Research ArticleAssociation of Polymorphisms in X-Ray Repair CrossComplementing 1 Gene and Risk of Esophageal Squamous CellCarcinoma in a Chinese Population

Yu-Xia Yun12 Li-Ping Dai1 Peng Wang1 Kai-Juan Wang1 Jian-Ying Zhang1 and Wei Xie1

1Department of Radiology The First Affiliated Hospital amp Department of Epidemiology College of Public Health and Henan KeyLaboratory of Tumor Epidemiology Zhengzhou University Zhengzhou Henan 450052 China2Department of Immunization Planning Centers for Disease Control and Prevention of Puyang City Puyang Henan 457000 China

Correspondence should be addressed to Li-Ping Dai lpdaihotmailcom and Wei Xie wxie1970hotmailcom

Received 11 November 2014 Revised 30 November 2014 Accepted 2 December 2014

Academic Editor David B Ordiz

Copyright copy 2015 Yu-Xia Yun et al This is an open access article distributed under the Creative Commons Attribution Licensewhich permits unrestricted use distribution and reproduction in any medium provided the original work is properly cited

Objectives To investigate the association between three single nucleotide polymorphisms (SNPs) in the X-ray repair crosscomplementing 1 gene (XRCC1) and the risk of esophageal squamous cell carcinoma (ESCC) in Chinese population MethodsA case-control study including 381 primary ESCC patients recruited from hospital and 432 normal controls matched with patientsby age and gender from Chinese Han population was conducted The genotypes of three XRCC1 polymorphisms at minus77TgtC(T-77C) codon 194 (Arg194Trp) and codon 399 (Arg399Gln) were studied by means of polymerase chain reaction-restrictionfragment length polymorphism techniques (PCR-RFLP) Unconditional logistic regression model and haplotype analysis wereused to estimate associations of these three SNPs in XRCC1 gene with ESCC risk Results Polymorphisms at these three sites inXRCC1 gene were not found to be associated with risk for developing ESCC however the haplotype Ccodon 194Gcodon 399Cminus77TgtC wassignificantly associated with reduced risk of ESCC (OR 062 95CI 040ndash096) upon haplotype analysisConclusionThese resultssuggested that the gene-gene interactions might play vital roles in the progression on esophageal cancer in Chinese Han populationand it would be necessary to confirm these findings in a large and multiethnic population

1 Introduction

Esophageal cancer (EC) is the eighth most common malig-nancy and the sixth most common cause of cancer-relateddeathsworldwide responsible for 38of all new cancer casesand for 54 of cancer related deaths each year [1ndash5] In 2008about 482000 new cases occurred and 406000 patients diedfrom EC worldwide over 83 of which were in developingcountries [2] EC is the fourth leading cause of cancer deathin China [6] with approximately 250000 cases diagnosedyearly and it contributes to about half of the cases of theworld[4 5 7ndash10]

Base excision repair (BER) is one of the important DNArepair pathways against DNA damage that could lead to can-cer resulted frommany factors including alteredmetabolismreactive oxygen species and methylating and deaminatingagents [7ndash10] The BER pathway has a primary role in

the repair of oxidative base lesions such as 8-hydroxyguanineformamidopyrimidines and 5-hydroxyuracil [11] Oxida-tive damage to DNA may lead to mutations that activateoncogenes or inactivate tumor suppressor genes and mayeventually increase the probability of genetic alterationsdeveloping into neoplastic events [11] Sequence variants inBER genes are thought to modulate DNA repair capacity andare consequently suspected of being associated with alteredcancer risk [12] XRCC1 protein encoded by XRCC1 geneplays a critical role involved in the BER pathway which inter-acts with enzymatic components of each stage of DNAstrand break repair including DNA polymerase beta APE1(apurinicapyrimidinic endonuclease 1) PARP-1 (poly [ADP-ribose] polymerase 1) and DNA ligase III [13ndash18] Thereare more than 60 validated single nucleotide polymorphisms(SNPs) in the XRCC1 gene containing 17 exons and 16introns on chromosome 19q132-133 among which three

Hindawi Publishing CorporationBioMed Research InternationalVolume 2015 Article ID 509215 7 pageshttpdxdoiorg1011552015509215

2 BioMed Research International

Table 1 Primer sequences and restriction endonucleases of three SNPs in XRCC1 gene

SNPs Location Position Primers Enzymes Digested fragments

codon 194 exon 6 C26304T F GCCAGGGCCCCTCCTTCAAR TACCCTCAGACCCACGAGT PvuII

CC (485)CT (485 396 89)

TT (396 89)

codon 399 exon 10 G28152A F TTGTGCTTTCTCTGTGTCCAR TCCTCCAGCCTTTTCTGATA MspI

GG (374 241)GA (615 374 241)

AA (615)

minus77TgtC 51015840UTR T-77C F GGTTCTGGAAGCCACTCAR GGGCTGAGGGCCTAAAC BsrB I

TT (167 67)TC (234 167 67)

CC (234)

polymorphisms in the XRCC1 gene at the minus77TgtC (51015840 endT to C) codon 194 (exon 6 Arg to Trp) and codon 399 (exon10 Arg to Gln) have been studied

The genetic polymorphism of XRCC1 codon 194 resultsin an arginine to tryptophan amino acid substitution andoccurs at a conserved residue in humans hamsters andmiceand this evolutionary conservation suggests that this site isfunctionally important [19 20] The genetic polymorphismin the XRCC1 gene at codon 399 results in an arginine toglutamine amino acid substitution A report of Lunn andcolleagues measured the prevalence of aflatoxin B1 adductsin placental DNA from 120 Taiwanese women and suggestedthat the XRCC1 codon 399 polymorphism may result indeficientDNArepair capacity [21]The result ofHao et al [22]showed that minus77TgtC can increase the combination ofXRCC1promoter and a transcription inhibitory factor thus reducingthe promoter activity and protein expression Because aminoacid residues at the protein-protein interfaces of multiproteincomplexes and residues involved in the active sites play a rolein enzyme function it is possible thatXRCC1 polymorphismslead to alteration of DNA repair capacity

Thus we conducted this case-control study to compre-hensively investigate the role of the polymorphisms (codon194 codon 399 and minus77TgtC) in XRCC1 gene in the develop-ment of ESCC in a Chinese Han population

2 Materials and Methods

21 Study Population and Sample Collection This case-con-trol study included 381 newly histopathologically diagnosedprimary ESCC patients recruited at the First AffiliatedHospital and the Second Affiliated Hospital of ZhengzhouUniversity between March 2008 and January 2010 All ESCCpatients had no prior history of other types of cancer andwerenot previously treated with chemotherapy or radiotherapyUniform trained investigators used the special questionnairecontaining information of age sex tobacco smoking alcoholintake family history of cancer and environmental factors tointerview patients face to face after written informed consent432 normal controls were frequently matched by age (plusmn5years) and gender with patients randomly selected from acensus of digestion diseases that we had conducted previouslyfrom March 2003 to July 2005 in Xinxiang County of HenanProvince Controls were required to be free of any digestiondiseases with written informed consent having no cancer

history and related clinical signs All the subjects were ethnicHan Chinese without immediate family relations

The 5mL venous blood samples obtained from the sub-jects were collected in an EDTA tube and stored at minus70∘C forextraction of DNA genome Tobacco smoking was definedas smoking at least one cigarette per day and persisting formore than one year Alcohol intake was defined as drinkingat least once a week with more than 100 gram every time andpersisting for more than six monthsThis study was approvedby the Institutional Review Board of Zhengzhou UniversityInformed consent was obtained from each study participant

22 XRCC1 Genotyping The genotypes of XRCC1 poly-morphisms were determined by PCR-RFLP Primers andrestriction endonucleases are shown in Table 1

The PCR reaction started with a total volume of 15 120583L foreachmixture containing the following reagents 75120583L 2timesTaqPCR MasterMix 05 120583M each primer 10 120583L (50 ng) DNAand 56 120583L deionized water

PCR conditions were as follows

codon 194 95∘C for 2min followed by 35 cycles of94∘C for 30 s 60∘C for 30 s 72∘C for 45 s and a finalelongation step at 72∘C for 7min

codon 399 94∘C for 5min followed by 35 cycles of94∘C for 30 s 57∘C for 30 s 72∘C for 45 s and a finalelongation step at 72∘C for 5min

minus77TgtC 94∘C for 5min followed by 35 cycles of94∘C for 30 s 60∘C for 30 s 72∘C for 30 s and a finalelongation step at 72∘C for 5min

The digested products were resolved on 2 agarose gels(for codons 194 and 399) 3 agarose gels (for minus77TgtC) andstained with 05 120583gmL ethidium bromide

All assays were repeated at least once by the sameindividual it is not relevant to verify the genotyping resultsGenotypes were validated by sequencing through biologicaltechnology company

23 Statistical Analysis All analyses were conducted bySPSS160 software To determine whether the frequenciesbetween cases and controls were significantly different (120572 =005) the 1205942 test was used And 1205942 test was also usedto compare distribution differences of haplotype combined

BioMed Research International 3

Table 2 Characteristics of esophageal cancer cases and controls

VariablesCase N()119873 = 381

Control N()119873 = 432

120594

2 P

Agele65 237 (622) 286 (662) 141 023gt65 144 (378) 146 (338)

GenderMale 256 (672) 278 (644) 072 040Female 125 (328) 154 (356)

Smokinglowast

Nonsmokers 189 (596) 264 (611) 017 068Smokers 128 (404) 168 (389)

Drinkinglowast

Nondrinkers 255 (807) 353 (819) 018 068Drinkers 61 (193) 78 (181)

Family history of cancerlowast

No 233 (756) 357 (852) 1060 0001Yes 75 (244) 62 (148)

lowastbecause of the failure data collection the number of cases and controls forsome factors was less than 381 or 432

genotype the number of mutation sites and the number ofmutation alleles among three genetic polymorphisms

Online software httpwwwhad2knowcomacademicshardy-weinberg-equilibrium-calculator-2-alleleshtml wasused to assess Hardy-Weinberg equilibrium for genotypefrequency in controls by a Pearsonrsquos goodness-of-fit 1205942 test tocompare the observed genotype frequencies to the expectedones with one degree of freedom Odds ratios (ORs) and95 confidence intervals (95CI) from logistic regressionanalysis for crude ORs and adjusted ORs when adjustingfor age gender smoking drinking and family history ofcancer were used to detect the associations between thesethree polymorphisms and ESCC risk Haplotypes for eachindividual were inferred using the SNPHAP 20 software Sta-tistical tests were two sided and were considered statisticallysignificant whenever 119875 lt 005

3 Results

31 Subject Characteristics Thefrequency distribution of agesex smoking alcohol drinking status and family history ofcancer among the study subjects is summarized in Table 2The number of individuals with a family history of cancer washigher in ESCC cases than in normal controls (1205942 = 1060119875 = 0001)

32 ESCC Risk Associated with Individual SNPs The geno-type distributions of the three studied SNPs in controls wereall in accordance with Hardy-Weinberg equilibrium the 119875value was 028 079 and 009 for codon 194 codon 399 andminus77TgtC respectively

As shown in Table 3 the distributions of heterozygousand homozygous genotypes of XRCC1 codon 194 and codon399 did not show statistically significant difference betweenthe cases and controls (119875 gt 005) and the results were thesame after adjustment for age gender smoking drinkingand family history of cancer The heterozygous genotypeTC combined genotype TC or CC and allele C of XRCC1minus77TgtC may decrease risk of ESCC however there was nosignificantly statistical association after adjusting age gendersmoking drinking and family history of cancer

33 Haplotype Analysis In order to study the haplotypesfor XRCC1 codon 194 codon 399 and minus77TgtC SNPHAP20 software was applied showing a total of eight builthaplotypes Table 4 shows the frequencies of the estimatedhaplotypes among patients and controls For every suscepti-bility analysis of a haplotype the haplotype CGT (codon 194codon 399 and minus77TgtC) containing major allele was takenas control The data of Table 4 indicated that only haplotypeCGC (codon 194 codon 399 and minus77TgtC)may decrease riskfor developing ESCC compared to the control after adjustingage gender smoking drinking and family history of cancer(OR 062 95 CI 040ndash096)

34 Combined Genotypes Analysis of XRCC1 Codon 194Codon 399 and minus77TgtC Using combined wild geno-type CCGGTT as control combined mutation genotypeCTGGCT may decrease the risk in developing ESCC (OR046 95 CI 022ndash096 119875 = 004) But after adjustingage gender smoking drinking and family history of cancercombined mutation genotype CTGGCT has no statisticalassociation with ESCC (Table 5)

35 Trend Analysis of the Number of Mutation Sites We per-formed trend analysis of the association between the numberof mutation sites and risk of ESCC Using null-mutation ofthree SNPs as control there was no statistically significantassociation of one sitemutation two sitesmutation and threesites mutation with ESCC susceptibility (trend 1205942 = 038119875 = 054) (Table 6)

4 Discussion

Environmental and genetic factors as identifiable risk factorsare considered to have a significant contribution in the devel-opment of cancer Some studies have found that environmen-tal factors including tobacco smoking alcohol consumptionnitrates and preformed nitrosocompounds can increase ECrisk [23 24] However not all individuals who have beenexposed to the environmental risk factors actually developEC suggesting that genetic susceptibility might contributeto the individual risk of EC XRCC1 polymorphisms havebeen reported to be associated with the risk of different kindsof cancers including gastric cancer colorectal cancer lungcancer and breast cancer [25ndash28]

Our data showed that there was no significant associationbetween polymorphism of XRCC1 codon 194 and ESCCsusceptibility and some results of the domestic and foreign

4 BioMed Research International

Table 3 Association of XRCC1 genotypes with esophageal cancer

Genotypes CaseN ()

ControlN () 120594

2 OR (95 CI) 119875 OR (95 CI)lowast 119875

lowast

Codon 194CC 166 (466) 187 (446) Reference 100 mdash mdash mdashTC 159 (447) 193 (461) 024 093 (069 125) 062 091 (066 126) 057TT 31 (87) 39 (93) 018 090 (053 150) 067 096 (055 168) 090CC + TC 190 (534) 232 (554) 031 092 (069 123) 058 092 (068 125) 059C 567 (677) 491 (690) Reference 100 mdash mdash mdashT 271 (323) 221 (310) 030 106 (086 132) 058 090 (076 121) 070

Codon 399GG 184 (485) 223 (516) Reference 100 mdash mdash mdashGA 166 (438) 169 (407) 139 119 (089 159) 024 114 (084 157) 040AA 29 (77) 30 (77) 032 117 (068 202) 057 103 (057 186) 092GA + AA 195 (515) 199 (472) 147 147 (022 157) 022 113 (083 152) 044G 534 (704) 615 (729) Reference 100 mdash mdash mdashA 224 (296) 229 (271) 115 113 (091 140) 028 107 (085 135) 057minus77TgtC

TT 310 (836) 319 (772) Reference 100 mdash mdash mdashTC 59 (159) 92 (223) 509 066 (046 095) 002 070 (048 103) 007CC 2 (05) 2 (05) 022 103 (014 735) 064 0 10TC + CC 61 (164) 94 (228) 492 067 (047 096) 003 069 (047 101) 006T 679 (915) 730 (884) Reference 100 mdash mdash mdashC 63 (85) 96 (116) 437 070 (050 098) 004 070 (048 100) 005

lowastadjusted for age gender smoking drinking and family history of cancer

Table 4 XRCC1 haplotype analysis of three polymorphisms in XRCC1 gene

Haplotypes Case N () Control N () 120594

2 OR (95 CI) P OR (95 CI)lowast Plowast

CGT 323 (424) 349 (404) Reference 100 mdash mdash mdashTGT 152 (199) 189 (219) 111 087 (067 113) 029 081 (060 110) 018CAT 221 (290) 229 (265) 012 104 (082 132) 073 099 (074 131) 092CGC 57 (75) 89 (103) 393 069 (048 100) 005 062 (040 096) 003CAC 2 (03) 4 (05) 010 054 (010 297) 076 025 (003 230) 022TAT 3 (04) 1 (01) 033 324 (034 3132) 057 360 (036 3579) 027TGC 4 (05) 3 (03) 001 144 (032 649) 092 076 (010 572) 079TAC 0 mdash mdash mdash mdash mdash mdashTotal 762 (100) 864 (100) mdash mdash mdash mdash mdashlowastadjusted for age gender smoking drinking and family history of cancerThe order of three SNPs codon 194 codon 399 and minus77TgtC

researches showed to be consistent with ours According tothese results Casson et al [29] founded that there was norelationship between polymorphismofXRCC1 codon 194 andesophageal adenocarcinoma (EA) susceptibility in Canadapopulation Lee et alrsquos [30] study also found that there was noassociation between polymorphism of XRCC1 codon 194 andESCC in Asia population On the contrary there are studiesshowing that XRCC1 codon 194 can increase the risk for ECFor example the result of Xing et al [31] indicated that themutation homozygous genotype (TT) of XRCC1 codon 194 isthe risk factor for EC the adjusted OR (95CI) has a value of198 (126ndash312) A case-control study of Liu et al [32] inHebei

population of China found that the mutation homozygousgenotype (TT) of XRCC1 codon 194 can increase individualrisk of ESCC 086-fold (adjusted OR (95 CI) 186 (119ndash288))

Regarding the XRCC1 codon 399 polymorphism resultswe have not seen any significant association with ESCCAccording to this Chen et al [33] and Song et al [34] con-ducted a case-control study in Jiangsu and Henan provincesof China respectively showing no association betweenXRCC1 codon 399 polymorphism and EC susceptibilityHowever according to the results of Yu et al [35] comparingwith wild type (GG) the mutation homozygous genotype

BioMed Research International 5

Table 5 Combination genotypes analysis of XRCC1 codons 194 399 and minus77TgtC

Combined genotypes Case119873 () Control119873 () 120594

2 OR (95 CI) 119875 OR (95 CI)lowast 119875

lowast

CCGGTT 39 (112) 43 (106) Reference 100 mdash mdash mdashCTGATT 68 (195) 71 (176) 004 106 (061 182) 085 095 (053 172) 087CTGGTT 65 (187) 72 (178) 000 099 (058 172) 099 088 (049 160) 068CCGATT 60 (172) 66 (163) 000 100 (057 175) 099 102 (056 187) 095TTGGTT 29 (83) 37 (92) 019 086 (045 166) 066 091 (045 184) 080CTGGCT 16 (46) 38 (94) 435 046 (022 096) 004 052 (024 113) 010CCAATT 23 (66) 23 (57) 007 110 (053 227) 079 086 (039 192) 072CCGACT 17 (49) 23 (57) 028 081 (038 175) 060 074 (032 170) 048CCGGCT 20 (57) 22 (54) 000 100 (048 211) 100 109 (050 242) 082CTGACT 4 (11) 2 (05) 023 221 (038 1271) 063 118 (018 774) 086CCAACT 1 (03) 3 (07) 014 037 (004 368) 071 037 (004 387) 041CTAATT 3 (09) 1 (02) 031 331 (033 3313) 058 374 (036 3883) 027

Others 3 (09) 3 (09) mdash mdash mdash mdash mdashTotal 348 (100) 404 (100) mdash mdash mdash mdash mdash

lowastadjusted for age gender smoking drinking and family history of cancer

Table 6 Trend analysis of the number of mutation sites

Number of mutation sites Case119873 () Control119873 () 120594

2 OR (95 CI) 119875 OR (95 CI)1 119875

1

0 39 (112) 43 (106) Reference 100 mdash mdash mdash1 198 (569) 220 (545) 000 099 (062 159) 097 095 (057 159) 0842 107 (307) 139 (344) 041 085 (051 140) 052 078 (046 136) 0403 4 (11) 2 (05) 023 221 (038 1271) 063 123 (019 804) 083mdash mdash mdash 038lowast mdash 054lowast mdash mdashTotal 348 (100) 404 (100) mdash mdash mdash mdash mdashlowasttrend chi-square1Adjusted for age gender smoking drinking and family history of cancer

(AA) was a risk factor for developing EC (OR (95 CI)515 (242ndash1093)) By stratification analysis smokers carryinghomozygous mutant (AA) were associated with a 731-foldincreased risk for EC compared to smokers carrying the wildtype (GG) (OR 831 95CI 392ndash1763) meanwhile drinkerscarrying homozygous mutant (AA) were associated with a443-fold increased risk for EC compared to drinkers carryingthe wild type (GG) (OR 543 95 CI 246ndash1199)

In this study we did not observe significant associationbetween polymorphism of XRCC1 minus77TgtC and EC suscep-tibility Supporting these results as Hao et al [22] firstlyreported theXRCC1 minus77TgtC polymorphism in 51015840 noncodingregion in 2004 the results found that XRCC1 minus77TgtCcan increase the combination of XRCC1 promoter and atranscription inhibitory factor thus reducing the promoteractivity and protein expression However they did not findthe association ofXRCC1 minus77TgtC polymorphismwith ESCCsusceptibility The relationship between XRCC1 minus77TgtC andEC susceptibility needs to be clarified by more large sizestudies

In this study we conducted quality control strictlythroughout the whole study The patients included wereall newly pathologically diagnosed thus avoiding the prev-alence-incidence bias Besides the controls were frequency-matched and the investigators were unified-trained rigor-ously Moreover we sequenced the three SNPs duplicately

and verified them by DNA sequencing making the resultscredible

In conclusion the present study suggested that the singlepolymorphism in the DNA repair gene XRCC1 was notstatistically associated with risk of ESCC however haplotypeCGC (codon 194 codon 399 and minus77TgtC) of three SNPsin XRCC1 gene may decrease risk for ESCC susceptibilityBut in the future it would be necessary to confirm thesefindings in a large and multiethnic population study becauseof the relatively small sample size in this study and gene-environment interaction analysis and it should also be per-formed to investigate the tumorigenesis mechanism

Conflict of Interests

The authors declare that there is no conflict of interestsregarding the publication of this paper

Acknowledgments

This research was supported by Peoplersquos Republic ofChina (National Natural Science Foundation of China no81072360) and Program for Science amp Technology Inno-vation Talents in Universities of Henan Province (no2010HASTIT027) and Excellent Youth Foundation of Hersquonan

6 BioMed Research International

Scientific Committee (no 124100510007) The authorsacknowledge the blood samples of cases given by the Firstand the Second Affiliated Hospitals of Zhengzhou UniversityThe authors also wish to acknowledge the residents in Xinx-iang County of Henan Province who supported their epide-miological study on the scene

References

[1] D M Parkin F I Bray and S S Devesa ldquoCancer burden in theyear 2000 The global picturerdquo European Journal of Cancer vol37 no 8 pp 4ndash66 2001

[2] J Ferlay H R Shin F Bray D Forman C Mathers and DM Parkin ldquoEstimates of worldwide burden of cancer in 2008GLOBOCAN2008rdquo International Journal of Cancer vol 127 no12 pp 2893ndash2917 2010

[3] D M Parkin F Bray J Ferlay and P Pisani ldquoGlobal cancerstatistics 2002rdquo CA A Cancer Journal for Clinicians vol 55 no2 pp 74ndash108 2005

[4] L Dai K Wang J Zhang Q Lv X Wu and Y Wang ldquoXRCC1gene polymorphisms and esophageal squamous cell carcinomarisk in Chinese population a meta-analysis of case-controlstudiesrdquo International Journal of Cancer vol 125 no 5 pp 1102ndash1109 2009

[5] H Yu C Fu J Wang H Xue and B Xu ldquoInteraction betweenXRCC1 polymorphisms and intake of long-term stored rice inthe risk of esophageal squamous cell carcinoma a case-controlstudyrdquo Biomedical and Environmental Sciences vol 24 no 3 pp268ndash274 2011

[6] A Jemal F Bray M M Center J Ferlay E Ward and DForman ldquoGlobal cancer statisticsrdquo CA A cancer Journal forClinicians vol 61 no 2 pp 69ndash90 2011

[7] J H J Hoeijmakers ldquoGenome maintenance mechanisms forpreventing cancerrdquoNature vol 411 no 6835 pp 366ndash374 2001

[8] T Lindahl and R D Wood ldquoQuality control by DNA repairrdquoScience vol 286 no 5446 pp 1897ndash1905 1999

[9] R D Wood M Mitchell J Sgouros and T Lindahl ldquoHumanDNA repair genesrdquo Science vol 291 no 5507 pp 1284ndash12892001

[10] E C Friedberg ldquoDNA damage and repairrdquoNature vol 421 no6921 pp 436ndash440 2003

[11] S Maynard S H Schurman C Harboe N C de Souza-Pintoand V A Bohr ldquoBase excision repair of oxidative DNA damageand association with cancer and agingrdquo Carcinogenesis vol 30no 1 pp 2ndash10 2009

[12] R J Hung J Hall P Brennan and P Boffetta ldquoGeneticpolymorphisms in the base excision repair pathway and cancerrisk a huge reviewrdquo American Journal of Epidemiology vol 162no 10 pp 925ndash942 2005

[13] M Stanczyk T Sliwinski M Cuchra et al ldquoThe associationof polymorphisms in DNA base excision repair genes XRCC1OGG1 and MUTYH with the risk of childhood acute lym-phoblastic leukemiardquo Molecular Biology Reports vol 38 no 1pp 445ndash451 2011

[14] L Cai N C Y You H Lu et al ldquoDietary selenium intake alde-hyde dehydrogenase-2 and X-ray repair cross-complementing1 genetic polymorphisms and the risk of esophageal squamouscell carcinomardquo Cancer vol 106 no 11 pp 2345ndash2354 2006

[15] G Liu W Zhou B Y Yeap et al ldquoXRCC1 and XPD polymor-phisms and esophageal adenocarcinoma riskrdquo Carcinogenesisvol 28 no 6 pp 1254ndash1258 2007

[16] L H Thompson and M G West ldquoXRCC1 keeps DNA fromgetting strandedrdquoMutation ResearchDNA Repair vol 459 no1 pp 1ndash18 2000

[17] R C Sobti J Singh P Kaur S S Pachouri E A Siddiquiand H S Bindra ldquoXRCC1 codon 399 and ERCC2 codon 751polymorphism smoking and drinking and risk of esophagealsquamous cell carcinoma in aNorth Indian populationrdquoCancerGenetics and Cytogenetics vol 175 no 2 pp 91ndash97 2007

[18] H Li T C Ha and B C Tai ldquoXRCC1 gene polymorphismsand breast cancer risk in different populations ameta-analysisrdquoBreast vol 18 no 3 pp 183ndash191 2009

[19] M R Shen I M Jones and H Mohrenweiser ldquoNonconser-vative amino acid substitution variants exist at polymorphicfrequency in DNA repair genes in healthy humansrdquo CancerResearch vol 58 no 4 pp 604ndash608 1998

[20] J E Lamerdin M A Montgomery S A Stilwagen et alldquoGenomic sequence comparison of the human and mouseXRCC1 DNA repair gene regionsrdquo Genomics vol 25 no 2 pp547ndash554 1995

[21] R M Lunn R G Langlois L L Hsieh C LThompson and DA Bell ldquoXRCC1 polymorphisms effects on aflatoxin B1-DNAadducts and glycophorin A variant frequencyrdquoCancer Researchvol 59 no 11 pp 2557ndash2561 1999

[22] B Hao H Wang K Zhou et al ldquoIdentification of geneticvariants in base excision repair pathway and their associationswith risk of esophageal squamous cell carcinomardquo CancerResearch vol 64 no 12 pp 4378ndash4384 2004

[23] C H Lee J M Lee D C Wu et al ldquoIndependent andcombined effects of alcohol intake tobacco smoking and betelquid chewing on the risk of esophageal cancer in TaiwanrdquoInternational Journal of Cancer vol 113 no 3 pp 475ndash4822005

[24] M Siddiqi R Kumar Z Fazili B Spiegelhalder and RPreussmann ldquoIncreased exposure to dietary amines and nitratein a population at high risk of oesophageal and gastric cancerin Kashmir (India)rdquo Carcinogenesis vol 13 no 8 pp 1331ndash13351992

[25] J Li L Mu and GWei ldquoRelationship between polymorphismsof DNA repair gene XRCC1 and susceptibility to lung cancerrdquoChina Oncology vol 15 pp 335ndash338 2005

[26] E J Duell R C Millikan G S Pittman et al ldquoPolymorphismsin the DNA repair gene XRCC1 and breast cancerrdquo CancerEpidemiology Biomarkers amp Prevention vol 10 no 3 pp 217ndash222 2001

[27] S G Lee B Kim J Choi C Kim I Lee and K Song ldquoGeneticpolymorphisms of XRCC1 and risk of gastric cancerrdquo CancerLetters vol 187 no 1-2 pp 53ndash60 2002

[28] S Z Abdel-Rahman A S Soliman M L Bondy et alldquoInheritance of the 194Trp and the 399Gln variant alleles of theDNA repair gene XRCC1 are associated with increased risk ofearly-onset colorectal carcinoma in Egyptrdquo Cancer Letters vol159 no 1 pp 79ndash86 2000

[29] A G Casson Z Zheng S C Evans P J Veugelers G APorter and D L Guernsey ldquoPolymorphisms in DNA repairgenes in the molecular pathogenesis of esophageal (Barrett)adenocarcinomardquo Carcinogenesis vol 26 no 9 pp 1536ndash15412005

[30] J M Lee Y C Lee S Y Yang et al ldquoGenetic polymorphisms ofXRCC1 and risk of the esophageal cancerrdquo International Journalof Cancer vol 95 no 4 pp 240ndash246 2001

[31] D Xing J Qi X Miao W Lu W Tan and D Lin ldquoPoly-morphisms of DNA repair genes XRCC1 and XPD and their

BioMed Research International 7

associations with risk of esophageal squamous cell carcinomain a Chinese populationrdquo International Journal of Cancer vol100 no 5 pp 600ndash605 2002

[32] J Liu W Lei J Ma and R Xue ldquoCorrelation of DNA repairgene polymorphisms and esophageal canceTNM staging andregional lymph node metastasisrdquo Chinese Journal of Thoracicand Cardiovascular Surgery vol 22 no 5 pp 315ndash317 2006

[33] M Chen J Wang G Guo et al ldquoThe single nucleotidepolymorphism of DNA damage repair gene XPD Lys751GlnXRCC1 Arg399Gln and genetic susceptibility for esophagealcancerrdquo Journal of Fudan University (Medical sciences) vol 35no 2 pp 273ndash277 2008

[34] C Song W Tan and D Lin ldquoPolymorphisms of DNArepair gene XRCC1 in Chinese population and its relation toesophageal squamous cell carcinomardquo Cancer vol 20 no 1 pp28ndash31 2001

[35] H P Yu X Y Zhang X L Wang et al ldquoDNA repair geneXRCC1 polymorphisms smoking and esophageal cancer riskrdquoCancer Detection and Prevention vol 28 no 3 pp 194ndash1992004

Submit your manuscripts athttpwwwhindawicom

Stem CellsInternational

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

MEDIATORSINFLAMMATION

of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Behavioural Neurology

EndocrinologyInternational Journal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Disease Markers

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

BioMed Research International

OncologyJournal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Oxidative Medicine and Cellular Longevity

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

PPAR Research

The Scientific World JournalHindawi Publishing Corporation httpwwwhindawicom Volume 2014

Immunology ResearchHindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Journal of

ObesityJournal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Computational and Mathematical Methods in Medicine

OphthalmologyJournal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Diabetes ResearchJournal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Research and TreatmentAIDS

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Gastroenterology Research and Practice

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Parkinsonrsquos Disease

Evidence-Based Complementary and Alternative Medicine

Volume 2014Hindawi Publishing Corporationhttpwwwhindawicom

2 BioMed Research International

Table 1 Primer sequences and restriction endonucleases of three SNPs in XRCC1 gene

SNPs Location Position Primers Enzymes Digested fragments

codon 194 exon 6 C26304T F GCCAGGGCCCCTCCTTCAAR TACCCTCAGACCCACGAGT PvuII

CC (485)CT (485 396 89)

TT (396 89)

codon 399 exon 10 G28152A F TTGTGCTTTCTCTGTGTCCAR TCCTCCAGCCTTTTCTGATA MspI

GG (374 241)GA (615 374 241)

AA (615)

minus77TgtC 51015840UTR T-77C F GGTTCTGGAAGCCACTCAR GGGCTGAGGGCCTAAAC BsrB I

TT (167 67)TC (234 167 67)

CC (234)

polymorphisms in the XRCC1 gene at the minus77TgtC (51015840 endT to C) codon 194 (exon 6 Arg to Trp) and codon 399 (exon10 Arg to Gln) have been studied

The genetic polymorphism of XRCC1 codon 194 resultsin an arginine to tryptophan amino acid substitution andoccurs at a conserved residue in humans hamsters andmiceand this evolutionary conservation suggests that this site isfunctionally important [19 20] The genetic polymorphismin the XRCC1 gene at codon 399 results in an arginine toglutamine amino acid substitution A report of Lunn andcolleagues measured the prevalence of aflatoxin B1 adductsin placental DNA from 120 Taiwanese women and suggestedthat the XRCC1 codon 399 polymorphism may result indeficientDNArepair capacity [21]The result ofHao et al [22]showed that minus77TgtC can increase the combination ofXRCC1promoter and a transcription inhibitory factor thus reducingthe promoter activity and protein expression Because aminoacid residues at the protein-protein interfaces of multiproteincomplexes and residues involved in the active sites play a rolein enzyme function it is possible thatXRCC1 polymorphismslead to alteration of DNA repair capacity

Thus we conducted this case-control study to compre-hensively investigate the role of the polymorphisms (codon194 codon 399 and minus77TgtC) in XRCC1 gene in the develop-ment of ESCC in a Chinese Han population

2 Materials and Methods

21 Study Population and Sample Collection This case-con-trol study included 381 newly histopathologically diagnosedprimary ESCC patients recruited at the First AffiliatedHospital and the Second Affiliated Hospital of ZhengzhouUniversity between March 2008 and January 2010 All ESCCpatients had no prior history of other types of cancer andwerenot previously treated with chemotherapy or radiotherapyUniform trained investigators used the special questionnairecontaining information of age sex tobacco smoking alcoholintake family history of cancer and environmental factors tointerview patients face to face after written informed consent432 normal controls were frequently matched by age (plusmn5years) and gender with patients randomly selected from acensus of digestion diseases that we had conducted previouslyfrom March 2003 to July 2005 in Xinxiang County of HenanProvince Controls were required to be free of any digestiondiseases with written informed consent having no cancer

history and related clinical signs All the subjects were ethnicHan Chinese without immediate family relations

The 5mL venous blood samples obtained from the sub-jects were collected in an EDTA tube and stored at minus70∘C forextraction of DNA genome Tobacco smoking was definedas smoking at least one cigarette per day and persisting formore than one year Alcohol intake was defined as drinkingat least once a week with more than 100 gram every time andpersisting for more than six monthsThis study was approvedby the Institutional Review Board of Zhengzhou UniversityInformed consent was obtained from each study participant

22 XRCC1 Genotyping The genotypes of XRCC1 poly-morphisms were determined by PCR-RFLP Primers andrestriction endonucleases are shown in Table 1

The PCR reaction started with a total volume of 15 120583L foreachmixture containing the following reagents 75120583L 2timesTaqPCR MasterMix 05 120583M each primer 10 120583L (50 ng) DNAand 56 120583L deionized water

PCR conditions were as follows

codon 194 95∘C for 2min followed by 35 cycles of94∘C for 30 s 60∘C for 30 s 72∘C for 45 s and a finalelongation step at 72∘C for 7min

codon 399 94∘C for 5min followed by 35 cycles of94∘C for 30 s 57∘C for 30 s 72∘C for 45 s and a finalelongation step at 72∘C for 5min

minus77TgtC 94∘C for 5min followed by 35 cycles of94∘C for 30 s 60∘C for 30 s 72∘C for 30 s and a finalelongation step at 72∘C for 5min

The digested products were resolved on 2 agarose gels(for codons 194 and 399) 3 agarose gels (for minus77TgtC) andstained with 05 120583gmL ethidium bromide

All assays were repeated at least once by the sameindividual it is not relevant to verify the genotyping resultsGenotypes were validated by sequencing through biologicaltechnology company

23 Statistical Analysis All analyses were conducted bySPSS160 software To determine whether the frequenciesbetween cases and controls were significantly different (120572 =005) the 1205942 test was used And 1205942 test was also usedto compare distribution differences of haplotype combined

BioMed Research International 3

Table 2 Characteristics of esophageal cancer cases and controls

VariablesCase N()119873 = 381

Control N()119873 = 432

120594

2 P

Agele65 237 (622) 286 (662) 141 023gt65 144 (378) 146 (338)

GenderMale 256 (672) 278 (644) 072 040Female 125 (328) 154 (356)

Smokinglowast

Nonsmokers 189 (596) 264 (611) 017 068Smokers 128 (404) 168 (389)

Drinkinglowast

Nondrinkers 255 (807) 353 (819) 018 068Drinkers 61 (193) 78 (181)

Family history of cancerlowast

No 233 (756) 357 (852) 1060 0001Yes 75 (244) 62 (148)

lowastbecause of the failure data collection the number of cases and controls forsome factors was less than 381 or 432

genotype the number of mutation sites and the number ofmutation alleles among three genetic polymorphisms

Online software httpwwwhad2knowcomacademicshardy-weinberg-equilibrium-calculator-2-alleleshtml wasused to assess Hardy-Weinberg equilibrium for genotypefrequency in controls by a Pearsonrsquos goodness-of-fit 1205942 test tocompare the observed genotype frequencies to the expectedones with one degree of freedom Odds ratios (ORs) and95 confidence intervals (95CI) from logistic regressionanalysis for crude ORs and adjusted ORs when adjustingfor age gender smoking drinking and family history ofcancer were used to detect the associations between thesethree polymorphisms and ESCC risk Haplotypes for eachindividual were inferred using the SNPHAP 20 software Sta-tistical tests were two sided and were considered statisticallysignificant whenever 119875 lt 005

3 Results

31 Subject Characteristics Thefrequency distribution of agesex smoking alcohol drinking status and family history ofcancer among the study subjects is summarized in Table 2The number of individuals with a family history of cancer washigher in ESCC cases than in normal controls (1205942 = 1060119875 = 0001)

32 ESCC Risk Associated with Individual SNPs The geno-type distributions of the three studied SNPs in controls wereall in accordance with Hardy-Weinberg equilibrium the 119875value was 028 079 and 009 for codon 194 codon 399 andminus77TgtC respectively

As shown in Table 3 the distributions of heterozygousand homozygous genotypes of XRCC1 codon 194 and codon399 did not show statistically significant difference betweenthe cases and controls (119875 gt 005) and the results were thesame after adjustment for age gender smoking drinkingand family history of cancer The heterozygous genotypeTC combined genotype TC or CC and allele C of XRCC1minus77TgtC may decrease risk of ESCC however there was nosignificantly statistical association after adjusting age gendersmoking drinking and family history of cancer

33 Haplotype Analysis In order to study the haplotypesfor XRCC1 codon 194 codon 399 and minus77TgtC SNPHAP20 software was applied showing a total of eight builthaplotypes Table 4 shows the frequencies of the estimatedhaplotypes among patients and controls For every suscepti-bility analysis of a haplotype the haplotype CGT (codon 194codon 399 and minus77TgtC) containing major allele was takenas control The data of Table 4 indicated that only haplotypeCGC (codon 194 codon 399 and minus77TgtC)may decrease riskfor developing ESCC compared to the control after adjustingage gender smoking drinking and family history of cancer(OR 062 95 CI 040ndash096)

34 Combined Genotypes Analysis of XRCC1 Codon 194Codon 399 and minus77TgtC Using combined wild geno-type CCGGTT as control combined mutation genotypeCTGGCT may decrease the risk in developing ESCC (OR046 95 CI 022ndash096 119875 = 004) But after adjustingage gender smoking drinking and family history of cancercombined mutation genotype CTGGCT has no statisticalassociation with ESCC (Table 5)

35 Trend Analysis of the Number of Mutation Sites We per-formed trend analysis of the association between the numberof mutation sites and risk of ESCC Using null-mutation ofthree SNPs as control there was no statistically significantassociation of one sitemutation two sitesmutation and threesites mutation with ESCC susceptibility (trend 1205942 = 038119875 = 054) (Table 6)

4 Discussion

Environmental and genetic factors as identifiable risk factorsare considered to have a significant contribution in the devel-opment of cancer Some studies have found that environmen-tal factors including tobacco smoking alcohol consumptionnitrates and preformed nitrosocompounds can increase ECrisk [23 24] However not all individuals who have beenexposed to the environmental risk factors actually developEC suggesting that genetic susceptibility might contributeto the individual risk of EC XRCC1 polymorphisms havebeen reported to be associated with the risk of different kindsof cancers including gastric cancer colorectal cancer lungcancer and breast cancer [25ndash28]

Our data showed that there was no significant associationbetween polymorphism of XRCC1 codon 194 and ESCCsusceptibility and some results of the domestic and foreign

4 BioMed Research International

Table 3 Association of XRCC1 genotypes with esophageal cancer

Genotypes CaseN ()

ControlN () 120594

2 OR (95 CI) 119875 OR (95 CI)lowast 119875

lowast

Codon 194CC 166 (466) 187 (446) Reference 100 mdash mdash mdashTC 159 (447) 193 (461) 024 093 (069 125) 062 091 (066 126) 057TT 31 (87) 39 (93) 018 090 (053 150) 067 096 (055 168) 090CC + TC 190 (534) 232 (554) 031 092 (069 123) 058 092 (068 125) 059C 567 (677) 491 (690) Reference 100 mdash mdash mdashT 271 (323) 221 (310) 030 106 (086 132) 058 090 (076 121) 070

Codon 399GG 184 (485) 223 (516) Reference 100 mdash mdash mdashGA 166 (438) 169 (407) 139 119 (089 159) 024 114 (084 157) 040AA 29 (77) 30 (77) 032 117 (068 202) 057 103 (057 186) 092GA + AA 195 (515) 199 (472) 147 147 (022 157) 022 113 (083 152) 044G 534 (704) 615 (729) Reference 100 mdash mdash mdashA 224 (296) 229 (271) 115 113 (091 140) 028 107 (085 135) 057minus77TgtC

TT 310 (836) 319 (772) Reference 100 mdash mdash mdashTC 59 (159) 92 (223) 509 066 (046 095) 002 070 (048 103) 007CC 2 (05) 2 (05) 022 103 (014 735) 064 0 10TC + CC 61 (164) 94 (228) 492 067 (047 096) 003 069 (047 101) 006T 679 (915) 730 (884) Reference 100 mdash mdash mdashC 63 (85) 96 (116) 437 070 (050 098) 004 070 (048 100) 005

lowastadjusted for age gender smoking drinking and family history of cancer

Table 4 XRCC1 haplotype analysis of three polymorphisms in XRCC1 gene

Haplotypes Case N () Control N () 120594

2 OR (95 CI) P OR (95 CI)lowast Plowast

CGT 323 (424) 349 (404) Reference 100 mdash mdash mdashTGT 152 (199) 189 (219) 111 087 (067 113) 029 081 (060 110) 018CAT 221 (290) 229 (265) 012 104 (082 132) 073 099 (074 131) 092CGC 57 (75) 89 (103) 393 069 (048 100) 005 062 (040 096) 003CAC 2 (03) 4 (05) 010 054 (010 297) 076 025 (003 230) 022TAT 3 (04) 1 (01) 033 324 (034 3132) 057 360 (036 3579) 027TGC 4 (05) 3 (03) 001 144 (032 649) 092 076 (010 572) 079TAC 0 mdash mdash mdash mdash mdash mdashTotal 762 (100) 864 (100) mdash mdash mdash mdash mdashlowastadjusted for age gender smoking drinking and family history of cancerThe order of three SNPs codon 194 codon 399 and minus77TgtC

researches showed to be consistent with ours According tothese results Casson et al [29] founded that there was norelationship between polymorphismofXRCC1 codon 194 andesophageal adenocarcinoma (EA) susceptibility in Canadapopulation Lee et alrsquos [30] study also found that there was noassociation between polymorphism of XRCC1 codon 194 andESCC in Asia population On the contrary there are studiesshowing that XRCC1 codon 194 can increase the risk for ECFor example the result of Xing et al [31] indicated that themutation homozygous genotype (TT) of XRCC1 codon 194 isthe risk factor for EC the adjusted OR (95CI) has a value of198 (126ndash312) A case-control study of Liu et al [32] inHebei

population of China found that the mutation homozygousgenotype (TT) of XRCC1 codon 194 can increase individualrisk of ESCC 086-fold (adjusted OR (95 CI) 186 (119ndash288))

Regarding the XRCC1 codon 399 polymorphism resultswe have not seen any significant association with ESCCAccording to this Chen et al [33] and Song et al [34] con-ducted a case-control study in Jiangsu and Henan provincesof China respectively showing no association betweenXRCC1 codon 399 polymorphism and EC susceptibilityHowever according to the results of Yu et al [35] comparingwith wild type (GG) the mutation homozygous genotype

BioMed Research International 5

Table 5 Combination genotypes analysis of XRCC1 codons 194 399 and minus77TgtC

Combined genotypes Case119873 () Control119873 () 120594

2 OR (95 CI) 119875 OR (95 CI)lowast 119875

lowast

CCGGTT 39 (112) 43 (106) Reference 100 mdash mdash mdashCTGATT 68 (195) 71 (176) 004 106 (061 182) 085 095 (053 172) 087CTGGTT 65 (187) 72 (178) 000 099 (058 172) 099 088 (049 160) 068CCGATT 60 (172) 66 (163) 000 100 (057 175) 099 102 (056 187) 095TTGGTT 29 (83) 37 (92) 019 086 (045 166) 066 091 (045 184) 080CTGGCT 16 (46) 38 (94) 435 046 (022 096) 004 052 (024 113) 010CCAATT 23 (66) 23 (57) 007 110 (053 227) 079 086 (039 192) 072CCGACT 17 (49) 23 (57) 028 081 (038 175) 060 074 (032 170) 048CCGGCT 20 (57) 22 (54) 000 100 (048 211) 100 109 (050 242) 082CTGACT 4 (11) 2 (05) 023 221 (038 1271) 063 118 (018 774) 086CCAACT 1 (03) 3 (07) 014 037 (004 368) 071 037 (004 387) 041CTAATT 3 (09) 1 (02) 031 331 (033 3313) 058 374 (036 3883) 027

Others 3 (09) 3 (09) mdash mdash mdash mdash mdashTotal 348 (100) 404 (100) mdash mdash mdash mdash mdash

lowastadjusted for age gender smoking drinking and family history of cancer

Table 6 Trend analysis of the number of mutation sites

Number of mutation sites Case119873 () Control119873 () 120594

2 OR (95 CI) 119875 OR (95 CI)1 119875

1

0 39 (112) 43 (106) Reference 100 mdash mdash mdash1 198 (569) 220 (545) 000 099 (062 159) 097 095 (057 159) 0842 107 (307) 139 (344) 041 085 (051 140) 052 078 (046 136) 0403 4 (11) 2 (05) 023 221 (038 1271) 063 123 (019 804) 083mdash mdash mdash 038lowast mdash 054lowast mdash mdashTotal 348 (100) 404 (100) mdash mdash mdash mdash mdashlowasttrend chi-square1Adjusted for age gender smoking drinking and family history of cancer

(AA) was a risk factor for developing EC (OR (95 CI)515 (242ndash1093)) By stratification analysis smokers carryinghomozygous mutant (AA) were associated with a 731-foldincreased risk for EC compared to smokers carrying the wildtype (GG) (OR 831 95CI 392ndash1763) meanwhile drinkerscarrying homozygous mutant (AA) were associated with a443-fold increased risk for EC compared to drinkers carryingthe wild type (GG) (OR 543 95 CI 246ndash1199)

In this study we did not observe significant associationbetween polymorphism of XRCC1 minus77TgtC and EC suscep-tibility Supporting these results as Hao et al [22] firstlyreported theXRCC1 minus77TgtC polymorphism in 51015840 noncodingregion in 2004 the results found that XRCC1 minus77TgtCcan increase the combination of XRCC1 promoter and atranscription inhibitory factor thus reducing the promoteractivity and protein expression However they did not findthe association ofXRCC1 minus77TgtC polymorphismwith ESCCsusceptibility The relationship between XRCC1 minus77TgtC andEC susceptibility needs to be clarified by more large sizestudies

In this study we conducted quality control strictlythroughout the whole study The patients included wereall newly pathologically diagnosed thus avoiding the prev-alence-incidence bias Besides the controls were frequency-matched and the investigators were unified-trained rigor-ously Moreover we sequenced the three SNPs duplicately

and verified them by DNA sequencing making the resultscredible

In conclusion the present study suggested that the singlepolymorphism in the DNA repair gene XRCC1 was notstatistically associated with risk of ESCC however haplotypeCGC (codon 194 codon 399 and minus77TgtC) of three SNPsin XRCC1 gene may decrease risk for ESCC susceptibilityBut in the future it would be necessary to confirm thesefindings in a large and multiethnic population study becauseof the relatively small sample size in this study and gene-environment interaction analysis and it should also be per-formed to investigate the tumorigenesis mechanism

Conflict of Interests

The authors declare that there is no conflict of interestsregarding the publication of this paper

Acknowledgments

This research was supported by Peoplersquos Republic ofChina (National Natural Science Foundation of China no81072360) and Program for Science amp Technology Inno-vation Talents in Universities of Henan Province (no2010HASTIT027) and Excellent Youth Foundation of Hersquonan

6 BioMed Research International

Scientific Committee (no 124100510007) The authorsacknowledge the blood samples of cases given by the Firstand the Second Affiliated Hospitals of Zhengzhou UniversityThe authors also wish to acknowledge the residents in Xinx-iang County of Henan Province who supported their epide-miological study on the scene

References

[1] D M Parkin F I Bray and S S Devesa ldquoCancer burden in theyear 2000 The global picturerdquo European Journal of Cancer vol37 no 8 pp 4ndash66 2001

[2] J Ferlay H R Shin F Bray D Forman C Mathers and DM Parkin ldquoEstimates of worldwide burden of cancer in 2008GLOBOCAN2008rdquo International Journal of Cancer vol 127 no12 pp 2893ndash2917 2010

[3] D M Parkin F Bray J Ferlay and P Pisani ldquoGlobal cancerstatistics 2002rdquo CA A Cancer Journal for Clinicians vol 55 no2 pp 74ndash108 2005

[4] L Dai K Wang J Zhang Q Lv X Wu and Y Wang ldquoXRCC1gene polymorphisms and esophageal squamous cell carcinomarisk in Chinese population a meta-analysis of case-controlstudiesrdquo International Journal of Cancer vol 125 no 5 pp 1102ndash1109 2009

[5] H Yu C Fu J Wang H Xue and B Xu ldquoInteraction betweenXRCC1 polymorphisms and intake of long-term stored rice inthe risk of esophageal squamous cell carcinoma a case-controlstudyrdquo Biomedical and Environmental Sciences vol 24 no 3 pp268ndash274 2011

[6] A Jemal F Bray M M Center J Ferlay E Ward and DForman ldquoGlobal cancer statisticsrdquo CA A cancer Journal forClinicians vol 61 no 2 pp 69ndash90 2011

[7] J H J Hoeijmakers ldquoGenome maintenance mechanisms forpreventing cancerrdquoNature vol 411 no 6835 pp 366ndash374 2001

[8] T Lindahl and R D Wood ldquoQuality control by DNA repairrdquoScience vol 286 no 5446 pp 1897ndash1905 1999

[9] R D Wood M Mitchell J Sgouros and T Lindahl ldquoHumanDNA repair genesrdquo Science vol 291 no 5507 pp 1284ndash12892001

[10] E C Friedberg ldquoDNA damage and repairrdquoNature vol 421 no6921 pp 436ndash440 2003

[11] S Maynard S H Schurman C Harboe N C de Souza-Pintoand V A Bohr ldquoBase excision repair of oxidative DNA damageand association with cancer and agingrdquo Carcinogenesis vol 30no 1 pp 2ndash10 2009

[12] R J Hung J Hall P Brennan and P Boffetta ldquoGeneticpolymorphisms in the base excision repair pathway and cancerrisk a huge reviewrdquo American Journal of Epidemiology vol 162no 10 pp 925ndash942 2005

[13] M Stanczyk T Sliwinski M Cuchra et al ldquoThe associationof polymorphisms in DNA base excision repair genes XRCC1OGG1 and MUTYH with the risk of childhood acute lym-phoblastic leukemiardquo Molecular Biology Reports vol 38 no 1pp 445ndash451 2011

[14] L Cai N C Y You H Lu et al ldquoDietary selenium intake alde-hyde dehydrogenase-2 and X-ray repair cross-complementing1 genetic polymorphisms and the risk of esophageal squamouscell carcinomardquo Cancer vol 106 no 11 pp 2345ndash2354 2006

[15] G Liu W Zhou B Y Yeap et al ldquoXRCC1 and XPD polymor-phisms and esophageal adenocarcinoma riskrdquo Carcinogenesisvol 28 no 6 pp 1254ndash1258 2007

[16] L H Thompson and M G West ldquoXRCC1 keeps DNA fromgetting strandedrdquoMutation ResearchDNA Repair vol 459 no1 pp 1ndash18 2000

[17] R C Sobti J Singh P Kaur S S Pachouri E A Siddiquiand H S Bindra ldquoXRCC1 codon 399 and ERCC2 codon 751polymorphism smoking and drinking and risk of esophagealsquamous cell carcinoma in aNorth Indian populationrdquoCancerGenetics and Cytogenetics vol 175 no 2 pp 91ndash97 2007

[18] H Li T C Ha and B C Tai ldquoXRCC1 gene polymorphismsand breast cancer risk in different populations ameta-analysisrdquoBreast vol 18 no 3 pp 183ndash191 2009

[19] M R Shen I M Jones and H Mohrenweiser ldquoNonconser-vative amino acid substitution variants exist at polymorphicfrequency in DNA repair genes in healthy humansrdquo CancerResearch vol 58 no 4 pp 604ndash608 1998

[20] J E Lamerdin M A Montgomery S A Stilwagen et alldquoGenomic sequence comparison of the human and mouseXRCC1 DNA repair gene regionsrdquo Genomics vol 25 no 2 pp547ndash554 1995

[21] R M Lunn R G Langlois L L Hsieh C LThompson and DA Bell ldquoXRCC1 polymorphisms effects on aflatoxin B1-DNAadducts and glycophorin A variant frequencyrdquoCancer Researchvol 59 no 11 pp 2557ndash2561 1999

[22] B Hao H Wang K Zhou et al ldquoIdentification of geneticvariants in base excision repair pathway and their associationswith risk of esophageal squamous cell carcinomardquo CancerResearch vol 64 no 12 pp 4378ndash4384 2004

[23] C H Lee J M Lee D C Wu et al ldquoIndependent andcombined effects of alcohol intake tobacco smoking and betelquid chewing on the risk of esophageal cancer in TaiwanrdquoInternational Journal of Cancer vol 113 no 3 pp 475ndash4822005

[24] M Siddiqi R Kumar Z Fazili B Spiegelhalder and RPreussmann ldquoIncreased exposure to dietary amines and nitratein a population at high risk of oesophageal and gastric cancerin Kashmir (India)rdquo Carcinogenesis vol 13 no 8 pp 1331ndash13351992

[25] J Li L Mu and GWei ldquoRelationship between polymorphismsof DNA repair gene XRCC1 and susceptibility to lung cancerrdquoChina Oncology vol 15 pp 335ndash338 2005

[26] E J Duell R C Millikan G S Pittman et al ldquoPolymorphismsin the DNA repair gene XRCC1 and breast cancerrdquo CancerEpidemiology Biomarkers amp Prevention vol 10 no 3 pp 217ndash222 2001

[27] S G Lee B Kim J Choi C Kim I Lee and K Song ldquoGeneticpolymorphisms of XRCC1 and risk of gastric cancerrdquo CancerLetters vol 187 no 1-2 pp 53ndash60 2002

[28] S Z Abdel-Rahman A S Soliman M L Bondy et alldquoInheritance of the 194Trp and the 399Gln variant alleles of theDNA repair gene XRCC1 are associated with increased risk ofearly-onset colorectal carcinoma in Egyptrdquo Cancer Letters vol159 no 1 pp 79ndash86 2000

[29] A G Casson Z Zheng S C Evans P J Veugelers G APorter and D L Guernsey ldquoPolymorphisms in DNA repairgenes in the molecular pathogenesis of esophageal (Barrett)adenocarcinomardquo Carcinogenesis vol 26 no 9 pp 1536ndash15412005

[30] J M Lee Y C Lee S Y Yang et al ldquoGenetic polymorphisms ofXRCC1 and risk of the esophageal cancerrdquo International Journalof Cancer vol 95 no 4 pp 240ndash246 2001

[31] D Xing J Qi X Miao W Lu W Tan and D Lin ldquoPoly-morphisms of DNA repair genes XRCC1 and XPD and their

BioMed Research International 7

associations with risk of esophageal squamous cell carcinomain a Chinese populationrdquo International Journal of Cancer vol100 no 5 pp 600ndash605 2002

[32] J Liu W Lei J Ma and R Xue ldquoCorrelation of DNA repairgene polymorphisms and esophageal canceTNM staging andregional lymph node metastasisrdquo Chinese Journal of Thoracicand Cardiovascular Surgery vol 22 no 5 pp 315ndash317 2006

[33] M Chen J Wang G Guo et al ldquoThe single nucleotidepolymorphism of DNA damage repair gene XPD Lys751GlnXRCC1 Arg399Gln and genetic susceptibility for esophagealcancerrdquo Journal of Fudan University (Medical sciences) vol 35no 2 pp 273ndash277 2008

[34] C Song W Tan and D Lin ldquoPolymorphisms of DNArepair gene XRCC1 in Chinese population and its relation toesophageal squamous cell carcinomardquo Cancer vol 20 no 1 pp28ndash31 2001

[35] H P Yu X Y Zhang X L Wang et al ldquoDNA repair geneXRCC1 polymorphisms smoking and esophageal cancer riskrdquoCancer Detection and Prevention vol 28 no 3 pp 194ndash1992004

Submit your manuscripts athttpwwwhindawicom

Stem CellsInternational

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

MEDIATORSINFLAMMATION

of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Behavioural Neurology

EndocrinologyInternational Journal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Disease Markers

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

BioMed Research International

OncologyJournal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Oxidative Medicine and Cellular Longevity

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

PPAR Research

The Scientific World JournalHindawi Publishing Corporation httpwwwhindawicom Volume 2014

Immunology ResearchHindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Journal of

ObesityJournal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Computational and Mathematical Methods in Medicine

OphthalmologyJournal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Diabetes ResearchJournal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Research and TreatmentAIDS

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Gastroenterology Research and Practice

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Parkinsonrsquos Disease

Evidence-Based Complementary and Alternative Medicine

Volume 2014Hindawi Publishing Corporationhttpwwwhindawicom

BioMed Research International 3

Table 2 Characteristics of esophageal cancer cases and controls

VariablesCase N()119873 = 381

Control N()119873 = 432

120594

2 P

Agele65 237 (622) 286 (662) 141 023gt65 144 (378) 146 (338)

GenderMale 256 (672) 278 (644) 072 040Female 125 (328) 154 (356)

Smokinglowast

Nonsmokers 189 (596) 264 (611) 017 068Smokers 128 (404) 168 (389)

Drinkinglowast

Nondrinkers 255 (807) 353 (819) 018 068Drinkers 61 (193) 78 (181)

Family history of cancerlowast

No 233 (756) 357 (852) 1060 0001Yes 75 (244) 62 (148)

lowastbecause of the failure data collection the number of cases and controls forsome factors was less than 381 or 432

genotype the number of mutation sites and the number ofmutation alleles among three genetic polymorphisms

Online software httpwwwhad2knowcomacademicshardy-weinberg-equilibrium-calculator-2-alleleshtml wasused to assess Hardy-Weinberg equilibrium for genotypefrequency in controls by a Pearsonrsquos goodness-of-fit 1205942 test tocompare the observed genotype frequencies to the expectedones with one degree of freedom Odds ratios (ORs) and95 confidence intervals (95CI) from logistic regressionanalysis for crude ORs and adjusted ORs when adjustingfor age gender smoking drinking and family history ofcancer were used to detect the associations between thesethree polymorphisms and ESCC risk Haplotypes for eachindividual were inferred using the SNPHAP 20 software Sta-tistical tests were two sided and were considered statisticallysignificant whenever 119875 lt 005

3 Results

31 Subject Characteristics Thefrequency distribution of agesex smoking alcohol drinking status and family history ofcancer among the study subjects is summarized in Table 2The number of individuals with a family history of cancer washigher in ESCC cases than in normal controls (1205942 = 1060119875 = 0001)

32 ESCC Risk Associated with Individual SNPs The geno-type distributions of the three studied SNPs in controls wereall in accordance with Hardy-Weinberg equilibrium the 119875value was 028 079 and 009 for codon 194 codon 399 andminus77TgtC respectively

As shown in Table 3 the distributions of heterozygousand homozygous genotypes of XRCC1 codon 194 and codon399 did not show statistically significant difference betweenthe cases and controls (119875 gt 005) and the results were thesame after adjustment for age gender smoking drinkingand family history of cancer The heterozygous genotypeTC combined genotype TC or CC and allele C of XRCC1minus77TgtC may decrease risk of ESCC however there was nosignificantly statistical association after adjusting age gendersmoking drinking and family history of cancer

33 Haplotype Analysis In order to study the haplotypesfor XRCC1 codon 194 codon 399 and minus77TgtC SNPHAP20 software was applied showing a total of eight builthaplotypes Table 4 shows the frequencies of the estimatedhaplotypes among patients and controls For every suscepti-bility analysis of a haplotype the haplotype CGT (codon 194codon 399 and minus77TgtC) containing major allele was takenas control The data of Table 4 indicated that only haplotypeCGC (codon 194 codon 399 and minus77TgtC)may decrease riskfor developing ESCC compared to the control after adjustingage gender smoking drinking and family history of cancer(OR 062 95 CI 040ndash096)

34 Combined Genotypes Analysis of XRCC1 Codon 194Codon 399 and minus77TgtC Using combined wild geno-type CCGGTT as control combined mutation genotypeCTGGCT may decrease the risk in developing ESCC (OR046 95 CI 022ndash096 119875 = 004) But after adjustingage gender smoking drinking and family history of cancercombined mutation genotype CTGGCT has no statisticalassociation with ESCC (Table 5)

35 Trend Analysis of the Number of Mutation Sites We per-formed trend analysis of the association between the numberof mutation sites and risk of ESCC Using null-mutation ofthree SNPs as control there was no statistically significantassociation of one sitemutation two sitesmutation and threesites mutation with ESCC susceptibility (trend 1205942 = 038119875 = 054) (Table 6)

4 Discussion

Environmental and genetic factors as identifiable risk factorsare considered to have a significant contribution in the devel-opment of cancer Some studies have found that environmen-tal factors including tobacco smoking alcohol consumptionnitrates and preformed nitrosocompounds can increase ECrisk [23 24] However not all individuals who have beenexposed to the environmental risk factors actually developEC suggesting that genetic susceptibility might contributeto the individual risk of EC XRCC1 polymorphisms havebeen reported to be associated with the risk of different kindsof cancers including gastric cancer colorectal cancer lungcancer and breast cancer [25ndash28]

Our data showed that there was no significant associationbetween polymorphism of XRCC1 codon 194 and ESCCsusceptibility and some results of the domestic and foreign

4 BioMed Research International

Table 3 Association of XRCC1 genotypes with esophageal cancer

Genotypes CaseN ()

ControlN () 120594

2 OR (95 CI) 119875 OR (95 CI)lowast 119875

lowast

Codon 194CC 166 (466) 187 (446) Reference 100 mdash mdash mdashTC 159 (447) 193 (461) 024 093 (069 125) 062 091 (066 126) 057TT 31 (87) 39 (93) 018 090 (053 150) 067 096 (055 168) 090CC + TC 190 (534) 232 (554) 031 092 (069 123) 058 092 (068 125) 059C 567 (677) 491 (690) Reference 100 mdash mdash mdashT 271 (323) 221 (310) 030 106 (086 132) 058 090 (076 121) 070

Codon 399GG 184 (485) 223 (516) Reference 100 mdash mdash mdashGA 166 (438) 169 (407) 139 119 (089 159) 024 114 (084 157) 040AA 29 (77) 30 (77) 032 117 (068 202) 057 103 (057 186) 092GA + AA 195 (515) 199 (472) 147 147 (022 157) 022 113 (083 152) 044G 534 (704) 615 (729) Reference 100 mdash mdash mdashA 224 (296) 229 (271) 115 113 (091 140) 028 107 (085 135) 057minus77TgtC

TT 310 (836) 319 (772) Reference 100 mdash mdash mdashTC 59 (159) 92 (223) 509 066 (046 095) 002 070 (048 103) 007CC 2 (05) 2 (05) 022 103 (014 735) 064 0 10TC + CC 61 (164) 94 (228) 492 067 (047 096) 003 069 (047 101) 006T 679 (915) 730 (884) Reference 100 mdash mdash mdashC 63 (85) 96 (116) 437 070 (050 098) 004 070 (048 100) 005

lowastadjusted for age gender smoking drinking and family history of cancer

Table 4 XRCC1 haplotype analysis of three polymorphisms in XRCC1 gene

Haplotypes Case N () Control N () 120594

2 OR (95 CI) P OR (95 CI)lowast Plowast

CGT 323 (424) 349 (404) Reference 100 mdash mdash mdashTGT 152 (199) 189 (219) 111 087 (067 113) 029 081 (060 110) 018CAT 221 (290) 229 (265) 012 104 (082 132) 073 099 (074 131) 092CGC 57 (75) 89 (103) 393 069 (048 100) 005 062 (040 096) 003CAC 2 (03) 4 (05) 010 054 (010 297) 076 025 (003 230) 022TAT 3 (04) 1 (01) 033 324 (034 3132) 057 360 (036 3579) 027TGC 4 (05) 3 (03) 001 144 (032 649) 092 076 (010 572) 079TAC 0 mdash mdash mdash mdash mdash mdashTotal 762 (100) 864 (100) mdash mdash mdash mdash mdashlowastadjusted for age gender smoking drinking and family history of cancerThe order of three SNPs codon 194 codon 399 and minus77TgtC

researches showed to be consistent with ours According tothese results Casson et al [29] founded that there was norelationship between polymorphismofXRCC1 codon 194 andesophageal adenocarcinoma (EA) susceptibility in Canadapopulation Lee et alrsquos [30] study also found that there was noassociation between polymorphism of XRCC1 codon 194 andESCC in Asia population On the contrary there are studiesshowing that XRCC1 codon 194 can increase the risk for ECFor example the result of Xing et al [31] indicated that themutation homozygous genotype (TT) of XRCC1 codon 194 isthe risk factor for EC the adjusted OR (95CI) has a value of198 (126ndash312) A case-control study of Liu et al [32] inHebei

population of China found that the mutation homozygousgenotype (TT) of XRCC1 codon 194 can increase individualrisk of ESCC 086-fold (adjusted OR (95 CI) 186 (119ndash288))

Regarding the XRCC1 codon 399 polymorphism resultswe have not seen any significant association with ESCCAccording to this Chen et al [33] and Song et al [34] con-ducted a case-control study in Jiangsu and Henan provincesof China respectively showing no association betweenXRCC1 codon 399 polymorphism and EC susceptibilityHowever according to the results of Yu et al [35] comparingwith wild type (GG) the mutation homozygous genotype

BioMed Research International 5

Table 5 Combination genotypes analysis of XRCC1 codons 194 399 and minus77TgtC

Combined genotypes Case119873 () Control119873 () 120594

2 OR (95 CI) 119875 OR (95 CI)lowast 119875

lowast

CCGGTT 39 (112) 43 (106) Reference 100 mdash mdash mdashCTGATT 68 (195) 71 (176) 004 106 (061 182) 085 095 (053 172) 087CTGGTT 65 (187) 72 (178) 000 099 (058 172) 099 088 (049 160) 068CCGATT 60 (172) 66 (163) 000 100 (057 175) 099 102 (056 187) 095TTGGTT 29 (83) 37 (92) 019 086 (045 166) 066 091 (045 184) 080CTGGCT 16 (46) 38 (94) 435 046 (022 096) 004 052 (024 113) 010CCAATT 23 (66) 23 (57) 007 110 (053 227) 079 086 (039 192) 072CCGACT 17 (49) 23 (57) 028 081 (038 175) 060 074 (032 170) 048CCGGCT 20 (57) 22 (54) 000 100 (048 211) 100 109 (050 242) 082CTGACT 4 (11) 2 (05) 023 221 (038 1271) 063 118 (018 774) 086CCAACT 1 (03) 3 (07) 014 037 (004 368) 071 037 (004 387) 041CTAATT 3 (09) 1 (02) 031 331 (033 3313) 058 374 (036 3883) 027

Others 3 (09) 3 (09) mdash mdash mdash mdash mdashTotal 348 (100) 404 (100) mdash mdash mdash mdash mdash

lowastadjusted for age gender smoking drinking and family history of cancer

Table 6 Trend analysis of the number of mutation sites

Number of mutation sites Case119873 () Control119873 () 120594

2 OR (95 CI) 119875 OR (95 CI)1 119875

1

0 39 (112) 43 (106) Reference 100 mdash mdash mdash1 198 (569) 220 (545) 000 099 (062 159) 097 095 (057 159) 0842 107 (307) 139 (344) 041 085 (051 140) 052 078 (046 136) 0403 4 (11) 2 (05) 023 221 (038 1271) 063 123 (019 804) 083mdash mdash mdash 038lowast mdash 054lowast mdash mdashTotal 348 (100) 404 (100) mdash mdash mdash mdash mdashlowasttrend chi-square1Adjusted for age gender smoking drinking and family history of cancer

(AA) was a risk factor for developing EC (OR (95 CI)515 (242ndash1093)) By stratification analysis smokers carryinghomozygous mutant (AA) were associated with a 731-foldincreased risk for EC compared to smokers carrying the wildtype (GG) (OR 831 95CI 392ndash1763) meanwhile drinkerscarrying homozygous mutant (AA) were associated with a443-fold increased risk for EC compared to drinkers carryingthe wild type (GG) (OR 543 95 CI 246ndash1199)

In this study we did not observe significant associationbetween polymorphism of XRCC1 minus77TgtC and EC suscep-tibility Supporting these results as Hao et al [22] firstlyreported theXRCC1 minus77TgtC polymorphism in 51015840 noncodingregion in 2004 the results found that XRCC1 minus77TgtCcan increase the combination of XRCC1 promoter and atranscription inhibitory factor thus reducing the promoteractivity and protein expression However they did not findthe association ofXRCC1 minus77TgtC polymorphismwith ESCCsusceptibility The relationship between XRCC1 minus77TgtC andEC susceptibility needs to be clarified by more large sizestudies

In this study we conducted quality control strictlythroughout the whole study The patients included wereall newly pathologically diagnosed thus avoiding the prev-alence-incidence bias Besides the controls were frequency-matched and the investigators were unified-trained rigor-ously Moreover we sequenced the three SNPs duplicately

and verified them by DNA sequencing making the resultscredible

In conclusion the present study suggested that the singlepolymorphism in the DNA repair gene XRCC1 was notstatistically associated with risk of ESCC however haplotypeCGC (codon 194 codon 399 and minus77TgtC) of three SNPsin XRCC1 gene may decrease risk for ESCC susceptibilityBut in the future it would be necessary to confirm thesefindings in a large and multiethnic population study becauseof the relatively small sample size in this study and gene-environment interaction analysis and it should also be per-formed to investigate the tumorigenesis mechanism

Conflict of Interests

The authors declare that there is no conflict of interestsregarding the publication of this paper

Acknowledgments

This research was supported by Peoplersquos Republic ofChina (National Natural Science Foundation of China no81072360) and Program for Science amp Technology Inno-vation Talents in Universities of Henan Province (no2010HASTIT027) and Excellent Youth Foundation of Hersquonan

6 BioMed Research International

Scientific Committee (no 124100510007) The authorsacknowledge the blood samples of cases given by the Firstand the Second Affiliated Hospitals of Zhengzhou UniversityThe authors also wish to acknowledge the residents in Xinx-iang County of Henan Province who supported their epide-miological study on the scene

References

[1] D M Parkin F I Bray and S S Devesa ldquoCancer burden in theyear 2000 The global picturerdquo European Journal of Cancer vol37 no 8 pp 4ndash66 2001

[2] J Ferlay H R Shin F Bray D Forman C Mathers and DM Parkin ldquoEstimates of worldwide burden of cancer in 2008GLOBOCAN2008rdquo International Journal of Cancer vol 127 no12 pp 2893ndash2917 2010

[3] D M Parkin F Bray J Ferlay and P Pisani ldquoGlobal cancerstatistics 2002rdquo CA A Cancer Journal for Clinicians vol 55 no2 pp 74ndash108 2005

[4] L Dai K Wang J Zhang Q Lv X Wu and Y Wang ldquoXRCC1gene polymorphisms and esophageal squamous cell carcinomarisk in Chinese population a meta-analysis of case-controlstudiesrdquo International Journal of Cancer vol 125 no 5 pp 1102ndash1109 2009

[5] H Yu C Fu J Wang H Xue and B Xu ldquoInteraction betweenXRCC1 polymorphisms and intake of long-term stored rice inthe risk of esophageal squamous cell carcinoma a case-controlstudyrdquo Biomedical and Environmental Sciences vol 24 no 3 pp268ndash274 2011

[6] A Jemal F Bray M M Center J Ferlay E Ward and DForman ldquoGlobal cancer statisticsrdquo CA A cancer Journal forClinicians vol 61 no 2 pp 69ndash90 2011

[7] J H J Hoeijmakers ldquoGenome maintenance mechanisms forpreventing cancerrdquoNature vol 411 no 6835 pp 366ndash374 2001

[8] T Lindahl and R D Wood ldquoQuality control by DNA repairrdquoScience vol 286 no 5446 pp 1897ndash1905 1999

[9] R D Wood M Mitchell J Sgouros and T Lindahl ldquoHumanDNA repair genesrdquo Science vol 291 no 5507 pp 1284ndash12892001

[10] E C Friedberg ldquoDNA damage and repairrdquoNature vol 421 no6921 pp 436ndash440 2003

[11] S Maynard S H Schurman C Harboe N C de Souza-Pintoand V A Bohr ldquoBase excision repair of oxidative DNA damageand association with cancer and agingrdquo Carcinogenesis vol 30no 1 pp 2ndash10 2009

[12] R J Hung J Hall P Brennan and P Boffetta ldquoGeneticpolymorphisms in the base excision repair pathway and cancerrisk a huge reviewrdquo American Journal of Epidemiology vol 162no 10 pp 925ndash942 2005

[13] M Stanczyk T Sliwinski M Cuchra et al ldquoThe associationof polymorphisms in DNA base excision repair genes XRCC1OGG1 and MUTYH with the risk of childhood acute lym-phoblastic leukemiardquo Molecular Biology Reports vol 38 no 1pp 445ndash451 2011

[14] L Cai N C Y You H Lu et al ldquoDietary selenium intake alde-hyde dehydrogenase-2 and X-ray repair cross-complementing1 genetic polymorphisms and the risk of esophageal squamouscell carcinomardquo Cancer vol 106 no 11 pp 2345ndash2354 2006

[15] G Liu W Zhou B Y Yeap et al ldquoXRCC1 and XPD polymor-phisms and esophageal adenocarcinoma riskrdquo Carcinogenesisvol 28 no 6 pp 1254ndash1258 2007

[16] L H Thompson and M G West ldquoXRCC1 keeps DNA fromgetting strandedrdquoMutation ResearchDNA Repair vol 459 no1 pp 1ndash18 2000

[17] R C Sobti J Singh P Kaur S S Pachouri E A Siddiquiand H S Bindra ldquoXRCC1 codon 399 and ERCC2 codon 751polymorphism smoking and drinking and risk of esophagealsquamous cell carcinoma in aNorth Indian populationrdquoCancerGenetics and Cytogenetics vol 175 no 2 pp 91ndash97 2007

[18] H Li T C Ha and B C Tai ldquoXRCC1 gene polymorphismsand breast cancer risk in different populations ameta-analysisrdquoBreast vol 18 no 3 pp 183ndash191 2009

[19] M R Shen I M Jones and H Mohrenweiser ldquoNonconser-vative amino acid substitution variants exist at polymorphicfrequency in DNA repair genes in healthy humansrdquo CancerResearch vol 58 no 4 pp 604ndash608 1998

[20] J E Lamerdin M A Montgomery S A Stilwagen et alldquoGenomic sequence comparison of the human and mouseXRCC1 DNA repair gene regionsrdquo Genomics vol 25 no 2 pp547ndash554 1995

[21] R M Lunn R G Langlois L L Hsieh C LThompson and DA Bell ldquoXRCC1 polymorphisms effects on aflatoxin B1-DNAadducts and glycophorin A variant frequencyrdquoCancer Researchvol 59 no 11 pp 2557ndash2561 1999

[22] B Hao H Wang K Zhou et al ldquoIdentification of geneticvariants in base excision repair pathway and their associationswith risk of esophageal squamous cell carcinomardquo CancerResearch vol 64 no 12 pp 4378ndash4384 2004

[23] C H Lee J M Lee D C Wu et al ldquoIndependent andcombined effects of alcohol intake tobacco smoking and betelquid chewing on the risk of esophageal cancer in TaiwanrdquoInternational Journal of Cancer vol 113 no 3 pp 475ndash4822005

[24] M Siddiqi R Kumar Z Fazili B Spiegelhalder and RPreussmann ldquoIncreased exposure to dietary amines and nitratein a population at high risk of oesophageal and gastric cancerin Kashmir (India)rdquo Carcinogenesis vol 13 no 8 pp 1331ndash13351992

[25] J Li L Mu and GWei ldquoRelationship between polymorphismsof DNA repair gene XRCC1 and susceptibility to lung cancerrdquoChina Oncology vol 15 pp 335ndash338 2005

[26] E J Duell R C Millikan G S Pittman et al ldquoPolymorphismsin the DNA repair gene XRCC1 and breast cancerrdquo CancerEpidemiology Biomarkers amp Prevention vol 10 no 3 pp 217ndash222 2001

[27] S G Lee B Kim J Choi C Kim I Lee and K Song ldquoGeneticpolymorphisms of XRCC1 and risk of gastric cancerrdquo CancerLetters vol 187 no 1-2 pp 53ndash60 2002

[28] S Z Abdel-Rahman A S Soliman M L Bondy et alldquoInheritance of the 194Trp and the 399Gln variant alleles of theDNA repair gene XRCC1 are associated with increased risk ofearly-onset colorectal carcinoma in Egyptrdquo Cancer Letters vol159 no 1 pp 79ndash86 2000

[29] A G Casson Z Zheng S C Evans P J Veugelers G APorter and D L Guernsey ldquoPolymorphisms in DNA repairgenes in the molecular pathogenesis of esophageal (Barrett)adenocarcinomardquo Carcinogenesis vol 26 no 9 pp 1536ndash15412005

[30] J M Lee Y C Lee S Y Yang et al ldquoGenetic polymorphisms ofXRCC1 and risk of the esophageal cancerrdquo International Journalof Cancer vol 95 no 4 pp 240ndash246 2001

[31] D Xing J Qi X Miao W Lu W Tan and D Lin ldquoPoly-morphisms of DNA repair genes XRCC1 and XPD and their

BioMed Research International 7

associations with risk of esophageal squamous cell carcinomain a Chinese populationrdquo International Journal of Cancer vol100 no 5 pp 600ndash605 2002

[32] J Liu W Lei J Ma and R Xue ldquoCorrelation of DNA repairgene polymorphisms and esophageal canceTNM staging andregional lymph node metastasisrdquo Chinese Journal of Thoracicand Cardiovascular Surgery vol 22 no 5 pp 315ndash317 2006

[33] M Chen J Wang G Guo et al ldquoThe single nucleotidepolymorphism of DNA damage repair gene XPD Lys751GlnXRCC1 Arg399Gln and genetic susceptibility for esophagealcancerrdquo Journal of Fudan University (Medical sciences) vol 35no 2 pp 273ndash277 2008

[34] C Song W Tan and D Lin ldquoPolymorphisms of DNArepair gene XRCC1 in Chinese population and its relation toesophageal squamous cell carcinomardquo Cancer vol 20 no 1 pp28ndash31 2001

[35] H P Yu X Y Zhang X L Wang et al ldquoDNA repair geneXRCC1 polymorphisms smoking and esophageal cancer riskrdquoCancer Detection and Prevention vol 28 no 3 pp 194ndash1992004

Submit your manuscripts athttpwwwhindawicom

Stem CellsInternational

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

MEDIATORSINFLAMMATION

of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Behavioural Neurology

EndocrinologyInternational Journal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Disease Markers

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

BioMed Research International

OncologyJournal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Oxidative Medicine and Cellular Longevity

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

PPAR Research

The Scientific World JournalHindawi Publishing Corporation httpwwwhindawicom Volume 2014

Immunology ResearchHindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Journal of

ObesityJournal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Computational and Mathematical Methods in Medicine

OphthalmologyJournal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Diabetes ResearchJournal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Research and TreatmentAIDS

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Gastroenterology Research and Practice

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Parkinsonrsquos Disease

Evidence-Based Complementary and Alternative Medicine

Volume 2014Hindawi Publishing Corporationhttpwwwhindawicom

4 BioMed Research International

Table 3 Association of XRCC1 genotypes with esophageal cancer

Genotypes CaseN ()

ControlN () 120594

2 OR (95 CI) 119875 OR (95 CI)lowast 119875

lowast

Codon 194CC 166 (466) 187 (446) Reference 100 mdash mdash mdashTC 159 (447) 193 (461) 024 093 (069 125) 062 091 (066 126) 057TT 31 (87) 39 (93) 018 090 (053 150) 067 096 (055 168) 090CC + TC 190 (534) 232 (554) 031 092 (069 123) 058 092 (068 125) 059C 567 (677) 491 (690) Reference 100 mdash mdash mdashT 271 (323) 221 (310) 030 106 (086 132) 058 090 (076 121) 070

Codon 399GG 184 (485) 223 (516) Reference 100 mdash mdash mdashGA 166 (438) 169 (407) 139 119 (089 159) 024 114 (084 157) 040AA 29 (77) 30 (77) 032 117 (068 202) 057 103 (057 186) 092GA + AA 195 (515) 199 (472) 147 147 (022 157) 022 113 (083 152) 044G 534 (704) 615 (729) Reference 100 mdash mdash mdashA 224 (296) 229 (271) 115 113 (091 140) 028 107 (085 135) 057minus77TgtC

TT 310 (836) 319 (772) Reference 100 mdash mdash mdashTC 59 (159) 92 (223) 509 066 (046 095) 002 070 (048 103) 007CC 2 (05) 2 (05) 022 103 (014 735) 064 0 10TC + CC 61 (164) 94 (228) 492 067 (047 096) 003 069 (047 101) 006T 679 (915) 730 (884) Reference 100 mdash mdash mdashC 63 (85) 96 (116) 437 070 (050 098) 004 070 (048 100) 005

lowastadjusted for age gender smoking drinking and family history of cancer

Table 4 XRCC1 haplotype analysis of three polymorphisms in XRCC1 gene

Haplotypes Case N () Control N () 120594

2 OR (95 CI) P OR (95 CI)lowast Plowast

CGT 323 (424) 349 (404) Reference 100 mdash mdash mdashTGT 152 (199) 189 (219) 111 087 (067 113) 029 081 (060 110) 018CAT 221 (290) 229 (265) 012 104 (082 132) 073 099 (074 131) 092CGC 57 (75) 89 (103) 393 069 (048 100) 005 062 (040 096) 003CAC 2 (03) 4 (05) 010 054 (010 297) 076 025 (003 230) 022TAT 3 (04) 1 (01) 033 324 (034 3132) 057 360 (036 3579) 027TGC 4 (05) 3 (03) 001 144 (032 649) 092 076 (010 572) 079TAC 0 mdash mdash mdash mdash mdash mdashTotal 762 (100) 864 (100) mdash mdash mdash mdash mdashlowastadjusted for age gender smoking drinking and family history of cancerThe order of three SNPs codon 194 codon 399 and minus77TgtC

researches showed to be consistent with ours According tothese results Casson et al [29] founded that there was norelationship between polymorphismofXRCC1 codon 194 andesophageal adenocarcinoma (EA) susceptibility in Canadapopulation Lee et alrsquos [30] study also found that there was noassociation between polymorphism of XRCC1 codon 194 andESCC in Asia population On the contrary there are studiesshowing that XRCC1 codon 194 can increase the risk for ECFor example the result of Xing et al [31] indicated that themutation homozygous genotype (TT) of XRCC1 codon 194 isthe risk factor for EC the adjusted OR (95CI) has a value of198 (126ndash312) A case-control study of Liu et al [32] inHebei

population of China found that the mutation homozygousgenotype (TT) of XRCC1 codon 194 can increase individualrisk of ESCC 086-fold (adjusted OR (95 CI) 186 (119ndash288))

Regarding the XRCC1 codon 399 polymorphism resultswe have not seen any significant association with ESCCAccording to this Chen et al [33] and Song et al [34] con-ducted a case-control study in Jiangsu and Henan provincesof China respectively showing no association betweenXRCC1 codon 399 polymorphism and EC susceptibilityHowever according to the results of Yu et al [35] comparingwith wild type (GG) the mutation homozygous genotype

BioMed Research International 5

Table 5 Combination genotypes analysis of XRCC1 codons 194 399 and minus77TgtC

Combined genotypes Case119873 () Control119873 () 120594

2 OR (95 CI) 119875 OR (95 CI)lowast 119875

lowast

CCGGTT 39 (112) 43 (106) Reference 100 mdash mdash mdashCTGATT 68 (195) 71 (176) 004 106 (061 182) 085 095 (053 172) 087CTGGTT 65 (187) 72 (178) 000 099 (058 172) 099 088 (049 160) 068CCGATT 60 (172) 66 (163) 000 100 (057 175) 099 102 (056 187) 095TTGGTT 29 (83) 37 (92) 019 086 (045 166) 066 091 (045 184) 080CTGGCT 16 (46) 38 (94) 435 046 (022 096) 004 052 (024 113) 010CCAATT 23 (66) 23 (57) 007 110 (053 227) 079 086 (039 192) 072CCGACT 17 (49) 23 (57) 028 081 (038 175) 060 074 (032 170) 048CCGGCT 20 (57) 22 (54) 000 100 (048 211) 100 109 (050 242) 082CTGACT 4 (11) 2 (05) 023 221 (038 1271) 063 118 (018 774) 086CCAACT 1 (03) 3 (07) 014 037 (004 368) 071 037 (004 387) 041CTAATT 3 (09) 1 (02) 031 331 (033 3313) 058 374 (036 3883) 027

Others 3 (09) 3 (09) mdash mdash mdash mdash mdashTotal 348 (100) 404 (100) mdash mdash mdash mdash mdash

lowastadjusted for age gender smoking drinking and family history of cancer

Table 6 Trend analysis of the number of mutation sites

Number of mutation sites Case119873 () Control119873 () 120594

2 OR (95 CI) 119875 OR (95 CI)1 119875

1

0 39 (112) 43 (106) Reference 100 mdash mdash mdash1 198 (569) 220 (545) 000 099 (062 159) 097 095 (057 159) 0842 107 (307) 139 (344) 041 085 (051 140) 052 078 (046 136) 0403 4 (11) 2 (05) 023 221 (038 1271) 063 123 (019 804) 083mdash mdash mdash 038lowast mdash 054lowast mdash mdashTotal 348 (100) 404 (100) mdash mdash mdash mdash mdashlowasttrend chi-square1Adjusted for age gender smoking drinking and family history of cancer

(AA) was a risk factor for developing EC (OR (95 CI)515 (242ndash1093)) By stratification analysis smokers carryinghomozygous mutant (AA) were associated with a 731-foldincreased risk for EC compared to smokers carrying the wildtype (GG) (OR 831 95CI 392ndash1763) meanwhile drinkerscarrying homozygous mutant (AA) were associated with a443-fold increased risk for EC compared to drinkers carryingthe wild type (GG) (OR 543 95 CI 246ndash1199)

In this study we did not observe significant associationbetween polymorphism of XRCC1 minus77TgtC and EC suscep-tibility Supporting these results as Hao et al [22] firstlyreported theXRCC1 minus77TgtC polymorphism in 51015840 noncodingregion in 2004 the results found that XRCC1 minus77TgtCcan increase the combination of XRCC1 promoter and atranscription inhibitory factor thus reducing the promoteractivity and protein expression However they did not findthe association ofXRCC1 minus77TgtC polymorphismwith ESCCsusceptibility The relationship between XRCC1 minus77TgtC andEC susceptibility needs to be clarified by more large sizestudies

In this study we conducted quality control strictlythroughout the whole study The patients included wereall newly pathologically diagnosed thus avoiding the prev-alence-incidence bias Besides the controls were frequency-matched and the investigators were unified-trained rigor-ously Moreover we sequenced the three SNPs duplicately

and verified them by DNA sequencing making the resultscredible

In conclusion the present study suggested that the singlepolymorphism in the DNA repair gene XRCC1 was notstatistically associated with risk of ESCC however haplotypeCGC (codon 194 codon 399 and minus77TgtC) of three SNPsin XRCC1 gene may decrease risk for ESCC susceptibilityBut in the future it would be necessary to confirm thesefindings in a large and multiethnic population study becauseof the relatively small sample size in this study and gene-environment interaction analysis and it should also be per-formed to investigate the tumorigenesis mechanism

Conflict of Interests

The authors declare that there is no conflict of interestsregarding the publication of this paper

Acknowledgments

This research was supported by Peoplersquos Republic ofChina (National Natural Science Foundation of China no81072360) and Program for Science amp Technology Inno-vation Talents in Universities of Henan Province (no2010HASTIT027) and Excellent Youth Foundation of Hersquonan

6 BioMed Research International

Scientific Committee (no 124100510007) The authorsacknowledge the blood samples of cases given by the Firstand the Second Affiliated Hospitals of Zhengzhou UniversityThe authors also wish to acknowledge the residents in Xinx-iang County of Henan Province who supported their epide-miological study on the scene

References

[1] D M Parkin F I Bray and S S Devesa ldquoCancer burden in theyear 2000 The global picturerdquo European Journal of Cancer vol37 no 8 pp 4ndash66 2001

[2] J Ferlay H R Shin F Bray D Forman C Mathers and DM Parkin ldquoEstimates of worldwide burden of cancer in 2008GLOBOCAN2008rdquo International Journal of Cancer vol 127 no12 pp 2893ndash2917 2010

[3] D M Parkin F Bray J Ferlay and P Pisani ldquoGlobal cancerstatistics 2002rdquo CA A Cancer Journal for Clinicians vol 55 no2 pp 74ndash108 2005

[4] L Dai K Wang J Zhang Q Lv X Wu and Y Wang ldquoXRCC1gene polymorphisms and esophageal squamous cell carcinomarisk in Chinese population a meta-analysis of case-controlstudiesrdquo International Journal of Cancer vol 125 no 5 pp 1102ndash1109 2009

[5] H Yu C Fu J Wang H Xue and B Xu ldquoInteraction betweenXRCC1 polymorphisms and intake of long-term stored rice inthe risk of esophageal squamous cell carcinoma a case-controlstudyrdquo Biomedical and Environmental Sciences vol 24 no 3 pp268ndash274 2011

[6] A Jemal F Bray M M Center J Ferlay E Ward and DForman ldquoGlobal cancer statisticsrdquo CA A cancer Journal forClinicians vol 61 no 2 pp 69ndash90 2011

[7] J H J Hoeijmakers ldquoGenome maintenance mechanisms forpreventing cancerrdquoNature vol 411 no 6835 pp 366ndash374 2001

[8] T Lindahl and R D Wood ldquoQuality control by DNA repairrdquoScience vol 286 no 5446 pp 1897ndash1905 1999

[9] R D Wood M Mitchell J Sgouros and T Lindahl ldquoHumanDNA repair genesrdquo Science vol 291 no 5507 pp 1284ndash12892001

[10] E C Friedberg ldquoDNA damage and repairrdquoNature vol 421 no6921 pp 436ndash440 2003

[11] S Maynard S H Schurman C Harboe N C de Souza-Pintoand V A Bohr ldquoBase excision repair of oxidative DNA damageand association with cancer and agingrdquo Carcinogenesis vol 30no 1 pp 2ndash10 2009

[12] R J Hung J Hall P Brennan and P Boffetta ldquoGeneticpolymorphisms in the base excision repair pathway and cancerrisk a huge reviewrdquo American Journal of Epidemiology vol 162no 10 pp 925ndash942 2005

[13] M Stanczyk T Sliwinski M Cuchra et al ldquoThe associationof polymorphisms in DNA base excision repair genes XRCC1OGG1 and MUTYH with the risk of childhood acute lym-phoblastic leukemiardquo Molecular Biology Reports vol 38 no 1pp 445ndash451 2011

[14] L Cai N C Y You H Lu et al ldquoDietary selenium intake alde-hyde dehydrogenase-2 and X-ray repair cross-complementing1 genetic polymorphisms and the risk of esophageal squamouscell carcinomardquo Cancer vol 106 no 11 pp 2345ndash2354 2006

[15] G Liu W Zhou B Y Yeap et al ldquoXRCC1 and XPD polymor-phisms and esophageal adenocarcinoma riskrdquo Carcinogenesisvol 28 no 6 pp 1254ndash1258 2007

[16] L H Thompson and M G West ldquoXRCC1 keeps DNA fromgetting strandedrdquoMutation ResearchDNA Repair vol 459 no1 pp 1ndash18 2000

[17] R C Sobti J Singh P Kaur S S Pachouri E A Siddiquiand H S Bindra ldquoXRCC1 codon 399 and ERCC2 codon 751polymorphism smoking and drinking and risk of esophagealsquamous cell carcinoma in aNorth Indian populationrdquoCancerGenetics and Cytogenetics vol 175 no 2 pp 91ndash97 2007

[18] H Li T C Ha and B C Tai ldquoXRCC1 gene polymorphismsand breast cancer risk in different populations ameta-analysisrdquoBreast vol 18 no 3 pp 183ndash191 2009

[19] M R Shen I M Jones and H Mohrenweiser ldquoNonconser-vative amino acid substitution variants exist at polymorphicfrequency in DNA repair genes in healthy humansrdquo CancerResearch vol 58 no 4 pp 604ndash608 1998

[20] J E Lamerdin M A Montgomery S A Stilwagen et alldquoGenomic sequence comparison of the human and mouseXRCC1 DNA repair gene regionsrdquo Genomics vol 25 no 2 pp547ndash554 1995

[21] R M Lunn R G Langlois L L Hsieh C LThompson and DA Bell ldquoXRCC1 polymorphisms effects on aflatoxin B1-DNAadducts and glycophorin A variant frequencyrdquoCancer Researchvol 59 no 11 pp 2557ndash2561 1999

[22] B Hao H Wang K Zhou et al ldquoIdentification of geneticvariants in base excision repair pathway and their associationswith risk of esophageal squamous cell carcinomardquo CancerResearch vol 64 no 12 pp 4378ndash4384 2004

[23] C H Lee J M Lee D C Wu et al ldquoIndependent andcombined effects of alcohol intake tobacco smoking and betelquid chewing on the risk of esophageal cancer in TaiwanrdquoInternational Journal of Cancer vol 113 no 3 pp 475ndash4822005

[24] M Siddiqi R Kumar Z Fazili B Spiegelhalder and RPreussmann ldquoIncreased exposure to dietary amines and nitratein a population at high risk of oesophageal and gastric cancerin Kashmir (India)rdquo Carcinogenesis vol 13 no 8 pp 1331ndash13351992

[25] J Li L Mu and GWei ldquoRelationship between polymorphismsof DNA repair gene XRCC1 and susceptibility to lung cancerrdquoChina Oncology vol 15 pp 335ndash338 2005

[26] E J Duell R C Millikan G S Pittman et al ldquoPolymorphismsin the DNA repair gene XRCC1 and breast cancerrdquo CancerEpidemiology Biomarkers amp Prevention vol 10 no 3 pp 217ndash222 2001

[27] S G Lee B Kim J Choi C Kim I Lee and K Song ldquoGeneticpolymorphisms of XRCC1 and risk of gastric cancerrdquo CancerLetters vol 187 no 1-2 pp 53ndash60 2002

[28] S Z Abdel-Rahman A S Soliman M L Bondy et alldquoInheritance of the 194Trp and the 399Gln variant alleles of theDNA repair gene XRCC1 are associated with increased risk ofearly-onset colorectal carcinoma in Egyptrdquo Cancer Letters vol159 no 1 pp 79ndash86 2000

[29] A G Casson Z Zheng S C Evans P J Veugelers G APorter and D L Guernsey ldquoPolymorphisms in DNA repairgenes in the molecular pathogenesis of esophageal (Barrett)adenocarcinomardquo Carcinogenesis vol 26 no 9 pp 1536ndash15412005

[30] J M Lee Y C Lee S Y Yang et al ldquoGenetic polymorphisms ofXRCC1 and risk of the esophageal cancerrdquo International Journalof Cancer vol 95 no 4 pp 240ndash246 2001

[31] D Xing J Qi X Miao W Lu W Tan and D Lin ldquoPoly-morphisms of DNA repair genes XRCC1 and XPD and their

BioMed Research International 7

associations with risk of esophageal squamous cell carcinomain a Chinese populationrdquo International Journal of Cancer vol100 no 5 pp 600ndash605 2002

[32] J Liu W Lei J Ma and R Xue ldquoCorrelation of DNA repairgene polymorphisms and esophageal canceTNM staging andregional lymph node metastasisrdquo Chinese Journal of Thoracicand Cardiovascular Surgery vol 22 no 5 pp 315ndash317 2006

[33] M Chen J Wang G Guo et al ldquoThe single nucleotidepolymorphism of DNA damage repair gene XPD Lys751GlnXRCC1 Arg399Gln and genetic susceptibility for esophagealcancerrdquo Journal of Fudan University (Medical sciences) vol 35no 2 pp 273ndash277 2008

[34] C Song W Tan and D Lin ldquoPolymorphisms of DNArepair gene XRCC1 in Chinese population and its relation toesophageal squamous cell carcinomardquo Cancer vol 20 no 1 pp28ndash31 2001

[35] H P Yu X Y Zhang X L Wang et al ldquoDNA repair geneXRCC1 polymorphisms smoking and esophageal cancer riskrdquoCancer Detection and Prevention vol 28 no 3 pp 194ndash1992004

Submit your manuscripts athttpwwwhindawicom

Stem CellsInternational

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

MEDIATORSINFLAMMATION

of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Behavioural Neurology

EndocrinologyInternational Journal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Disease Markers

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

BioMed Research International

OncologyJournal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Oxidative Medicine and Cellular Longevity

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

PPAR Research

The Scientific World JournalHindawi Publishing Corporation httpwwwhindawicom Volume 2014

Immunology ResearchHindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Journal of

ObesityJournal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Computational and Mathematical Methods in Medicine

OphthalmologyJournal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Diabetes ResearchJournal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Research and TreatmentAIDS

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Gastroenterology Research and Practice

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Parkinsonrsquos Disease

Evidence-Based Complementary and Alternative Medicine

Volume 2014Hindawi Publishing Corporationhttpwwwhindawicom

BioMed Research International 5

Table 5 Combination genotypes analysis of XRCC1 codons 194 399 and minus77TgtC

Combined genotypes Case119873 () Control119873 () 120594

2 OR (95 CI) 119875 OR (95 CI)lowast 119875

lowast

CCGGTT 39 (112) 43 (106) Reference 100 mdash mdash mdashCTGATT 68 (195) 71 (176) 004 106 (061 182) 085 095 (053 172) 087CTGGTT 65 (187) 72 (178) 000 099 (058 172) 099 088 (049 160) 068CCGATT 60 (172) 66 (163) 000 100 (057 175) 099 102 (056 187) 095TTGGTT 29 (83) 37 (92) 019 086 (045 166) 066 091 (045 184) 080CTGGCT 16 (46) 38 (94) 435 046 (022 096) 004 052 (024 113) 010CCAATT 23 (66) 23 (57) 007 110 (053 227) 079 086 (039 192) 072CCGACT 17 (49) 23 (57) 028 081 (038 175) 060 074 (032 170) 048CCGGCT 20 (57) 22 (54) 000 100 (048 211) 100 109 (050 242) 082CTGACT 4 (11) 2 (05) 023 221 (038 1271) 063 118 (018 774) 086CCAACT 1 (03) 3 (07) 014 037 (004 368) 071 037 (004 387) 041CTAATT 3 (09) 1 (02) 031 331 (033 3313) 058 374 (036 3883) 027

Others 3 (09) 3 (09) mdash mdash mdash mdash mdashTotal 348 (100) 404 (100) mdash mdash mdash mdash mdash

lowastadjusted for age gender smoking drinking and family history of cancer

Table 6 Trend analysis of the number of mutation sites

Number of mutation sites Case119873 () Control119873 () 120594

2 OR (95 CI) 119875 OR (95 CI)1 119875

1

0 39 (112) 43 (106) Reference 100 mdash mdash mdash1 198 (569) 220 (545) 000 099 (062 159) 097 095 (057 159) 0842 107 (307) 139 (344) 041 085 (051 140) 052 078 (046 136) 0403 4 (11) 2 (05) 023 221 (038 1271) 063 123 (019 804) 083mdash mdash mdash 038lowast mdash 054lowast mdash mdashTotal 348 (100) 404 (100) mdash mdash mdash mdash mdashlowasttrend chi-square1Adjusted for age gender smoking drinking and family history of cancer

(AA) was a risk factor for developing EC (OR (95 CI)515 (242ndash1093)) By stratification analysis smokers carryinghomozygous mutant (AA) were associated with a 731-foldincreased risk for EC compared to smokers carrying the wildtype (GG) (OR 831 95CI 392ndash1763) meanwhile drinkerscarrying homozygous mutant (AA) were associated with a443-fold increased risk for EC compared to drinkers carryingthe wild type (GG) (OR 543 95 CI 246ndash1199)

In this study we did not observe significant associationbetween polymorphism of XRCC1 minus77TgtC and EC suscep-tibility Supporting these results as Hao et al [22] firstlyreported theXRCC1 minus77TgtC polymorphism in 51015840 noncodingregion in 2004 the results found that XRCC1 minus77TgtCcan increase the combination of XRCC1 promoter and atranscription inhibitory factor thus reducing the promoteractivity and protein expression However they did not findthe association ofXRCC1 minus77TgtC polymorphismwith ESCCsusceptibility The relationship between XRCC1 minus77TgtC andEC susceptibility needs to be clarified by more large sizestudies

In this study we conducted quality control strictlythroughout the whole study The patients included wereall newly pathologically diagnosed thus avoiding the prev-alence-incidence bias Besides the controls were frequency-matched and the investigators were unified-trained rigor-ously Moreover we sequenced the three SNPs duplicately

and verified them by DNA sequencing making the resultscredible

In conclusion the present study suggested that the singlepolymorphism in the DNA repair gene XRCC1 was notstatistically associated with risk of ESCC however haplotypeCGC (codon 194 codon 399 and minus77TgtC) of three SNPsin XRCC1 gene may decrease risk for ESCC susceptibilityBut in the future it would be necessary to confirm thesefindings in a large and multiethnic population study becauseof the relatively small sample size in this study and gene-environment interaction analysis and it should also be per-formed to investigate the tumorigenesis mechanism

Conflict of Interests

The authors declare that there is no conflict of interestsregarding the publication of this paper

Acknowledgments

This research was supported by Peoplersquos Republic ofChina (National Natural Science Foundation of China no81072360) and Program for Science amp Technology Inno-vation Talents in Universities of Henan Province (no2010HASTIT027) and Excellent Youth Foundation of Hersquonan

6 BioMed Research International

Scientific Committee (no 124100510007) The authorsacknowledge the blood samples of cases given by the Firstand the Second Affiliated Hospitals of Zhengzhou UniversityThe authors also wish to acknowledge the residents in Xinx-iang County of Henan Province who supported their epide-miological study on the scene

References

[1] D M Parkin F I Bray and S S Devesa ldquoCancer burden in theyear 2000 The global picturerdquo European Journal of Cancer vol37 no 8 pp 4ndash66 2001

[2] J Ferlay H R Shin F Bray D Forman C Mathers and DM Parkin ldquoEstimates of worldwide burden of cancer in 2008GLOBOCAN2008rdquo International Journal of Cancer vol 127 no12 pp 2893ndash2917 2010

[3] D M Parkin F Bray J Ferlay and P Pisani ldquoGlobal cancerstatistics 2002rdquo CA A Cancer Journal for Clinicians vol 55 no2 pp 74ndash108 2005

[4] L Dai K Wang J Zhang Q Lv X Wu and Y Wang ldquoXRCC1gene polymorphisms and esophageal squamous cell carcinomarisk in Chinese population a meta-analysis of case-controlstudiesrdquo International Journal of Cancer vol 125 no 5 pp 1102ndash1109 2009

[5] H Yu C Fu J Wang H Xue and B Xu ldquoInteraction betweenXRCC1 polymorphisms and intake of long-term stored rice inthe risk of esophageal squamous cell carcinoma a case-controlstudyrdquo Biomedical and Environmental Sciences vol 24 no 3 pp268ndash274 2011

[6] A Jemal F Bray M M Center J Ferlay E Ward and DForman ldquoGlobal cancer statisticsrdquo CA A cancer Journal forClinicians vol 61 no 2 pp 69ndash90 2011

[7] J H J Hoeijmakers ldquoGenome maintenance mechanisms forpreventing cancerrdquoNature vol 411 no 6835 pp 366ndash374 2001

[8] T Lindahl and R D Wood ldquoQuality control by DNA repairrdquoScience vol 286 no 5446 pp 1897ndash1905 1999

[9] R D Wood M Mitchell J Sgouros and T Lindahl ldquoHumanDNA repair genesrdquo Science vol 291 no 5507 pp 1284ndash12892001

[10] E C Friedberg ldquoDNA damage and repairrdquoNature vol 421 no6921 pp 436ndash440 2003

[11] S Maynard S H Schurman C Harboe N C de Souza-Pintoand V A Bohr ldquoBase excision repair of oxidative DNA damageand association with cancer and agingrdquo Carcinogenesis vol 30no 1 pp 2ndash10 2009

[12] R J Hung J Hall P Brennan and P Boffetta ldquoGeneticpolymorphisms in the base excision repair pathway and cancerrisk a huge reviewrdquo American Journal of Epidemiology vol 162no 10 pp 925ndash942 2005

[13] M Stanczyk T Sliwinski M Cuchra et al ldquoThe associationof polymorphisms in DNA base excision repair genes XRCC1OGG1 and MUTYH with the risk of childhood acute lym-phoblastic leukemiardquo Molecular Biology Reports vol 38 no 1pp 445ndash451 2011

[14] L Cai N C Y You H Lu et al ldquoDietary selenium intake alde-hyde dehydrogenase-2 and X-ray repair cross-complementing1 genetic polymorphisms and the risk of esophageal squamouscell carcinomardquo Cancer vol 106 no 11 pp 2345ndash2354 2006

[15] G Liu W Zhou B Y Yeap et al ldquoXRCC1 and XPD polymor-phisms and esophageal adenocarcinoma riskrdquo Carcinogenesisvol 28 no 6 pp 1254ndash1258 2007

[16] L H Thompson and M G West ldquoXRCC1 keeps DNA fromgetting strandedrdquoMutation ResearchDNA Repair vol 459 no1 pp 1ndash18 2000

[17] R C Sobti J Singh P Kaur S S Pachouri E A Siddiquiand H S Bindra ldquoXRCC1 codon 399 and ERCC2 codon 751polymorphism smoking and drinking and risk of esophagealsquamous cell carcinoma in aNorth Indian populationrdquoCancerGenetics and Cytogenetics vol 175 no 2 pp 91ndash97 2007

[18] H Li T C Ha and B C Tai ldquoXRCC1 gene polymorphismsand breast cancer risk in different populations ameta-analysisrdquoBreast vol 18 no 3 pp 183ndash191 2009

[19] M R Shen I M Jones and H Mohrenweiser ldquoNonconser-vative amino acid substitution variants exist at polymorphicfrequency in DNA repair genes in healthy humansrdquo CancerResearch vol 58 no 4 pp 604ndash608 1998

[20] J E Lamerdin M A Montgomery S A Stilwagen et alldquoGenomic sequence comparison of the human and mouseXRCC1 DNA repair gene regionsrdquo Genomics vol 25 no 2 pp547ndash554 1995

[21] R M Lunn R G Langlois L L Hsieh C LThompson and DA Bell ldquoXRCC1 polymorphisms effects on aflatoxin B1-DNAadducts and glycophorin A variant frequencyrdquoCancer Researchvol 59 no 11 pp 2557ndash2561 1999

[22] B Hao H Wang K Zhou et al ldquoIdentification of geneticvariants in base excision repair pathway and their associationswith risk of esophageal squamous cell carcinomardquo CancerResearch vol 64 no 12 pp 4378ndash4384 2004

[23] C H Lee J M Lee D C Wu et al ldquoIndependent andcombined effects of alcohol intake tobacco smoking and betelquid chewing on the risk of esophageal cancer in TaiwanrdquoInternational Journal of Cancer vol 113 no 3 pp 475ndash4822005

[24] M Siddiqi R Kumar Z Fazili B Spiegelhalder and RPreussmann ldquoIncreased exposure to dietary amines and nitratein a population at high risk of oesophageal and gastric cancerin Kashmir (India)rdquo Carcinogenesis vol 13 no 8 pp 1331ndash13351992

[25] J Li L Mu and GWei ldquoRelationship between polymorphismsof DNA repair gene XRCC1 and susceptibility to lung cancerrdquoChina Oncology vol 15 pp 335ndash338 2005

[26] E J Duell R C Millikan G S Pittman et al ldquoPolymorphismsin the DNA repair gene XRCC1 and breast cancerrdquo CancerEpidemiology Biomarkers amp Prevention vol 10 no 3 pp 217ndash222 2001

[27] S G Lee B Kim J Choi C Kim I Lee and K Song ldquoGeneticpolymorphisms of XRCC1 and risk of gastric cancerrdquo CancerLetters vol 187 no 1-2 pp 53ndash60 2002

[28] S Z Abdel-Rahman A S Soliman M L Bondy et alldquoInheritance of the 194Trp and the 399Gln variant alleles of theDNA repair gene XRCC1 are associated with increased risk ofearly-onset colorectal carcinoma in Egyptrdquo Cancer Letters vol159 no 1 pp 79ndash86 2000

[29] A G Casson Z Zheng S C Evans P J Veugelers G APorter and D L Guernsey ldquoPolymorphisms in DNA repairgenes in the molecular pathogenesis of esophageal (Barrett)adenocarcinomardquo Carcinogenesis vol 26 no 9 pp 1536ndash15412005

[30] J M Lee Y C Lee S Y Yang et al ldquoGenetic polymorphisms ofXRCC1 and risk of the esophageal cancerrdquo International Journalof Cancer vol 95 no 4 pp 240ndash246 2001

[31] D Xing J Qi X Miao W Lu W Tan and D Lin ldquoPoly-morphisms of DNA repair genes XRCC1 and XPD and their

BioMed Research International 7

associations with risk of esophageal squamous cell carcinomain a Chinese populationrdquo International Journal of Cancer vol100 no 5 pp 600ndash605 2002

[32] J Liu W Lei J Ma and R Xue ldquoCorrelation of DNA repairgene polymorphisms and esophageal canceTNM staging andregional lymph node metastasisrdquo Chinese Journal of Thoracicand Cardiovascular Surgery vol 22 no 5 pp 315ndash317 2006

[33] M Chen J Wang G Guo et al ldquoThe single nucleotidepolymorphism of DNA damage repair gene XPD Lys751GlnXRCC1 Arg399Gln and genetic susceptibility for esophagealcancerrdquo Journal of Fudan University (Medical sciences) vol 35no 2 pp 273ndash277 2008

[34] C Song W Tan and D Lin ldquoPolymorphisms of DNArepair gene XRCC1 in Chinese population and its relation toesophageal squamous cell carcinomardquo Cancer vol 20 no 1 pp28ndash31 2001

[35] H P Yu X Y Zhang X L Wang et al ldquoDNA repair geneXRCC1 polymorphisms smoking and esophageal cancer riskrdquoCancer Detection and Prevention vol 28 no 3 pp 194ndash1992004

Submit your manuscripts athttpwwwhindawicom

Stem CellsInternational

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

MEDIATORSINFLAMMATION

of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Behavioural Neurology

EndocrinologyInternational Journal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Disease Markers

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

BioMed Research International

OncologyJournal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Oxidative Medicine and Cellular Longevity

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

PPAR Research

The Scientific World JournalHindawi Publishing Corporation httpwwwhindawicom Volume 2014

Immunology ResearchHindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Journal of

ObesityJournal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Computational and Mathematical Methods in Medicine

OphthalmologyJournal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Diabetes ResearchJournal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Research and TreatmentAIDS

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Gastroenterology Research and Practice

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Parkinsonrsquos Disease

Evidence-Based Complementary and Alternative Medicine

Volume 2014Hindawi Publishing Corporationhttpwwwhindawicom

6 BioMed Research International

Scientific Committee (no 124100510007) The authorsacknowledge the blood samples of cases given by the Firstand the Second Affiliated Hospitals of Zhengzhou UniversityThe authors also wish to acknowledge the residents in Xinx-iang County of Henan Province who supported their epide-miological study on the scene

References

[1] D M Parkin F I Bray and S S Devesa ldquoCancer burden in theyear 2000 The global picturerdquo European Journal of Cancer vol37 no 8 pp 4ndash66 2001

[2] J Ferlay H R Shin F Bray D Forman C Mathers and DM Parkin ldquoEstimates of worldwide burden of cancer in 2008GLOBOCAN2008rdquo International Journal of Cancer vol 127 no12 pp 2893ndash2917 2010

[3] D M Parkin F Bray J Ferlay and P Pisani ldquoGlobal cancerstatistics 2002rdquo CA A Cancer Journal for Clinicians vol 55 no2 pp 74ndash108 2005

[4] L Dai K Wang J Zhang Q Lv X Wu and Y Wang ldquoXRCC1gene polymorphisms and esophageal squamous cell carcinomarisk in Chinese population a meta-analysis of case-controlstudiesrdquo International Journal of Cancer vol 125 no 5 pp 1102ndash1109 2009

[5] H Yu C Fu J Wang H Xue and B Xu ldquoInteraction betweenXRCC1 polymorphisms and intake of long-term stored rice inthe risk of esophageal squamous cell carcinoma a case-controlstudyrdquo Biomedical and Environmental Sciences vol 24 no 3 pp268ndash274 2011

[6] A Jemal F Bray M M Center J Ferlay E Ward and DForman ldquoGlobal cancer statisticsrdquo CA A cancer Journal forClinicians vol 61 no 2 pp 69ndash90 2011

[7] J H J Hoeijmakers ldquoGenome maintenance mechanisms forpreventing cancerrdquoNature vol 411 no 6835 pp 366ndash374 2001

[8] T Lindahl and R D Wood ldquoQuality control by DNA repairrdquoScience vol 286 no 5446 pp 1897ndash1905 1999

[9] R D Wood M Mitchell J Sgouros and T Lindahl ldquoHumanDNA repair genesrdquo Science vol 291 no 5507 pp 1284ndash12892001

[10] E C Friedberg ldquoDNA damage and repairrdquoNature vol 421 no6921 pp 436ndash440 2003

[11] S Maynard S H Schurman C Harboe N C de Souza-Pintoand V A Bohr ldquoBase excision repair of oxidative DNA damageand association with cancer and agingrdquo Carcinogenesis vol 30no 1 pp 2ndash10 2009

[12] R J Hung J Hall P Brennan and P Boffetta ldquoGeneticpolymorphisms in the base excision repair pathway and cancerrisk a huge reviewrdquo American Journal of Epidemiology vol 162no 10 pp 925ndash942 2005

[13] M Stanczyk T Sliwinski M Cuchra et al ldquoThe associationof polymorphisms in DNA base excision repair genes XRCC1OGG1 and MUTYH with the risk of childhood acute lym-phoblastic leukemiardquo Molecular Biology Reports vol 38 no 1pp 445ndash451 2011

[14] L Cai N C Y You H Lu et al ldquoDietary selenium intake alde-hyde dehydrogenase-2 and X-ray repair cross-complementing1 genetic polymorphisms and the risk of esophageal squamouscell carcinomardquo Cancer vol 106 no 11 pp 2345ndash2354 2006

[15] G Liu W Zhou B Y Yeap et al ldquoXRCC1 and XPD polymor-phisms and esophageal adenocarcinoma riskrdquo Carcinogenesisvol 28 no 6 pp 1254ndash1258 2007

[16] L H Thompson and M G West ldquoXRCC1 keeps DNA fromgetting strandedrdquoMutation ResearchDNA Repair vol 459 no1 pp 1ndash18 2000

[17] R C Sobti J Singh P Kaur S S Pachouri E A Siddiquiand H S Bindra ldquoXRCC1 codon 399 and ERCC2 codon 751polymorphism smoking and drinking and risk of esophagealsquamous cell carcinoma in aNorth Indian populationrdquoCancerGenetics and Cytogenetics vol 175 no 2 pp 91ndash97 2007

[18] H Li T C Ha and B C Tai ldquoXRCC1 gene polymorphismsand breast cancer risk in different populations ameta-analysisrdquoBreast vol 18 no 3 pp 183ndash191 2009

[19] M R Shen I M Jones and H Mohrenweiser ldquoNonconser-vative amino acid substitution variants exist at polymorphicfrequency in DNA repair genes in healthy humansrdquo CancerResearch vol 58 no 4 pp 604ndash608 1998

[20] J E Lamerdin M A Montgomery S A Stilwagen et alldquoGenomic sequence comparison of the human and mouseXRCC1 DNA repair gene regionsrdquo Genomics vol 25 no 2 pp547ndash554 1995

[21] R M Lunn R G Langlois L L Hsieh C LThompson and DA Bell ldquoXRCC1 polymorphisms effects on aflatoxin B1-DNAadducts and glycophorin A variant frequencyrdquoCancer Researchvol 59 no 11 pp 2557ndash2561 1999

[22] B Hao H Wang K Zhou et al ldquoIdentification of geneticvariants in base excision repair pathway and their associationswith risk of esophageal squamous cell carcinomardquo CancerResearch vol 64 no 12 pp 4378ndash4384 2004

[23] C H Lee J M Lee D C Wu et al ldquoIndependent andcombined effects of alcohol intake tobacco smoking and betelquid chewing on the risk of esophageal cancer in TaiwanrdquoInternational Journal of Cancer vol 113 no 3 pp 475ndash4822005

[24] M Siddiqi R Kumar Z Fazili B Spiegelhalder and RPreussmann ldquoIncreased exposure to dietary amines and nitratein a population at high risk of oesophageal and gastric cancerin Kashmir (India)rdquo Carcinogenesis vol 13 no 8 pp 1331ndash13351992

[25] J Li L Mu and GWei ldquoRelationship between polymorphismsof DNA repair gene XRCC1 and susceptibility to lung cancerrdquoChina Oncology vol 15 pp 335ndash338 2005

[26] E J Duell R C Millikan G S Pittman et al ldquoPolymorphismsin the DNA repair gene XRCC1 and breast cancerrdquo CancerEpidemiology Biomarkers amp Prevention vol 10 no 3 pp 217ndash222 2001

[27] S G Lee B Kim J Choi C Kim I Lee and K Song ldquoGeneticpolymorphisms of XRCC1 and risk of gastric cancerrdquo CancerLetters vol 187 no 1-2 pp 53ndash60 2002

[28] S Z Abdel-Rahman A S Soliman M L Bondy et alldquoInheritance of the 194Trp and the 399Gln variant alleles of theDNA repair gene XRCC1 are associated with increased risk ofearly-onset colorectal carcinoma in Egyptrdquo Cancer Letters vol159 no 1 pp 79ndash86 2000

[29] A G Casson Z Zheng S C Evans P J Veugelers G APorter and D L Guernsey ldquoPolymorphisms in DNA repairgenes in the molecular pathogenesis of esophageal (Barrett)adenocarcinomardquo Carcinogenesis vol 26 no 9 pp 1536ndash15412005

[30] J M Lee Y C Lee S Y Yang et al ldquoGenetic polymorphisms ofXRCC1 and risk of the esophageal cancerrdquo International Journalof Cancer vol 95 no 4 pp 240ndash246 2001

[31] D Xing J Qi X Miao W Lu W Tan and D Lin ldquoPoly-morphisms of DNA repair genes XRCC1 and XPD and their

BioMed Research International 7

associations with risk of esophageal squamous cell carcinomain a Chinese populationrdquo International Journal of Cancer vol100 no 5 pp 600ndash605 2002

[32] J Liu W Lei J Ma and R Xue ldquoCorrelation of DNA repairgene polymorphisms and esophageal canceTNM staging andregional lymph node metastasisrdquo Chinese Journal of Thoracicand Cardiovascular Surgery vol 22 no 5 pp 315ndash317 2006

[33] M Chen J Wang G Guo et al ldquoThe single nucleotidepolymorphism of DNA damage repair gene XPD Lys751GlnXRCC1 Arg399Gln and genetic susceptibility for esophagealcancerrdquo Journal of Fudan University (Medical sciences) vol 35no 2 pp 273ndash277 2008

[34] C Song W Tan and D Lin ldquoPolymorphisms of DNArepair gene XRCC1 in Chinese population and its relation toesophageal squamous cell carcinomardquo Cancer vol 20 no 1 pp28ndash31 2001

[35] H P Yu X Y Zhang X L Wang et al ldquoDNA repair geneXRCC1 polymorphisms smoking and esophageal cancer riskrdquoCancer Detection and Prevention vol 28 no 3 pp 194ndash1992004

Submit your manuscripts athttpwwwhindawicom

Stem CellsInternational

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

MEDIATORSINFLAMMATION

of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Behavioural Neurology

EndocrinologyInternational Journal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Disease Markers

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

BioMed Research International

OncologyJournal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Oxidative Medicine and Cellular Longevity

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

PPAR Research

The Scientific World JournalHindawi Publishing Corporation httpwwwhindawicom Volume 2014

Immunology ResearchHindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Journal of

ObesityJournal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Computational and Mathematical Methods in Medicine

OphthalmologyJournal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Diabetes ResearchJournal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Research and TreatmentAIDS

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Gastroenterology Research and Practice

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Parkinsonrsquos Disease

Evidence-Based Complementary and Alternative Medicine

Volume 2014Hindawi Publishing Corporationhttpwwwhindawicom

BioMed Research International 7

associations with risk of esophageal squamous cell carcinomain a Chinese populationrdquo International Journal of Cancer vol100 no 5 pp 600ndash605 2002

[32] J Liu W Lei J Ma and R Xue ldquoCorrelation of DNA repairgene polymorphisms and esophageal canceTNM staging andregional lymph node metastasisrdquo Chinese Journal of Thoracicand Cardiovascular Surgery vol 22 no 5 pp 315ndash317 2006

[33] M Chen J Wang G Guo et al ldquoThe single nucleotidepolymorphism of DNA damage repair gene XPD Lys751GlnXRCC1 Arg399Gln and genetic susceptibility for esophagealcancerrdquo Journal of Fudan University (Medical sciences) vol 35no 2 pp 273ndash277 2008

[34] C Song W Tan and D Lin ldquoPolymorphisms of DNArepair gene XRCC1 in Chinese population and its relation toesophageal squamous cell carcinomardquo Cancer vol 20 no 1 pp28ndash31 2001

[35] H P Yu X Y Zhang X L Wang et al ldquoDNA repair geneXRCC1 polymorphisms smoking and esophageal cancer riskrdquoCancer Detection and Prevention vol 28 no 3 pp 194ndash1992004

Submit your manuscripts athttpwwwhindawicom

Stem CellsInternational

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

MEDIATORSINFLAMMATION

of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Behavioural Neurology

EndocrinologyInternational Journal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Disease Markers

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

BioMed Research International

OncologyJournal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Oxidative Medicine and Cellular Longevity

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

PPAR Research

The Scientific World JournalHindawi Publishing Corporation httpwwwhindawicom Volume 2014

Immunology ResearchHindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Journal of

ObesityJournal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Computational and Mathematical Methods in Medicine

OphthalmologyJournal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Diabetes ResearchJournal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Research and TreatmentAIDS

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Gastroenterology Research and Practice

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Parkinsonrsquos Disease

Evidence-Based Complementary and Alternative Medicine

Volume 2014Hindawi Publishing Corporationhttpwwwhindawicom

Submit your manuscripts athttpwwwhindawicom

Stem CellsInternational

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

MEDIATORSINFLAMMATION

of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Behavioural Neurology

EndocrinologyInternational Journal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Disease Markers

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

BioMed Research International

OncologyJournal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Oxidative Medicine and Cellular Longevity

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

PPAR Research

The Scientific World JournalHindawi Publishing Corporation httpwwwhindawicom Volume 2014

Immunology ResearchHindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Journal of

ObesityJournal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Computational and Mathematical Methods in Medicine

OphthalmologyJournal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Diabetes ResearchJournal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Research and TreatmentAIDS

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Gastroenterology Research and Practice

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Parkinsonrsquos Disease

Evidence-Based Complementary and Alternative Medicine

Volume 2014Hindawi Publishing Corporationhttpwwwhindawicom