Sca1 expression is sufficient to mediate adher-ence to nonphagocytic mammalian cells. Likewise, a solubleSca1 peptide is able to inhibit association of virulent R. conoriibacteria with their cognate host cells. We predict that the Sca1function is likely conserved among diverse SFG Rickettsia spe-cies due to the high degrees of identity and similarity of Sca1sequences. Interestingly, Sca1 expression on the surface of E.coli is not sufficient to mediate invasion of mammalian cells,suggesting that while Sca1 may play a critical role in the asso-ciation of SFG rickettsiae with target cells, other interactionsare required to induce bacterial internalization.

MATERIALS AND METHODS

Amino acid alignment. Amino acid sequences of R. conorii Malish7 (geneidentification number, gi:15891942), R. rickettsii Sheila Smith (gi:157827888), R.japonica YM (gi:51557577), R. africae ESF-5 (gi:167471126), and R. australis

Phillips (gi:51557593) were aligned using Clustal W/Mac Vector 9.5.2 (MacVector, Cary, NC) with an open gap penalty of 10.0 and an extend gap penaltyof 0.2. The degrees of identity and similarity of Sca1 sequences were determinedusing the calculated alignment. Therefore, the numbers in amino acid designa-tions below do not refer to any single protein but refer to the total alignment.

Gene manipulations. Insertion of the R. conorii sca1 open reading frameinto pET22b was performed by directional restriction endonuclease-mediatedinsertion. Briefly, sca1 was PCR amplified from R. conorii Malish 7 genomicDNA using primers sca1-F (5�-ACCATGGATAAGTTAACAGAACAACA)and sca1-R (5�-CTTAAGGTAAACCTACACCACCACCACCACCACTAA)and TA cloned into pCR2.1 (Invitrogen, Carlsbad, CA) to produce pSca1-100.The sca1 insertion was removed by digestion with NcoI and BamHI (NewEngland Biolabs, Ipswich, MA) and ligated into similarly digested pET-22b withquick ligase (New England Biolabs) to make pSca1-200. Positive clones werescreened by PCR, and the entire sca1 insertion was sequenced to verify accurateinsertion in frame with 5� pelB signal and 3� His6 sequences. Construction ofpYC9 (pET22b::ompB) is described elsewhere (5). pYC7 contains rompB bp 105to 4002 (amino acids 35 to 1334) corresponding to the rOmpB “passengerdomain.” The gene fragment was PCR amplified from chromosomal DNA usingthe primers described previously for pYC11 (5) and was directionally cloned intopET-22b using NcoI and XhoI sites.

pGST-Sca1(29-327) was constructed by restriction enzyme-mediated insertioninto pGEX-2TKP (acquired from T. Kouzarides). The sca1 insertion fragmentwas amplified from R. conorii genomic DNA with primers GST-F (5�-GGATCCGCAATACCTTTTGAGGGT) and Sca1-900R (5�-CTCGAGCTGCGTATACAACTTCTGCA) and ligated into pCR.1. The fragment was liberated with theBamHI and XhoI restriction enzymes and ligated into pGEX-2TKP to create aplasmid encoding recombinant glutathione S-transferase (GST)-Sca1(amino ac-ids 29 to 327) [rGST-Sca1(29-327)] under control of an isopropyl-�-D-thiogalac-topyranoside (IPTG)-inducible promoter.

pGEX-HIS is a derivative of pGEX-2TKP that encodes an N-terminal GSTtag, a C-terminal four-glycine linker, and a six-histidine tag flanking the pGEX-2TKP multicloning site. This plasmid was generated by QuikChange mutagenesisusing the complementary primers pGEX-HIS Forward (5�-GGTCGACTCGAGCTCAAGCTTGGAGGTGGAGGTCACCATCACCATCACCATAATTCATCGTGACTGACTGAC) and pGEX-HIS Reverse (5�-GTCAGTCAGTCACGATGAATGGTGATGGTGATGGTGACCTCCACCTCCAAGCTTGAGCTCGAGTCGACC) and conditions described previously (62).

Culture of bacterial and mammalian cells. Vero (ATCC) and HeLa cells wereroutinely grown in Dulbecco’s modified Eagle’s medium (DMEM) (Mediatech,Manassas, VA) supplemented with 10% heat-inactivated fetal bovine serum(Invitrogen), 1� nonessential amino acids (NEAA) (Mediatech), and 0.5 mMsodium pyruvate (NaPyr) (Lonza, Walkersville, MD) at 37°C in the presence of5% CO2. EA.hy926 cells were grown under the same conditions without NEAAand NaPyr.

R. conorii Malish7 was cultured and isolated with Vero cells as describedelsewhere (32) and was purified by sucrose density centrifugation. Briefly, heavilyinfected cells were harvested and gently lysed by passage through syringes cou-pled to needles with increasing gauges. After unlysed mammalian cells wereremoved, the rickettsia-containing lysate was overlaid onto 20% sucrose andseparated by centrifugation. Infectious bacteria were quantified by titration (43).

pET-22b, pYC9, and pSca1-200 were transformed into E. coli BL21(DE3)(Stratagene, La Jolla, CA) for protein production. The strains were grown in LBmedium supplemented with 100 �g/ml ampicillin overnight, diluted 1:20 intofresh medium, and grown at 30°C until the optical density at 600 nm (OD600) was�0.5. E. coli harboring either pET-22b or pSca1-200 was induced at 30°C with 0.5mM isopropyl-�-D-thiogalactopyranoside (IPTG). Induction of rOmpB (pYC9)in E. coli was performed as previously described (5).

RNA isolation and reverse transcriptase PCR (RT-PCR). Total RNA wasextracted from approximately 4 � 105 R. conorii Malish7 infectious particlesusing an RNeasy kit as described by the manufacturer (Qiagen) and was treatedwith RNase Out and DNase I (Invitrogen) to remove contaminating RNase andDNA. RNA was quantified based on absorbance using the equation [RNA(�g/ml)] � A260 � 40. Individual 120-ng aliquots of each DNA-free RNApreparation were reverse transcribed using an ImPromII kit (Promega, Madison,WI) with random hexamers and avian myeloblastosis virus (AMV) reverse tran-scriptase (RTase) as directed by the manufacturer. Target rickettsial genes(ompA and sca1) were PCR amplified from cDNA using 5�Mastermix (5Prime,Gaithersburg, MD) and primers 5�-AATGACACCGCTACAGGAAGCAGAand 5�-AAACGGGCTTCTCCACGCACCAAA for ompA and primers 5�-TGCGTTTCAAGCACAGCAAGCA and 5�-TTGCATGGCTCGTAATGCCGTTCT for sca1. Parallel amplification reactions were performed in the absence ofcDNA and RTase to ensure that the RNA preparation was pure. All PCR products

1896 RILEY ET AL. INFECT. IMMUN.

were separated by agarose gel electrophoresis in the presence of ethidium bromide,and the accuracy of amplification was verified by DNA sequencing.

Protein preparation, sequencing, Western blotting, and immunofluorescence.Isolated R. conorii Malish7 preparations were boiled in SDS-PAGE buffer, elec-trophoresed in 4 to 20% gradient acrylamide gels (Invitrogen), and stained withCoomassie brilliant blue. A portion of a separated gel corresponding to proteinswith molecular masses of approximately 120 to 250 kDa was extracted andsubjected to microcapillary liquid chromatography-tandem mass spectrometry(LC-MS/MS) peptide sequencing (Taplin Biological Mass Spectrometry Facility,Harvard Medical School, Boston, MA).

Affinity-purified rabbit anti-Sca1 antibody was produced using the R. conoriiSca1 peptide sequence 144TEQSQNTYTPESTEC157 (Gen Script, Piscataway,NJ). This antibody was used to assess the presence of Sca1 in E. coliBL21(DE3)(pSca1-200). Outer membrane proteins of E. coli were prepared asdescribed previously (51). Briefly, 10 ml of induced E. coli BL21(DE3) withcorresponding plasmids was centrifuged and resuspended in 1 ml phosphate-buffered saline (PBS) with 1� Complete protease inhibitor cocktail (Roche,Basel, Switzerland). The cells were lysed by sonication, and the debris waspelleted by centrifugation at 1,000 � g to remove unbroken cells. The superna-tant was treated with 0.5% Sarkosyl to solubilize the inner membrane and wascentrifuged again at high speed to precipitate the outer membrane. The outermembrane preparation was subjected to SDS-PAGE, transferred to nitrocellu-lose, and incubated with anti-Sca1 or anti-rOmpB, followed by goat anti-rabbithorseradish peroxidase (HRP)-conjugated antibodies (Sigma, St. Louis, MO).Immunoblots were developed using chemiluminescence and exposure to film.

Recombinant GST-Sca1 containing amino acids 29 to 327 [rGST-Sca1(29-327)]or rGST-His (pGEX-His) protein was produced in E. coli BL21-CodonPlus(DE3)-RIL (Stratagene) harboring pGST-Sca1(29-327) or pGEX-His. Followinginduction at 30°C with 0.5 mM IPTG, bacteria were harvested by centrifugationand lysed by sonication in PBS. Lysates were cleared by centrifugation andloaded onto 5-ml GST-TRAP FF (GE Healthcare, Piscataway, NJ) columnsusing an ATKA fast protein liquid chromatograph (FPLC) with a UPC-900 UVabsorbance monitor and a Frac900 fraction collector (GE Healthcare). Thecolumns were washed and subjected to increasing concentrations of PBS, 30 mMglutathione elution buffer. Protein purity was assessed by SDS-PAGE with Coo-massie brilliant blue staining. Protein concentrations were determined by calcu-lating the mean observed results of Bradford and bicinchoninic acid (BCA)protein assays (Pierce, Rockford, IL). Fractions containing purified protein weredialyzed against PBS, 1 mM phenylmethanesulfonyl fluoride, 10% glycerol (pH7.5). Aliquots were snap-frozen with liquid nitrogen prior to cryogenic storage at�80°C and were thawed on ice immediately prior to use in cell-based assays.

Sca1(29-327) antiserum was produced from rGST-Sca1(29-327) after removal ofthe GST tag. Briefly, recombinant protein preparations dialyzed against PBS,10% glycerol (pH 7.5) were incubated overnight at room temperature with 10U/mg thrombin (GE Healthcare) to liberate the GST peptide. Each resultingsolution was passed repeatedly over GST-TRAP FF and HiTrap benzamidine FFcolumns (GE Healthcare) to remove the GST peptide and thrombin, respec-tively. The remaining GST-free Sca1(29-327) protein with Freund’s adjuvant wasutilized to immunize a New Zealand White rabbit. Any contaminating anti-GSTantibodies were removed from the Sca1(29-327) antiserum by repeated passageover an rGST peptide-loaded GST-TRAP FF column. The E. coli surface reac-tivity of the antibody was eliminated by incubation with fixed E. coliBL21(DE3)(pET22b), followed by centrifugation to precipitate any antibodiesbound to the E. coli.

rOmpB(35-1335) was produced in E. coli BL21(DE3) harboring pYC7 andwas purified under denaturing conditions. Briefly, following induction at 30°Cwith 0.5 mM IPTG, bacteria were harvested by centrifugation, resuspended inPBS, and disrupted with a French press. Insoluble components were isolated byultracentrifugation and solubilized in 8 M urea-PBS (pH 8.0). rOmpB(35-1335)was purified from the urea-soluble material by Ni-nitrilotriacetic acid (NTA)affinity chromatography.

Mouse anti-R. conorii hyperimmune serum was isolated from experimentallyinfected animals. Briefly, C3H/HeN mice were inoculated retroorbitally with1.8 � 105 PFU of R. conorii Malish7. These mice were monitored, and diseaseprogression was scored. At day 11 postinfection, when the mice showed nofurther signs of illness, the mice were again infected retroorbitally with 7.9 � 106

PFU of R. conorii. At day 21 postinoculation, all mice were sacrificed, and bloodsamples were obtained by cardiac puncture. Sterile serum was obtained bycentrifugal separation of blood components with Serum Gel S/1.1 tubes(Sarstedt, Numbrecht, Germany) and filtering through 0.22-�m filters.

For Western immunoblot analysis, total R. conorii lysate or recombinant pro-teins [rGST-Sca1(29-327) and rOmpB(35-1335)-His] were separated by SDS-PAGE,transferred to nitrocellulose, probed with the appropriate antisera, and devel-

oped using chemiluminescence. Rabbit anti-Sca1(29-327) and normal rabbit serawere utilized at a dilution of 1:500.

For immunofluorescent or flow cytometric analysis of R. conorii, purifiedbacteria were air dried onto glass coverslips or left in solution before they werefixed with 4% paraformaldehyde. The bacteria were incubated with a 1:200dilution of mouse anti-R. conorii hyperimmune serum as described above and a1:200 dilution of anti-Sca1(29-327) or normal rabbit serum and then with a1:1,000 dilution of secondary goat anti-mouse IgG-Alexa Fluor 546 antibody anda 1:1,000 dilution of secondary goat anti-rabbit IgG-Alexa Fluor 488 antibody.Cells were visualized with a Leica TCS SP2 AOBS laser scanning confocalmicroscope equipped with an acousto-optical beam splitter (AOBS) using aphysical magnification of �100 and an 8� digital zoom, which was controlledwith LCS Leica confocal software. Bacteria were also analyzed with a BD LSR-IIflow cytometer using fluorescein isothiocyanate (FITC) and phycoerythrin (PE)parameters and FloJo software. The analysis of Sca1 expression in relation tonormal rabbit serum (FITC) was predicated on positive detection of mouseanti-R. conorii (PE) fluorescence.

Cell association and invasion assays. Cell association and invasion assays wereperformed as described previously (5, 33). Briefly, induced E. coli BL21(DE3)harboring pSca1-200, pYC9, or pET22b was added to a confluent monolayer ofVero, HeLa, or EAhy.926 cells in serum-free media. Portions of the bacterium-containing media were plated to determine the number of CFU that were addedto each mammalian monolayer. Contact of the bacteria with each mammalianmonolayer was initiated by centrifugation at 200 � g, and then the preparationswere incubated at 37°C in the presence of 5% CO2 for 20 and 60 min for theadherence and invasion assays, respectively. For invasion assays, infected cellswere washed with PBS and then incubated for 2 h with complete mediumsupplemented with 100 �g/ml gentamicin to kill the extracellular bacteria. For allE. coli assays, infected cells were washed extensively in PBS, and bacteria wereliberated by incubation with 0.1% Triton X-100 in sterile H2O and then platedon LB agar to enumerate associated bacteria. The results were expressed as thepercentage of the bacteria recovered based on the number of bacteria in theinitial inoculum.

For R. conorii infection, confluent monolayers of Vero or EAhy.926 cells in48-well tissue culture plates were pretreated with 800 �g/ml rGST-His or withrGST-Sca1(29-327) for 30 min prior to infection. R. conorii infectious particleswere added to a monolayer of mammalian cells, and contact was induced bycentrifugation at 500 � g. The cells were incubated for 20 min at 37°C in thepresence of 5% CO2 before extensive washing with PBS. The cells were thenfixed with 4% paraformaldehyde and permeabilized with 0.1% Triton X-100 inH2O. The cells were then stained for immunofluorescence with a 1:1,000 dilutionof RC7 (rabbit anti-R. conorii, kindly provided by David Walker, University ofTexas Medical Branch), followed by a 1:500 dilution of goat anti-rabbit AlexaFluor 488 and 4�,6�-diamidino-2-phenylindole (DAPI) to stain nuclei. Cells wereexamined with an Eclipse TE2000-U inverted microscope (Nikon, Tokyo, Japan)equipped with CARV II (BD, Franklin Lakes, KJ) and a Photometrics Cascade1K camera (Roper Scientific, Tucson, AZ) using a final �200 optical zoom, andimages were analyzed with IPLab3.7 (Scanalytics, Rockville, MD). R. conorii cellsand mammalian nuclei were counted using the cell counter analysis tool fromImage J (http://rsb.info.nih.gov/ij), and the results were expressed as the ratio ofR. conorii cells to mammalian cells (nuclei).

RESULTS

Sca1 is conserved among SFG Rickettsia species. R. conoriisca1 is a 5,709-bp open reading frame (ORF) that encodes apredicted 212,153-Da protein. Since sca1 is present in thegenomes of the vast majority of SFG Rickettsia species (37, 38),

TABLE 1. Sequence conservation of the R. conorii Sca1 protein inother Rickettsia spp.

Rickettsia strain% Identity for amino acids:

1–400 401–800 801–1200 1201–1600 1601–2060

R. africae ESF-5 94.2 96.4 83.7 48.6 98.1R. rickettsii Sheila Smith 94.2 94 82.2 85.4 94.9R. japonica YM 91.4 86.8 75.5 96.9 91.1R australis Phillips 60.7 5.1 5.6 48.6 89.3R. typhi Wilmington 32.8 4.1 4.5 12.1 74.8

VOL. 78, 2010 R. CONORII Sca1 IS AN ADHESIN 1897

we wanted to ascertain the level of Sca1 protein sequenceconservation among related and diverse spotted fever group(SFG) rickettsiae. As shown in Table 1, sequence analysis ofSca1 proteins from Rickettsia species dispersed throughout theworld revealed considerable levels of sequence identity andsimilarity, with particular conservation at the N and C termini.The C-terminal conservation can be attributed in part to thechemical and structural constraints of the membrane-imbeddedpore-forming �-peptide (28). However, much of the N-terminalconservation occurs outside the predicted signal sequence and in

the completely uncharacterized passenger domain. The apparentlimits on sequence variability in these regions imply that there isfunctional conservation, and these regions are an attractive targetfor treatment of SFG Rickettsia infections.

sca1 is transcribed and translated in R. conorii. Functionalcharacterization of Sca1 was precluded by the need to verifytranscription and translation. We first isolated total RNA frominfectious R. conorii bacteria isolated from infected Vero cellsand performed nonquantitative reverse transcriptase PCR(RT-PCR) amplification of sca1. We performed identical re-

FIG. 1. Sca1 is expressed in cultured R. conorii Malish7. (A) RT-PCR detection of sca1 mRNA transcript from R. conorii cultured in Vero cells.Specific sca1 cDNA was amplified only after incubation with both input RNA and reverse transcriptase (RTase) in order to eliminate the possibilityof exogenous DNA contamination in the reverse transcription reaction. As a positive control we amplified ompA, a gene known to be expressedunder culture conditions. (B) Total lysate from purified R. conorii was separated by SDS-PAGE. Protein species that migrated slower than thereadily visible rOmpB protein (120 kDa) were excised from the gel and subjected to microcapillary LC-MS/MS peptide sequencing. For reference,a higher magnification of the sequenced portion of the SDS-PAGE gel is shown to the right of the entire Coomassie blue-stained gel. Therecovered peptide sequence hits encompassed many of the predicted high-molecular-weight proteins from R. conorii, including rOmpA, rOmpB,and Sca1 (see Table S1 in the supplemental material). Sca1 was the most abundant protein sequenced in this sample as determined by the numberof peptides sequenced and the extent of protein coverage. (C) Western immunoblot analysis of total R. conorii protein lysates using rabbitanti-Sca1(29-327) serum (�-Sca1) detected a protein with a molecular mass of approximately 130 kDa (lane 1) that corresponds to the putativelyprocessed Sca1 protein but is not reactive with a total protein lysate from uninfected Vero cells (lane 2). Normal rabbit serum (NRS) did not detectSca1. (D) Specificity of anti-Sca1 antisera. Recombinant GST-Sca1(29-327) (lane 1) and the 10-histidine-tagged rOmpB passenger domain (aminoacids 35 to 1334) (lane 2) were separated by SDS-PAGE, stained with Coomassie blue (left panel), and immunoblotted with the antisera indicated[anti-Sca1(29-327) serum [�-Sca1] and normal rabbit serum (NRS)]. Sca1 antiserum detects recombinant Sca1 but not rOmpB. (E) Flow cytometricanalysis of R. conorii. Purified R. conorii was stained with murine anti-R. conorii antiserum and anti-mouse IgG PE-conjugated antisera. Cells werethen counterstained with either normal rabbit serum or rabbit anti-Sca1 (26-327) and FITC-conjugated anti-rabbit IgG. PE-positive cells were gatedand then analyzed for FITC expression. Cells incubated with normal rabbit serum produced only background levels of fluorescence (red trace),while for cells incubated with anti-Sca1 antisera there was a significant increase in fluorescence intensity indicative of Sca1 surface expression (bluetrace). (F) Immunofluorescence microscopy using specific anti-Sca1(29-327) revealed the presence of Sca1. The panels on the left show mouseanti-R. conorii hyperimmune serum recognition of whole bacteria. The panels in the middle show recognition by samples of rabbit serum, includinganti-Sca1(29-327) and normal rabbit serum (NRS), and the panels on the right show merged images of appropriate rabbit and mouse serum signals.Sca1 appears to be present in distinct foci on the R. conorii outer membrane.


actions to amplify a portion of the ompA ORF, which is knownto produce protein in cell culture conditions (30), and reac-tions without RNA or reverse transcriptase as controls. Asshown in Fig. 1A, the presence of a specific sca1 product underthe appropriate conditions confirmed that there was transcrip-tion of sca1 in R. conorii.

We next queried whether R. conorii isolated from Vero cellsexpressed the Sca1 protein. An R. conorii protein lysate wasseparated by SDS-PAGE, and proteins with apparent molec-ular masses between 130 kDa and 250 kDa were excised andanalyzed by microcapillary LC-MS/MS peptide sequencing(Fig. 1B). Peptides corresponding to various proteins, includ-ing rOmpA, rOmpB, and Sca1, were identified using peptidesequencing (see Table S1 in the supplemental material). Atotal of 50 peptides attributed to Sca1 were detected, corre-sponding to 33.9% of the predicted protein.

We also created a polyclonal antiserum directed against theN-terminal portion of the Sca1 passenger domain (amino acids29 to 327). Western analysis of total R. conorii lysate using thisanti-Sca1(29-327) serum yielded a reactive band at an apparentmolecular mass of approximately 130 kDa, which was not ob-served using normal rabbit serum (Fig. 1C). This Sca1-reac-tive band likely represents a peptide processed from thefull-length protein, which is predicted to have a molecularmass greater than 200 kDa. In order to confirm the speci-ficity of this antiserum, we separated the rGST-Sca1(29-327)

and rOmpB(35-1334)-His proteins by SDS-PAGE, transferredthe proteins to nitrocellulose, and probed for reactivity torabbit sera, including anti-Sca1(29-327) and normal rabbitsera. As shown in Fig. 1D, the anti-Sca1 serum reacted withthe recombinant Sca1 protein (lane 1) but did not cross-reactwith the recombinant rOmpB peptide (lane 2). Normal rabbitserum showed no specific reactivity with either protein. Takentogether, these results demonstrate that the anti-Sca1(29-327)serum is specifically reactive with the Sca1 protein and not withanother abundant rickettsial antigen, rOmpB.

Having demonstrated both the presence of the Sca1 proteinin R. conorii and the specificity and efficacy of the anti-Sca1(29-327) serum, we wanted to determine the cellular localization ofthis protein. R. conorii cells were stained with mouse polyclonalanti-R. conorii antisera and then with either anti-Sca1(29-327)serum or normal rabbit serum and the appropriate fluoro-phore-conjugated secondary antibodies. R. conorii-positivecells were gated and then analyzed for expression of Sca1 onthe cell surface. As shown in Fig. 1E, flow cytometry demon-strated that there was a significant level of Sca1-specific fluo-rescence on gated intact R. conorii cells compared to the nor-mal rabbit serum control. We confirmed that Sca1 was presenton the R. conorii cell surface by using immunofluorescencemicroscopy. As shown in Fig. 1F, Sca1 was readily observed onthe surface of R. conorii cells compared to the normal rabbitserum control (middle panels). Interestingly, the distributionof Sca1 was not uniform, and Sca1 was in a distinct portion(s)of most cells, a pattern consistent with surface exposure ofSca1. These results confirm that Sca1 is actively translated in R.conorii under culture conditions and that its expression is con-sistent with being on the outer membrane of the bacterium.

Expression of Sca1 in E. coli is sufficient to mediate adher-ence to mammalian cells. Due to the lack of efficient genetictools to manipulate R. conorii, we utilized a heterologous E.

coli expression system to analyze the function of Sca1 when itwas exposed to the extracellular environment. The entire R.conorii sca1 open reading frame was cloned into the IPTG-inducible pET-22b vector to produce pSca1-200 (Fig. 2A) andthen transformed into the E. coli BL21(DE3) strain. Inductionof protein expression in E. coli harboring pSca1-200 but notpET22b or pYC9 (ompB) resulted in the presence of a high-molecular-weight anti-Sca1 reactive product in isolated outermembrane protein preparations (Fig. 2B).

Other rickettsial autotransporter proteins have previouslybeen determined to mediate adherence and invasion of hostcells (4, 5, 34, 54). We therefore examined the ability of Sca1-expressing E. coli to adhere to cultured mammalian cells. Sca1-expressing E. coli was applied to confluent monolayers ofmammalian cells, and contact with epithelial (HeLa and Vero)and endothelial (EAhy.926) cells was induced by centrifuga-tion. After incubation, cells were extensively washed to removenonadherent bacteria, fixed, and, for analysis of immunofluo-rescence, treated with rabbit anti-E. coli and anti-rabbit AlexaFluor 488 to stain E. coli (green), with DAPI to stain nuclei(blue), and with Phalloidin-TR to stain actin (red). The immu-nofluorescence analysis revealed that there was an increase inthe number of adherent E. coli cells when Sca1 was expressed(Fig. 3A). The Sca1-mediated adhesion was verified by re-moval of adherent bacteria from live mammalian monolayersand enumeration using a CFU-based quantification assay. This

FIG. 2. Expression of R. conorii Sca1 on the surface of E. coli.(A) Diagram of the sca1-containing pET-22b plasmid variant pSca1-200, showing the relevant 5� and 3� features. This vector encodes arecombinant protein fusion containing an N-terminal E. coli PelBsignal sequence, R. conorii Sca1, and a C-terminal His6 tag. Due to theN-terminal PelB signal sequence and the inherent ability of autotrans-porter proteins to direct their own translocation across the bacterialouter membrane, Sca1 is predicted to be anchored in the bacterialouter membrane and primarily exposed to the extracellular environ-ment. RBS, ribosome binding site. (B) Western blot analysis of outermembrane preparations of E. coli harboring the empty vector pET22b,pSca1-200, or ompB-containing pYC9 with anti-Sca1 (amino acids 144to 157) or polyclonal anti-rOmpB. The presence of pYC9 has previ-ously been demonstrated to permit rOmpB expression. Antibodiesagainst Sca1 and rOmpB are not cross-reactive. “T7 pro” and “T7term” refer to the transcriptional promoter and terminator sequences,respectively, present in pET-22b.


assay confirmed that significant increases in the adherence toboth epithelial and endothelial cell lines were mediated bySca1 expression (Fig. 3B to D). The observed percentages ofadherence are comparable to those for other defined adher-ence proteins (3–5, 19, 33). Therefore, the expression of R.conorii Sca1 on the outer surface of E. coli cells is sufficient tomediate adherence of these bacteria to mammalian cells.

Sca1-expressing E. coli does not invade host cells. A previ-ous study demonstrated that the expression of R. conoriirOmpB (Sca5) in E. coli was sufficient to mediate adherenceto and entry into mammalian cells (5, 54). We therefore soughtto determine if R. conorii Sca1 expression is also sufficient tomediate invasion of host cells. E. coli cells expressing eitherSca1 (pSca1-200) or rOmpB (pYC9) or E. coli cells with anempty vector (pET22b) were applied to cultured monolayersof Vero, HeLa, or EAhy.926 cells, and internalization wasquantified by performing a gentamicin protection assay. Asshown in Fig. 4, Sca1-expressing E. coli did not invade nonph-agocytic mammalian cells, whereas E. coli expressing rOmpB(pYC9) did invade these cells. These results demonstrate thatunlike other R. conorii Sca proteins, Sca1 is not sufficient tomediate invasion of either epithelial or endothelial cells.

Sca1 peptide competitively inhibits R. conorii-host cell as-sociation. We next determined if Sca1 could competitivelyinhibit R. conorii-host cell interactions. We preincubated mam-malian monolayers with soluble rGST-Sca1(29-327) or rGST-His

peptides and then assessed the ability of R. conorii to associatewith the cells. As shown in Fig. 5A to C, preexposure of cellsto rGST-Sca1(29-327) inhibited R. conorii-host cell association,as assessed by immunofluorescence and subsequent deter-mination of the ratio of R. conorii cells to host cells. Thisobservation demonstrates that preincubation with excessrGST-Sca1(29-327) can competitively inhibit association ofthe full-length Sca1 protein with the cognate mammalianligand and that the observed adherence phenotype is, infact, a consequence of Sca1 expression. The competitiveinhibition further demonstrated that Sca1 mediates adher-ence of R. conorii to host cells.

DISCUSSION

Adherence and invasion are absolutely critical events in thelife cycle of SFG rickettsiae, and these processes are predictedto be mediated by specific ligand-receptor interactions. Bioin-formatic analysis of sequenced SFG Rickettsia genomes re-vealed a family of sca (surface cell antigen) genes that encodeproteins that are predicted to be exposed to the extracellularenvironment (2, 28). Most of these genes, including sca3 andsca6 to sca16, are not well conserved across the spotted fevergroup, and many residual open reading frames do not encodecomplete proteins. In contrast, sca1, sca0 (ompA), sca2, sca4,and sca5 are nearly universally present in SFG rickettsiae. We

FIG. 3. Sca1-expressing E. coli adheres to mammalian cells. (A) E. coli BL21(DE3)(pSca1-200) cells were induced using distilled water (toprow) or 0.5 mM IPTG (bottom row). These bacteria were incubated with Vero cells, and the preparations were washed to remove nonadherentbacteria. The cells were then permeabilized and stained with the antibodies or fluorophores indicated. The results are typical of three separateexperiments. Scale bars � 100 �m. �E. coli, anti-E. coli. (B, C, and D) In lieu of immunofluorescent staining, E. coli cells harboring pET22b (emptyvector) or pSca1-200 and induced with IPTG were enumerated by plate-based quantification of CFU that adhered to HeLa (B), Vero (C) orEAhy.926 (D) cells. All results are expressed as percentages of adherent bacteria based on the total bacterial input. The data are representativeof the data from at least 3 independent assays for each host cell line. *, P � 0.01.


demonstrated that like other sca genes, sca1 is actively tran-scribed and expressed in R. conorii isolated from infectedmammalian cells. Furthermore, using immunofluorescence mi-croscopy, we demonstrated that Sca1 is localized on the R.conorii cell surface. To our knowledge, this is the first obser-

vation of the presence of Sca1 at the outer membrane of anySFG rickettsial species.

Interestingly, the predicted amino acid sequence of R. cono-rii Sca1 shares high levels of sequence identity and similaritywith Sca1 proteins present in geographically diverse SFG Rick-

FIG. 4. Sca1-expressing E. coli cells do not invade mammalian cells. Sca1-expressing E. coli cells were incubated with the HeLa (A), Vero (B),or EAhy.926 (C) mammalian cell lines, washed with PBS to remove nonadherent bacteria, and then treated with gentamicin to kill extracellularbacteria. The remaining bacteria were enumerated. All experiments were conducted with rOmpB-expressing E. coli(pYC9) as a positive controlfor invasion of mammalian cells. The results are expressed as percentages of the input CFU and are typical of the results of three separateexperiments.

FIG. 5. Incubation with a recombinant GST-Sca1 peptide blocks interaction with mammalian cells. Preincubation of Vero (A and C) orEAhy.926 (B) cells with rGST-Sca1(29-327) but not preincubation with rGST-His blocks association of R. conorii with host cells. After incubationof the peptides with the host cells, R. conorii cells were added to the mixtures, and contact was induced by centrifugation. After incubation, thecells were extensively washed and stained for immunofluorescent analysis with anti-R. conorii and DAPI to visualize the host nuclei (C). Theremaining R. conorii cells were enumerated by immunofluorescence, and the results are expressed as the ratios of R. conorii cells to host cells(nuclei) (A and B). The data are representative of the data from at least three independent experiments. *, P 0.01. Scale bars � 50 mm.


ettsia species. The limited diversity implies that there is a con-served function that is either necessary or advantageous for thebacteria. The N and C termini of Sca1 are particularly wellconserved. While we observed the expected conservation inregions with defined functions (namely, the signal sequenceand �-peptide), the N-terminal portion of the Sca1 passengerpeptide also appears to have limited sequence diversity, sug-gesting that the N-terminal portion of the Sca1 passenger pep-tide has a conserved function. We hypothesize that the Sca1-mediated adherence function is associated with the N terminusof the passenger domain, likely including the region encom-passing amino acids 29 to 327.

Numerous reports have implicated a “zipper-like” mecha-nism in entry of SFG Rickettsia into host cells (20, 21, 25, 32,49). This invasion strategy normally involves many receptor-ligand interactions at the interacting surfaces, followed by in-duction of host intracellular signaling to modulate the localhost cytoskeletal environment and endocytic machinery at thesite of interaction (8). Since Sca1 is able to mediate adherencebut not invasion, this protein is likely to be a participant in theinitial interaction between the bacterium and the host. In fact,Sca1 is likely to be a single component of overall rickettsialadherence because competitive inhibition with Sca1 peptidesdid not eliminate all R. conorii cell association and other rick-ettsial proteins have been demonstrated to be involved in as-sociation with host cells (Fig. 6) (4, 5, 34, 54). Thus, disruptionof any single receptor-ligand interaction is unlikely to com-pletely prevent R. conorii interaction with the host cells. Initialadherence is a vital function and likely aids in the subsequentbacterium-host interactions that result in invasion. Modulationof host signaling has been identified for the rickettsial rOmpB-mediated interaction with host cells (5, 32). However, sinceSca1 expression does not mediate invasion of host cells, thisprotein is unlikely to be responsible for host intracellular sig-

naling. It is possible that Sca1 augments signaling events me-diated by other rickettsial proteins through induced adhesionand an intimate interaction with the host.

Innate immune responses are thought to limit the growthand spread of rickettsiae before establishment of specific anti-Rickettsia antibody responses. Several studies using differentanimal models of infection have identified critical componentsof the host defense response, including natural killer (NK)cells (1), CD8 T lymphocytes (13–15, 22, 59), gamma inter-feron (IFN-�), and tumor necrosis factor alpha (TNF-�) (14,15). Importantly, passively transferred polyclonal antibodies torOmpA or rOmpB protect SCID mice from lethal R. conoriiinfection in the absence of any other adaptive immune re-sponse (17). Also, specific Fc-dependent adherence and inva-sion of opsonized bacteria are not productive, because thebacteria cannot escape from the phagosome (16, 18). It istherefore important to note that an antibody-dependent im-mune response is able to efficiently capture and kill extracel-lular bacteria. Furthermore, antibody-bound bacteria arestrong activators of natural antirickettsial innate immunity.Natural killer (NK) cells are thought to be vital mediators ofearly control of SFG Rickettsia infection (1), and NK cells areacutely responsive to pathogen-bound antibodies through theactions of their many FC receptors (48, 52). It is thereforelikely that circulating Sca antibodies amplify and expedite thenormal innate immune response to SFG Rickettsia, includingNK cell-dependent activation of endothelial cells (15, 16,18, 59).

Our phenotypic observations of Sca1-mediated adherencedo not preclude other functions for Sca1. Currently, we are notable to perform genetic manipulation of the sca1 gene in R.conorii; therefore, our ability to query whether there are otherSca1-mediated functions is partially limited. The surface-ex-posed Sca1 passenger peptide is quite large (�130 kDa), and

FIG. 6. Model for the initial interactions of R. conorii with host cells. SFG Rickettsia species must enter host cells in order to survive. The twoinitial functions that must be performed by the bacteria are adherence to and invasion of the host cells. Adherence is mediated in part by therickettsial proteins Sca1, Sca2, rOmpA, and rOmpB and possibly by other factors, such as other conserved Sca proteins. In contrast, Sca2 andrOmpB have been demonstrated to promote internalization. rOmpB is sufficient to trigger internalization in the absence of other virulence factorsusing pathways involving actin polymerization, clathrin, caveolin, and Ku70. The adherence and invasion processes are therefore mediated by manyrickettsial factors, and disruption of any single receptor-ligand interaction is unlikely to completely abrogate infection by SFG Rickettsia species.Furthermore, since multiple proteins promote the same functions, we cannot eliminate the possibility that larger heteromeric protein complexesare involved in the adherence and invasion processes.


Sca1 appears to be one of the few rickettsial proteins exposedto the environment. Therefore, it is likely that there are otherrickettsial functions that are mediated by Sca1. We predict thatSca1-mediated adherence is a universal function in SFG rick-ettsiae. The current definition of Sca1-mediated adherenceemphasizes the need to identify the interacting Sca1 ligand inorder to expand our targets for disruptive therapies for severeRickettsia infections.

In conclusion, we demonstrated that the Sca1 protein isproduced in R. conorii. When this protein is expressed on thesurface of E. coli cells, it can allow these cells to adhere to hostcells, and the presence of a recombinant Sca1 peptide candisrupt association of R. conorii with mammalian host cells.This work identified an attractive target for development ofpreventive therapies or treatments for severe infections withspotted fever group Rickettsia species.

ACKNOWLEDGMENTS

We thank Vytas Bindokas, Robert Hillman, Emily Chen, JustinKern, and Olaf Schneewind for technical assistance and helpful sug-gestions.

This work was supported in part by NIH award RO1-AI072606-01 toJ.J.M. and by a Biological Sciences Collegiate Division (BSCD) sum-mer research fellowship to K.C.G. This work was also sponsored by theNIH/NIAID Regional Center of Excellence for Bio-defense andEmerging Infectious Diseases Research (RCE) Program. We acknowl-edge membership in and support provided by the Region V “GreatLakes” RCE (NIH award 2-U54-AI-057153).

REFERENCES

1. Billings, A. N., H. M. Feng, J. P. Olano, and D. H. Walker. 2001. Rickettsialinfection in murine models activates an early anti-rickettsial effect mediatedby NK cells and associated with production of gamma interferon. Am. J.Trop. Med. Hyg. 65:52–56.

2. Blanc, G., M. Ngwamidiba, H. Ogata, P. E. Fournier, J. M. Claverie, and D.Raoult. 2005. Molecular evolution of rickettsia surface antigens: evidence ofpositive selection. Mol. Biol. Evol. 22:2073–2083.

3. Braun, L., H. Ohayon, and P. Cossart. 1998. The InIB protein of Listeriamonocytogenes is sufficient to promote entry into mammalian cells. Mol.Microbiol. 27:1077–1087.

4. Cardwell, M. M., and J. J. Martinez. 2009. The Sca2 autotransporter proteinfrom Rickettsia conorii is sufficient to mediate adherence to and invasion ofcultured mammalian cells. Infect. Immun. 77:5272–5280.

5. Chan, Y. G., M. M. Cardwell, T. M. Hermanas, T. Uchiyama, and J. J.Martinez. 2009. Rickettsial outer-membrane protein B (rOmpB) mediatesbacterial invasion through Ku70 in an actin, c-Cbl, clathrin and caveolin2-dependent manner. Cell. Microbiol. 11:629–644.

6. Chapman, A. S., J. S. Bakken, S. M. Folk, C. D. Paddock, K. C. Bloch, A.Krusell, D. J. Sexton, S. C. Buckingham, G. S. Marshall, G. A. Storch, G. A.Dasch, J. H. McQuiston, D. L. Swerdlow, S. J. Dumler, W. L. Nicholson,D. H. Walker, M. E. Eremeeva, and C. A. Ohl. 2006. Diagnosis and man-agement of tickborne rickettsial diseases: Rocky Mountain spotted fever,ehrlichioses, and anaplasmosis—United States: a practical guide for physi-cians and other health-care and public health professionals. MMWR Rec-ommend. Rep. 55:1–27.

7. Cohn, Z. A., F. M. Bozeman, J. M. Campbell, J. W. Humphries, and T. K.Sawyer. 1959. Study on growth of Rickettsia. V. Penetration of Rickettsiatsutsugamushi into mammalian cells in vitro. J. Exp. Med. 109:271–292.

8. Cossart, P. 2004. Bacterial invasion: a new strategy to dominate cytoskeletonplasticity. Dev. Cell 6:314–315.

9. Dalton, M. J., M. J. Clarke, R. C. Holman, J. W. Krebs, D. B. Fishbein, J. G.Olson, and J. E. Childs. 1995. National surveillance for Rocky Mountainspotted fever, 1981-1992: epidemiologic summary and evaluation of riskfactors for fatal outcome. Am. J. Trop. Med. Hyg. 52:405–413.

10. Davidson, M. G., E. B. Breitschwerdt, D. H. Walker, M. G. Levy, C. S.Carlson, E. M. Hardie, C. A. Grindem, and M. P. Nasisse. 1990. Vascularpermeability and coagulation during Rickettsia rickettsii infection in dogs.Am. J. Vet. Res. 51:165–170.

11. de Sousa, R., S. D. Nobrega, F. Bacellar, and J. Torgal. 2003. Mediterraneanspotted fever in Portugal: risk factors for fatal outcome in 105 hospitalizedpatients. Ann. N. Y. Acad. Sci. 990:285–294.

12. Diaz-Montero, C. M., H. M. Feng, P. A. Crocquet-Valdes, and D. H. Walker.2001. Identification of protective components of two major outer membrane

proteins of spotted fever group Rickettsiae. Am. J. Trop. Med. Hyg. 65:371–378.

13. Feng, H., V. L. Popov, G. Yuoh, and D. H. Walker. 1997. Role of T lympho-cyte subsets in immunity to spotted fever group Rickettsiae. J. Immunol.158:5314–5320.

14. Feng, H. M., V. L. Popov, and D. H. Walker. 1994. Depletion of gammainterferon and tumor necrosis factor alpha in mice with Rickettsia conorii-infected endothelium: impairment of rickettsicidal nitric oxide productionresulting in fatal, overwhelming rickettsial disease. Infect. Immun. 62:1952–1960.

15. Feng, H. M., and D. H. Walker. 1993. Interferon-gamma and tumor necrosisfactor-alpha exert their antirickettsial effect via induction of synthesis ofnitric oxide. Am. J. Pathol. 143:1016–1023.

16. Feng, H. M., and D. H. Walker. 2000. Mechanisms of intracellular killing ofRickettsia conorii in infected human endothelial cells, hepatocytes, andmacrophages. Infect. Immun. 68:6729–6736.

17. Feng, H. M., T. Whitworth, J. P. Olano, V. L. Popov, and D. H. Walker. 2004.Fc-dependent polyclonal antibodies and antibodies to outer membrane pro-teins A and B, but not to lipopolysaccharide, protect SCID mice against fatalRickettsia conorii infection. Infect. Immun. 72:2222–2228.

18. Feng, H. M., T. Whitworth, V. Popov, and D. H. Walker. 2004. Effect ofantibody on the rickettsia-host cell interaction. Infect. Immun. 72:3524–3530.

19. Gaillard, J. L., P. Berche, C. Frehel, E. Gouin, and P. Cossart. 1991. Entryof L. monocytogenes into cells is mediated by internalin, a repeat proteinreminiscent of surface antigens from gram-positive cocci. Cell 65:1127–1141.

20. Gouin, E., C. Egile, P. Dehoux, V. Villiers, J. Adams, F. Gertler, R. Li, andP. Cossart. 2004. The RickA protein of Rickettsia conorii activates theArp2/3 complex. Nature 427:457–461.

21. Gouin, E., H. Gantelet, C. Egile, I. Lasa, H. Ohayon, V. Villiers, P. Gounon,P. J. Sansonetti, and P. Cossart. 1999. A comparative study of the actin-based motilities of the pathogenic bacteria Listeria monocytogenes, Shigellaflexneri and Rickettsia conorii. J. Cell Sci. 112:1697–1708.

22. Hackstadt, T. 1996. The biology of rickettsiae. Infect. Agents Dis. 5:127–143.23. Hattwick, M. A., R. J. O’Brien, and B. F. Hanson. 1976. Rocky Mountain

spotted fever: epidemiology of an increasing problem. Ann. Intern. Med.84:732–739.

24. Hattwick, M. A., H. Retailliau, R. J. O’Brien, M. Slutzker, R. E. Fontaine,and B. Hanson. 1978. Fatal Rocky Mountain spotted fever. JAMA 240:1499–1503.

25. Heinzen, R. A. 2003. Rickettsial actin-based motility: behavior and involve-ment of cytoskeletal regulators. Ann. N. Y. Acad. Sci. 990:535–547.

26. Helmick, C. G., K. W. Bernard, and L. J. D’Angelo. 1984. Rocky Mountainspotted fever: clinical, laboratory, and epidemiological features of 262 cases.J. Infect. Dis. 150:480–488.

27. Henderson, I. R., and A. C. Lam. 2001. Polymorphic proteins of Chlamydiaspp.—autotransporters beyond the Proteobacteria. Trends Microbiol. 9:573–578.

28. Jacob-Dubuisson, F., R. Fernandez, and L. Coutte. 2004. Protein secretionthrough autotransporter and two-partner pathways. Biochim. Biophys. Acta1694:235–257.

29. Li, H., and D. H. Walker. 1992. Characterization of rickettsial attachment tohost cells by flow cytometry. Infect. Immun. 60:2030–2035.

30. Li, H., and D. H. Walker. 1998. rOmpA is a critical protein for the adhesionof Rickettsia rickettsii to host cells. Microb. Pathog. 24:289–298.

31. Li, Z., C. M. Diaz-Montero, G. Valbuena, X. J. Yu, J. P. Olano, H. M. Feng,and D. H. Walker. 2003. Identification of CD8 T-lymphocyte epitopes inOmpB of Rickettsia conorii. Infect. Immun. 71:3920–3926.

32. Martinez, J. J., and P. Cossart. 2004. Early signaling events involved in theentry of Rickettsia conorii into mammalian cells. J. Cell Sci. 117:5097–5106.

33. Martinez, J. J., M. A. Mulvey, J. D. Schilling, J. S. Pinkner, and S. J.Hultgren. 2000. Type 1 pilus-mediated bacterial invasion of bladder epithe-lial cells. EMBO J. 19:2803–2812.

34. Martinez, J. J., S. Seveau, E. Veiga, S. Matsuyama, and P. Cossart. 2005.Ku70, a component of DNA-dependent protein kinase, is a mammalianreceptor for Rickettsia conorii. Cell 123:1013–1023.

35. Masters, E. J., G. S. Olson, S. J. Weiner, and C. D. Paddock. 2003. RockyMountain spotted fever: a clinician’s dilemma. Arch. Intern. Med. 163:769–774.

36. Moe, J. B., D. F. Mosher, R. H. Kenyon, J. D. White, J. L. Stookey, L. R.Bagley, and D. P. Fine. 1976. Functional and morphologic changes duringexperimental Rocky Mountain spotted fever in guinea pigs. Lab. Invest.35:235–245.

37. Ngwamidiba, M., G. Blanc, H. Ogata, D. Raoult, and P. E. Fournier. 2005.Phylogenetic study of Rickettsia species using sequences of the autotrans-porter protein-encoding gene sca2. Ann. N. Y. Acad. Sci. 1063:94–99.

38. Ngwamidiba, M., G. Blanc, D. Raoult, and P. E. Fournier. 2006. Sca1, apreviously undescribed paralog from autotransporter protein-encodinggenes in Rickettsia species. BMC Microbiol. 6:12.

39. O’Reilly, M., C. Paddock, B. Elchos, J. Goddard, J. Childs, and M. Currie.2003. Physician knowledge of the diagnosis and management of RockyMountain spotted fever: Mississippi, 2002. Ann. N. Y. Acad. Sci. 990:295–301.


40. Oster, C. N., D. S. Burke, R. H. Kenyon, M. S. Ascher, P. Harber, and C. E.Pedersen, Jr. 1977. Laboratory-acquired Rocky Mountain spotted fever. Thehazard of aerosol transmission. N. Engl. J. Med. 297:859–863.

41. Ramm, L. E., and H. H. Winkler. 1976. Identification of cholesterol in thereceptor site for rickettsiae on sheep erythrocyte membranes. Infect. Immun.13:120–126.

42. Ramm, L. E., and H. H. Winkler. 1973. Rickettsial hemolysis: effect ofmetabolic inhibitors upon hemolysis and adsorption. Infect. Immun. 7:550–555.

43. Reed, L. J., and H. Muench. 1938. A simple method of estimating fiftypercent endpoints. Am. J. Hyg. 27:493–497.

44. Renesto, P., P. Dehoux, E. Gouin, L. Touqui, P. Cossart, and D. Raoult.2003. Identification and characterization of a phospholipase D-superfamilygene in rickettsiae. J. Infect. Dis. 188:1276–1283.

45. Roux, V., and D. Raoult. 2000. Phylogenetic analysis of members of thegenus Rickettsia using the gene encoding the outer-membrane proteinrOmpB (ompB). Int. J. Syst. Evol. Microbiol. 50 Pt. 4:1449–1455.

46. Silverman, D. J., and S. B. Bond. 1984. Infection of human vascular endo-thelial cells by Rickettsia rickettsii. J. Infect. Dis. 149:201–206.

47. Silverman, D. J., C. L. Wisseman, Jr., and A. Waddell. 1980. In vitro studiesof Rickettsia-host cell interactions: ultrastructural study of Rickettsiaprowazekii-infected chicken embryo fibroblasts. Infect. Immun. 29:778–790.

48. Sulica, A., P. Morel, D. Metes, and R. B. Herberman. 2001. Ig-bindingreceptors on human NK cells as effector and regulatory surface molecules.Int. Rev. Immunol. 20:371–414.

49. Teysseire, N., J. A. Boudier, and D. Raoult. 1995. Rickettsia conorii entryinto Vero cells. Infect. Immun. 63:366–374.

50. Teysseire, N., C. Chiche-Portiche, and D. Raoult. 1992. Intracellular move-ments of Rickettsia conorii and R. typhi based on actin polymerization. Res.Microbiol. 143:821–829.

51. Thanassi, D. G., E. T. Saulino, M. J. Lombardo, R. Roth, J. Heuser, and S. J.Hultgren. 1998. The PapC usher forms an oligomeric channel: implicationsfor pilus biogenesis across the outer membrane. Proc. Natl. Acad. Sci.U. S. A. 95:3146–3151.

52. Trinchieri, G., and N. Valiante. 1993. Receptors for the Fc fragment of IgGon natural killer cells. Nat. Immun. 12:218–234.

53. Turco, J., and H. H. Winkler. 1982. Differentiation between virulent andavirulent strains of Rickettsia prowazekii by macrophage-like cell lines. In-fect. Immun. 35:783–791.

54. Uchiyama, T., H. Kawano, and Y. Kusuhara. 2006. The major outer mem-brane protein rOmpB of spotted fever group rickettsiae functions in therickettsial adherence to and invasion of Vero cells. Microbes Infect. 8:801–809.

55. Walker, D. H., B. G. Cain, and P. M. Olmstead. 1978. Laboratory diagnosisof Rocky Mountain spotted fever by immunofluorescent demonstration ofRickettsia in cutaneous lesions. Am. J. Clin. Pathol. 69:619–623.

56. Walker, D. H., H. M. Feng, and V. L. Popov. 2001. Rickettsial phospholipaseA2 as a pathogenic mechanism in a model of cell injury by typhus andspotted fever group rickettsiae. Am. J. Trop. Med. Hyg. 65:936–942.

57. Walker, D. H., W. T. Firth, and B. C. Hegarty. 1984. Injury restricted to cellsinfected with spotted fever group rickettsiae in parabiotic chambers. ActaTrop. 41:307–312.

58. Walker, D. H., C. Occhino, G. R. Tringali, S. Di Rosa, and S. Mansueto.1988. Pathogenesis of rickettsial eschars: the tache noire of boutonneusefever. Hum. Pathol. 19:1449–1454.

59. Walker, D. H., J. P. Olano, and H. M. Feng. 2001. Critical role of cytotoxicT lymphocytes in immune clearance of rickettsial infection. Infect. Immun.69:1841–1846.

60. Walker, D. H., G. A. Valbuena, and J. P. Olano. 2003. Pathogenic mecha-nisms of diseases caused by Rickettsia. Ann. N. Y. Acad. Sci. 990:1–11.

61. Walker, T. S., and H. H. Winkler. 1978. Penetration of cultured mousefibroblasts (L cells) by Rickettsia prowazeki. Infect. Immun. 22:200–208.

62. Wang, W., and B. A. Malcolm. 1999. Two-stage PCR protocol allowing intro-duction of multiple mutations, deletions and insertions using QuikChange site-directed mutagenesis. Biotechniques 26:680–682.

63. Winkler, H. H. 1974. Inhibitory and restorative effects of adenine nucleotideson rickettsial adsorption and hemolysis. Infect. Immun. 9:119–126.

64. Winkler, H. H. 1977. Rickettsial hemolysis: adsorption, desorption, read-sorption, and hemagglutination. Infect. Immun. 17:607–612.

65. Winkler, H. H., and E. T. Miller. 1980. Phospholipase A activity in thehemolysis of sheep and human erythrocytes by Rickettsia prowazeki. Infect.Immun. 29:316–321.

66. Winkler, H. H., and L. E. Ramm. 1975. Adsorption of typhus rickettsiae toghosts of sheep erythrocytes. Infect. Immun. 11:1244–1251.

67. Wisseman, C. L., Jr., E. A. Edlinger, A. D. Waddell, and M. R. Jones. 1976.Infection cycle of Rickettsia rickettsii in chicken embryo and L-929 cells inculture. Infect. Immun. 14:1052–1064.

Editor: R. P. Morrison


Documents

Rickettsia conorii Autotransporter Protein Sca1 Promotes ...The pathogenesis of spotted fever group (SFG) Rickettsia species, including R. conorii and R. rickettsii, is acutely dependent