RESEARCH ARTICLE Open Access

A novel point mutation within the EDA genecauses an exon dropping in mature RNA inHolstein Friesian cattle breed affected by X-linkedanhidrotic ectodermal dysplasiaMaria Gargani*, Alessio Valentini and Lorraine Pariset

Abstract

Background: X-linked anhidrotic ectodermal dysplasia is a disorder characterized by abnormal development oftissues and organs of ectodermal origin caused by mutations in the EDA gene. The bovine EDA gene encodes theectodysplasin A, a membrane protein expressed in keratinocytes, hair follicles and sweat glands, which is involvedin the interactions between cell and cell and/or cell and matrix. Four mutations causing ectodermal dysplasia incattle have been described so far.

Results: We identified a new single nucleotide polymorphism (SNP) at the 9th base of exon 8 in the EDA gene intwo calves of Holstein Friesian cattle breed affected by ectodermal dysplasia. This SNP is located in the exonicsplicing enhancer (ESEs) recognized by SRp40 protein. As a consequence, the spliceosome machinery is no longerable to recognize the sequence as exonic and causes exon skipping. The mutation determines the deletion of theentire exon (131 bp) in the RNA processing, causing a severe alteration of the protein structure and thus thedisease.

Conclusion: We identified a mutation, never described before, that changes the regulation of alternative splicingin the EDA gene and causes ectodermal dysplasia in cattle. The analysis of the SNP allows the identification ofcarriers that can transmit the disease to the offspring. This mutation can thus be exploited for a rational andefficient selection of unequivocally healthy cows for breeding.

BackgroundEctodermal dysplasia (ED) is a genetic disease character-ized by abnormal development of tissues and organs ofectodermal origin, including teeth, hair, nails and sweatglands [1]. There are different forms of ED, the mostcommon of which is caused by mutations in X-linkedectodysplasin gene A (EDA). It has been described inhuman [2], mouse [3], dog [4] and cattle [5]. Commonfeatures shown by the affected individuals are hypodon-tia, sparse hair and absence of sweat glands.Numerous mutations in the X-linked EDA gene have

been identified as the cause of disease in human [6-8]and mouse [3,9].

In cattle, the gene EDA is located on chromosomeX q22 [10] and encodes ectodyslpasin-A, a membraneprotein expressed in keratinocytes, hair follicles andsweat glands, which is involved in the interactionbetween cell and cell and/or cell and matrix. The EDAgene may encode for two protein isoforms, EDA1 andEDA2, that differ for the presence or absence of twoaminoacids [5]. These two isoforms are members ofTFN family.Since the disease follows X-linked recessive transmis-

sion, only males present the full form, while heterozy-gous females (carriers) are asymptomatic or show slightsymptoms, such as hypotrichosis and reduction in thenumber of teeth. The genetic transmission of this dis-ease in cattle was described by Drögemüller and colla-borators [5], who found a deletion of the whole exon 3of EDA gene in an affected German Holstein calves and

* Correspondence: maria.gargani@unitus.itDepartment for Innovation in Biological, Agro-Food and Forest systems(DIBAF), University of Tuscia, Viterbo, Italy

Gargani et al. BMC Veterinary Research 2011, 7:35http://www.biomedcentral.com/1746-6148/7/35

© 2011 Gargani et al; licensee BioMed Central Ltd. This is an Open Access article distributed under the terms of the Creative CommonsAttribution License (http://creativecommons.org/licenses/by/2.0), which permits unrestricted use, distribution, and reproduction inany medium, provided the original work is properly cited.

proposed to use for the bovine disease the name of thehomologous human syndrome. The same authors subse-quently described a G/T mutation at the beginning ofintron 8 that leads to a defect in splicing and an in-frame protein deletion of 51 or 45 base pairs withrespect to the EDA1 and EDA2 transcripts [11] and aC/T SNP at position 24 of exon 6 that causes a non-sense mutation of arginine (R) into a stop codon (X)[12].Recently a new case of ectodermal dysplasia was

reported in Danish Red Holstein cattle by Karlskov-Mortensen and collaborators [13]. They found a newtranscript variant including an insertion of 161 bp LINEfragment between exon1 and exon 2.In our study we screened the EDA gene in two

affected calves and some of their close relatives, for atotal of eight animals, in order to identify the mutationscausing the disease in Holstein Friesian cattle breed.

ResultsCattle samples were screened for mutations throughDNA and RNA sequence analysis. By sequencing theDNA of the sampled individuals, we identified a singlenucleotide polymorphism (SNP) G/A at the 9th base ofexon 8 [GenBank: AJ278907.1 position 30.549]. Bothaffected calves were hemizygous A/-, the mother andthe four sisters were heterozygous G/A (therefore allcarriers), the healthy brother was hemizygous G/-(Figure 1,2). To verify if the mutation had effects onexon splicing we performed an analysis using HumanSplicing Finder software [14]. The results revealed thatthe mutation is located within the exonic splicingenhancer (ESE) recognized by SR proteins.

At the RNA level we performed reverse transcriptasePCR (RT-PCR) and sequencing of the cDNA. In theaffected calves a deletion in the amplified band of 323bp, shown by healthy animals (Figure 3), compatible insize with the skipping of the whole exon 8 (131 bp), wasobserved. The mother and the four sisters presentedtwo bands of 323 bp and 192 bp, corresponding tothose of healthy and affected individuals respectively.Sequencing of the RT-PCR products revealed that theamplified fragment of the affected animals lacked exactly131 bp, corresponding to exon 8. At the protein level,the exon skipping leads to a frameshift and conse-quently to a premature stop codon. The mutated pro-tein is lacking in 119 amino acids (about half of theprotein) including the TFN domain (Figure 4).

DiscussionThe identification of mutations causing a genetic diseaseis of great economic importance as it allows diagnosingthe healthy carriers, and then the eradication of the dis-ease. In this study we identified a new mutation in thebovine EDA gene causing ectodermal dysplasia in Hol-stein Friesian cattle breed.The G/A transversion we found in the affected calves

causes a change from the glycine residue encoded bythe wild type allele to a serine residue. This missensemutation changes both amino acid sequence and proteinstructure causing deleterious effects. Several studies haveshown that some missense mutations, located in exonicsplicing regulatory elements, can cause diseases by alter-ing the splicing machinery process [15]. The mutationwe identified causes the incorrect splicing of both geneisoforms (EDA1, EDA2). In the mutated individuals the

G/A G/-

G/AG/A G/AG/AG/- A/- A/-

M

S1 S2 Hb S3 S4 A1 A2

Figure 1 Pedigree of the Friesian cattle family used in this study. Pedigree includes the genotypes at the mutation site of EDA gene.Animals affected with anhidrotic ectodermal dysplasia are shown as solid symbols. Affected calves (A1, A2) were hemizygous A/-, the mother(M) and four sisters (S1, S2, S3, S4) were heterozygous G/A, the healthy brother (Hb) was hemizygous G/-. The pedigree is consistent with an X-chromosomal, recessive trait.

Gargani et al. BMC Veterinary Research 2011, 7:35http://www.biomedcentral.com/1746-6148/7/35

Page 2 of 7

whole exon 8 is excluded from the final mRNAsequence during the splicing process.The accurate removal of introns from pre-mRNA is

essential for correct gene expression. Splicing is primar-ily regulated by splice-site motifs between intron andexon junctions [16]. In addition to the splice-site motifs,several studies have shown that other sequences are

involved in the regulation of splicing process [17-19].They form two classes of regulatory elements: exonicsplicing enhancers (ESEs), recognized by SR proteins,and exonic splicing silencers (ESSs), recognized byhnRNP proteins [18-21]. These sequences have beenidentified by experimental and computationalapproaches [22].In our study, the analysis of splicing revealed that the

mutation is located within the exonic splicing enhancer(ESEs) sequences recognized by SRp40 protein. Thefunction of SR proteins is binding to exonic sequencesand enhancing the identification of the flanking splicesite [23].Several studies have demonstrated that single point

mutations in exonic splicing enhancers (ESEs) lead todisease development [24-26]. For example, a C/Tmutation in ESE sequence found in the human mito-chondrial acetoacetyl-CoA thiolase gene results inexon 10 skipping. The protein is no more functionalcausing the mitochondrial acetoacetyl-CoA thiolase(T2) deficiency disorder [24]. Two silent substitutionsin the Pyruvate dehydrogenase complex (PDHA1 gene)found in most patients with PDHc deficiency causeexon 5 skipping by disruption of a putative exonic spli-cing enhancer [25].The EDA protein consists of a TFN domain for bind-

ing to the receptor, a collagen domain and cutting sitesfor furin. The TNF domain sequence is strongly con-served between cattle, human, mouse and dog demon-strating the presence of a very important motif in thisregion. The mutation we discovered influences the spli-cing process leading to the formation of a truncatedprotein. In the individuals presenting the described G >A transversion, SRp40 protein is no longer able torecognise the ESE sequence resulting in skipping ofexon 8 (Figure 5). At the protein level, this leads to aframeshift deletion causing the loss of the TFN domainin the mutated ectodysplasin. The truncated EDA pro-tein is no longer functional thus causing the ectodermaldysplasia disease.Recently a mutation that leads to a truncated EDA

protein was reported in Danish Red Holstein cattle. Thismutation is an insertion of a LINE element betweenexon1 and exon2 in the EDA transcript, causing a fra-meshift which introduces a premature stop codon in thebeginning of exon 2 [13]. Our results are in agreementwith the data of Drögemüller et al. [11], reporting apoint mutation within the 5’ splice site of intron 8 incattle EDA gene. The mutated transcript described bythose authors uses a cryptic internal splice acceptor sitewithin exon 8. The mutation we identified is locatedwithin the same cryptic splice site: this is a further con-firmation supporting the involvement of the SNP wedescribed in the splicing process.

Figure 2 Sequence analysis of exon 8 from wild, carriers andaffected animal. The upper sequence is from a healthy animal, theintermediate sequence is from affected calf and the lower sequenceis from an affected calf. Arrow indicates the G/A mutation locatedat position 9 of bovine EDA exon 8.

Gargani et al. BMC Veterinary Research 2011, 7:35http://www.biomedcentral.com/1746-6148/7/35

Page 3 of 7

ConclusionWe identified a new single nucleotide mutation thatcauses ectodermal dysplasia in Holstein Friesian cattlebreed. The analysis of this SNP allows the identificationof the three possible genotypes (healthy, affected and

carrier) and thus can be used to highlight carrier cowsthat can transmit the disease to the offspring. Ectodys-plasia causes a significant economic loss: the use of het-erozygous carriers in breeding results in a 25% chanceof birth of an affected animal and 25% of birth of a

Figure 3 Agarose gel electrophoreses of RT-PCR products from exon 6 to exon 9 in a Friesian cattle family. The wild type (W) and thehealthy brother (Hb) showed a single band of 323 bp. The affected calves (A1, A2) showed a band of 192 bp. The mother (M) and the foursisters (S1, S2, S3, S4), all heterozygous, presented both bands. (MK) 50 bp ladder, arrows show the two bands of 192 bp and 323 bp.

Figure 4 Alignment of EDA amino acid sequence in affected and healthy cattle. The lack of exon 8 in affected animals leads to aframeshift and a premature stop codon during translation process. The TNF domain is shown in grey.

Gargani et al. BMC Veterinary Research 2011, 7:35http://www.biomedcentral.com/1746-6148/7/35

Page 4 of 7

carrier. Therefore, the early screening for heterozygotesthat are carriers of the described mutation but do notexhibit the disease would particularly useful.

MethodsSamples collectionEight animals (two affected males, their mother, ahealthy brother and four sisters), plus one healthy con-trol of Friesian breed, were screened for mutationswithin the EDA gene. The affected animals showedcomplete hypodontia and a generalized hypotrichosiswith a short hair coat (Figure 6). The severity of hypo-trichosis varied in different areas of the body: both ani-mals showed a short hair coat on the head, aroundeyes and on the tail. Moreover the neck, the flanks andthe ventral abdomen appeared completely hairless. Theskin was wrinkled especially on the neck. The absenceof hair coat caused chronic skin problems such abra-sion in both animals. These excoriations were moresevere on the back. The mother showed mild symp-toms of disease. We observed a partial hypotrichosisand hypodontia. The deficiency of the hair coat wasmore severe around ears while hair coat was normalon the flanks. Concerning dentition, we found onlyfour incisors instead of eight and all teeth were longand pointed (Figure 7). Molars were normal in numberand morphology. Moreover, one female showed anabnormal dentition with a partial hypodontia. Weobserved only four incisors bad positioned while thehair coat was normal. All other females are phenotypi-cally sane.

Blood samples were collected in EDTA tubes and fro-zen at -20°C until extraction. Genomic DNA was iso-lated using DNeasy Blood & Tissue Kit (Qiagen),checked for DNA quality on agarose gel and quantifiedusing a DTX microplate reader (Beckman Coulter) afterstaining with Picogreen (Invitrogen).Skin samples were put in RNAlater (Sigma) immedi-

ately after collection and stored at -80°C. Total RNAwas extracted from skin and blood using RNeasy tissueKit (Qiagen) and RNeasy blood Kit (Qiagen) respectivelyand quantified using a DTX microplate reader (BeckmanCoulter) using Quant-it RNA assay (Invitrogen).

Figure 5 A gene model. Splicing patterns in wildtype (wt) and affected (mut) animals. In the wild animals the splicing process leads to anormal transcript. In the affected animals the G/A mutation influences the splicing process producing a truncated transcript in which exon 8 isskipped.

Figure 6 Affected calf. Complete hypodontia and generalizedhypotrichosis in affected calf.

Gargani et al. BMC Veterinary Research 2011, 7:35http://www.biomedcentral.com/1746-6148/7/35

Page 5 of 7

Blood and skin samples collection were performedaccording to the Animal Ethics Committee of CRA,Italy, in agreement with local ethical requirements.

Mutation analysisUsing a forward (5’ TGGGGGTTGTGTACAG 3’) and areverse (5’ TCAGCCATTGGCTGGTCTGGGC 3’) pri-mer located in intron 7 and intron 8 respectively [5],each PCR reaction was performed in 25 ul containing10 ng of genomic DNA, 0.2 mM dNTP, 20 pmol ofeach primer, 1X buffer and 2U Taq polymerase (Bio-line). After a 5 min initial denaturation at 94°C, 30cycles of 30 sec at 94°C, 1 min at 55°C and 1 min at 72°C were carried out. After exosap (USB) purification, thePCR products were sequenced from both directionsusing the same primers with a CEQ8800 sequencer(Beckman Coulter) using DTCS kit (Beckman Coulter)according to manufacturer’s instructions.RT-PCR one step (Qiagen) was performed on total RNA

using a forward primer (5’ ATAAAGCTGGAACTCGAG3’) located in exon 6 and a reverse primer (5’ TTGCCTGTCTCAATACTG 3’) located in exon 9 [11]. The reac-tion was performed in 25 ul containing 10 ug RNA, 1X Buf-fer, 0.2 mM dNTP, 0.6 uM of each primer and 1 ul RT-PCR Enzyme (Qiagen). After a 30 min reverse transcriptionat 50°C and 15 min at 95°C, 30 cycles of 30 sec at 94°C, 1min at 55°C and 1 min at 72°C were performed.The RT-PCR products were sequenced from both

directions using the same primers as described above.Sequences analysis and alignment were performed

using Bioedit software [27].

Splicing analysisIn order to study the effects of mutations on splicingsignals we used Human Splicing Finder Version 2.4.1

[14] available at http://www.umd.be/HSF/. The softwareprovides a tool to predict the effects of mutations onsplicing signals and to identify splicing motifs in thesequence of interest.

AcknowledgementsWe want to thank Mrs Gabriella Porcai for technical assistance and Dr.Riccardo Fortunati who kindly provided samples.

Authors’ contributionsMG carried out the molecular genetic studies and drafted the manuscript.AV participated in design and coordination of the study. LP carried out thedesign of the study and helped to draft the manuscript. All authors readand approved the final manuscript.

Received: 29 December 2010 Accepted: 8 July 2011Published: 8 July 2011

References1. Pinheiro M, Freire Maia: Ectodermal dysplasias: a clinical classification and

a causal review. Am J Med Genet 1994, 53:153-162.2. Kupietzky A, Houpt M: Hypohidrotic ectodermal dysplasia: characteristics

and treatment. Quintessence Int 1995, 26:285-291.3. Ferguson BM, Brockdorff N, Formstone E, Ngyuen T, Kronmiller JE, Zonana J:

Cloning of Tabby, the murine homolog of the human EDA gene:evidence for amembraneassociated protein with a short collagenousdomain. Hum Mol Genet 1997, 6:1589-1594.

4. Lewis JR, Reiter AM, Mauldin EA, Casal ML: Dental abnormalitiesassociated with X-linked hypohidrotic ectodermal dysplasia in dogs.Orthod Craniofac Res 2010, 13(1):40-7.

5. Drögemüller C, Distl O, Leeb T: Partial deletion of the bovine ED1 genecauses anhidrotic ectodermal dysplasia in cattle. Genome Res 2001,11(10):1699-705.

6. Tariq M, Wasif N, Ayub M, Ahmad W: A novel 4-bp insertion mutation inEDA1 gene in a Pakistani family with X-linked hypohidrotic ectodermaldysplasia. Eur J Dermatol 2007, 17(3):209-12.

7. Cluzeau C, Hadj-Rabia S, Jambou M, Mansour S, Guigue P, Masmoudi S,Bal E, Chassaing N, Vincent MC, Viot G, Clauss F, Manière MC, Toupenay S,Merrer ML, Lyonnet S, Cormier-Daire V, Amiel J, Faivre L, de Prost Y,Munnich A, Bonnefont JP, Bodemer C, Smahi A: Only four genes (EDA1,EDAR, EDARADD and WNT10A) account for 90% of hypohidrotic/anhidrotic ectodermal dysplasia cases. Hum Mutat 2010, 32:70-77.

8. Tomb R, Soutou B, Zalloua P: Anhidrotic ectodermal dysplasia. Report ofa rare mutation in EDA1. Ann Dermatol Venereol 2009, 136(1):28-31.

Figure 7 Mother. (A) Deficiency of the hair coat around ears and (B) partial hypodontia in the heterozygous mother.

Gargani et al. BMC Veterinary Research 2011, 7:35http://www.biomedcentral.com/1746-6148/7/35

Page 6 of 7

9. Srivastava AK, Pispa J, Hartung AJ, Du Y, Ezer S, Jenks T, Shimada T,Pekkanen M, Mikkola ML, Ko MS, Thesleff I, Kere J, Schlessinger D: TheTabby phenotype is caused by mutation in a mouse homologue of theEDA gene that reveals novel mouse and human exons and encodes aprotein (ectodysplasin-A) with collagenous domains. Proc Natl Acad SciUSA 1997, 94(24):13069-74.

10. Kuiper H, Kutschke L, Drögemüller C, Leeb T, Distl O: Assignment of thebovine ectodysplasin A gene (ED1) to bovine Xq22- > q24 byfluorescence in situ hybridization. Cytogenet Cell Genet 2001, 92(3-4):356-7.

11. Drögemüller C, Peters M, Pohlenz J, Distl O, Leeb T: A single pointmutation within the ED1 gene disrupts correct splicing at two differentsplice sites and leads to anhidrotic ectodermal dysplasia in cattle. J MolMed 2002, 80(5):319-23.

12. Drögemüller C, Barlund CS, Palmer CW, Leeb T: A novel mutation in thebovine EDA gene causing anhidrotic ectodermal displasia. Arch TierzDummerstorf 2006, 49:615-616.

13. Karlskov-Mortensen P, Cirera S, Nielsen L, Arnbjerg J, Reibel J, Fredholm M,Agerholm JS: Exonization of a LINE1 fragment implicated in X-linkedhypohidrotic ectodermal dysplasia in cattle. Anim Genet 2011.

14. Desmet FO, Hamroun D, Lalande M, Collod-Béroud G, Claustres M,Béroud C: Human Splicing Finder: an online bioinformatics tool topredict splicing signals. Nucleic Acids Res 2009, 37(9):e67.

15. Gorlov IP, Gorlova OY, . Frazier ML, Amos CI: Missense Mutations in hMLH1and hMSH2 Are Associated with Exonic Splicing Enhancers. Am J HumGenet 2003, 73:1157-1161.

16. Woolfe A, Mullikin JC, Elnitski L: Genomic features defining exonic variantsthat modulate splicing. Genome Biol 2010, 11(2):R20.

17. Long JC, Caceres JF: The SR protein family of splicing factors: masterregulators of gene expression. Biochem J 2009, 417(1):15-27.

18. Cartegni L, Krainer AR: Disruption of an SF2/ASF-dependent exonicsplicing enhancer in SMN2 causes spinal muscular atrophy in theabsence of SMN1. Nat Genet 2002, 30(4):377-84.

19. Black DL: Mechanisms of alternative pre-messenger RNA splicing. AnnuRev Biochem 2003, 72:291-336.

20. Jensen CJ, Oldfield BJ, Rubio JP: Splicing, cis genetic variation anddisease. Biochem Soc Trans 2009, 37(6):1311-5.

21. Berasain C, Goñi S, Castillo J, Latasa MU, Prieto J, Avila MA: Impairment ofpre-mRNA splicing in liver disease: mechanisms and consequences.World J Gastroenterol 2010, 16(25):3091-102.

22. Akerman M, David-Eden H, Pinter RY, Mandel-Gutfreund Y: Acomputational approach for genome-wide mapping of splicing factorbinding sites. Genome Biol 2009, 10(3):R30.

23. Lin S, Fu XD: SR proteins and related factors in alternative splicing. AdvExp Med Biol 2007, 623:107-22.

24. Fukao T, Horikawa R, Naiki Y, Tanaka T, Takayanagi M, Yamaguchi S,Kondo N: A novel mutation (c.951C > T) in an exonic splicing enhancerresults in exon 10 skipping in the human mitochondrial acetoacetyl-CoAthiolase gene. Mol Genet Metab 2010, 100(4):339-44.

25. Boichard A, Venet L, Naas T, Boutron A, Chevret L, de Baulny HO, DeLonlay P, Legrand A, Nordman P, Brivet M: Two silent substitutions in thePDHA1 gene cause exon 5 skipping by disruption of a putative exonicsplicing enhancer. Mol Genet Metab 2008, 93(3):323-30.

26. Moseley CT, Mullis PE, Prince MA, Phillips JA: An exon splice enhancermutation causes autosomal dominant GH deficiency. J Clin EndocrinolMetab 2002, 87(2):847-52.

27. Hall TA: BioEdit: a user-friendly biological sequence alignment editor andanalysis program for Windows 95/98/NT. Nucl Acids Symp Ser 1999,41:95-98.

doi:10.1186/1746-6148-7-35Cite this article as: Gargani et al.: A novel point mutation within theEDA gene causes an exon dropping in mature RNA in Holstein Friesiancattle breed affected by X-linked anhidrotic ectodermal dysplasia. BMCVeterinary Research 2011 7:35.

Submit your next manuscript to BioMed Centraland take full advantage of:

• Convenient online submission

• Thorough peer review

• No space constraints or color figure charges

• Immediate publication on acceptance

• Inclusion in PubMed, CAS, Scopus and Google Scholar

• Research which is freely available for redistribution

Submit your manuscript at www.biomedcentral.com/submit

Gargani et al. BMC Veterinary Research 2011, 7:35http://www.biomedcentral.com/1746-6148/7/35

Page 7 of 7