RFLP analysis of HLA-DR5 haplotypes

RFLP analysis of HLA-DR5 E. Reed, P. McManus, N. Suciu-Foca. RFLP analysis of HLA-DR5 haplotypes. Tissue Antigens 1991: 37: 66-73.

Abstract: The analysis of HLA-DR5 haplotypes unravelled a new DRB3 polymorphism and permitted the identification of various associations between alleles of the DRBl and DRB3 loci. This new polymorphism consists of a 10.5 kb Taql restriction fragment which was encountered in an African-American family (JS). In Caucasoids, the DRwl 1 allele has been previously observed only in association with the DRw52b allele. RFLP and oligonucleotide typing of HLA-DRw52 alleles associated with DRwl 1 showed, however, that 4 Caucasoid individuals from our panel carried the DRw52a allele and 1 the DRw52c allele. Similarly, DRwl2, which is usually associated with DRw52b, was encounterd with DRw52a in 1 Chinese and with DRw52c in an African-American and a Chinese panel member. The study of DRB3 alleles associated with DRwl 1 and DRw 12 indicates that, similar to serology, RFLP studies become partic- ularly informative when individuals of different races and ethnic origins

I are studied.

Introduction

The HLA class I1 antigens are polymorphic trans- membrane glycoproteins composed of non-cova- lently associated alpha and beta chains. These antigens determine the ability of an individual to respond immunologically to foreign antigens and are therefore referred to as immune-response genes (1). Class I1 antigens also play an important role in alloreactivity and in the predisposition to certain diseases (2).

The HLA class I1 region is divided into three subregions called DP, DQ and DR. Each of these subregions contains at least 1 alpha chain gene and 2 beta chain genes (3). With the exception of the DR alpha chain, all of the expressed alpha and beta polypeptides exhibit allelic polymorphism. The DRBl gene encodes the HLA-DRI-HLA- DRw 18 determinants. In most haplotypes, DRB2 appears to be a pseudogene (4). The DRB3 gene encodes the DRw52 alleles which are expressed in

and DRwl8 haplotypes (5). Although the HLA- DRw8 haplotype is associated with the DRw52 specificity, only 1 DRBl gene has been found to be expressed on this haplotype (6). The DRB4 gene encodes the DRw53 supertypic specificity which is in linkage disequilibrium with DR4, DR7 and DR9 haplotypes. The DRBS gene encodes four recently identified alleles found in association with DRwl5 and DRw 16 antigens. Genomic analysis shows that the DRBS gene maps in a position similar to the DRB3 gene found on other haplotypes (7).

HLA-DRwll, DRwl2, DRwl3, DRwl4, DRwl7

haplotypes Elaine Reed, Peter McManus and Nicole Suciu-Foca Department of Pathology, College of Physicians and Surgeons of Columbia University, New York, New York, U.S.A.

Key words: DRB3 - HLA-DR5 haplotypes - HLA- DR polymorphism

Received 30 September, revised, accepted for publication 20 November 1990

The HLA-DRB3 gene exhibits limited polymorphism with four currently recognized allelic variants, DRB3*0101 (DRw52a), DRB3*0201 (DRw52b), DRB3*0202 (DRw52b) and DRB3*0301 (DRw52c) (8-10). We presently report on the RFLP pattern of HLA-DR5 haplotypes encountered in the New York City population. This study describes different associations of DRBl with DRB3 alleles on DRwll and DRwl2 haplotypes. A new variant of DRB3 detected by RFLP in an African-American was explored by DNA sequencing and family studies.

Material and methods Serology

HLA-A, B, C, and HLA-DR, HLA-DQ typing was performed on purified T-lymphocyte and B- lymphocyte suspensions, respectively, using the complement-dependent microlymphocytotoxicity assay as previously described (11). The typing reagents used in this study were obtained from our own collection and from One Lambda, Inc. (Los Angeles, CA).

Study population

The study population consisted of 36 DRwl1- and 7 DRw 12-positive individuals who were selected by serology testing of 200 healthy blood donors who are members of our HLA reference panel. Of these 43 HLA-DR5-positive individuals, 32 are Caucasoid, 9 are African-Americans and 2 are Chi-

66

HLA-DR5 haplotypes

amplify the first domain of DRB. The primers used in these studies were: DRBAmpl (5’CCGGATCCTCGTGTCCCCACAGCAGC3’) and DRBAmp2 (S’TTCGCCTGCGCACTGT- GAAGCTCT3’). Reaction mixtures were subjected to 30 cycles of amplification at 95°C (1 min), 55°C (1 min) and 72°C (2 min).

nese. The segregation of HLA-DRwll was followed in one African-American family. Also included in the study were HLA-DRwl 1 and HLA- DRwl2 HTCs provided by the 10th International Histocompatibility Workshop: 10~9035, 9036, 9037,9038, 9040,9041,9042,9043 and 9044.

Southern blotting

Southern blotting was performed using the pro- cedure described by the 10th International Histo- compatibility Workshop (12). Briefly, leukocyte pellets (5 x 10’) were lysed in 10 mM Tris, 10 mM EDTA, pH 8.0, NaCl 50 mM, sodium dodecyl sulfate (SDS) 0.2% and Proteinase K 200 pg/ml (Bethesda Research Laboratories, MD) and incu- bated overnight at 42°C in a rotary shaker. The DNA was extracted using chloroform and phenol. DNA (7 pg) was digested with the Taql restriction endonuclease in the appropriate buffers as directed by the manufacturer (Bethesda Research Labora- tories, MD). Digested DNA (7pg) was electropho- resed in 0.9% agarose gels in Tris-acetate-EDTA buffer. Lambda phage DNA fragments of known size were included in the gels as size markers. The gels were depurinated and the DNA transferred to Biotrace membranes (Gelman Sciences Inc., Ann Arbor, MI). The membranes were prehybridized in 1% SDS, 5X SSC, salmon sperm DNA (0.2 mg/ ml) and 5X Denhardt’s solution for 4 h at 65°C. The membranes were then hybridized in the same solution at 65°C for 24 h with lo7 cpm radiolabeled DRB, DQA and DQB cDNA probes (13-15). Hy- bridized filters were washed twice at room temperature with 2X SSC, 1.0% SDS and twice at 65°C with 0.1X SSC, 1.0% SDS. Membranes were then examined by autoradiography. The cDNA probes were labeled with (al~ha-~*P) dCTP using the multi- primer labeling method (16).

Haplotypes carried by the 36 DRwl1- and 7 DRw 12-positive individuals were inferred from a) family segregation studies and b) comparison of band patterns in heterozygous individuals with patterns of migration of RFLP fragments in HLA- DR and DQ homozygous typing cells of known specificities. These HTCs were provided and characterized by the 10th International Histocompat- ibility Workshop.

Amplification of genomic DNA

Genomic DNA was amplified by the polymerase chain reaction (PCR) according to standard methods (17). Briefly, 0.5 pg of genomic DNA was amplified for 30 cycles using Taq polymerase (Perkin Elmer-Cetus, Norwalk, CT). Oligo- nucleotide primers were designed to specifically

Dot blot and oligonucleotide hybridization

Amplified DNA was denatured with 0.4 N NaOH, 25 mM EDTA and spotted on nylon membranes (Schleicher and Schuell, Keene, NH) at 30 ng per spot. Membranes were baked for 2 h at 80°C and hybridized at 42°C in 6X SSC, 5X Denhardt’s solution, 0.5% SDS and 100 pg/ml salmon sperm DNA. After 1 h, 5 pmoles of 32P-labeled probe was added to 4 ml of the solution and hybridization was continued for 2 h at 42°C. The membranes were washed twice at room temperature with 2X SSC, 0.1 % SDS for 10 min and twice with 6X SSC, 1% SDS for 10 min at a temperature varying for each probe. The sequence and specificity of the oligonucleotide probes and the wash temperatures used are listed below.

OligonucIeo- Nucieotide Sequence Specificity Wash tide Probe Temperature 17003 GGTGGACAAT- DRw52 62°C

1010 GGAGCTGCGT- DRw52a 52°C TACTGCAG

AAGTCTG

GAGTACGCG

CGTGCGC

13703 TAACCAGGAG- DRw52b 58°C

3704 AGGAGGAGTT- DRw52c 54°C

Cloning and sequencing of amplified DNA

Amplified DNA was phosphorylated with T4 poly- nucleotide kinase and agarose gel-purified. The fragment was then blunt ligated with pBluescript SK plasmid (Stratagene, LaJolla, CA) which was cut with EcoRV and dephosphorylated. The lig- ation mixture was transformed into E. coli strains XL1-Blue. The colonies were screened with the oligonucleotide probe #17003 which has the sequence (GGTGGACAATTACTGCAG) and which is specific for codons 74-80 of the DRB3 gene. The colonies hybridizing to the oligonucleotide probe #17003, were picked up and sequenced. Sequencing was performed by the dideoxy chain termination method of Sanger (18) using the Sequenase Kit I1 (United States Biochemical Corp., Cleveland, OH). Five independent clones were sequenced. Sequence errors introduced by PCR amplification were not encountered.

67

Reed et al.

PLT and HTC typing studies

For PLT studies, responding PBL (1 x 106/ml) were primed in 10-d MLC with irradiated stimulating cells (1 x 106/ml) as previously described (19-22). At the end of the incubation, primary cultures were washed, counted, plated in 96-well V-bottom trays (2.5 x lo4 cells/well), restimulated for 48 h with irradiated stimulating cells (5 x 104/well) and then labeled and counted. Mean cpm in triplicate reac- tions were subjected to the Linear Cluster Analysis program (1 9-22), which allocates blastogenic responses into positive (cluster 2), intermediary (cluster l), and negative (cluster 0). The method in- volves the selection of a partition level for an ord- ered array of values, such that the resulting clusters have minimal “within-cluster” variances (1 9). HTC typing was performed as previously described (20). Cryopreserved responding and stimulating peripheral blood lymphocytes were used at 5 x lo4 cells/well. HLA-D differences were quantitated as described previously (22).

Results Taql DRB RFLP patterns

Southern blot hybridization was used to character- ize the restriction fragments associated with DR5 haplotypes. Table 1 summarizes the Taql RFLP patterns obtained by hybridizing DNA from 36 DRwll and 7 DRwl2 heterozygous cells with the DRB, DQA and DQB cDNA probes. All of the 36 individuals carrying DRwll showed the charcteristic 6.1 kb fragment which has been previously described (23-24), and which is also present

in the DRwl 1 workshop HTCs tested. Also present in subjects carrying DRwl 1 were the 4.2 kb or 4.1 kb fragments previously assigned to the DRB2 pseudogene (25, 26).

Thirty-four of the 36 DRw 1 1 -positive individuals carried DQw7 and 2 showed DQw6 by RFLP typing with DQA and DQB cDNA probes. As expected, the DRwll,DQw7 and the DRw 1 1 ,DQw6 haplotypes were found to be associated with the 4.7 kb and 6.5 kb DQA Taql restriction fragments, respectively. Hybridization with the DQB probe showed the characteristic 4.5 kb fragment for DQw7 and the 2.8 kb fragment for DQw6 haplotypes.

The 34 DRwll,DQw7 haplotypes were of two types, One type occurred in 29 individuals and was characterized by an 11.5 kb fragment known to define the DRB3, DRw52b allele (23, 24, 27). The second type was found in 5 individuals (4 Caucaso- ids and 1 African-American) and consisted of a 9.8 kb fragment which is characteristic of the DRB3, DRw52a and DRw52c alleles (23, 24, 27). This latter association has been previously found in South African and Pacific populations (26,28) but as yet, to our knowledge, not in Caucasoids.

Two individuals carried the less common DRwll,DQw6 haplotype. One of them, a Cauca- soid, showed a 9.8 kb fragment characteristic for HLA-DRw52a and -DRw52c. This association is less frequent in Caucasoids, who usually show DRw52b (1 1.5 kb fragment) associated with HLA- DRw 1 1 ,DQw6. The second DRw 1 1 ,DQw6-positive individual is an African-American (JS) who shows a unique 10.5 kb Taql restriction fragment.

Seven individuals from our HLA-DR5 panel

Table 1. DRB Taq 1 restriction fragments associated with HLA-DR5 haplotypes

HLA Haplotype Number Ethnic DRB RFLPs (kb) DQA RFLPs (kb) WB RFLPs (kb) DRw DQw tested Group 11.5 10.5 9.8 6.1 4.3 4.2 4.1 6.5 4.7 2.7 5.3 4.5 2.8

JS (52b) (New) (52 a/c) ( w l l ) (w12) ( ~ 1 2 ) (w6) (“7) (w5) (w5) (w7) (WE)

11 7 15 Caucasoid +‘ - b - + - + - - + - - + - - + - - + - + - - + - 11 7 2 African + -

11 7 2 Caucasoid - - + + - + - - + - - + - - + + - - + - + - - + - 11 7 2 Caucasoid -

1 African + 1 Caucasoid - - + + - + - + - + 11 6 11 6 1 African - + - + - - + + - 12 7 3 Caucasoid + - - - + - + - + - - + -

1 Chinese - - + - + - + - + - - + - 1 Chinese - - + - + - + + - - - + - 12 7

12 7 1 African - - + - + - + - - + + -

12 5 1 Caucasoid + - - - + - + - - + + - 12 5

12 Caucasoid

- - - - - -

- -

+ indicates the presence of a restriction fragment. - indidtes the absence of the respective restriction fragment.

68

HLA-DR5 haplotypes

carry the HLA-DRwl2 allele. HLA-DQ typing by RFLP showed that 5 were DRwl2,DQw7 and 2 were DRwl2,DQwS. Four out of the 5 DRw 12,DQw7 haplotypes were associated with a 4.7 kb DQA and 4.5 kb DQB Taql fragments. One Chinese carrying the DRw 12,DQw7 haplotype showed a 6.5 kb Taql/DQA restriction fragment. Two individuals carrying the DRwl2,DQwS haplotype showed the characteristic 2.7 kb DQA and 5.3 kb DQB Taql restriction fragments. The 4.3 kb and 4.1 kb fragments which are characteristic of HLA-DRw12 were found in all 7 individuals. Out of the 5 HLA-DRwl2,DQw7 individuals, 3 exhibited the 11.5 kb fragment characteristic of HLA-DRw52b and 2 showed the 9.8 kb fragment associated with DRw52a and DRW52c. Two individuals showed the HLA-DRwl2,DQwS haplotype. One of them exhibits the 9.8 kb fragment indicative of DRw52a or DRw52c, and the other the 11.5 kb fragment defining DRw52b.

Segregation analysis of the "new" DRB3 polymorphism

In 1 individual carrying DRwll,DQw6 we found a 10.5 kb Taql restriction fragment which ap- peared to be a new polymorphism. The segregation of the 10.5 kb fragment was followed in this individual's family using Taql DNA digests and prob- ing them with the DRB cDNA probe. The mother (1.2) and 2 of the children (11.1 and 11.4, who is JS) showed the 10.5 kb fragment segregating with the HLA-Aw68,Cw6,Bw58,DRwll ,DQw6 haplotype (d). The father was not available, yet seems to have carried a 10.5 kb fragment on the Aw36,Cw4,Bw52,DRwll ,DQw6 haplotype (a) in- herited by one of his children (11.2) (Fig. 1, Table 2). Fig. 2 shows the comparison of the 10.5 kb fragment found in JS (Lane 2) to the 11.5 kb fragment (Lane 1) and 9.8 kb fragment (Lanes 3 and

Table 2. HLA genotype of family JS

cell

1.2 C A29 Cw7 B49 DRw8 - W w 4 ~ ~~

D Aw68 Cw6 Bw58 DRwl1 DRw52 W w 6

11.1 B A2 CX Bw63 DRwl5 - W w 6

D Aw68 Cw6 Bw58 DRwl1 DRw52 DQw6

11.2 A Aw36 Cw4 Bw52 DRwl l DRw52 W w 6

C A29 Cw7 B49 DRw8 - m4 11.3 B A2 CX Bw63 DRwl5 - W w 6 .

C A29 Cw6 B49 DRw8 - DChnr4

11.4 B A2 CX Bw63 DRwl5 - DQw6

(JS) D Aw68 Cw6 Bw58 DRwl l DRw52 W w 6

Figure 1. HLA-DRB hybridization of Taql digested genomic DNA showing segregation of the new DRw52 RFLP patteren in an African-American family (Lane 1: mother; Lanes 2, 3, 4 and 5: children).

4) associated with the DRw52b and DRW52a/c specificities, respectively.

Oligonucleotide typing of DRw52 alleles

The 9.8 kb Taql restriction fragment associated with the DRw52a and DRw52c alleles was found in 6 DRwl 1 and 3 DRwl2 individuals. To distinguish between the DRw52a and DRw52c alleles we performed oligonucleotide typing. For this, the 290 bp region corresponding to the first domain of DRB was amplified by the PCR method and hybridized with oligonucleotide probes specific for DRw52a, DRw52b and DRw52c alleles. As shown in Table 3, the DRw52a allele was present in 4 DRwl l,DQw7 Caucasoids and 1 DRwl2,DQw7 Chinese. The DRw52c allele was found in an African and a Caucasoid with the DRwll,DQw7 and DRw 11,DQw6 haplotypes, respectively. The DRw52c allele was also present in a Chinese with the DRwl2,DQW7 haplotype and in an African with the DRwl2,DQwS haplotype.

69

Reed et al.

variant had the same sequence as the DRB3*0202 gene (DRw52b) described by Didier et al. (29).

Figure 2. HLA-DRB hybridization of Taql digested genomic DNA from cells carrying the HLA-DRw52b, DRw52x, DRw52a and DRw52c alleles. The HLA-DRBl/DRB3 genotypes of the cells are: Lane 1, DRwl6/DRwl1, DRw52b; Lane 2 (JS) DRwlS/DRwll, DRw52x; Lane 3, DRwl5/DRwl3, DRw52a; Lane 4, DR7/DRw12, DRw52c.

Sequencing of the first domain of the DRw52 variant

To determine whether the novel 10.5 kb fragment observed in family JS is associated with a polymorphism in a coding region of the DRB3 gene, the first domain of this gene was cloned and sequenced. When the sequence was compared to that of other DRw52 genes, we found that this new DRw52

Table 3. Oligonucleotide typing of HLA-DRw52 alleles

HLA Haplotype No. of Ethnic DRw52 Subtypes DRw WW Individuals Group 52a 52c

11 7 4 Caucasoid + 11 7 1 African + 11 6 1 Caucasoid + 12 7 1 Chinese + 12 7 1 Chinese + 12 5 1 African +

PLT and HE typing studies

Although the nucleotide sequence of the first domain of the DRB3 gene found in JS is identical to the sequence of DRw52b, it is not excluded that JS, who shows a distinct RFLP (10.5 kb), carries a DRw52 allele which differs from DRw52b in its second domain. Such differences may result in distinct T-cell epitopes. We have examined the possibility that the DRw52 allele carried by JS is identical to DRw52b by performing PLT studies. To generate PLT reagents, we primed PBL from a sibling, individual 11.3 (Table 2), against irradiated PBL from JS (11.4). PBL from an unrelated member of our panel, ER, whose genotype is HLA- DRw15,HLA-DR4 were also primed against JS. Anti-DRw52b PLTs were generated by priming individual 11.3 and ER to the 10th Workshop HTC #9040 which is homozygous for HLA-DRwl 1 and DRw52b. The priming combinations are shown in Table 4.

All four PLTs were restimulated in the same experiment with cells carrying one of the following specificities: DRw52a, DRw52b, DRw52c or DRw52x represented by JS and his family. The DRw52b-positive cells were either DRwl 1 , DRw52b or DRwl4,DRw52b. The DRw52a-positive cell was DRwl4,DRw52a homozygous and the DRw52c-positive cell was DRw 13,DRw52c homozygous. The results in Table 5 show that the PLTs primed to DRw52b were restimulated in secondary cultures by DRw52b- as well as by DRw52x-positive cells. Similarly, the PLTs primed to DRw52x were restimulated both by DRw52b and DRw52x. The anti-DRw52b and anti-DRw52x PLTs showed no secondary reactivity to DRw52a and DRw52c, indicating that they were specific for DRwl 17DRw52b and DRwl 1,DRw52x7 respec-

Table 4. Priming combinations for PLT reagents

Responding HIA DWW Stimulating HIA DRlDR Cells Genotype cells Genotype

~ ~~

11.3 DRwl5, w W 6 11.4 DRwl5, DQw6 DRw8, wW4 (JS) DRwll, DRw52x, w W 6

11.3 DRwl5, w W 6 1 0 ~ 9 0 4 0 DRwll, DRw52b. DQw7 DRw8, wW4 DRwl1, DRw52b, w W 7

ER DRwl5, w W 6 11.4 DRwl5, DQw6 DR4, W w 8 (JS) DRwl1, DRw52x, Ww6

ER DRwl5, W w 6 1 0 ~ 9 0 4 0 DRwll, DRw52b, wW7 DR4, DQw8 DRwll, DRw52b, wW7

HLA-DR5 haplotypes

Table 5. PLT responses elicited by variants of DRB3

HLA-DRB1 IDR3 Genotypes of Stimulating Cells

DRw15 DRwl5 - DRw8 DRwl5 - DRwl5 DRwl 1 ,w52b DRwl4,w52b DRwl4,w52a DRwl3,w52c

DRw8 DRwl 1 ,w52x DRwl I ,w52x DRwl 1 ,w52x DR4 DRwl I ,w52b DRwl4,~52b DRw14,w52a DRwl3,~52C - -

JS Family PLTs 11.3 11.1 11.2 11.4 ER low9040 low9061 low9057 low9063

11.3 anti- DRw52b 0" lb 1 1 0 1 1 0 0

11.3 anti-

ER anti- ORw52b 0 1 1 1 0 1 1 0 0

ER anti- ORw52x 0 1 1 1 0 1 1 0 0

DRw52x 0 2c 2 2 0 2 2 0 0

cluster 0: negative. cluster 1: intermediary. cluster 2: positive.

tively, and that these two haplotypes are "PLT" identical to each other.

In a further attempt to establish whether DRw 1 1 ,DRw52x heterozygous individuals recog- nize HLA-DRw52b7 we performed an HTC typing experiment. Cryopreserved peripheral blood lymphocytes from 6 responders, including a DRw52x heterozygote, individual 11.2 from the JS family, were stimulated in primary MLC with a DRwl17DRw52b HTC (10~9040) and with 2 controls (Table 6). Similar to the HLA- DRw 1 1 ,DRw52b heterozygous cells, the DRwl 1 ,DRw52x responder exhibited typing reac- tions to the HLA-DRwl 1 ,DRw52b HTC. Hence, DRw52b is not stimulatory in primary MLC to a DR52x responder when the responder and stimu- lator share HLA-DRwll.

Discussion

HLA-DR5 and its subtypes HLA-DRwll and HLA-DRwl2 are associated with the HLA- DRw52 specificity which is encoded by the DRB3 gene. The allelic variants of DRB3, DRw52a, DRw52b, and DRw52c, can be distinguished using alloreactive T cells (10, 30), RFLP analysis (23-28, 30, 31), 2-D gel analysis (32) and DRB3 allele- specific oligonucleotides for DNA hybridization (33). RFLP analysis using the Taql restriction en- zyme shows that the DRw52a and DRw52c alleles are associated with a 9.8 kb restriction fragment, whereas DRw52b is associated with an 11.5 kb fragment. In the present study we report on a new RFLP pattern of DRB3 which consists of a 10.5 kb Taql restriction fragment. This new variant

Table 6. T cells from a DRwll ,DRw52x responder are not stimulated by the DRw52b product in primary MU:

Stimulating Cells x

Responding Cells 1 Ow9040 11.2 Control

DRwl 1 ,DRw52b/DRwll ,DRw52b DRw8IDRwll ,DRw52x DRlIDR7

DRwl l,DRw52x/DRw8 (11.2) 575' 164 10698 DRwl l,DRw52bIDRwl5 302 11 832 7769 DRwl 1,DRw52bIDRwll ,DRw52b 132 3326 2736 DRZ/DR3,DRw52a 6902 12907 172 DRwl 1 ,DRw52b/DRwl3,DRw52b 826 12472 9297 DRl/DR7 91 74 351 21 172

cpm in triplicate cultures.

71

Reed et al.

was encountered in an African-American family in which it was shared by the paternal a (DRw 1 1 ,DQw6) and maternal d (DRw 1 1 ,DQw6) haplotypes. To determine whether this restriction fragment defines a new DRB3 allele we sequenced the first domain of this DRB3 gene. The sequence which we found, however, is identical to that re- ported by Didier et al. on the DRB3*0202 gene of the homozygous typing cell SWEIG (lows 9037) (29). This HLA-DRw1 1 homozygous typing cell line has the 6.1 and 11.5 kb Taql restriction fragments indicating that it carries the DRw52b allele. Since the sequence of the first domain of the DRB3 haplotype encountered in JS is identical to that of SWEIG HTC, it appears that the JS family also carries the HLA-DRB3 DRw52b allele. Results of PLT studies are consistent with the possibility that the HLA-DRw52 gene of the JS family is identical to DRw52b expressed by other unrelated cells, since PLTs primed to DRw52b were restimulated by DRw52x from the JS family and vice-versa. HTC typing studies showed that a DRw52x heterozygous individual failed to respond in primary MLC to a DRw52b HTC. The 10.5 kb restriction fragment found in the JS family, therefore, represents a polymorphic site of the DRw52b gene outside the coding region. However, since we did not sequence the second domain of the DRB3 gene, we cannot rule out the possibility that this 10.5 kb fragment represents a polymorphism in the second domain.

Recent studies by Martell et al. have demon- strated the existence of a new DRw52 variant, provisionally named DRw52d, which is associated with DRwll,DQw7 haplotypes and is confined to individuals of African or mixed ancestry (26). It is likely that the Taql/DRB RFLP of 11.0-kb observed in the South African population is the same as the 10.5-kb fragment associated with the DRwl 1 ,DQw6 haplotype in our study.

In summary, our study uncovers a new RFLP of the DRB3 gene, which is located in a non-coding region. It therefore appears that RFLP studies of HLA have the potential of contributing a great array of useful information for anthropology and paternity investigations.

Acknowledgments

This work has been supported by the following grants from the National Institutes of Health: POL-HL36581-03, RO1-HD22920-01A1 and R01-A125210-03. The authors acknowledge the secretarial help of Mrs. Lilian Acosta, and the technical help of Yenhui Chang.

References

1. Benacerraf B. Role of MHC gene products in immune regulation. Science 1981: 212: 1229-38.

2. Svejgaard A, Platz P, Ryder LP. HLA and disease 1982-A survey. Immunol Rev 1983: 7 0 193-218.

3. Kappes D, Strominger JL. Human class I1 major histocompatibility complex genes and proteins. Ann Rev Biochem

4. Rollini T, Mach B, Gorski J. Characterization of an HLA- DR-B pseudogene in the DRw52 supertypic group. Immun- ogenetics 1987: 25: 336-42.

5. Gorski J, Tosi R, Strubin M, Rabourdin-Combe C, Mach B. Serological and immunochemical analysis of the products of a single HLA-DR-alpha and DR-beta chain gene expressed in a mouse cell line after DNA-mediated co- transformation reveals that the B chain carries a known supertypic specificity. J Exp Med 1985: 162: 105-16.

6. Bohme J, Anderson M, Anderson G, Moller E, Peterson PA, Rask L. HLA-DRB genes vary in number between different specificities, whereas the number of DQB genes is constant. J Immunol1985: 135: 2149-55.

7. Kawai J, Ando A, Sat0 T, Nakatinji T, Tsuji K, Inoko H. Analysis of gene structure and antigen determinants of DR2 antigens using DR gene transfer into mouse L cells. J Imrnunol 1989: 142: 312-17.

8. Bodmer J, Marsh SGE, Albert E. Nomenclature for factors of the HLA system. 1989. Immunology Today 1990: 11: 3-9.

9. Gorski J, Mach B. Polymorphism of human Ia antigens: gene conversion between two DRbeta loci results in a new HLA-D/DR specificity. Nature 1986: 322: 67-70.

10. Gorski J, Irle C, Mickelson EM, et al. Correlation of structure with T cell responses of the three members of the HLA-DRw52 allelic series. J Exp Med 1989: 170: 1027-32.

11. Reed E, Hardy M, Benvenisty A, et al. Effect of antiidiotyp- ic antibodies on graft survival in renal allograft recipients. NEJM 1987: 316: 1450-55.

12. Marcadet A, O’Connell P, Cohen D. Standardized Southern Blot Workshop Technique. In: Dupont B, ed. Immunobiol- ogy of HLA. New York: Springer Verlag, 1989: 553-60.

13. Long EO, Wake CT, Gorski J, Mach B. Complete sequence of an HLA-DRb chain deduced from a cDNA clone and identification of multiple non-allelic DRb chain genes. Embo J 1983: 2 38P-94.

14. Auffray C, Lillie JW, Korman AJ, et al. Structure and expression of HLA-DQ alpha and -DX alpha genes: interal- lelic alternate splicing of the HLA-DQ alpha gene and functional splicing of the HLA-DQ alpha gene using retro- viral vector. Immunogenetics 1987: 2 6 63-73.

15. Sheldon EL, Kellogg DE, Watson R, Levenson CH, Erlich HA. Use of nonisotopic M13 probes for genetic analysis: application to HLA class I1 loci. Proc Natl Acad Sci USA 1986: 83: 9085-9.

16. Feinburg AP, Vogelstein B. A technique for radiolabelling DNA restriction endonuclease fragments to high specific activity. Anal Biochem 1983: 132-6-13.

17. Saiki RK, Gelfand DH, Stoffel S, et al. Primer-directed enzymatic amplification of DNA with a thermostable DNA polymerase. Science 1988: 239 487-91.

18. Sanger F, Nicklen S, Coulson AR. DNA sequencing with chain terminating inhibitors. Proc Natl Acad Sci USA 1977: 74: 5463-67.

19. Rubinstein P, Falk C, Martin M, Nicholson J, Suciu-Foca N. Complete typing of the HLA region in families. 111. Analysis of responses in the primed lymphocyte test (PLT). Transplant Proc 1977: 9 1747-9.

20. Suciu-Foca N, Susinno E, Nicholson J, Fotino M, Molinaro A, Rubinstein P. Complete typing of the HLA region in

1988: 57: 991-1028.

72

HLA-DR5 haplotypes

families. IV. The genetics of HLA-D as seen by the HTC and PLT methods. Transplant Proc 1977: 9: 17514.

21. Rubinstein P, Suciu-Foca N. The genetics of PLT. Tissue Antigens 1977: 10 166-71.

22. Suciu-Foca N, Rubinstein P, Susinno E, Broell J, Weiner J, Reemtsma K. Quantitation of HLA-D differences. Tissue Antigens 1978: 12: 94-105.

23. Bidwell JL, Bidwell EA, Savage DA, Middleton D, Klouda PT, Bradley BA. A DNA-RFLP typing system that posi- tively identifies well-defined and ill-defined HLA-DR and DQ alleles, including DRwlO, Transplantation 1988: 4 5 640-46.

24. Bidwell J. DNA-RFLP analysis and. genotyping of HLA- DR and DQ antigens. Immunology Today 1988: 9 18-22.

25. Cox N, Mela APP, Zmijewski CM, Spielman RS. HLA- DR typing “at the DNA level” RFLPs and subtypes detected with a DRB cDNA probe. Am J Hum Genet 1988: 43 954-63.

26. Martell RW, Oudshoom M, Arendse B, DuToit E. Poly- morphism of DRw52 and its association with DRwl 1 and DRwl2 in South African Blacks (Negroes) and individuals of mixed ancestry (Cape Coloreds). Human Immunol1990:

27. Simons MJ, Wheeler R, Cohen D, Lalouel JM, Dupont B. Restriction fragment length polymorphism of HLA genes: Summary of the 10th International Workshop Southern Blot analysis. In Dupont B, Immunobiology of HLA. New York: Springer Verlag, 1989: 959-1023.

28. Kohnen-Corish MRJ, Serjeantson SW. RFLP analysis of

28: 32-8.

HLA-DR and DQ genes and their linkage relationships in the Pacific. Am J Hum Genet 1986: 39: 751-62.

29. Didier DK, Schiffenbaum J, Shuman S, et al. Characteriza- tion of two distinct DRB chain alleles at the BIII locus of the DR5 haplotypes: BIII alleles are highly conserved. J

30. Termijtelen A, Gorski J, Robbins FM, et al. Correlations between polymorphisms at the DNA and at the protein level of DRw52 haplotypes revealed with a variety of tech- niques. Human Irnmunol 1988: 22: 171-78.

31. Savage DA, Bidwell JL, Cullen C, Bidwell EA, Middleton D. Identification of HLA-DRw52 associated antigens using HLA class I1 allogenotyping. Tissue Antigens 1988: 32 27-5.

32. Ballas M, Madrigal A, Bontrop R, Giphart MJ, Bodmer J, Goldmar SF. Molecular analysis of the HLA-DR5 haplotypes. Tissue Antigens 1989: 34: 223-32.

33. Tiercy JM, Gorski J, Betuel H, et al. DNA typing of DRw6 subtypes: Correlation with DRBl and DRB3 allelic se- quences by hybridization with oligonucleotide probes. Hu- mun Immunol 1989: 24: 1-14.

Imm~011986: 137: 2627-31.

Address: Dr. Elaine Reed Department of Pathology College of Physicians and Surgeons of Columbia University 14-403, 630 West 168th Street New York, NY 10032 U.S.A.

73

Documents

RFLP analysis of HLA-DR5 haplotypes