Seediscussions,stats,andauthorprofilesforthispublicationat:https://www.researchgate.net/publication/265558707

Resveratrolsupplementationdoesnotaugmentperformanceadaptationsorfibre-type-specificresponsestohigh-intensityintervaltraininginhumans

ARTICLEinAPPLIEDPHYSIOLOGYNUTRITIONANDMETABOLISM·JULY2014

ImpactFactor:2.34·DOI:10.1139/apnm-2014-0070·Source:PubMed

CITATIONS

10

READS

190

9AUTHORS,INCLUDING:

BrittanyAEdgett

Queen'sUniversity

11PUBLICATIONS63CITATIONS

SEEPROFILE

KiraAVorobej

UniversityofWaterloo

2PUBLICATIONS20CITATIONS

SEEPROFILE

JasonG.E.Zelt

Queen'sUniversity

9PUBLICATIONS41CITATIONS

SEEPROFILE

BrendonJGurd

Queen'sUniversity

60PUBLICATIONS719CITATIONS

SEEPROFILE

Allin-textreferencesunderlinedinbluearelinkedtopublicationsonResearchGate,

lettingyouaccessandreadthemimmediately.

Availablefrom:BrendonJGurd

Retrievedon:07March2016

ARTICLE

Resveratrol supplementation does not augment performanceadaptations or fibre-type–specific responses to high-intensityinterval training in humansTrisha D. Scribbans, Jasmin K. Ma, Brittany A. Edgett, Kira A. Vorobej, Andrew S. Mitchell,Jason G.E. Zelt, Craig A. Simpson, Joe Quadrilatero, and Brendon J. Gurd

Abstract: The present study examined the effect of concurrent exercise training and daily resveratrol (RSV) supplementa-tion (150 mg) on training-induced adaptations following low-dose high-intensity interval training (HIIT). Sixteen recreation-ally active (�22 years, �51 mL·kg−1·min−1) men were randomly assigned in a double-blind fashion to either the RSV orplacebo group with both groups performing 4 weeks of HIIT 3 days per week. Before and after training, participants had aresting muscle biopsy taken, completed a peak oxygen uptake test, a Wingate test, and a submaximal exercise test. A maineffect of training (p < 0.05) and interaction effect (p < 0.05) on peak aerobic power was observed; post hoc pairwisecomparisons revealed that a significant (p < 0.05) increase occurred in the placebo group only. Main effects of training(p < 0.05) were observed for both peak oxygen uptake (placebo – pretraining: 51.3 ± 1.8, post-training: 54.5 ± 1.5 mL·kg−1·min−1,effect size (ES) = 0.93; RSV – pretraining: 49.6 ± 2.2, post-training: 52.3 ± 2.5 mL·kg−1·min−1, ES = 0.50) and Wingate peakpower (placebo: pretraining: 747 ± 39, post-training: 809 ± 31 W, ES = 0.84; RSV – pretraining: 679 ± 39, post-training: 691 ±43 W, ES = 0.12). Fibre-type distribution was unchanged, while a main effect of training (p < 0.05) was observed for succinatedehydrogenase activity and glycogen content, but not �-glycerophosphate dehydrogenase activity or intramuscular lipidsin type I and IIA fibres. The fold change in PGC-1�, SIRT1, and SOD2 gene expression following training was significantly(p < 0.05) lower in the RSV group than placebo. These results suggest that concurrent exercise training and RSV supple-mentation may alter the normal training response induced by low-volume HIIT.

Key words: resveratrol, high-intensity interval training (HIIT), PGC-1�, skeletal muscle, antioxidant, oxidative/glycolytic capacity,anaerobic exercise capacity.

Résumé : Cette étude analyse l’effet combiné de l’exercice physique et de la supplémentation journalière en resvératrol(« RSV » : 150 mg) sur les adaptations consécutives a une séance d’une faible dose d’entraînement par intervalles a hauteintensité (« HIIT »). On répartit aléatoirement a double insu seize hommes actifs par loisir (�22 ans, �51 mL·kg−1·min−1) dansdeux groupes (RSV et placebo) soumis pareillement a 4 semaines de HIIT a raison de 3 jours par semaine. Avant et après uneséance d’entraînement, on pratique une biopsie musculaire au repos et les sujets participent a un test de la consommationmaximale d’oxygène de pointe, un test de Wingate et un test d’effort sous-maximal. La puissance aérobie de pointe présenteun effet principal de l’entraînement (p < 0,05) et une interaction (p < 0,05); l’analyse post-hoc de la comparaison par pairerévèle une augmentation significative (p < 0,05) seulement dans le groupe placebo. L’analyse révèle un effet principal del’entraînement (p < 0,05) sur de la consommation maximale d’oxygène de pointe (placebo – formation avant : 51,3 ± 1,8,après la formation : 54,5 ± 1,5 mL·kg−1·min−1, ampleur de l’effet (AE) = 0,93; RSV – formation avant : 49,6 ± 2,2, après laformation : 52,3 ± 2,5 mL·kg−1·min−1, AE = 0,50) et la puissance de pointe au test de Wingate (placebo: formation avant : 747 ±39, après la formation : 809 ± 31 W, AE = 0,84; RSV – formation avant : 679 ± 39, après la formation : 691 ± 43W, AE = 0,12).La proportion des types de fibre musculaire ne varie pas; le programme d’entraînement révèle un effet principal del’entraînement (p < 0,05) sur l’activité de la déshydrogénase succinique et le contenu en glycogène, mais pas sur l’activitéde la GPD et le contenu de lipides des fibres musculaires de type I et IIA. Les variations des valeurs de PGC-1�, de SIRT1 et del’expression du gène SOD2 suscitées par l’entraînement sont significativement plus faibles (p < 0,05) dans le groupe RSVcomparativement au groupe placebo. D’après ces observations, la combinaison de l’entraînement physique et de lasupplémentation en RSV semble modifier l’adaptation normale a l’entraînement suscitée par un HIIT de faible volume.[Traduit par la Rédaction]

Mots-clés : resvératrol, entraînement par intervalle d’intensité élevée (HIIT), PGC-1�, muscle squelettique, antioxydant, capacitéoxydative/glycolytique, capacité d’effort anaérobie.

Received 2 March 2014. Accepted 6 July 2014.

T.D. Scribbans,* J.K. Ma,* B.A. Edgett, J.G.E. Zelt, and B.J. Gurd. School of Kinesiology and Health Studies, Queen’s University, Kingston, ON K7L 3N6,Canada.K.A. Vorobej, A.S. Mitchell, and J. Quadrilatero. Department of Kinesiology, University of Waterloo, Waterloo, ON N2L 3G1, Canada.C.A. Simpson. Department of Emergency Medicine, Queen’s University, Kingston, ON K7L 3N6, Canada.Corresponding author: Brendon J. Gurd (e-mail: gurdb@queensu.ca).*These authors contributed equally to this manuscript.

Pagination not final (cite DOI) / Pagination provisoire (citer le DOI)

1

Appl. Physiol. Nutr. Metab. 39: 1–9 (2014) dx.doi.org/10.1139/apnm-2014-0070 Published at www.nrcresearchpress.com/apnm on 23 July 2014.

App

l. Ph

ysio

l. N

utr.

Met

ab. D

ownl

oade

d fr

om w

ww

.nrc

rese

arch

pres

s.co

m b

y Q

ueen

s U

nive

rsity

on

09/1

5/14

For

pers

onal

use

onl

y.

IntroductionExercise training results in improvements in exercise perfor-

mance that are mediated, at least partially, by increases in mito-chondrial content maximal aerobic and anaerobic power, and animproved capacity to oxidize fatty acids during submaximal exer-tion (Burgomaster et al. 2008; Shepherd et al. 2013; Terada et al.2004). Resveratrol (RSV), a naturally occurring polyphenol, hasrecently been proposed to function as an “exercise mimetic”because of its antioxidant properties (Baur and Sinclair 2006) andits ability to stimulate mitochondrial biogenesis through activationof the AMPK/SIRT1/PGC-1� axis (Cantó and Auwerx 2009; Lagougeet al. 2006). More specifically, in rodent models, chronic RSV feed-ing improves metabolic and cardiovascular function (Baur andSinclair 2006; Lagouge et al. 2006; Pearson et al. 2008), exerciseperformance, and maximal oxygen uptake (Lagouge et al. 2006;Murase et al. 2008).

Findings from these murine studies (Baur and Sinclair 2006;Lagouge et al. 2006; Murase et al. 2008; Pearson et al. 2008) providecompelling evidence that suggests RSV supplementation, in com-bination with exercise training, may augment training-inducedadaptations in skeletal muscle metabolic function and perfor-mance. Also in rodent models, concurrent RSV feeding and exer-cise training has been demonstrated to induce greater increases incardiac function (Dolinsky et al. 2012), aerobic capacity (Dolinskyet al. 2012; Hart et al. 2013), and skeletal muscle oxidative capacity(Dolinsky et al. 2012; Hart et al. 2013; Menzies et al. 2013) thanexercise training alone. These results position RSV as a potentiallypotent ergogenic aid for individuals seeking improved exerciseperformance.

Unfortunately, although perhaps not surprisingly (Joyner 2013),the efficacy of RSV at improving metabolic and cardiovascular func-tion in humans has proven to be much less profound. For example,while several early reports demonstrated a beneficial effect of RSV onmetabolic health (Crandall et al. 2012; Timmers et al. 2011), theseresults have proven difficult to reproduce in different populations(Poulsen et al. 2013; Yoshino et al. 2012). Furthermore, in starkcontrast to the synergistic effects of RSV feeding during exercisetraining observed in rodents, a recent report examining thecombined effects of exercise and RSV in older (aged 60–72 years)men demonstrated that RSV supplementation reduced training-induced improvements in cardiovascular function and exerciseperformance (Gliemann et al. 2013). Given the controversy gen-erated by these apparent RSV-mediated reductions in training-induced adaptations (Smoliga and Blanchard 2013), and theequivocality of studies examining RSV-induced metabolic effectsin humans (Crandall et al. 2012; Poulsen et al. 2013; Timmers et al.2011; Yoshino et al. 2012), it is of considerable interest if the ap-parent negative effects of concurrent exercise training and RSVsupplementation are limited to older men, and (or) if exercise-mediated increases in variables known to contribute to improvedexercise performance, in addition to maximal oxygen uptake, aresimilarly affected by RSV supplementation.

Therefore, the purpose of this study was 3-fold: (i) to examinethe effects of RSV supplementation on exercise-mediated increasesin aerobic capacity in young healthy men; (ii) to examine if RSVsupplementation impacts exercise-induced adaption in anaerobiccapacity and submaximal substrate utilization; and (iii) to deter-mine if RSV supplementation impacts skeletal muscle geneexpression or adaptations in oxidative/glycolytic capacity in afibre-specific manner. We hypothesized that exercise capacitywould increase in both groups following training, but as a resultof RSV’s reported ability to counteract training-induced improve-ments in exercise performance (Gliemann et al. 2013), the magni-tude of increase would be reduced in the RSV group.

Materials and methodsAll experimental procedures performed on human participants

were approved by the Health Sciences Human Research EthicsBoard at Queen’s University and conformed to the Declaration ofHelsinki. Verbal and written explanations of the experimentalprotocol and associated risks were provided to all participantsprior to obtaining written informed consent.

Experimental designMuscle biopsies were taken, and aerobic and anaerobic exercise

capacity and submaximal exercise substrate utilization were de-termined before and after the 4-week training intervention (Fig. 1A).The training intervention consisted of 4 weeks of extremely low-volume cycle high-intensity interval training (HIIT) (Ma et al. 2013;McRae et al. 2012; Tabata et al. 1996) performed 3 times per week(Fig. 1B). During the intervention participants were administereddaily doses of either RSV (150 mg) or placebo using a randomizeddouble-blind design.

ParticipantsSixteen participants, who engaged in less than 3 h of structured

aerobic exercise per week at enrollment, volunteered for thestudy (participant characteristics are presented in Table 1). Partic-ipants were randomly assigned to either the RSV (n = 8) or placebo(n = 8) supplemented group. Participants were instructed to main-tain exercise and nutritional habits and to avoid the ingestion ofnutritional supplements and foods high in naturally occurringRSV (grapes, some teas, and peanuts) for the duration of the study.All participants completed all 12 training sessions over the 4-weekperiod.

Physiological testingDuring baseline testing (pretraining), participants reported

to the lab following an overnight fast (≥12 h). A muscle biopsy wasobtained 30 min after participants consumed a standardizedbreakfast (plain bagel (190 kcal; 1 g fat, 36 g carbohydrate, 7 g protein)with 15 g of peanut butter (90 kcal; 8 g fat, 4 g carbohydrate, 3 gprotein) and 200 mL of apple juice (90 kcal; 0 g fat, 22 g carbohy-drate, 0 g protein)). The biopsy was taken from the vastus lateralisunder superficial local anaesthesia (2% lidocaine, with epineph-rine) using the Bergstrom needle biopsy technique (Bergstrom1975) adapted with suction.

Forty-eight hours following the muscle biopsy, participantscompleted an incremental ramp protocol to exhaustion todetermine peak oxygen uptake (VO2peak) as described previously(Edgett et al. 2013). Following completion of the VO2peak test, par-ticipants rested for 30 min before completing a Wingate test con-sisting of 2 min of load-less cycling followed by 30 s of “all-out”effort (5% body weight). RPM was collected continuously and peak(first 5-s average) and mean power (average for total 30 s) weredetermined. Twenty-four hours after the VO2peak and Wingatetests, participants returned to the lab following an overnight fast(≥12 h) and completed a steady-state cycle test 30 min after con-sumption of a standardized breakfast (see above for meal details).The test consisted of 15 min of sitting on the cycle ergometer(rest) followed by 30 min of cycling at 150 W. Gas exchange wascollected continuously throughout both rest and exercise using ametabolic cart (Moxus AEI Technologies, Pittsburgh, Pa., USA).Average oxygen uptake, carbon dioxide output, and respiratoryexchange ratio (RER) were calculated during the last 10 min of restand for the entire 30 min of exercise. See Fig. 1 for a schematictimeline of the pre- and post-training physiological testing.

Post-training testing began 72 h following the final trainingsession and was conducted in an identical manner as baselinetesting procedures. Please see above for details.

Pagination not final (cite DOI) / Pagination provisoire (citer le DOI)

2 Appl. Physiol. Nutr. Metab. Vol. 39, 2014

Published by NRC Research Press

App

l. Ph

ysio

l. N

utr.

Met

ab. D

ownl

oade

d fr

om w

ww

.nrc

rese

arch

pres

s.co

m b

y Q

ueen

s U

nive

rsity

on

09/1

5/14

For

pers

onal

use

onl

y.

Training protocolThe training protocol has been described in detail previously

(Ma et al. 2013; Tabata et al. 1996). Briefly, participants completedeight 20-s intervals at �170% of peak aerobic work rate (WRpeak)separated by 10 s of rest (Fig. 1B). During rest periods participantscycled against no load at a cadence of their choice. Three trainingsessions were completed per week over the 4-week interventionperiod.

SupplementationParticipants consumed either a placebo or RSV supplement daily

for 4 weeks (28 days) during the training portion of the study. Thefirst dose was administered �24 h prior to each participants firsttraining session and the last dose after the last training session(�72 prior to the commencement of post-testing). Daily RSV dos-ages contained 150 mg of 99% trans-RSV (resVida). Placebo pillswere identical to the RSV supplements but contained inert micro-

crystalline cellulose. Both participants and investigators wereblinded to the contents of the pills. On training days, participantsconsumed the supplement �15 min after the completion of exer-cise under supervision of an investigator. On nonexercise days,subjects consumed their supplements with breakfast with confir-mation being obtained by an investigator via text message.

Immunofluorescent and histochemical analysisImmunofluorescent analysis of myosin heavy chain (MHC)

isoforms was performed, as previously described (Bloembergand Quadrilatero 2012), using primary antibodies against MHCI(BA-F8), MHCIIa (SC-71), and MHCIIx (6H1) (Developmental StudiesHybridoma Bank), followed by isotype-specific fluorescent sec-ondary antibodies. This allowed for the identification of type I(blue), type IIA (green), type IIX (red), as well as hybrid fibre types(IIAX). For all analyses type IIX and type IIAX fibres were analyzedtogether (type IIAX/IIX). Fibre-type composition was determinedby counting all fibres within a muscle cross-section.

For all immunofluorescent procedures, sections were mountedwith Prolong Gold Antifade Reagent (Life Technologies) and im-aged the following day. All sections were visualized with an AxioObserver Z1 microscope (Carl Zeiss). Individual images were takenacross the entire muscle cross-section and assembled into a com-posite panoramic image using AxioVision software (Carl Zeiss).

As a general indicator of oxidative and glycolytic poten-tial, histochemical staining for succinate dehydrogenase (SDH)(Blanco et al. 1988) and �-glycerophosphate dehydrogenase(GPD) (Halkjaer-Kristensen and Ingemann-Hansen 1979) activitywas performed (Bloemberg and Quadrilatero 2012). Intramuscularlipid content was determined with Oil Red O staining (Koopmanet al. 2001), whereas glycogen content was determined using thePeriodic Acid–Schiff reaction (Quadrilatero et al. 2010). Imageswere acquired with a bright field Nikon microscope linked to aPixelLink digital camera. Individual images were taken across

Fig. 1. Schematic diagram of the timeline for pre- and post-training physiological testing and training protocols. Participants performedphysiological testing (A) prior to beginning training and daily supplementation of either 150 mg placebo or resveratrol (RSV), and 72 hfollowing the last training bout. Participants performed 3 weekly bouts of low-volume high-intensity interval cycle training (HIIT) whiletaking daily placebo or RSV (B). RER, respiratory exchange ratio; VO2peak, peak oxygen uptake; WR, work rate.

Table 1. Participant characteristics (N = 16).

Placebo (n = 8) RSV (n = 8)

Pre Post Pre Post

Age (y) 22±1 — 21±1 —Height (cm) 182±2 — 183±2 —Body mass (kg) 80±2.9 80±2.5 76±2.6 76±3.0BMI (kg·m−2) 24±0.8 24±0.6 22±0.6 22±0.7Absolute VO2peak (mL·min−2)* 4116±224 4352±187 3834±254 4084±271Peak aerobic power (W)*,† 314±37 341±41‡ 340±23 347±23

Note: Data are means ± SE unless otherwise indicated. BMI, body mass index;VO2peak, peak oxygen uptake.

*Main effect of training, p < 0.05.†Significant group by time interaction effect, p < 0.05.‡Significant (p < 0.05) within-group effect of training (determined using a post

hoc, pairwise comparison), p < 0.05.

Pagination not final (cite DOI) / Pagination provisoire (citer le DOI)

Scribbans et al. 3

Published by NRC Research Press

App

l. Ph

ysio

l. N

utr.

Met

ab. D

ownl

oade

d fr

om w

ww

.nrc

rese

arch

pres

s.co

m b

y Q

ueen

s U

nive

rsity

on

09/1

5/14

For

pers

onal

use

onl

y.

the entire muscle cross-section and assembled into a compo-site panoramic image using Microsoft Image Composite Editor(Microsoft). Image analysis was performed in ImageJ (NationalInstitutes of Health) by converting color images to 8-bit, and cal-culated by subtracting background staining of individual fibres.Compiled images were matched to fibre-type images and �30 ofeach fibre type were randomly selected and analyzed with databeing expressed relative to the values obtained in type I fibres,which were assigned a reference value of 1.0, and reported asmean optical density in arbitrary units (AU).

Quantitative real-time polymerase chain reaction (PCR)RNA was extracted using a modified version of the single-step

method by guanidinium thiocyanate-phenol-chloroform extrac-tion (Chomczynski and Sacchi 2006). The purified RNA pellet wasdissolved in RNase and DNase-free ultrapure water then quanti-fied spectrophotometrically at 260 nm. Protein contaminationwas assessed by measuring absorbance at 280 nm. Samples had anaverage 260:280 ratio of 1.99 ± 0.02 (mean ± SD). One microgram ofresulting RNA was reverse transcribed using the QuantiTectReverse Transcription Kit (Qiagen, Mississauga, Ont., Canada).Transcript levels were determined on an ABI 7500 Real Time PCRSystem (Foster City, Calif., USA) using the following protocol:1 cycle at 95 °C for 15 min, 40 cycles of 95 °C for 15 s, 30 s at theprimer set specific annealing temperature (Table 2), and 72 °C for36 s, followed by a dissociation curve to assess specificity of thereaction. Primer set efficiencies were determined using real- timePCR with an appropriate cDNA dilution series prior to sampleanalysis. Average primer set-specific efficiencies (Rasmussen 2001)were E = 2.06 ± 0.06 (mean ± SD). All samples were run in duplicate25-�L reactions that contained 50 ng cDNA, 0.58 mmol·L−1 prim-ers, and GoTaq PCR Master Mix (Promega, Madison, Wis., USA).No-template controls were run with water in place of cDNA toensure the absence of contamination. Results were analyzed ac-cording to the ��Ct method using TATA-binding protein as ahousekeeping gene (Livak and Schmittgen 2001). Primer sets arelisted in Table 2.

Statistical analysisA 2-way, mixed ANOVA was used to compare the effect of group

(RSV and placebo) and time (pre- and post-training) for all musclederived data (SDH, GPD, intramuscular glycogen, and lipid) andpre- to post-training physiological testing data. A Bonferroni cor-rection was used for post hoc pairwise comparison of means formain effects and significant interactions. To evaluate the practicalsignificance of the training effect, standardized mean effect sizes(ESs) (Cohen’s d) were calculated as described by Cohen (1988) witha large effect corresponding to >0.8, a moderate effect >0.5, and asmall effect >0.2 (Cohen 1988). All fibre-type–specific analyseswere performed within a particular fibre type. All statistical anal-

ysis was performed using GraphPad Prism version 5.01 (GraphPadSoftware Inc., La Jolla, Calif., USA). Post hoc power calculationswere performed using G*Power software (Faul et al. 2007). Statis-tical significance was accepted at p < 0.05 and all data are pre-sented as means ± SE.

Results

VO2peakA main effect of training (p < 0.05) on VO2peak (Table 1; Fig. 2) was

observed following training (placebo: ES = 0.93; RSV: ES = 0.50). Amain effect of training (p < 0.05) and interaction effect (p < 0.05)on peak aerobic power (Table 1) was observed with post hoc anal-ysis, revealing a significant (p < 0.05) increase in the placebo grouponly.

Wingate peak power and training session performanceA main effect of training (p < 0.05) on Wingate peak power

(Fig. 3A; placebo: ES = 0.84, RSV: ES = 0.12) and average intervalpower generated during training session 1 compared with train-ing session 11 (Fig. 3B; placebo: ES = 0.87, RSV: ES = 0.45) wasobserved.

Exercise substrate utilizationNo effect of significant main effect of training was observed for

either resting (Fig. 3C; placebo: ES = −0.04, RSV: ES = 0.83) orexercise (Fig. 3D; placebo: ES = 0.02, RSV: ES = 0.79) RER.

Fibre-type distribution and enzyme activitiesNo effect of training was demonstrated for fibre-type distribu-

tion following training in either group (Fig. 4B). A main effect oftraining (p < 0.05) was observed for SDH activity in type I (placebo:

Table 2. List of primer sequences used for real-time polymerase chain reaction and their specific annealing temper-atures (T).

Gene Forward primer (5=¡3=) Reverse primer (5=¡3=) T (°C) NCBI RefSeq

PGC-1� CACTTACAAGCCAAACCAACAACT CAATAGTCTTGTTCTCAAATGGGGA 59 NM_013261.3PDK4 CGGCTGGTGGGAAGACTTGA TGCCGCGGAGTGAAGAGTCT 59 NM_002612.3SIRT1 AGAACATAGACACGCTGGAACA CAAGATGCTGTTGCAAAGGAACC 59 NM_012238.4GCN5 AAGGACCCCGACCAGCTCTA GGGAAGCGGATGACCTCGTA 59 NM_021078.2RIP140 GTTCCACTCAGCCCAGCAGT AGACCCTGCACAGCCCAAGT 59 NM_003489.3EGR1 AGCAGCCCTACGAGCACCT CGAGTGGTTTGGCTGGGGTA 59 NM_001964.2p53 CCAACAACACCAGCTCCTCT CCTCATTCAGCTCTCGGAAC 61 NM_000546.5GPx1 GAGAACGCCAAGAACGAAGA TCTCGAAGAGCATGAAGTTGG 59 NM_201397.1SOD2 GACAAACCTCAGCCCTAACG CGTCAGCTTCTCCTTAAACTTG 59 NM_000636.2TBP AGACGAGTTCCAGCGCAAGG GCGTAAGGTGGCAGGCTGTT 59 NM_003194.4

Note: EGR1, early growth response protein 1; GCN5, general control nonderepressible 5; GPx1, glutathione peroxidase 1; PDK4,pyruvate dehydrogenase kinase 4; PGC-1�, peroxisome proliferator-activated receptor gamma coactivator 1 alpha; RIP140, receptor-interacting protein 140; SIRT1, silent mating type information regulation 2 homolog 1; SOD2, superoxide dismutase 2: TBP, TATA-binding protein.

Fig. 2. Effects of exercise training supplemented with resveratrol(RSV) or placebo on maximal oxygen uptake (VO2peak). RelativeVO2peak (mL·kg−1·min−1) before (Pre) and after (Post) 4 weeks oflow-volume high-intensity interval training supplemented withdaily RSV or placebo. *, Main effect of training (p < 0.05).

Pagination not final (cite DOI) / Pagination provisoire (citer le DOI)

4 Appl. Physiol. Nutr. Metab. Vol. 39, 2014

Published by NRC Research Press

App

l. Ph

ysio

l. N

utr.

Met

ab. D

ownl

oade

d fr

om w

ww

.nrc

rese

arch

pres

s.co

m b

y Q

ueen

s U

nive

rsity

on

09/1

5/14

For

pers

onal

use

onl

y.

ES = 1.12, RSV: ES = 0.94) and IIA (placebo: ES = 1.54, RSV: ES = 1.13)fibres following training in both groups (Fig. 4C), while no effectof training was observed in any fibre type for GPD activity ineither group (Fig. 4D; type I – placebo: ES = 0.02, RSV: ES = 0.18;type IIA – placebo: ES = −0.18, RSV: ES = 0.07). Representative slidesare shown in Fig. 4A.

Fibre-type–specific substrate storageA main effect of training (p < 0.05) was observed for glycogen

content in type I (Fig. 5B; placebo: ES = 0.24, RSV: ES = 1.46) andtype IIA fibres (Fig. 5C; placebo: ES = 0.62, RSV: ES = 1.60). No effectof training was observed for intramuscular lipid content in type Ior IIA fibres following training (Fig. 5D; type I – placebo: ES = 0.00,RSV: ES = 0.80; type IIA – placebo: ES = –0.24, RSV: ES = 0.41).

Gene expressionThe fold change in PGC-1� (Fig. 6A), SIRT1 (Fig. 6B), and SOD2

(Fig. 6C) gene expression was significantly (p < 0.05) differentbetween placebo and RSV. No differences were observed betweengroups for GPx1 (Fig. 6D), EGR1, GCN5, p53, PDK4, or RIP140 geneexpression (Table 3).

DiscussionThe present study examined the impact of 4 weeks of LV-HIIT,

supplemented with either 150 mg of RSV or placebo daily, onaerobic and anaerobic exercise performance, exercise substrateutilization, skeletal muscle gene expression, and fibre-type–specific adaptations. LV-HIIT, both in the presence and absence ofRSV supplementation, significantly increased (p < 0.05) maximaloxygen uptake, Wingate peak power, and training performance(average training session power), while resting and exercise RERremained unchanged following training. These differences in ex-ercise capacity and substrate utilization were accompanied by thefollowing adaptations within skeletal muscle: (i) comparable in-creases in SDH activity in both type I and type IIA fibres; (ii) com-parable increases in glycogen content of type I and IIA fibres; and(iii) reductions in the fold change of PGC-1�, SIRT1, and SOD2 geneexpression following training with RSV.

RSV does not augment, but may impair trainingadaptations

The current data set clearly demonstrates that RSV supplemen-tation (150 mg·day−1) does not augment increases in aerobic oranaerobic capacity, exercise substrate utilization, or muscle-fibre–

specific adaptations following HIIT, findings that contradictobservations made in animal models (Dolinsky et al. 2012; Hartet al. 2013; Menzies et al. 2013). Further, the significant interactioneffect observed for peak aerobic power (Table 1), combined withlarge ESs (Cohen’s d) observed in placebo and small to moderateeffect sizes observed with RSV for our measures of exercise per-formance (VO2peak, Wingate peak/average power, training sessionperformance), suggest that RSV may actually be impairing/alter-ing the adaptive response to training. This suggestion is consis-tent with recent observations made in older adults (Gliemannet al. 2013). Thus, while the differences between groups from thecurrent study should be interpreted with caution given the non-significant interaction effects observed, they do raise the possi-bility that RSV may impair the adaptive response to HIIT andhighlight the importance of future, large-scale, randomized con-trol trails seeking to clarify the impact of RSV on the adaptiveresponse to exercise in humans.

RSV and training-induced increases in maximal oxygenuptake

Evidence from animal models suggests that RSV may act as anexercise mimetic and (or) ergogenic aid augmenting improve-ments in exercise capacity and skeletal muscle metabolism in-duced by endurance training (Dolinsky et al. 2012; Hart et al. 2013;Menzies et al. 2013). Contrary to these animal studies, a recentstudy evaluating the impact of RSV supplementation on training-induced health outcomes, including VO2peak, suggested that RSVmay actually oppose the effects of exercise training in humans(Gliemann et al. 2013). Consistent with the failure of RSV to aug-ment the training response in humans, VO2peak increased follow-ing training in both groups with no statistically significant groupby time interaction effect observed.

In animal models, RSV augments the training response via theactivation of the AMPK/SIRT1/PGC-1� pathway and the inductionof mitochondrial biogenesis in skeletal muscle (Menzies et al.2013). This effect appears to contribute to improved aerobic exer-cise capacity (Dolinsky et al. 2012; Lagouge et al. 2006). In thecurrent study, we observed comparable increases in SDH activitybetween groups (Fig. 3C), suggesting similar increases in mito-chondrial content (Larsen et al. 2012). However, while the lack of asignificant interaction between groups makes this finding diffi-cult to interpret with confidence, no effect of training on RER waspresent in the placebo group (rest: ES = −0.04, exercise: ES = 0.02),

Fig. 3. Effects of 4 weeks of low-volume high-intensity interval training supplemented with daily resveratrol (RSV) or placebo on anaerobicexercise capacity, training power, and exercise respiratory exchange ratio (RER). (A) Wingate peak power before (Pre) and after (Post) training.(B) Average power of all intervals, not including rest periods, during the first and eleventh training sessions. Submaximal exercise RERPre- and Post-training with placebo (C) and RSV (D) supplementation. *, Main effect of training (p < 0.05).

Pagination not final (cite DOI) / Pagination provisoire (citer le DOI)

Scribbans et al. 5

Published by NRC Research Press

App

l. Ph

ysio

l. N

utr.

Met

ab. D

ownl

oade

d fr

om w

ww

.nrc

rese

arch

pres

s.co

m b

y Q

ueen

s U

nive

rsity

on

09/1

5/14

For

pers

onal

use

onl

y.

while RSV supplementation resulted in a large effect both at rest(ES = 0.83) and during exercise (ES = 0.79) following training(Fig. 2D). This result is similar to observations made previously(Gliemann et al. 2013) and is consistent with reduced mitochon-drial volume (Yeo et al. 2010) and oxidative capacity (Perry et al.2008; Phillips et al. 1996) following RSV supplementation. Further,PGC-1� gene expression was lower in the RSV group (Fig. 5A),suggesting that RSV supplementation may be somehow limitingand (or) preventing the activation of PGC-1�, which is typicallyassociated with exercise training. These results are inconsistentwith RSV’s reported ability to activate the AMPK/SIRT1/PCG-1� axisin animal and cellular models (Cantó and Auwerx 2009; Hart et al.2013; Lagouge et al. 2006) but adds to a growing body of evidencedemonstrating that AMPK/SIRT1 are not activated (Poulsen et al.2013; Yoshino et al. 2012), and may in fact be inhibited (Skrobuket al. 2012), by RSV in human skeletal muscle.

While differential effects of RSV in animals and humans havebeen attributed to potential interspecies differences in the effectsof RSV, they may also be related to the significantly reduced dos-age typically administered to humans compared with animals(Smoliga and Blanchard 2013). For example, in the present studyparticipants received an �50-fold lower dose than those adminis-tered in animal studies (Dolinsky et al. 2012; Hart et al. 2013;Menzies et al. 2013), potentially resulting in low bioavailability ofRSV (Brown et al. 2010). In addition to potentially limiting theability of RSV to activate AMPK/SIRT1/PGC-1�, low bioavailabilityof RSV in humans may cause it to act primarily as an antioxidant(Baur and Sinclair 2006). Consistent with RSV having anti-oxidanteffects within skeletal muscle, we observed a significant (p < 0.05)difference in the fold change of PGC-1�, SIRT1, and SOD2 geneexpression, and a trend for a reduction (p = 0.18) in GPx1 geneexpression with RSV (Fig. 5). These results are similar to those

Fig. 4. Effects of 4 weeks of low-volume high-intensity interval training supplemented with daily resveratrol (RSV) or placebo on fibre-typedistribution and fibre-type–specific enzyme capacities. (A) Representative slides of immunofluorescent fibre-type analysis (blue fibres are type I,green are type IIA, red/green are type IIX/IIAX) with serial sections of succinate dehydrogenase (SDH) and �-glycerophosphate dehydrogenase(GPD) activity before (Pre) and after (Post) training. (B) Percentage of total fibre distribution of type I, IIA and IIX/IIAX fibres Pre- and Post-training.Fibre-type–specific change in SDH (C) and GPD (D) activity Pre- and Post-training in type I, and IIA fibres. Bars represent 100 �m. AU, arbitraryunits. *, Main effect of training (p < 0.05).

Pagination not final (cite DOI) / Pagination provisoire (citer le DOI)

6 Appl. Physiol. Nutr. Metab. Vol. 39, 2014

Published by NRC Research Press

App

l. Ph

ysio

l. N

utr.

Met

ab. D

ownl

oade

d fr

om w

ww

.nrc

rese

arch

pres

s.co

m b

y Q

ueen

s U

nive

rsity

on

09/1

5/14

For

pers

onal

use

onl

y.

Fig. 5. Effects of 4 weeks of low-volume high-intensity interval training supplemented with daily resveratrol (RSV) or placebo onintramuscular glycogen and lipid storage. (A) Representative slides of glycogen (Periodic Acid–Schiff reaction) and intramuscular lipid (IML)content (Oil Red O staining) before (Pre) and after (Post) training. See representative fibre-type slides (Fig. 2A). Fibre-type–specific fold changesin glycogen content in type I (B) and IIA (C) fibres. (D) Fibre-type–specific fold changes in intramuscular lipid content in type I and IIA fibres.Bars represent 100 �m. AU, arbitrary units; OD, optical density. *, Main effect of training (p < 0.05).

Fig. 6. Effects of 4 weeks of low-volume high-intensity interval training supplemented with daily resveratrol (RSV) or placebo on geneexpression. Fold change from pretraining (Pre) in the expression of (A) peroxisome proliferator-activated receptor gamma coactivator 1 alpha(PGC-1�), (B) silent mating type information regulation 2 homolog 1 (SIRT1), (C) superoxide dismutase 2 (SOD2), and (D) glutathione peroxidase 1(GPx1). AU, arbitrary units. #, Significantly (p < 0.05) different from placebo.

Pagination not final (cite DOI) / Pagination provisoire (citer le DOI)

Scribbans et al. 7

Published by NRC Research Press

App

l. Ph

ysio

l. N

utr.

Met

ab. D

ownl

oade

d fr

om w

ww

.nrc

rese

arch

pres

s.co

m b

y Q

ueen

s U

nive

rsity

on

09/1

5/14

For

pers

onal

use

onl

y.

observed following the administration of exogenous antioxidantssuch as vitamin C (Gomez-Cabrera et al. 2008; Paulsen et al. 2014). Thefunctional impact of these changes in gene expression is unclear asthe protein content of GPx1 and SOD2 appear unaffected by RSV sup-plementation (Gliemann et al. 2013). However, given the lack of aneffect of antioxidant treatment (vitamins C and E) on changes inVO2peak (Gomez-Cabrera et al. 2008; Paulsen et al. 2014), it appearsunlikely that an antioxidant effect of RSV would be inhibitingexercise-induced increases in VO2peak. Thus, while the impact of RSVon VO2peak appears to be different between animals and humans, themechanisms underlying these differential responses remain unclearand represent an important area for future study.

RSV and training-induced increases in exercise poweroutput

In contrast to aerobic exercise performance, little work hasexamined the impact of RSV supplementation on training-induced improvements in anaerobic exercise capacity. However,in animals RSV does increase motor coordination (Lagouge et al.2006), isometric force production (Dolinsky et al. 2012), and mus-cular strength (Hart et al. 2013; Lagouge et al. 2006). In the currentstudy, we observed a main effect of training on the training-induced increase in Wingate peak power (placebo: � = 62 W, ES =0.84; RSV: � = 12 W, ES = 0.12; Fig. 3A). Further, mean trainingsession power increased (p < 0.05) from the first to the eleventhtraining session in both groups (placebo: �75 W, ES = 0.87; RSV:�44 W, ES = 0.45; p = 0.06). For both of these variables the effect oftraining was large in the in the placebo group and small to mod-erate with RSV. This suggests that RSV supplementation mayeither impair adaptations that result in increases in anaerobicpower, or somehow limit the ability of skeletal muscle to generatehigh levels of force. Interestingly, RSV inhibits ATP synthase(Zheng and Ramirez 2000) and complex I and III of the respiratorychain in rodent brain mitochondrial fractions (Zini et al. 1999) andimpairs ATP production in a variety of cell models (Hawley et al.2010; Higashida et al. 2013; Zang et al. 2006). Although speculative,if this effect is also present in human skeletal muscle, a reducedcapacity to generate ATP may contribute to the reductions inskeletal muscle power production observed in the present study.

SummaryThe present study demonstrates that 4 weeks of RSV supple-

mentation during a training intervention in humans does notaugment the magnitude of training-induced increases in maximaloxygen uptake and anaerobic exercise capacity and abolishestraining-induced increases in skeletal muscle gene expression ofPGC-1�, SIRT1, and SOD2. Further, the observation that the effect oftraining on exercise performance outcomes was large in the pla-cebo group and small to moderate with RSV raises the possibilitythat RSV may actually impair the adaptive response to HIIT inhumans, although there is a need for further research to confirmthis assertion. While concerns regarding the bioavailability of RSV

in humans cannot be ignored (Brown et al. 2010), our results ques-tion and even contradict the ability of RSV to act as an ergogenicaid in humans and highlight the need for further research exam-ining the impact of RSV supplementation on mitochondrial func-tion and training-induced skeletal muscle and whole-bodyadaptations in humans.

AcknowledgementsWe are grateful to a dedicated group of volunteers for their help

in conducting training sessions. We would also like to acknowl-edge our participants, without whom this study would not havebeen possible.

ReferencesBaur, J.A., and Sinclair, D.A. 2006. Therapeutic potential of resveratrol: the in

vivo evidence. Nat. Rev. Drug Discov. 5(6): 493–506. doi:10.1038/nrd2060.PMID:16732220.

Bergstrom, J. 1975. Percutaneous needle biopsy of skeletal muscle in physiolog-ical and clinical research. Scand. J. Clin. Lab. Invest. 35(7): 609–616. doi:10.3109/00365517509095787. PMID:1108172.

Blanco, C.E., Sieck, G.C., and Edgerton, V.R. 1988. Quantitative histochemicaldetermination of succinic dehydrogenase activity in skeletal muscle fibres.Histochem. J. 20(4): 230–243. doi:10.1007/BF01747468. PMID:3209423.

Bloemberg, D., and Quadrilatero, J. 2012. Rapid determination of myosin heavychain expression in rat, mouse, and human skeletal muscle using multicolorimmunofluorescence analysis. PLoS ONE. 7(4): e35273. doi:10.1371/journal.pone.0035273. PMID:22530000.

Brown, V.A., Patel, K.R., Viskaduraki, M., Crowell, J.A., Perloff, M., Booth, T.D.,et al. 2010. Repeat dose study of the cancer chemopreventive agent resvera-trol in healthy volunteers: safety, pharmacokinetics, and effect on theinsulin-like growth factor axis. Cancer Res. 70(22): 9003–9011. doi:10.1158/0008-5472.CAN-10-2364. PMID:20935227.

Burgomaster, K.A., Howarth, K.R., Phillips, S.M., Rakobowchuk, M.,MacDonald, M.J., McGee, S.L., et al. 2008. Similar metabolic adaptations dur-ing exercise after low volume sprint interval and traditional endurance train-ing in humans. J. Physiol. 586(1): 151–160. PMID:17991697.

Cantó, C., and Auwerx, J. 2009. PGC-1�, SIRT1 and AMPK, an energy sensingnetwork that controls energy expenditure. Curr. Opin. Lipidol. 20(2): 98–105.doi:10.1097/MOL.0b013e328328d0a4. PMID:19276888.

Chomczynski, P., and Sacchi, N. 2006. The single-step method of RNA isolationby acid guanidinium thiocyanate–phenol–chloroform extraction: twenty-something years on. Nat. Protoc. 1(2): 581–585. doi:10.1038/nprot.2006.83.PMID:17406285.

Cohen, J. 1988. Statistical Power Analysis for the Behavioral Sciences. Routledge,Hillsdale, N.J., USA.

Crandall, J.P., Oram, V., Trandafirescu, G., Reid, M., Kishore, P., Hawkins, M.,et al. 2012. Pilot Study of Resveratrol in Older Adults With Impaired GlucoseTolerance. J. Gerontol. A Biol. Sci. Med. Sci. 67(12): 1307–1312. doi:10.1093/gerona/glr235. PMID:22219517.

Dolinsky, V.W., Jones, K.E., Sidhu, R.S., Haykowsky, M., Czubryt, M.P.,Gordon, T., et al. 2012. Improvements in skeletal muscle strength and cardiacfunction induced by resveratrol during exercise training contribute to en-hanced exercise performance in rats. J. Physiol. 590(11): 2783–2799. doi:10.1113/jphysiol.2012.230490. PMID:22473781.

Edgett, B.A., Foster, W.S., Hankinson, P.B., Simpson, C.A., Little, J.P.,Graham, R.B., et al. 2013. Dissociation of Increases in PGC-1� and Its Regula-tors from Exercise Intensity and Muscle Activation Following Acute Exercise.PLoS ONE, 8(8): e71623. doi:10.1371/journal.pone.0071623. PMID:23951207.

Faul, F., Erdfelder, E., Lang, A.-G., and Buchner, A. 2007. G*Power 3: A flexiblestatistical power analysis program for the social, behavioral, and biomedicalsciences. Behavior Research Methods, 39(2): 175–191. doi:10.3758/BF03193146.PMID:17695343.

Gliemann, L., Schmidt, J.F., Olesen, J., Bienso, R.S., Peronard, S.L.,Grandjean, S.U., et al. 2013. Resveratrol blunts the positive effects of exercisetraining on cardiovascular health in aged men. J. Physiol. 591(20): 5047–5059.doi:10.1113/jphysiol.2013.258061. PMID:23878368.

Gomez-Cabrera, M.-C., Domenech, E., Romagnoli, M., Arduini, A., Borras, C.,Pallardo, F.V., et al. 2008. Oral administration of vitamin C decreases musclemitochondrial biogenesis and hampers training-induced adaptations in en-durance performance. Am. J. Clin. Nutr. 87(1): 142–149. PMID:18175748.

Halkjaer-Kristensen, J.J., and Ingemann-Hansen, T.T. 1979. Microphotometricanalysis of NADH-tetrazolium reductase and alpha-glycerophosphate dehy-drogenase in human quadriceps muscle. Histochem. J. 11(2): 127–136. doi:10.1007/BF01002990. PMID:155667.

Hart, N., Sarga, L., Csende, Z., Koltai, E., Koch, L.G., Britton, S.L., et al. 2013.Resveratrol enhances exercise training responses in rats selectively bred forhigh running performance. Food and Chemical Toxicology, 61: 53–59. doi:10.1016/j.fct.2013.01.051. PMID:23422033.

Hawley, S.A., Ross, F.A., Chevtzoff, C., Green, K.A., Evans, A., Fogarty, S., et al.2010. Use of cells expressing y subunit variants to identify diverse mecha-

Table 3. Fold change in gene expression (AU)following 4 weeks of low-volume high-intensityinterval training supplemented with either res-veratrol (RSV) or placebo.

Placebo (n = 8) RSV (n = 8)

EGR1 1.12±0.15 1.68±0.48GCN5 1.00±0.07 1.05±0.09p53 0.95±0.10 1.02±0.17PDK4 1.38±0.28 1.11±0.18RIP140 1.13±0.11 0.95±0.10

Note: Data are means ± SE unless otherwise indicated.EGR1, early growth response protein 1; GCN5, general con-trol nonderepressible 5; PDK4, pyruvate dehydrogenase ki-nase 4; RIP140, receptor-interacting protein 140.

Pagination not final (cite DOI) / Pagination provisoire (citer le DOI)

8 Appl. Physiol. Nutr. Metab. Vol. 39, 2014

Published by NRC Research Press

App

l. Ph

ysio

l. N

utr.

Met

ab. D

ownl

oade

d fr

om w

ww

.nrc

rese

arch

pres

s.co

m b

y Q

ueen

s U

nive

rsity

on

09/1

5/14

For

pers

onal

use

onl

y.

nisms of AMPK activation. Cell Metab. 11(6): 554–565. doi:10.1016/j.cmet.2010.04.001. PMID:20519126.

Higashida, K., Kim, S.H., Jung, S.R., Asaka, M., Holloszy, J.O., and Han, D.-H. 2013.Effects of resveratrol and SIRT1 on PGC-1� activity and mitochondrial biogen-esis: a reevaluation. Plos Biol. 11: e1001603. doi:10.1371/journal.pbio.1001603.PMID:23874150.

Joyner, M.J. 2013. Food for thought - resveratrol vs. exercise training. J. Physiol.591(20): 4953–4953. doi:10.1113/jphysiol.2013.263004.

Koopman, R.R., Schaart, G.G., and Hesselink, M.K.M. 2001. Optimisation of oilred O staining permits combination with immunofluorescence and auto-mated quantification of lipids. Histochem. Cell Biol. 116(1): 63–68. doi:10.1007/s004180100297. PMID:11479724.

Lagouge, M., Argmann, C., Gerhart-Hines, Z., Meziane, H., Lerin, C., Daussin, F.,et al. 2006. Resveratrol improves mitochondrial function and protectsagainst metabolic disease by activating SIRT1 and PGC-1�. Cell, 127(6): 1109–1122. doi:10.1016/j.cell.2006.11.013. PMID:17112576.

Larsen, S., Nielsen, J., Hansen, C.N., Nielsen, L.B., Wibrand, F., Stride, N., et al.2012. Biomarkers of mitochondrial content in skeletal muscle of healthyyoung human subjects. J. Physiol. 590(14): 3349–3360. doi:10.1113/jphysiol.2012.230185. PMID:22586215.

Livak, K.J., and Schmittgen, T.D. 2001. Analysis of relative gene expression datausing real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Meth-ods, 25(4): 402–408. doi:10.1006/meth.2001.1262. PMID:11846609.

Ma, J.K., Scribbans, T.D., Edgett, B.A., Colin Boyd, J., Simpson, C.A., Little, J.P.,et al. 2013. Extremely low-volume, high-intensity interval training improvesexercise capacity and increases mitochondrial protein content in humanskeletal muscle. Open J. Mol. Integ. Phys. 03(04): 202–210. doi:10.4236/ojmip.2013.34027.

McRae, G., Payne, A., Zelt, J.G.E., Scribbans, T.D., Jung, M.E., Little, J.P., et al. 2012.Extremely low volume, whole-body aerobic-resistance training improves aer-obic fitness and muscular endurance in females. Appl. Physiol. Nutr. Metab.37: 1124–1131. doi:10.1139/h2012-093. PMID:22994393.

Menzies, K.J., Singh, K., Saleem, A., and Hood, D.A. 2013. Sirtuin 1-mediatedEffects of Exercise and Resveratrol on Mitochondrial Biogenesis. J. Biol.Chem. 288(10): 6968–6979. doi:10.1074/jbc.M112.431155. PMID:23329826.

Murase, T., Haramizu, S., Ota, N., and Hase, T. 2008. Suppression of the aging-associated decline in physical performance by a combination of resveratrolintake and habitual exercise in senescence-accelerated mice. Biogerontology,10(4): 423–434. doi:10.1007/s10522-008-9177-z. PMID:18830683.

Paulsen, G., Cumming, K.T., Holden, G., Hallén, J., Rønnestad, B.R., Sveen, O.,et al. 2014. Vitamin C and E supplementation hampers cellular adaptation toendurance training in humans: a double-blind randomized controlled trial.J. Physiol. doi:10.1113/jphysiol.2013.267419.

Pearson, K.J., Baur, J.A., Lewis, K.N., Peshkin, L., Price, N.L., Labinskyy, N., et al.2008. Resveratrol delays age-related deterioration and mimics transcrip-tional aspects of dietary restriction without extending life span. Cell Metab.8(2): 157–168. doi:10.1016/j.cmet.2008.06.011. PMID:18599363.

Perry, C.G.R., Heigenhauser, G.J.F., Bonen, A., and Spriet, L.L. 2008. High-intensity aerobic interval training increases fat and carbohydrate metaboliccapacities in human skeletal muscle. Appl. Physiol. Nutr. Metab. 33(6): 1112–1123. doi:10.1139/H08-097. PMID:19088769.

Phillips, S.M., Green, H.J., Tarnopolsky, M.A., Heigenhauser, G.J., and Grant, S.M.1996. Progressive effect of endurance training on metabolic adaptations inworking skeletal muscle. Am. J. Physiol. 270(2 Pt. 1): E265–E272.

Poulsen, M.M., Vestergaard, P.F., Clasen, B.F., Radko, Y., Christensen, L.P.,

Stødkilde-Jørgensen, H., et al. 2013. High-dose resveratrol supplementationin obese men: an investigator-initiated, randomized, placebo-controlled clin-ical trial of substrate metabolism, insulin sensitivity, and body composition.Diabetes, 62(4): 1186–1195. doi:10.2337/db12-0975. PMID:23193181.

Quadrilatero, J., Bombardier, E., Norris, S.M., Talanian, J.L., Palmer, M.S.,Logan, H.M., et al. 2010. Prolonged moderate-intensity aerobic exercise doesnot alter apoptotic signaling and DNA fragmentation in human skeletalmuscle. Am. J. Physiol. Endocrinol. Metab. 298(3): E534–E547. doi:10.1152/ajpendo.00678.2009. PMID:19996388.

Rasmussen, R. 2001. Quantification on the LightCycler. In Rapid Cycle Real-TimePCR. Edited by S. Meuer, C. Wittwer, and K.-I. Nakagawara. Springer. pp.21–34. doi:10.1007/978-3-642-59524-0_3.

Shepherd, S.O., Cocks, M., Tipton, K.D., Ranasinghe, A.M., Barker, T.A.,Burniston, J.G., et al. 2013. Sprint interval and traditional endurance trainingincrease net intramuscular triglyceride breakdown and expression of perili-pin 2 and 5. J. Physiol. 591(3): 657–675. doi:10.1113/jphysiol.2012.240952.PMID:23129790.

Skrobuk, P., Kraemer, S., Semenova, M.M., Zitting, A., and Koistinen, H.A. 2012.Acute exposure to resveratrol inhibits AMPK activity in human skeletal mus-cle cells. Diabetologia, 55(11): 3051–3060. doi:10.1007/s00125-012-2691-1. PMID:22898769.

Smoliga, J.M., and Blanchard, O.L. 2013. Recent data do not provide evidence thatresveratrol causes ‘mainly negative’ or ‘adverse’ effects on exercise trainingin humans. J. Physiol. 591(20): 5251–5252. doi:10.1113/jphysiol.2013.262956.PMID:24130323.

Tabata, I., Nishimura, K., Kouzaki, M., Hirai, Y., Ogita, F., Miyachi, M., et al. 1996.Effects of moderate-intensity endurance and high-intensity intermittenttraining on anaerobic capacity and VO2max. Med. Sci. Sports Exerc. 28(10):1327–1330. doi:10.1097/00005768-199610000-00018. PMID:8897392.

Terada, S., Tabata, I., and Higuchi, M. 2004. Effect of high-intensity intermittentswimming training on fatty acid oxidation enzyme activity in rat skeletalmuscle. Jpn. J. Physiol. 54(1): 47–52. doi:10.2170/jjphysiol.54.47. PMID:15040848.

Timmers, S., Konings, E., Bilet, L., Houtkooper, R.H., van de Weijer, T.,Goossens, G.H., et al. 2011. Calorie restriction-like effects of 30 days of res-veratrol supplementation on energy metabolism and metabolic profile inobese Humans. Cell Metab. 14(5): 612–622. doi:10.1016/j.cmet.2011.10.002.PMID:22055504.

Yeo, W.K., McGee, S.L., Carey, A.L., Paton, C.D., Garnham, A.P., Hargreaves, M.,et al. 2010. Acute signalling responses to intense endurance training com-menced with low or normal muscle glycogen. Exp. Physiol. 95(2): 351–358.doi:10.1113/expphysiol.2009.049353. PMID:19854796.

Yoshino, J., Conte, C., Fontana, L., Mittendorfer, B., Imai, S.-I., Schechtman, K.B.,et al. 2012. Resveratrol Supplementation does not improve metabolic func-tion in nonobese women with normal glucose tolerance. Cell Metab. 16(5):658–664. doi:10.1016/j.cmet.2012.09.015. PMID:23102619.

Zang, M., Xu, S., Maitland-Toolan, K.A., Zuccollo, A., Hou, X., Jiang, B., et al. 2006.Polyphenols stimulate AMP-activated protein kinase, lower lipids, and in-hibit accelerated atherosclerosis in diabetic LDL receptor-deficient mice. Di-abetes, 55(8): 2180–2191. doi:10.2337/db05-1188. PMID:16873680.

Zheng, J., and Ramirez, V.D. 2000. Inhibition of mitochondrial proton F0F1-ATPase/ATP synthase by polyphenolic phytochemicals. Br. J. Pharmacol.130(5): 1115–1123. doi:10.1038/sj.bjp.0703397. PMID:10882397.

Zini, R., Morin, C., Bertelli, A., Bertelli, A.A., and Tillement, J.P. 1999. Effects ofresveratrol on the rat brain respiratory chain. Drugs Exp. Clin. Res. 25(2–3):87–97. PMID:10370869.

Pagination not final (cite DOI) / Pagination provisoire (citer le DOI)

Scribbans et al. 9

Published by NRC Research Press

App

l. Ph

ysio

l. N

utr.

Met

ab. D

ownl

oade

d fr

om w

ww

.nrc

rese

arch

pres

s.co

m b

y Q

ueen

s U

nive

rsity

on

09/1

5/14

For

pers

onal

use

onl

y.