Research Article Emergence of Enteric Viruses in

Research ArticleEmergence of Enteric Viruses in Production Chickens Isa Concern for Avian Health

Elena Mettifogo1 Luis F N Nuntildeez1 Jorge L Chacoacuten1

Silvana H Santander Parra1 Claudete S Astolfi-Ferreira1

Joseacute A Jerez2 Richard C Jones3 and Antonio J Piantino Ferreira1

1 Department of Pathology School of Veterinary Medicine University of Sao Paulo Avendia Professor Orlando Marques de Paiva 87CEP 05508-900 Sao Paulo SP Brazil

2 Department of Preventive Veterinary Medicine and Animal Health School of Veterinary Medicine University of Sao PauloAvendia Professor Orlando Marques de Paiva 87 CEP 05508-900 Sao Paulo SP Brazil

3 Department of Infection Biology Institute of Global Health University of Liverpool Liverpool CH64 7TE UK

Correspondence should be addressed to Antonio J Piantino Ferreira ajpferruspbr

Received 26 August 2013 Accepted 31 October 2013 Published 22 January 2014

Academic Editors A Rak-Mardyła and N Shirai

Copyright copy 2014 Elena Mettifogo et alThis is an open access article distributed under theCreative CommonsAttribution Licensewhich permits unrestricted use distribution and reproduction in any medium provided the original work is properly cited

Several viruses have been identified in recent years in the intestinal contents of chickens and turkeys with enteric problems whichhave been observed in commercial farms worldwide including Brazil Molecular detection of these viruses in Brazil can transformto a big threat for poultry production due to risk for intestinal integrity This disease is characterized by severely delayed growthlow uniformity lethargy watery diarrhea delayed feed consumption and a decreased conversion rate Chicken astrovirus (CAstV)rotavirus reovirus chicken parvovirus (ChPV) fowl adenovirus of subgroup I (FAdV-1) and avian nephritis virus (ANV) wereinvestigated using the conventional polymerase chain reaction (PCR) and the reverse transcription polymerase chain reaction(RT-PCR) In addition the infectious bronchitis virus (IBV) which may play a role in enteric disease was included The virusesmost frequently detected either alone or in concomitance with other viruses were IBV ANV rotavirus and CAstV followed byparvovirus reovirus and adenovirusThis study demonstrates the diversity of viruses in Brazilian chicken flocks presenting entericproblems characterized by diarrhea growth retard loss weight andmortality which reflects themulticausal etiology of this disease

1 Introduction

The economic impact of enteric virus infections on thepoultry industry has been evaluated and ranges from insignif-icant economic effects to those that are severe and causedevastating losses Enteric diseases tend to predominantlyaffect young birds however the disease may occur in allage groups which increases susceptibility to other diseasesdecreases feed conversion efficiency and prolongs the timeto market [1 2] At present no specific treatment exists andcommercially available vaccines have not yet been developedfor any of the viruses that are involved in this disease

Enteric disease was induced by experimental infectionin one-day-old broiler chicks with intestinal content froma broiler flock which has presented enteric problems suchas diarrhea poor performance and mortality [3 4] or with

preparations from the intestinal contents of affected birdsthat did not contain bacteria or protozoa [3 5] Howeverexperimental attempts to reproduce this disease followinginoculation with a single pathogen were unsuccessful Underfield conditions these intestinal infections are usually com-plicated by interactions with other infectious agents or bythe age nutrition and immune status of the birds as wellas the management and environmental conditions whichcomplicated the evaluation of the role of these viruses inthe enteric diseases manifestation [6ndash8] Enteric diseasesrelated to viruses were firstly reported in the late 1970s andis characterized by growth deficiency retarded feather devel-opment diarrhea and other abnormalities [9ndash11] Althoughseveral clinical cases of enteric disease have been observedin several regions of Brazil there is no extensive researchon this syndrome except for studies on the detection of

Hindawi Publishing Corporatione Scientific World JournalVolume 2014 Article ID 450423 8 pageshttpdxdoiorg1011552014450423

2 The Scientific World Journal

some atypical rotaviruses in broiler chickens with enteritis[12 13] rotavirus reovirus and picobirnavirus using thepolyacrylamide gel electrophoresis (PAGE) technique [14]

In the past enteric disease has been called the pale birdsyndrome and helicopter wing disease and was characterizedby poor growth and retarded feather development Thesesymptoms are observed consistently along with the otherless frequent clinical signs including diarrhea increasedmortality and pancreatic and lymphoid atrophy [6 15]Enteric diseases seem to be the most acceptable name for thisclinical manifestation because it most appropriately reflectsthe consistency of the clinical findings and indicates thatthese cases are probably caused by the same infectious agents

In this study we screened seven related viruses aspotential agents of enteric disease in chickens to investigatethe highest number of agents and their emergence in theBrazilian poultry production

2 Materials and Methods

21 Field Samples Two hundred and eighty (280) intestinalcontents samples were collected from commercial chickenfrom nine Brazilian states as follows Rio Grande do SulMinas Gerais Sao Paulo Parana Para Rio de Janeiro SantaCatarina Goias and Ceara The samples were collectedbetween 2008 and 2010 Two hundred and twelve of thesamples were collected from chickens with clinical signs ofenteric problems that were described as diarrhea poorweightgain malabsorption syndrome culling andmortality and 68samples were collected from chickens without clinical histo-ries of enteric problems in the last three reared previouslyflocks Each sample was composed of a pool of intestinalcontents obtained from five chickens of whole intestine fromduodenum to the end of ileumThe age of the chickens variedfrom three days old to 106weeks old broilers broiler breederspullet and layer hen flocks Samples were preserved at minus20∘Cuntil shipment to the Laboratory of Avian Diseases (SaoPaulo SP Brazil) and were kept at minus20∘C until the processing

22 Preparation of Intestinal-Content Samples A 1 5 sus-pension was prepared with Tris-Calcium buffer (TrisHCl01M CaCl

215mM pH 73) [16] After 30 minutes at

room temperature under periodic homogenizations the celldebris was removed by low-speed centrifugation (3300timesgfor 15min) Supernatants were stored at minus20∘C until analysisDNA and RNA were extracted from supernatants usingTRIzol (Invitrogen Valencia CA USA) according to themanufacturerrsquos instructions

23 Reference Viruses ChPV adenovirus CAstV and ANVstrains that had been isolated fromBrazilian flocks andwhoseidentity had been confirmed by sequencing were used aspositive controls in the molecular assays Additionally aMassachusetts vaccine strain (H120) Nebraska calf diarrheavirus and S1133 strains were used as controls for IBVrotavirus and reovirus respectively

24 Primers Previously published primer sets were utilizedfor the reverse-transcriptase polymerase chain reaction (RT-PCR) and for PCR to detect the seven viruses screened in thisstudy The sequences and references are showed in Table 1

25 DNAVirus Detection Conventional PCRwas conductedto detect chicken parvovirus and fowl adenovirus of subgroup1 DNA as previously described [17 18] Briefly extractedDNA (25 120583L) was used as a template for PCR in a 25 120583Lreaction mix that contained 10 pmol of each of the forwardand reverse primers (as described inTable 1) 5 120583Lof 5timesbuffer02mM deoxynucleoside triphosphate (dNTP) mix 125mMMgCl

2 and 1U of Platinum DNA Polymerase (Invitrogen)

The negative control included sterile water Amplificationswere performed in a Biometra DNA thermocycler (BiometraGmbH Goettingen Germany) After a 5min incubation at95∘C 30 cycles of amplification (94∘C for 30 sec 55∘C for1min and 72∘C for 1min) were performed to detect chickenparvovirus and 34 cycles of amplification (94∘C for 1min55∘C for 45 sec and 72∘C for 1min) to detect fowl adenovirussubgroup I The PCRs ended with a final extension stepof 10min at 72∘C The PCR products were visualized afterseparation by electrophoresis in an agarose gel (15) usingBlue Green Dye (LGC Sao Paulo Brazil) to stain the DNAThe size of the amplified product was estimated using the 100base pair DNA Ladder molecular size marker (Invitrogen)

26 RNA Virus Detection RNA isolated from field sampleswas in vitro transcribed and amplified using the One-StepRT-PCR Kit (Qiagen Valencia CA USA) Primer sets thathave been previously described were used to detect CAstVreovirus rotavirus and ANV as described in Table 1 The25 120583L reaction mix contained 1 X Qiagen One Step RT-PCRkit reaction buffer 320 120583M of each dNTP 10 pmol of eachforward and reverse primer 1 120583L of Qiagen RT-PCR enzymeblend and 25 120583L of extracted RNA To detect IBV theprimers and reaction conditions described by Cavanagh etal [19] were used to amplify a 179 bp fragment from the31015840untranslated region To detect ANV andCAstV the primerssets described by Day et al [20] were used

3 Results

At least one virus was detected in 226 (807) of the 280examined samples Of the 212 samples collected from chick-ens with clinical signs such as diarrhea lethargy poor perfor-mance poor weight gain malabsorption and mortality 183(654) were positive for one or more of the screened virusesand in 43 (154) samples at least one enteric-diseases-related virus was detected in samples from healthy chickens(Table 2) All of the investigated viruses were detected inthe intestinal samples from the commercial chickens broilerbreeders pullet and layer hens flocks regardless of clinicalsigns (Table 4) The results were analyzed according tothe detection of single and concomitant (Table 2) virus insamples from chickens with and without clinical symptoms(Table 2) and the absolute number of positive samples foreach virus (Table 3) In both conditions of analysis described

The Scientific World Journal 3

Table 1 Primers sets nucleotide sequences amplicons and the corresponding references that were used to screen for the viruses

Virus Primer Nucleotide sequence (51015840-31015840) Amplicon (bp) Reference

Parvovirus PVF 1 GGCCGTTAACGATATCACTCAAGTTTC 561 [18]PVR 1 AAAGCGCTTGCGGTGAAGTCTGGCGCT

Avian adenovirus group I Hexon A CAA RTT CAG RCA GAC GT 897 [17]Hexon B TAG TGA TGM CGS GAC ATC AT

IBVUTR 41+ ATGTCTATCGCCAGGGAAATGTC

179 [6]UTR 31 GGGCGTCCAAGTGCTGTACCCUTR 11 GCTCTAACTCTATACTAGCCTA

CAstV CASpolIF GAYACARBCGAATGCGRBAGRBTTG 362 [20]CASpolIR TCAGTGGAAGTGGGKCARBTCTAC

Reovirus S4-F13 GTGCGTGTTGGAGTTTCCCG 1120 [21]S4-R1133 TACGCCATCCTAGCTGGA

Rotavirus F30 GTGCGGAAAGATGGAGAAC 630 [22]R660 GTTGGGGTACCAGGGATTAA

ANV Pol 1F GYATGGGCGCYATCYATTTGAYAAC 473 [20]Pol 1R CRBTTTGCCCKCRBTARBTCTTTRBTAY pyrimidine BR purine CK G ou T

Table 2 Distribution of the seven viruses in the 280 samples ofintestinal contents from the chickens with and without clinical signsof enteric diseases from 2007 to 2010

Virus With clinicalsigns

Without clinicalsigns Total ()

IBV 39 (139) 6 (21) 45 (161)ANV 18 (64) 4 (14) 22 (79)CAstV 10 (36) 4 (14) 14 (50)Parvovirus 5 (18) 0 (00) 5 (18)Adenovirus 12 (43) 2 (07) 14 (50)Rotavirus 6 (21) 4 (14) 10 (36)Reovirus 1 (04) 0 (00) 1 (04)Total one virus 91 (325) 20 (71) 111 (396)

Concomitancedagger

Two viruses 60 (214) 14 (50) 74 (264)Three viruses 25 (89) 6 (21) 31 (111)Four viruses 7 (25) 2 (07) 9 (32)Five viruses 0 (00) 1 (04) 1 (04)Totalconcomitanceviruses

92 (329) 23 (82) 115 (411)

Total of positives 183 (654) 43 (154) 226 (807)Negative 29 (104) 25 (89) 54 (193)Total 212 (757) 68 (243) 280 (100)IBV infectious bronchitis virus ANV avian nephritis virus CAstV chickenastrovirus daggertwo ormore viruses detected simultaneously in the same sample

above the viruses with the greatest frequencies in descendingorder were IBV ANV rotavirus and CAstV Table 2 showsthe number of combinations among the viruses that weredetected in the concomitant samples The absolute numbers(Table 3) indicate that IBV was the most frequently identifiedvirus (429) followed by ANV (296) CAstV (211)

and rotavirus (171) chicken parvovirus (121) FAdV-1(96) and reovirus (79)

The majority of positive samples were detected in broilerchickens 193 (854) during the first sevenweeks of age beingmore frequent at the first four weeks following for broilerbreeders with 22 (97) of positive samples and the lowestdetection of enteric viruses was present in pullet and layerhens with 49 both types of birds with a homogeneousdistribution among the weeks (Table 4) The minimum agewas three-day-old broilerwithout symptoms thatwas positivefor IBV and CAstV In the broiler breeders and pulletlayerhens positive samples were detected in almost all age groupsfrom the first week in the broiler breeders and from the fourthweek in pulletlayer hens (Table 4) Two samples from thebreeder chicks were positive for CAstV at one day old

4 Discussion

Bacteria and parasites have been considered the primary etio-logical agents of gastroenteritis in commercial poultry How-ever many viral infections have been associated with entericdiseases of chickens and turkeys including coronavirusreoviruses rotaviruses adenoviruses enteroviruses and themembers of Family Astroviridae (Chicken Astrovirus-CAstVandAvianNephritis Virus-ANV) [22ndash27] Infectionswith thepreviously mentioned viruses are believed to be importantin the pathogenesis of the economically important entericdisease such as runting and stunting syndrome (RSS) whichaffects young chickens mainly broiler chickens [6 9 2829] and turkeys [1] Recently studies have included theenterotropic strains of infectious bronchitis virus (IBV) asa possible etiological agent of enteritis in chickens [30]IBV can grow in many cells of the gastrointestinal tract[31] and some Asian strains were described to cause lesionsin the proventriculus IBV is believed to only persist in


Table 3 Frequencies of individual and multiple enteric virus infections detected in intestinal samples

Number of combinations viruses detected IBV ANV CAstV Rotavirus ChPV FAdV-1 ReovirusOne virus 45 22 14 10 5 14 1Two viruses 49 28 16 31 13 7 4Three viruses 17 25 22 4 10 4 11Four viruses 8 7 6 3 5 2 5Five viruses 1 1 1 0 1 0 1Number of positive samples 120 83 59 48 34 27 22 of positive samples for each virus (119899 = 280) 429 296 211 171 121 96 79ANV avian nephritis virus CAstV chicken astrovirus ChPV chicken parvovirus IBV infectious bronchitis virus FAdV-1 fowl adenovirus group 1

Table 4 Positive samples for one or more viruses obtained from broiler chickens breeders and layer hens and the respective age in weeks atchicks which were detected

Broiler chickens Broiler breeders Pulletlayer hensWeeks Number of positive samples Weeks Number of positive samples Weeks Number of positive samples1 27 1 3 4 12 32 8 1 8 13 31 12 1 13 24 33 23 1 23 15 20 31 1 24 16 33 32 2 31 17 17 33 2 48 1

34 1 93 235 1 106 137 340 245 151 157 158 1

Total 193 (854) Total 22 (97) Total 11 (49) of samples positive for each type of bird (119899 = 226)

the gastrointestinal tract of young chickens and in layerswithout clinical disease [32]

Different denominations or terms have been used todescribe the enteric disease in poultry because the clinicalsigns are infrequent or occur independently of previousconditions such as the presence of primary or secondaryetiological agents the immune and nutritional status of thehost and environmental conditions [3 4 15 33] Accordingto Saif [2] the gastrointestinal tract (GIT) is the primaryorgan of the body that is exposed and a variety of injuriesagainst it could result in inefficient utilization of nutrientsduring the early stages of development Of the various signsdescribed for enteric disease diarrhea and lack of normaldevelopment are the most consistently reported symptoms

The results obtained in this study demonstrate a highlevel of infection with one or more of the seven virusesinvestigated in the chickens with clinical symptoms (654)as shown in Table 2 However samples taken from chickenswithout symptoms (154)were also positive for these viruses(Table 2) which demonstrates a similar prevalence between

these two groupsThis result indicates that chickens should beshedding the virus via the enteric tract without showing anyclinical symptoms therefore these chickens are consideredasymptomatic carriers or reservoir representing a potentialsource of infection Other studies showed lower levels ofrotavirus infection (41) in normal chickens [14] whilehigher frequencies were found in asymptomatic flocks with30 rotavirus [13] and 30 for CAstV from healthy flocksof turkeys [34] However these studies did not survey awide range of viruses In an extensive survey of turkey flockswith enteric disease and healthy turkey flocks in the UnitedStates Rotaviruses were detected slightly more frequentlyin healthy than in diseased flocks [34] Astroviruses weredetected in the intestinal contents of poultry prior to the onsetof clinical disease and gross pathologic changes [35] ANV-induced clinical disease presents as kidney lesions in youngchickens but only presents as a subclinical persistent infectioninmature chicken [23]These conditions reflect those virusesother than reovirus coronavirus and chicken parvoviruswhich have been identified in samples fromflocks that appear


healthy and may have different degrees of pathogenicity [2225] In fact there are indications that different serotypes andeven strains within the same serotype can vary in their abilityto produce illness and death [15] Moreover several factorsinfluence the susceptibility of chickens to enteroviruses suchas age passive immunity level simultaneous infection withother pathogens and management failures which causestress [14 36 37]

Regardless of the symptoms most of the samples (226samples) representing 807 were positive for one or more ofthe viruses which demonstrates the high prevalence of theseviruses in Brazilian chicken flocks (Table 2) In almost half ofthese positive samples (115 samples or 411 of total) two ormore viruses were detected simultaneously which highlightsthe hypothesis of multicausal etiology for the enteric diseaseThe distribution of the seven viruses in these concomitancesamples was demonstrated and is shown in Table 2

The combinations were scattered proportionally accord-ing to the prevalence of each virus and did not present apattern or a constant frequency None particular combinationof the viruses was observed with significant repeatabilityRarely a single agent is the sole contributing factor to entericdisease moreover the presence of different combinations ofviruses could result in varied disease presentations [2]

IBV was the most prevalent virus detected in the samplesthat contained a single virus (Table 2) and in all of thesamples (120 samples429) as shown in Table 3 IBV isthe infectious agent associated with infectious bronchitis ofchickens and is responsible for outbreaks in many countriesincluding Brazil Infectious bronchitis (IB) is characterizedby respiratory reproductive and sometimes renal signsHowever some strains of this virus have been demonstratedto multiply in intestinal cells and were referred to as possibleagents of diarrhea or may at least have some role in entericdiseases [31] Recently we isolated variant strains of IBVfrom the intestinal contents of chickens with enteritis butwithout the typical respiratory reproductive or renal signs[30] In these cases IBV was the only pathogen presentwhile all of the samples were negative for astrovirus reovirusand rotavirusWhen one-day-old SPF chicks were inoculatedwith filtrated IBV variants respiratory signs but not diarrhealor renal signs were observed (data not published) In addi-tion these sampleswere not screened at for other likely agentsof enteritis such as ANVor chicken parvovirus However theIBV strains that were detected in the intestinal contents maynot play a role as direct pathogens in enteric disease

Of the viruses investigated ANV was the second mostprevalent by absolute numbers and was detected in 83samples (296) as shown inTable 3 If IBV is not the primarycausal agent then ANV is the most prevalent pathogen caus-ing enteric disease that was detected in this study Originallyregarded as a picornavirus ANV was recently characterizedas a new member of the Family Astroviridae in 2000 [23] andhas been detected in kidney samples from young chickenswith growth deficiencies in Hungary [38] A recent study thatwas performed in the United States to detect the presenceof several enteroviruses in chicken flocks demonstrated thatANV was the most prevalent virus followed by coronavirusreovirus CAstV and rotavirus [21] The characteristic signs

of avian nephritis that are caused by AVN vary from none(subclinical) to outbreaks characterized by diarrhea growthretard renal failure with tubulonephrosis interstitial nephri-tis uricosis and death [37 39]

Chicken astroviruses (CAstV) were the third androtaviruses were the fourth most frequent agents detectedin this study with 211 and 171 respectively (Table 3)Previously a high frequency of CAstV was reported byPantin-Jackwood et al [21] where 21 of the 34 (617)analyzed samples were identified as positive for CAstVAstroviruses cause or have been associated with acutegastroenteritis in humans cattle swine sheep cats dogsdeer mice and turkeys as well as with fatal hepatitis inducks [26 29 40 41] However the clinical importance ofCAstV remains unclear On the other hand rotaviruses arefrequently associated with enteric disease but the economicsignificance of rotaviruses to the poultry industry has not yetbeen defined [10 36 42] Rotaviruses were present in 465of the samples and in chicken flocks from all regions of theUnited States that were tested during 2005 and 2006 [21]Studies on the classification of serogroups by PAGE haveindicated that group D rotaviruses are the most frequentlyreported group in United Kingdom flocks [42] Furthermoregroup D rotavirus infection has recently been implicatedas a contributing factor to the development of RSS in 5-to 14-day-old broilers in Germany [43] The A F and Ggroups have also been detected in broiler flocks [36 43] InBrazil a study identified nine distinct electropherogroupsusing PAGE but only three were similar to the A groupprofile of avian rotavirus [14] More recently rotavirus wasalso detected in 453 of chicken and layer flocks in Braziland approximately 15 of these samples were identified asbelonging to group A [13] In a previous study using the sameRT-PCR test for the NSP4 gene [22] four different genotypesof rotaviruses were detected in samples from commercialturkeys reflecting the great genetic variability of rotavirusessimilar to that reported in humans and other mammals

Parvoviruses are known to cause gastrointestinal diseasein mammalian species and have been implicated as a causeof malabsorption syndrome in chickens and enteritis inturkeys [9 44] However the role of chicken parvoviruses indisease has not yet been determined Previous studies usingelectron microscopy have identified parvovirus-like particlesin the samples of chickens with enteric disease [45] but itwas not possible to confirm the presence of parvovirusesuntil the development of new molecular tools such as PCR[46] In this survey 121 of the chickens were positive forchicken parvovirus which is slightly more than those whichwere positive for reovirus and adenovirus and indicates thatchicken parvovirus should be considered as an importantetiological agent of enteric disease in chicken In a nationwidesurvey in the United States a high prevalence of chickenparvovirus (77) was detected in 54 chicken samples [18]

Fowl Adenovirus subgroup I had a frequency 96positive samples among the viruses investigated in this study(Table 3) The subgroup I and II adenoviruses are consideredwidely distributed in poultry and are commonly found inenteric samples [10 47] Although the association betweenadenovirus and disease is well established for subgroup


II (turkey hemorrhagic enteritis and related viruses andsubgroup III (egg drop syndrome)) the role ofmost subgroupI avian adenoviruses as pathogens is not well defined [10]

Avian reoviruses are frequently detected in the intestinaltracts of poultry with enteric disease and are widely dis-tributed in poultry [48] Avian reoviruses were identified inthis study of lowest frequency with only 79 (Table 3) Avianreoviruses were identified in 628 of the chicken flockstested from all regions of the United States during 2005 and2006 [21] Avian reoviruses have been isolated from a varietyof tissues in chickens that are affected by assorted diseaseconditions including viral arthritistenosynovitis respiratorydisease immunosuppression and enteric disease or malab-sorption syndrome [48]Moreover avian reoviruses have alsobeen demonstrated to cause a synergistic effect and enhancethe pathogenicity of other agents such as chicken anemiavirus Escherichia coli [49] and infectious bursal diseasevirus [50] However the severity of the effects dependedon the strain of reovirus A clear relationship is frequentlyreported between arthritistenosynovitis and reovirus infec-tion However the role of avian reoviruses in enteric diseaseremains unclear when we consider other primary pathogensassociated with enteric problems in chickens [49 50]

The association between viruses and age showed that theviruses could be detected at different stages in the broil-ers breeders and pulletlayer hens for example virus wasdetected from the first week of age to the last week especiallyin broilers An important finding was the detection of CAstVin one-day-old breeder chicks which may constitute anindicator of vertical transmission According to McNultyet al [42] in a longitudinal study carried out in youngpoultry flocks the avian rotavirus is normally detected aftertwo weeks of age because of the modulation of the passivematernal immunity However Tamehiro et al [14] reportedsamples that were positive for rotavirus in one-week-oldbroiler chickens Furthermore Pantin-Jackwood et al [21]demonstrated the presence of rotavirus in samples collectedfrom poults before placement in addition to the presence ofastrovirus throughout their lifetime

In conclusion the primary viruses detected in this studywere the IBVANVCAstV and rotavirus followed by chickenparvovirus adenovirus and reovirus However the astro-viruses (ANV and CAstV) should be regarded as the mostimportant pathogens because coronavirus (IBV) althoughpresent in a higher percentage of samples has not beendemonstrated to cause pathogenicity in the enteric tract inour previous experiments (data not published) Detection ofvirus was high among chickens with and without clinicalsigns of disease which demonstrates the high prevalenceof these viruses in asymptomatic carriers and indicates thatthese carries may represent a potential source of infectionMoreover the presence of CAstV in one-day-old breederchicks that was detected in this study may suggest a verticaltransmission In addition the injuries that these viruses causecan interfere with the absorption capacity of the intestinaltract during the first weeks of life of these birds whichenhances the negative impact on productivity for the rest ofthe production cycleThis is the first study to demonstrate thepresence of these viruses in association with enteric disease

in Brazil Experimental challenges should be conducted toestablish the role of these viruses and to analyze their impacton commercial chicken productivity

Conflict of Interests

The authors declare that there is no conflict of interestsregarding the publication of this paper

Acknowledgments

This study was sponsored by Fundacao de Amparo a Pesquisado Estado de Sao Paulo (FAPESP) Grant no 0659332-9and Conselho Nacional de Desenvolvimento Cientıfico eTecnologico (CNPq)

References

[1] H J Barnes and J S Guy ldquoPoulty enteritis-mortality syndromerdquoinDiseases of Poultry YM Saif H J Barnes J R Glisson AMFadly L R McDougald and D E Swayne Eds pp 1171ndash1180Iowa State Press Ames Iowa USA 2003

[2] Y M Saif ldquoViral enteric infectionsrdquo inDiseases of Poultry Y MSaif A M Fadly J R Glisson L R McDougald L K Nolanand D E Swayne Eds pp 329ndash330 Blackwell Ames IowaUSA USA 2008

[3] J L Sell D L Reynolds and M Jeffrey ldquoEvidence that bacteriaare not causative agents of stunting syndrome in poultsrdquo PoultryScience vol 71 no 9 pp 1480ndash1485 1992

[4] F Shapiro and I Nir ldquoStunting syndrome in broilers effectof age and exogenous amylase and protease on performancedevelopment of the digestive tract digestive enzyme activityand apparent digestibilityrdquo Poultry science vol 74 no 12 pp2019ndash2028 1995

[5] R D Montgomery C R Boyle W R Maslin and D LMagee ldquoAttempts to reproduce a runtingstunting-type syn-drome using infectious agents isolated from affectedmississippibroilersrdquo Avian Diseases vol 41 no 1 pp 80ndash92 1997

[6] J S Guy ldquoVirus infections of the gastrointestinal tract ofpoultryrdquo Poultry Science vol 77 no 8 pp 1166ndash1175 1998

[7] F ShapiroMMahagna and INir ldquoStunting syndrome in broil-ers effect of glucose or maltose supplementation on digestiveorgans intestinal disaccharidases and some bloodmetabolitesrdquoPoultry Science vol 76 no 2 pp 369ndash380 1997

[8] F Shapiro I Nir and D Heller ldquoStunting syndrome in broilerseffect of stunting syndrome inoculum obtained from stuntingsyndrome affected broilers on broilers leghorns and Turkeypoultsrdquo Poultry Science vol 77 no 2 pp 230ndash236 1998

[9] B M Kouwenhoven M Vertommen and J H H van EckldquoRunting and leg weakness in broilers Involvement of infec-tious factorsrdquo Veterinary Science Communications vol 2 no 1pp 253ndash259 1978

[10] M S McNulty and J B McFerran ldquoVirus infections of birdsrdquoin Virus Infectious of Vertebrates J B McFerran and M SMcNulty Eds pp 519ndash529 Elsevier Science New York NYUSA 1993

[11] R K Page O J Fletcher G N Rowland D Gaudry and PVillegas ldquoMalabsorption syndrome in broiler chickensrdquo AvianDiseases vol 26 no 3 pp 618ndash624 1982


[12] A F Alfieri M Resende J S Resende and A A AlfierildquoAtypical rotavirus infections among broiler chickens in BrazilrdquoArquivo Brasilero de Medicina Veterinaria e Zootecnia vol 41pp 81ndash82 1989

[13] L Y B Villarreal G Uliana C Valenzuela et al ldquoRotavirusdetection and isolation from chickens with or without symp-tomsrdquoRevista Brasileira de Ciencia Avicola vol 8 no 3 pp 187ndash191 2006

[14] C Y Tamehiro A F Alfieri K C Medici and A A AlfierildquoSegmented double-stranded genomic RNA viruses in fecalsamples from broiler chickenrdquo Brazilian Journal of Microbiol-ogy vol 34 no 4 pp 349ndash353 2003

[15] F Shapiro and I Nir ldquoStunting syndrome in broilers physicalphysiological and behavioral aspectsrdquo Poultry Science vol 74no 1 pp 33ndash44 1995

[16] M L Racz V Munford M J B Fernandes S S Kroeff andI Kotait ldquoIdentification propagation and subgroup character-ization of an equine rotavirus isolated in Sao Paulo BrazilrdquoBrazilian Journal of Microbiology vol 24 pp 161ndash165 1993

[17] G Meulemans M Boschmans T P Van den Berg andM Decaesstecker ldquoPolymerase chain reaction combined withrestriction enzyme analysis for detection and differentiation offowl adenovirusesrdquoAvian Pathology vol 30 no 6 pp 655ndash6602001

[18] L Zsak K O Strother and J M Day ldquodevelopment of apolymerase chain reaction procedure for detection of chickenand Turkey parvovirusesrdquo Avian Diseases vol 53 no 1 pp 83ndash88 2009

[19] D Cavanagh K Mawditt D D BWelchman P Britton and RE Gough ldquoCoronaviruses from pheasants (Phasianuscolchicus)are genetically closely related to coronaviruses of domestic fowl(infectious bronchitis virus) and turkeysrdquo Avian Pathology vol31 no 1 pp 81ndash93 2002

[20] J M Day M J Pantin-Jackwood and E Spackman ldquoSequenceand phylogenetic analysis of the S1 genome segment of turkey-origin reovirusesrdquoVirus Genes vol 35 no 2 pp 235ndash242 2007

[21] M J Pantin-Jackwood J M Day M W Jackwood and ESpackman ldquoEnteric viruses detected by molecular methodsin commercial chicken and turkey flocks in the United Statesbetween 2005 and 2006rdquo Avian Diseases vol 52 no 2 pp 235ndash244 2008

[22] M J Pantin-Jackwood E Spackman J M Day and D RivesldquoPeriodic monitoring of commercial turkeys for enteric virusesindicates continuous presence of astrovirus and rotavirus on thefarmsrdquo Avian Diseases vol 51 no 3 pp 674ndash680 2007

[23] T Imada S Yamaguchi M Mase K Tsukamoto M Kubo andA Morooka ldquoAvian nephritis virus (ANV) as a new memberof the family Astroviridae and construction of infectious ANVcDNArdquo Journal of Virology vol 74 no 18 pp 8487ndash8493 2000

[24] M J Pantin-Jackwood E Spackman and P R WoolcockldquoMolecular characterization and typing of chicken and Turkeyastroviruses circulating in the United States implications fordiagnosticsrdquo Avian Diseases vol 50 no 3 pp 397ndash404 2006

[25] M J Pantin-Jackwood E Spackman and J M Day ldquoPathologyand virus tissue distribution of turkey origin reoviruses inexperimentally infected turkey poultsrdquo Veterinary Pathologyvol 44 no 2 pp 185ndash195 2007

[26] D L Reynolds and S L Schultz-Cherry ldquoAstrovirus infectionsrdquoinDiseases of Poultry Y M Saif A M Fadly J R Glisson L RMcDougald L K Nolan and D E Swayne Eds pp 351ndash355Blackwell Ames Iowa USA 2008

[27] E Spackman D Kapczynski and H Sellers ldquoMultiplex real-time reverse transcription-polymerase chain reaction for thedetection of three viruses associated with poult enteritiscomplex turkey astrovirus turkey coronavirus and Turkeyreovirusrdquo Avian Diseases vol 49 no 1 pp 86ndash91 2005

[28] C D Bracewell and P Wyeth ldquoInfectious stunting of chickensrdquoVeterinary Record vol 109 no 3 p 64 1981

[29] D A Pass M D Robertson and G E Wilcox ldquoRuntingsyndrome in broiler chickens in Australiardquo Veterinary Recordvol 110 no 16 pp 386ndash387 1982

[30] L Y B Villarreal P E Brandao J L Chacon et al ldquoMolecularcharacterization of infectious bronchitis virus strains isolatedfrom the enteric contents of Brazilian laying hens and broilersrdquoAvian Diseases vol 51 no 4 pp 974ndash978 2007

[31] A G Ambali and R C Jones ldquoEarly pathogenesis in chicksof infection with an enterotropic strain of infectious bronchitisvirusrdquo Avian Diseases vol 34 no 4 pp 809ndash817 1990

[32] R C Jones and A G Ambali ldquoRe-excretion of an enterotropicinfectious bronchitis virus by hens at point of lay after experi-mental infection at day oldrdquo Veterinary Record vol 120 no 26pp 617ndash618 1987

[33] M S Lilburn H M Edwards Jr and L S Jensen ldquoImpairednutrient utilization associated with pale bird syndrome inbroiler chicksrdquo Poultry Science vol 61 no 3 pp 608ndash609 1982

[34] D L Reynolds Y M Saif and K W Theil ldquoA survey of entericviruses of turkey poultsrdquoAvianDiseases vol 31 no 1 pp 89ndash981987

[35] M L Thouvenelle J S Haynes J S Sell and D L ReynoldsldquoAstrovirus infection in hatchling turkeys alterations in intesti-nal maltase activityrdquo Avian Diseases vol 39 no 2 pp 343ndash3481995

[36] M S McNulty D Todd and G M Allan ldquoEpidemiologyof rotavirus infection in broiler chickens recognition of fourserogroupsrdquo Archives of Virology vol 81 no 1-2 pp 113ndash1211984

[37] M Narita S Umiji K Furuta J Shirai and K NakamuraldquoldquoPathogenicity of avian nephritis virus in chicks previouslyinfected with infectious bursal disease virusrdquo Avian Pathologyvol 20 pp 101ndash111 1991

[38] M Mandoki T Bakonyi E Ivanics C Nemes M Dobos-Kovacs andM Rusvai ldquoPhylogenetic diversity of avian nephri-tis virus in Hungarian chicken flocksrdquo Avian Pathology vol 35no 3 pp 224ndash229 2006

[39] T Imada S Yamaguchi and H Kawamura ldquoPathogenicity forbaby chicks of the G-4260 strain of the picornavirus lsquoaviannephritis virusrsquordquoAvian Diseases vol 23 no 3 pp 582ndash588 1979

[40] W Baxendale and T Mebatsion ldquoThe isolation and characteri-sation of astroviruses from chickensrdquo Avian Pathology vol 33no 3 pp 364ndash370 2004

[41] M D Koci B S Seal and S Schultz-Cherry ldquoMolecularcharacterization of an avian astrovirusrdquo Journal of Virology vol74 no 13 pp 6173ndash6177 2000

[42] M S McNulty G M Allan and R M McCracken ldquoExper-imental infection of chicken with rotaviruses clinical andvirological findingsrdquo Avian Pathology vol 12 pp 45ndash54 1983

[43] P Otto E M Liebler-Tenorio M Elschner J Reetz U Lohrenand R Diller ldquoDetection of rotaviruses and intestinal lesions inbroiler chicks from flocks with Runting and Stunting Syndrome(RSS)rdquo Avian Diseases vol 50 no 3 pp 411ndash418 2006

[44] D W Trampel D A Kinden R F Solorzano and P LStogsdill ldquoParvovirus-like enteropathy in Missouri turkeysrdquoAvian Diseases vol 27 no 1 pp 49ndash54 1983


[45] J Kisary B Avalosse A Miller-Faures and J RommelaereldquoThe genome structure of a new chicken virus identifies it asa parvovirusrdquo Journal of General Virology vol 66 no 10 pp2259ndash2263 1985

[46] L Zsak K O Strother and J Kisary ldquoPartial genome sequenceanalysis of parvoviruses associated with enteric disease inpoultryrdquo Avian Pathology vol 37 no 4 pp 435ndash441 2008

[47] J K A Cook ldquoPathogenicity of avian adenoviruses for day oldchicksrdquo Journal of Comparative Pathology vol 84 no 4 pp505ndash515 1974

[48] R C Jones ldquoReovirus infectionsrdquo in Diseases of Poultry Y MSaif A M Fadly J R Glisson L R McDougald L K Nolanand D E Swayne Eds pp 309ndash310 Blackwell Ames IowaUSA 2008

[49] J K Rosenberger P A Fries S S Cloud and R A Wilson ldquoInvitro and in vivo characterization of avian Escherichia coli IIFactors associated with pathogenicityrdquo Avian Diseases vol 29no 4 pp 1094ndash1107 1985

[50] A Moradian J Thorsen and R J Julian ldquoSingle and combinedinfections of specific-pathogen-free chickens with infectiousbursal disease virus and an intestinal isolate of reovirusrdquo AvianDiseases vol 34 no 1 pp 63ndash72 1990

Submit your manuscripts athttpwwwhindawicom

Veterinary MedicineJournal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Veterinary Medicine International



International Journal of

Microbiology


AnimalsJournal of

EcologyInternational Journal of


PsycheHindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Evolutionary BiologyInternational Journal of


Hindawi Publishing Corporationhttpwwwhindawicom

Applied ampEnvironmentalSoil Science

Volume 2014

Biotechnology Research International


Agronomy




Journal of Parasitology Research

Hindawi Publishing Corporation httpwwwhindawicom


Volume 2014

Zoology

GenomicsInternational Journal of


InsectsJournal of


The Scientific World JournalHindawi Publishing Corporation httpwwwhindawicom Volume 2014


VirusesJournal of

ScientificaHindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Cell BiologyInternational Journal of



Case Reports in Veterinary Medicine


some atypical rotaviruses in broiler chickens with enteritis[12 13] rotavirus reovirus and picobirnavirus using thepolyacrylamide gel electrophoresis (PAGE) technique [14]

In the past enteric disease has been called the pale birdsyndrome and helicopter wing disease and was characterizedby poor growth and retarded feather development Thesesymptoms are observed consistently along with the otherless frequent clinical signs including diarrhea increasedmortality and pancreatic and lymphoid atrophy [6 15]Enteric diseases seem to be the most acceptable name for thisclinical manifestation because it most appropriately reflectsthe consistency of the clinical findings and indicates thatthese cases are probably caused by the same infectious agents

In this study we screened seven related viruses aspotential agents of enteric disease in chickens to investigatethe highest number of agents and their emergence in theBrazilian poultry production

2 Materials and Methods

21 Field Samples Two hundred and eighty (280) intestinalcontents samples were collected from commercial chickenfrom nine Brazilian states as follows Rio Grande do SulMinas Gerais Sao Paulo Parana Para Rio de Janeiro SantaCatarina Goias and Ceara The samples were collectedbetween 2008 and 2010 Two hundred and twelve of thesamples were collected from chickens with clinical signs ofenteric problems that were described as diarrhea poorweightgain malabsorption syndrome culling andmortality and 68samples were collected from chickens without clinical histo-ries of enteric problems in the last three reared previouslyflocks Each sample was composed of a pool of intestinalcontents obtained from five chickens of whole intestine fromduodenum to the end of ileumThe age of the chickens variedfrom three days old to 106weeks old broilers broiler breederspullet and layer hen flocks Samples were preserved at minus20∘Cuntil shipment to the Laboratory of Avian Diseases (SaoPaulo SP Brazil) and were kept at minus20∘C until the processing

22 Preparation of Intestinal-Content Samples A 1 5 sus-pension was prepared with Tris-Calcium buffer (TrisHCl01M CaCl

215mM pH 73) [16] After 30 minutes at

room temperature under periodic homogenizations the celldebris was removed by low-speed centrifugation (3300timesgfor 15min) Supernatants were stored at minus20∘C until analysisDNA and RNA were extracted from supernatants usingTRIzol (Invitrogen Valencia CA USA) according to themanufacturerrsquos instructions

23 Reference Viruses ChPV adenovirus CAstV and ANVstrains that had been isolated fromBrazilian flocks andwhoseidentity had been confirmed by sequencing were used aspositive controls in the molecular assays Additionally aMassachusetts vaccine strain (H120) Nebraska calf diarrheavirus and S1133 strains were used as controls for IBVrotavirus and reovirus respectively

24 Primers Previously published primer sets were utilizedfor the reverse-transcriptase polymerase chain reaction (RT-PCR) and for PCR to detect the seven viruses screened in thisstudy The sequences and references are showed in Table 1

25 DNAVirus Detection Conventional PCRwas conductedto detect chicken parvovirus and fowl adenovirus of subgroup1 DNA as previously described [17 18] Briefly extractedDNA (25 120583L) was used as a template for PCR in a 25 120583Lreaction mix that contained 10 pmol of each of the forwardand reverse primers (as described inTable 1) 5 120583Lof 5timesbuffer02mM deoxynucleoside triphosphate (dNTP) mix 125mMMgCl

2 and 1U of Platinum DNA Polymerase (Invitrogen)

The negative control included sterile water Amplificationswere performed in a Biometra DNA thermocycler (BiometraGmbH Goettingen Germany) After a 5min incubation at95∘C 30 cycles of amplification (94∘C for 30 sec 55∘C for1min and 72∘C for 1min) were performed to detect chickenparvovirus and 34 cycles of amplification (94∘C for 1min55∘C for 45 sec and 72∘C for 1min) to detect fowl adenovirussubgroup I The PCRs ended with a final extension stepof 10min at 72∘C The PCR products were visualized afterseparation by electrophoresis in an agarose gel (15) usingBlue Green Dye (LGC Sao Paulo Brazil) to stain the DNAThe size of the amplified product was estimated using the 100base pair DNA Ladder molecular size marker (Invitrogen)

26 RNA Virus Detection RNA isolated from field sampleswas in vitro transcribed and amplified using the One-StepRT-PCR Kit (Qiagen Valencia CA USA) Primer sets thathave been previously described were used to detect CAstVreovirus rotavirus and ANV as described in Table 1 The25 120583L reaction mix contained 1 X Qiagen One Step RT-PCRkit reaction buffer 320 120583M of each dNTP 10 pmol of eachforward and reverse primer 1 120583L of Qiagen RT-PCR enzymeblend and 25 120583L of extracted RNA To detect IBV theprimers and reaction conditions described by Cavanagh etal [19] were used to amplify a 179 bp fragment from the31015840untranslated region To detect ANV andCAstV the primerssets described by Day et al [20] were used

3 Results

At least one virus was detected in 226 (807) of the 280examined samples Of the 212 samples collected from chick-ens with clinical signs such as diarrhea lethargy poor perfor-mance poor weight gain malabsorption and mortality 183(654) were positive for one or more of the screened virusesand in 43 (154) samples at least one enteric-diseases-related virus was detected in samples from healthy chickens(Table 2) All of the investigated viruses were detected inthe intestinal samples from the commercial chickens broilerbreeders pullet and layer hens flocks regardless of clinicalsigns (Table 4) The results were analyzed according tothe detection of single and concomitant (Table 2) virus insamples from chickens with and without clinical symptoms(Table 2) and the absolute number of positive samples foreach virus (Table 3) In both conditions of analysis described
















Concomitancedagger


92 (329) 23 (82) 115 (411)





4 Discussion







34 1 93 235 1 106 137 340 245 151 157 158 1
























Acknowledgments


References




























































Microbiology


AnimalsJournal of








Volume 2014



Agronomy







Volume 2014

Zoology



InsectsJournal of




VirusesJournal of





















Concomitancedagger


92 (329) 23 (82) 115 (411)





4 Discussion







34 1 93 235 1 106 137 340 245 151 157 158 1
























Acknowledgments


References




























































Microbiology


AnimalsJournal of








Volume 2014



Agronomy







Volume 2014

Zoology



InsectsJournal of




VirusesJournal of











34 1 93 235 1 106 137 340 245 151 157 158 1
























Acknowledgments


References




























































Microbiology


AnimalsJournal of








Volume 2014



Agronomy







Volume 2014

Zoology



InsectsJournal of




VirusesJournal of
























Acknowledgments


References




























































Microbiology


AnimalsJournal of








Volume 2014



Agronomy







Volume 2014

Zoology



InsectsJournal of




VirusesJournal of














Acknowledgments


References




























































Microbiology


AnimalsJournal of








Volume 2014



Agronomy







Volume 2014

Zoology



InsectsJournal of




VirusesJournal of






















































Microbiology


AnimalsJournal of








Volume 2014



Agronomy







Volume 2014

Zoology



InsectsJournal of




VirusesJournal of




















Microbiology


AnimalsJournal of








Volume 2014



Agronomy







Volume 2014

Zoology



InsectsJournal of




VirusesJournal of













Microbiology


AnimalsJournal of








Volume 2014



Agronomy







Volume 2014

Zoology



InsectsJournal of




VirusesJournal of






Documents

Research Article Emergence of Enteric Viruses in