Research ArticleAP-1-Targeting Anti-Inflammatory Activity of the MethanolicExtract of Persicaria chinensis

Muhammad Jahangir Hossen12 Seung Cheol Kim3 Young-Jin Son4

Kwang-Soo Baek1 Eunji Kim1 Woo Seok Yang1 Deok Jeong1 Jae Gwang Park1

Han Gyung Kim1 Woo-Jae Chung1 Keejung Yoon1 Chongsuk Ryou5 Sang Yeol Lee6

Jong-Hoon Kim7 and Jae Youl Cho1

1Department of Genetic Engineering Sungkyunkwan University Suwon 440-746 Republic of Korea2Department of Animal Science Patuakhali Science and Technology University Patuakhali 8602 Bangladesh3Division of Gynecologic Oncology Department of Obstetrics and Gynecology Ewha Womans University Mokdong HospitalCollege of Medicine Ewha Womans University Seoul 158-710 Republic of Korea4Department of Pharmacy Sunchon National University Suncheon 540-742 Republic of Korea5Department of Pharmacy College of Pharmacy and Institute of Pharmaceutical Science and Technology Hanyang UniversityAnsan 426-791 Republic of Korea6Department of Life Science Gachon University Sungnam 461-701 Republic of Korea7Department of Veterinary Physiology College of Veterinary Medicine Biosafety Research InstituteChonbuk National University Jeonju 561-756 Republic of Korea

Correspondence should be addressed to Jong-Hoon Kim jhkim1jbnuackr and Jae Youl Cho jaechoskkuedu

Received 8 January 2015 Revised 22 February 2015 Accepted 2 March 2015

Academic Editor Cun-Zhi Liu

Copyright copy 2015 Muhammad Jahangir Hossen et al This is an open access article distributed under the Creative CommonsAttribution License which permits unrestricted use distribution and reproduction in any medium provided the original work isproperly cited

In traditional Chinese medicine Persicaria chinensis L has been prescribed to cure numerous inflammatory disorders Wepreviously analyzed the bioactivity of the methanol extract of this plant (Pc-ME) against LPS-induced NO and PGE

2in RAW2647

macrophages and found that it preventedHClEtOH-induced gastric ulcers inmiceThe purpose of the current studywas to explorethe molecular mechanism by which Pc-ME inhibits activator protein- (AP-) 1 activation pathway andmediates its hepatoprotectiveactivity To investigate the putative therapeutic properties of Pc-ME against AP-1-mediated inflammation and hepatotoxicitylipopolysaccharide- (LPS-) stimulated RAW2647 and U937 cells a monocyte-like human cell line and an LPSD-galactosamine-(D-GalN-) induced acute hepatitis mouse model were employed The expression of LPS-induced proinflammatory cytokinesincluding interleukin- (IL-) 1120573 IL-6 and tumor necrosis factor-120572 (TNF-120572) was significantly diminished by Pc-ME Moreover Pc-ME reduced AP-1 activation and mitogen-activated protein kinase (MAPK) phosphorylation in both LPS-stimulated RAW2647cells and differentiated U937 cells Additionally we highlighted the hepatoprotective and curative effects of Pc-ME pretreated orallyin a mouse model of LPSD-GalN-intoxicated acute liver injury by demonstrating the significant reduction in elevated serum ASTand ALT levels and histological damage Therefore these results strongly suggest that Pc-ME could function as an antihepatitisremedy suppressing MAPKAP-1-mediated inflammatory events

1 Introduction

Inflammation and innate immune response are consideredbeneficial for host survival [1] and are part of the complex bio-logical response of living organisms to harmful stimuli suchas infection cellular damage and tissue injury [2] Numerous

cellular and biochemical alterations including downregula-tion of anti-inflammatory proteins andupregulation of proin-flammatory gene products occur during inflammatory condi-tions to facilitate immune cell recruitment and to boost bodyrsquosdefensive mechanism [3 4] Nevertheless the instability ofimmune homeostasis and prolonged inflammatory response

Hindawi Publishing CorporationEvidence-Based Complementary and Alternative MedicineVolume 2015 Article ID 608126 11 pageshttpdxdoiorg1011552015608126

2 Evidence-Based Complementary and Alternative Medicine

can result in the development of various chronic diseases suchas autoimmune disorders cancer and vascular diseases [5 6]Lipopolysaccharide (LPS) stimulates several proinflamma-tory mediator cytokines such as interferon interleukin-1120573(IL-1120573) interleukin-6 (IL-6) and tumor necrosis factor-120572(TNF-120572) [1 7 8]

During LPS-induced inflammation LPS binds to toll-likereceptor 4 (TLR4) and stimulates the recruitment of bothcytoplasmic MyD88 and TRIF adaptor proteins which acti-vate mitogen-activated protein kinase (MAPK) signaling [9]The MAPK family consists of extracellular signal-regulatedkinase (ERK) c-Jun N-terminal kinase (JNK) and p38 Con-tinual activation of the MAPK signaling pathway has beenshown to increase the activation of activator protein- (AP-) 1a heterodimeric transcription factor composed of c-Fos c-Jun ATF and JDP families [10] Activated AP-1 eventuallyupregulates the transcription of inflammatory genes contain-ing the 12-O-tetradecanoylphorbol-13-acetate (TPA) DNAresponse element (TRE 51015840-TGAGCTCA-31015840) [11] Indeed itis known that the development of numerous human inflam-matory diseases is accompanied with the activation of AP-1[12] Hence targeting MAPKAP-1 pathways is an attractiveanti-inflammatory therapeutic approach

Hepatitis a liver disease associated with severe hepa-tocyte damage is highly associated with acute or chronicinflammation caused by other infections alcohol ingestioncertain medications some industrial organic solvents andplants and autoimmune diseases [13 14] Liver inflammationrecruits numerous types of immune cells such as naturalkiller cells T cells dendritic cells andmacrophages [13] Likeother inflammatory diseases the hepatic macrophages dis-play prime pathophysiological roles in inducing liver injuryby enormous production of reactive oxygennitrogen speciesand proinflammatory cytokines such as TNF-120572 IL-1120573 andIL-6 [13] LPSD-galactosamine- (D-GalN-) induced hepati-tis in mice is a classical experimental model of severe liverinjury involving the production of inflammatory cytokinesand recruitment of inflammatory cells leading to liverdamage and dysfunction [15 16]

Persicaria chinensis L (Polygonaceae) is one of the rep-resentative medicinal plants that are widely used in tropicaland subtropical Eastern Asia [17] The Malaysian Chinesecommunity and Tamang community of Nepal have beenknown to prescribe this plant to treat various lung diseases[18 19] Malaysian communities and Indian tribes have usedthe methanolic extract of leaves to cope with infectiousdiseases and ulcers [17 20] In addition numerous previousstudies have reported the importance of P chinensis as ananti-inflammatory plant [18ndash20] but the molecular ethno-pharmacological evidence is still ambiguous Recently wedemonstrated that 95 methanol extract of the aerialparts of this plant (Pc-ME) can effectively ameliorateinflammatory responses in HClEtOH-induced gastritis andTLR4-activated macrophages through the suppression ofSykSrcNF-120581B [17] Previously it was stated that MAPKsplay an important role in the regulation of LPS-inducedinflammation by controlling AP-1 activation [21] and arestrongly linked to the induction of hepatitis [22 23] This

prompted us to further examine the molecular inhibitoryeffects of Pc-ME on the AP-1 pathway and we assumedthat this extract may be capable of attenuating hepatitissymptoms To conquer our hypothesis we used lipopolysac-charide- (LPS-) treated macrophages RAW2647 cell line andhuman pleurapleural effusion monocyte-like cell line U937and LPSD-GalN-induced hepatitis mouse model Holis-tic molecular approaches including reporter gene assaysimmunoprecipitation analysis and histopathological andhematopathological investigation were also used to confirmour assumption

2 Materials and Methods

21 Materials Quercetin 3-(45-dimethylthiazol-2-yl)-25-diphenyltetrazolium bromide (MTT) and lipopolysaccha-ride (LPS E coli 0111B4) were purchased from Sigma Chem-ical Co (St Louis MO USA) Luciferase constructs contain-ing promoters for AP-1 were a gift from Professor ChungHae Young (Pusan National University Pusan Korea) Fetalbovine serum (FBS) and RPMI1640 were obtained fromGibco (Grand Island NY USA) RAW2647 cells a BALBc-derived murine macrophage cell line (number TIB-71) U937cells a human pleurapleural effusionmonocyte-like cell line(number CRL-15932) and HEK293 cells a human embry-onic kidney cell line (number CRL-1573) were purchasedfromAmerican Tissue Culture Center (Rockville MD USA)Luciferase constructs containing binding sites for AP-1 wereused as reported previously [24 25] All other chemicals wereobtained from Sigma Phosphospecific or total antibodies tolaminAC c-Fos c-Jun ERK JNK p38MEK12MKK4 and120573-actin used in this studywere purchased fromCell SignalingTechnology (Beverly MA USA)

22 Pc-ME Preparation Pc-ME (Code number PBID110601) was obtained from the Plant Extract Bank in the PlantDiversity Research Center (Daejeon Korea httpextractkribbrekrextractfhtm e-mail mplantextkribbrekr) asreported previously [17]

23 Drug Treatment In case of cellular experiments Pc-MEprepared in 100 DMSO at a concentration of 100mgmLwas diluted with culture medium For animal experimentPc-ME (200mgkg) was resuspended in 1 sodium car-boxymethylcellulose (CMC) as reported previously [26] andLPS (10 120583gkg)D-GalN (1 gkg) was dissolved in phosphate-buffered saline (PBS)

24 In Vitro Studies241 Cell Culture The cancerous macrophage lineRAW2647 and human pleurapleural effusion monocyte-like cell line U937 were maintained in RPMI1640 whilehuman embryonic kidney cell line HEK293 was culturedin DMEM medium each supplemented with 10 heat-inactivated FBS glutamine and penicillinstreptomycin at37∘C during 5 CO

2 Before Pc-ME treatment U937 cells

were treated with PMA (20 nM) for 12 h

Evidence-Based Complementary and Alternative Medicine 3

Table 1 RT-PCR and real-time PCR primers used in this study

(a) RT-PCR primers

Name Sequence (51015840 to 31015840)

TNF-120572 F TTGACCTCAGCGCTGAGTTGR CCTGTAGCCCACGTCGTAGC

IL-6 F GGAAATCGTGGAAATGAGR GCTTAGGCATAACGCACT

IL-1120573 F CAGGATGAGGACATGAGCACR CTCTGCAGACTCAAACTCCA

GAPDH F CAA TGA ATA CGG CTA CAG CAA CR AGG GAG ATG CTC AGT GTT GG

(b) Real-time PCR primers

Name Sequence (51015840 to 31015840)

TNF-120572 F GAAAGCATGATCCGGGACGTGR GATGGCAGAGAGGAGGTTGAC

IL-6 F AAGCCAGAGCTGTGCAGATGAGTAR CTTGGTCACCGACGTCCTGT

IL-1120573 F CCGACCACCACTACAGCAAGR GGGCAGGGAACCAGCATCTT

GAPDH F TGGAAGGACTCATGACCACAR AGGGGTCTACATGGCAACTG

242 Cell Viability Test After preincubation of RAW2647HEK 293 andU937 cells (1 times 106 cellsmL) for 18 h Pc-ME (0100 200 and 300 120583gmL) was added to the cell suspensionsand incubated for 24 h The effect of Pc-ME on cell viabilitywas tested by a conventional MTT assay according toprevious reports [27 28] In brief at 3 h prior to culture ter-mination 10 120583L of MTT solutions (10mgmL in phosphate-buffered saline pH 74) was added and cells were continu-ously cultured until assay termination The incubation washalted by the addition of 15 sodium dodecyl sulphate toeach well to solubilize the formazan and absorbance at 570ndash630 nm (OD

570ndash630) was measured using a Spectramax 250microplate reader

243 mRNA Analysis by Semiquantitative Reverse Tran-scriptase-Polymerase Chain Reaction (RT-PCR) and Real-Time PCR To determine mRNA expression levels of proin-flammatory cytokine genes RAW2647 or U937 cells wereexposed to Pc-ME (0 100 and 300120583gmL) for 30min(RAW2647 cells) or 3 h (U937 cells) before incubation withLPS (1 120583gmL for RAW2647 cells and 10 120583gmL for U937cells) for 6 h (RAW2647 cells) or 12 h (U937 cells) TotalRNA was prepared with TRIzol reagent (Gibco) according tothe manufacturerrsquos instructions and stored at minus70∘C for lateruse Semiquantitative RT-PCR and real-time PCR reactionswere also carried out according to previous report [29] Theprimers (Bioneer Seoul Korea) used in this study are listedin Table 1

244 Plasmid Transfection and Luciferase Reporter GeneActivity Assay HEK293 cells (1 times 106 cellsmL in 12-wellplates) were transfected with plasmids (120573-galactosidase and

AP-1-Luc) under cotransfection with an inducing molecule(MyD88 TRIF or PMA) using the polyethyleneimine (PEI)method The cells were treated with Pc-ME (0 100 200and 300 120583gmL) or quercetin (0 20 40 and 80 120583M) for 12 huntil harvesting Luciferase activity was determined by theLuciferase Assay System (Promega Madison WI USA) aspreviously reported [30 31]

25 In Vivo Studies251 Animals Male C57BL6 mice (6ndash8 weeks old 17ndash21 g) were purchased from DAEHAN BIOLINK (ChungbukKorea) and were housed in groups of 6ndash8 mice under a12 h lightdark cycle (lights on at 6 am) Water and pelletdiets (Samyang Daejeon Korea) were supplied ad libitumAnimals were cared for in accordance with the guidelinesissued by theNational Institute ofHealth for the Care andUseof Laboratory Animals (NIH Publication 80-23 revised in1996) Studies were performed in accordance with guidelinesestablished by the Institutional Animal Care and Use Com-mittee at Sungkyunkwan University (Suwon Korea approvalID SKKUBBI 12-6-1)

252 LPSD-GalN-Induced Hepatitis Mouse Model Amodelof experimental liver inflammationwas induced by LPS injec-tion according to a previously publishedmethod [32] Brieflyfive-week-old C57BL6 mice were treated orally with Pc-ME(200mgkg) once a day for six days with the aid of cropneedles One hour after the final administration of Pc-MELPS (10 120583gkg) and D-GalN (1 gkg) were injected intraperi-toneally Each animal was anesthetized with an overdose ofurethane 1 hour after administration of hepatitis inducersand blood was collected by cardiac puncture The livers werethen excised and gently rinsed with PBS Serumwas obtainedby centrifugation of blood at 3000 rpm for 15min Thelevels of serum alanine aminotransferase (ALT) and aspartateaminotransferase (AST) were measured with a Roche Modu-lar spectrophotometric autoanalyzer

253 Histopathology The histopathological observation wasalso performed as previously described [33] Briefly tissuesamples taken from the liver of the mice at 8 h after challengewith LPS and D-GalN were fixed with 10 formalin in PBSand then embedded in paraffin Approximately 4 120583m thintissue sections were stained with hematoxylin and eosin forhistopathological examination

26 Preparation of Total Lysates Nuclear Extracts andImmunoblotting In vivo samples (liver tissues from micetreated with Pc-ME (0 and 200mgkg)) or in vitro samples(RAW2647 cells (5 times 106 cellsmL) stimulated with LPS forvarious time points (2 3 5 15 30 and 60min) in the presenceor absence of Pc-ME (0 to 300120583gmL) or PMA-treated U937cells stimulated with LPS for 30 and 60min during Pc-ME(0 and 300 120583gmL) exposure) were washed three times incold PBS with 1mM sodium orthovanadate and lysed by asonicator or a Tissuemizer in lysis buffer (20mM Tris-HClpH 74 2mM EDTA 2mM ethyleneglycotetraacetic acid50mM 120573-glycerophosphate 1mM sodium orthovanadate

4 Evidence-Based Complementary and Alternative Medicine

1mM dithiothreitol 1 Triton X-100 10 glycerol 10 120583gmLaprotinin 10 120583gmL pepstatin 1mM benzamide and 2mMPMSF) for 30min with rotation at 4∘CThe lysates were clari-fied by centrifugation at 16000timesg for 10min at 4∘Cand storedat minus20∘C until needed

Nuclear extracts were prepared in a three-step procedurewith RAW2647 cells stimulated with LPS for 15 30 60and 120min in the presence or absence of Pc-ME (0 and300 120583gmL) as reported previously [34] The cells werecollected with a rubber policeman washed with 1 times PBSand lysed in 500 120583L lysis buffer containing 50mM KCl 05Nonidet P-40 25mM HEPES (pH 78) 1mM phenylmethyl-sulfonyl fluoride 10 120583gmL leupeptin 20120583gmL aprotininand 100 120583M 14-dithiothreitol (DTT) on ice for 4min Celllysates were then centrifuged at 19326timesg for 1min in amicro-centrifuge In the second step the pellet (the nuclear fraction)waswashed once inwashing buffer whichwas the same as thelysis buffer but without Nonidet P-40 In the final step nucleiwere treated with an extraction buffer (lysis buffer containing500mM KCl and 10 glycerol) The nucleiextraction buffermixture was frozen at minus80∘C and then thawed on ice andcentrifuged at 19326timesg for 5min The supernatant wascollected as a nuclear extract

Soluble cell lysates or the nuclear extracts were immunob-lotted and total or phosphorylated protein levels of transcrip-tion factors (lamin AC c-Fos and c-Jun) ERK JNK p38MEK12 MKK4 and 120573-actin (as a control) were visualizedaccording to a previously published method [35]

27 Statistical Analysis All data are expressed as the mean plusmnstandard deviation (SD) of an experiment performed with six(Figures 1 2 and 6) or three (Figures 3 4 and 5) samples for invitro test and sixmice of each group for in vivo tests (Figure 5)Statistical comparisons were carried out by ANOVAScheffersquospost hoc test and Kruskal-WallisMann-Whitney tests A 119875value lt005 was considered statistically significant All statis-tical tests were performed with the computer program SPSS17 for Windows XP Similar results were found in an addi-tional independent set of in vitro and in vivo experimentsperformed under the same conditions

3 Results

31 Effect of Pc-ME on Cell Viability As shown in Figure 1the viability of RAW2647 HEK293 and U937 cells wasnot significantly affected by treatment with Pc-ME up to300 120583gmL compared with that of the cells receiving no LPStreatment

32 Effect of Pc-ME on the Transcriptional Activation of AP-1We next performed a transfection experiment with the AP-1-Luc construct and HEK293 cells and used luciferase assays toexaminewhether Pc-ME suppressed the functional activationof AP-1 We found that AP-1-mediated luciferase activity wasincreased by PMA treatment (up to 50-fold) or cotransfectionwith adaptormolecules TRIF (up to 45-fold) andMyD88 (upto 8-fold) whereas Pc-ME treatment significantly (119875 lt 001)and dose-dependently (100 200 and 300120583gmL) inhibited

Cel

l via

bilit

y (

of c

ontro

l)

2000 100 3000

20

40

60

80

100

120

RAW2647 cellsHEK293 cellsU937 cells

Pc-ME (120583gmL)

Figure 1 Cell viability of RAW2647 HEK293 and U937 cells wasdetermined using the MTT assay

this upregulation (Figure 2) suggesting that AP-1 activationis a major pharmacological target of Pc-ME

AP-1 transcription factor is known to have a major reg-ulatory role in inflammatory gene expression so we exam-ined the suppressive effect of Pc-Me on the activation andtranslocation of AP-1 after treatment with Pc-ME Figure 3(a)shows the increase in nuclear level of the AP-1 c-Fos subunitdue to time-dependent inhibition by Pc-ME (15 30 60 and120min) Similar time-dependent (30 and 60min) inhibitorypatterns of c-Fos expression were confirmed by whole lysateextraction from U937 cells (Figure 3(b))

33 Effects of Pc-ME on LPS-Induced Proinflammatory Cytok-ine Production Lee et al [33] and Feldmann [36] have sug-gested that TNF-120572 IL-1120573 and IL-6 are crucial mediators ofthe development of inflammatory diseases We further inves-tigated the effect of Pc-ME on proinflammatory gene expres-sion in RAW2647 cells and U937 cells after LPS treatmentRT-PCR results demonstrated a significant concentration-dependent decrease in LPS-induced upregulation of TNF-120572IL-1120573 and IL-6 mRNA levels in Pc-ME-treated RAW2647cells (Figure 3(c)) In parallel real-time PCR (Figures 3(d)to 3(f)) in U937 cells clearly showed that LPS was able toinduce the upregulation of proinflammatory cytokines suchas TNF-120572 up to 6460-fold IL-1120573 up to 1360-fold and IL-6 upto 20-fold whereas Pc-ME (300 120583gmL) strongly (119875 lt 001)inhibited this

34 Effect of Pc-ME on Upstream Signaling for AP-1 Acti-vation It has been reported [37] that phosphorylation ofMAPK (ERK JNK and p38) plays a pivotal role in theregulation of LPS-induced inflammatory mediators so weperformed Western blot analysis to determine the inhibitoryactivity of Pc-ME on proinflammatorymediators LPS signif-icantly elevated the phosphorylation of ERK JNK and p38whereas Pc-ME pretreatment strongly and time-dependently(5 15 30 and 60min) suppressed LPS-induced phospho-rylation of JNK and ERK but not that of p38 (Figure 4(a)

Evidence-Based Complementary and Alternative Medicine 5

Tag2 +minus

minus

minus

+minus

minus

+100

minus

+200

minus

+300

MyD88

0

2

4

6

8

10

lowastlowast lowastlowastlowastlowast

Pc-ME (120583gmL)

AP-1-

med

iate

d lu

cife

rase

ac

tivity

(fol

d in

crea

se)

(a)

pcDNA +minusminus

minus

+minus

minus

+100

minus

+200

minus

+300

TRIF

0

1

2

3

4

5

6

lowastlowast

lowastlowast

lowast

Pc-ME (120583gmL)

AP-1-

med

iate

d lu

cife

rase

ac

tivity

(fol

d in

crea

se)

(b)

0

10

20

30

40

50

60

minus

minus

+

minus

+100

+200

+300

lowastlowast

lowastlowast

Pc-ME (120583gmL)PMA (100nM)

AP-1-

med

iate

d lu

cife

rase

activ

ity (f

old

incr

ease

)

(c)

Figure 2 Effect of Pc-ME on the reporter gene assay The promoter binding activity of the transcription factor AP-1 was analyzed using areporter gene assay in HEK293 cells transfected with plasmid constructs AP-1-Luc (1 120583gmL) or 120573-gal (as a transfection control) with 1120583gmLof MyD88 (a) or TRIF (b) and 100 nM PMA (c) in the presence of Pc-ME Luciferase activity was measured using a luminometer lowastlowast119875 lt 001compared with control

left panel) in RAW2647 cells The right panel in Figure 4(a)shows that Pc-ME (50 100 200 and 300120583gmL) dose-dependently blocked the phosphorylation of ERK and JNKwhich validates our experimental findings and confirmsour expectations Upstream signaling enzymes (MEK12 andMKK4) contributing to ERK and JNK phosphorylation wereappreciably blocked by Pc-ME at 2 3 and 5min of LPS treat-ment (Figure 4(b)) which demonstrates that MEK12 andMKK4 might be targeted by Pc-ME in its AP-1-suppressiveanti-inflammatory actions in LPS-stimulated RAW2647cells In concurrence with our LPSD-GalN-treated micehepatitis experimental model the upregulation of phospho-rylated MKK4 and c-Fos in the liver tissue was markedlysuppressed by orally administered Pc-ME (Figure 5(d))

35 Hepatoprotective Effect of Pc-ME on LPSD-GalN-InducedLiver Injury in Mice We used a mouse model of LPSD-GalN-induced liver injury to investigate the in vivo hep-atoprotective effect of Pc-ME LPSD-GalN-triggered ALT

(14000UL) and AST (10000UL) protein levels were sig-nificantly (119875 lt 001) decreased by Pc-ME (Figures 5(a)and 5(b))Moreover histopathological analysis demonstratedthat the liver sections of the LPSD-GalN group displayedmore neutrophil recruitment as assessed by bigger sized andincreased numbers dark spots (see arrows in Figure 5(c))compared with the saline-treated control groups in contrastthe Pc-ME-treated groups exhibited lower neutrophil num-bers (Figure 5(c)) which demonstrates the strong hepatopro-tective activity of Pc-ME

36 Effect of Quercetin on AP-1 Activity Cotransfectionwith the adaptor molecule MyD88 enhanced AP-1-mediatedluciferase activity by 45-fold quercetin a major flavonoidfrom Pc-ME [17] significantly (119875 lt 001) and dose-dependently inhibited this upregulation (Figure 6) whichdemonstrates that AP-1 activation is amajor pharmacologicaltarget of Pc-ME and its ingredient quercetin

6 Evidence-Based Complementary and Alternative Medicine

Lamin AC

+

minus

+

300

+

minus

+

300

+

minus

+

300

+

minus

+

300

Nuclear fraction (RAW2647 cells)

minus

minus

c-Fos

c-Jun

Pc-ME (120583gmL)

15min 30min 60min 120min

LPS (1120583gmL)

(a)

+

minus

+

minus

+

300

U937 cells

minus

minus

+

300

p-c-Fos

c-Fos

Pc-ME (120583gmL)

30min 60min

120573-actin

LPS (10120583gmL)

(b)

minus

minus

+

minus

+

100

+

300

GAPDH

IL-6

Pc-ME (120583gmL)LPS (1120583gmL)

RAW2647 cells (6h)

TNF-120572

IL-1120573

(c)

0

1000

2000

3000

4000

5000

6000

7000

minus minus 300

lowastlowast

Pc-ME (120583gmL)

TNF-120572

expr

essio

n (r

elat

ive q

uant

ity)

U937 cells (12h)

LPS (10120583gmL)(d)

0

200

400

600

800

1000

1200

1400

1600

minus minus 300

lowastlowast

Pc-ME (120583gmL)

IL-1120573

expr

essio

n (r

elat

ive q

uant

ity)

LPS (10120583gmL)

U937 cells (12h)

(e)

0

5

10

15

20

25

IL-6

gen

e exp

ress

ion

(rel

ativ

e qua

ntity

)

minus minus 300

lowastlowast

Pc-ME (120583gmL)

U937 cells (12h)

LPS (10120583gmL)

(f)

Figure 3 Effect of Pc-ME on the activation of proinflammatory cytokines and transcriptional regulation (a) Levels of c-Fos c-Jun andlamin AC in nuclear fractions were determined by immunoblot analysis in RAW2647 cells (b) Phospho- or total protein levels of c-Fosand 120573-actin in cell lysates were determined by immunoblot analysis in U937 cells (c) mRNA levels of TNF-120572 IL-1120573 IL-6 and GAPDH weredetermined by semiquantitative RT-PCR in RAW2647 cells (dndashf) mRNA levels of TNF-120572 IL-1120573 and IL-6 were determined by real-timeRT-PCR in U937 cells

4 Discussion

While P chinensis has high ethnopharmacological worthin Eastern Asian countries the molecular mechanisms

underlying its anti-inflammatory activity are still unknownRecently our studies have revealed that P chinensismethanolextract exhibits strong antigastritis activity and is able toblock NF-120581B activation via suppression of Src and Syk

Evidence-Based Complementary and Alternative Medicine 7

15min 30min 60min5min RAW2647 cells (30min)

p-ERK

ERK

p-JNK

JNKp-JNK

ERK

p-ERK

p-p38

p38

JNK

RAW2647 cells

minus

minus

+

minus

+

50

+

100

+

200

+

300

minus

minus

+

minus

+

300

+

minus

+

300

+

minus

+

300

+

minus

+

300Pc-ME (120583gmL)LPS (1120583gmL)

Pc-ME (120583gmL)LPS (1120583gmL)

120573-actin

120573-actin

(a)

5min3min2minminus

minus

+

minus

+

300

+

minus

+

300

+

minus

+

300

p-MEK12

MEK12

MKK4

p-MKK4

RAW2647 cells

Pc-ME (120583gmL)LPS (1120583gmL)

120573-actin

(b)

Figure 4 Effect of Pc-ME on the activation of upstream signaling enzymes of AP-1 translocation (a and b) Phospho- and total protein levelsof ERK JNK p38 MEK12 MKK4 and 120573-actin in cell lysates were determined by immunoblotting analysis

activities [17] However SrcSyk-linked activation of NF-120581Bis not the only important regulatory loop of inflammatoryreaction In addition it has been reported that AP-1 activatedby MAPK plays another crucial roles in inflammatory reac-tion [11 38 39] In the present study therefore we aimed toelucidate inhibitory mechanism of Pc-ME on AP-1 functionin vitro and in vivo by using LPS-activated macrophages andLPSD-GalN-triggered hepatitis model

It has been shown that reporter gene luciferase assayperformed in conjunction with HEK293 cells transfectedwith Luc constructs and adaptor molecules essential for TLRsignaling [40] is a reasonable approach for studying func-tional activation of transcription factors [41 42] Thereforeto examine the ability of Pc-ME to suppress AP-1 functionwe first employed the luciferase assay using HEK293 cellstransfected with the AP-1-Luc construct As expected AP-1-mediated luciferase activity was enhanced up to 45- to485-fold by PMA treatment or cotransfection with adaptormolecules (TRIF and MyD88) and Pc-ME notably inhibitedthis upregulation in a dose-dependent manner (Figure 2)Moreover nuclear translocation of c-Fos was reduced by Pc-ME treatment in a time-dependent manner (Figure 3(a))

implying that AP-1 family of transcription factors can befunctionally inactivated and that their upstream kinasesresponsible for AP-1 phosphorylation can be targeted

Several earlier reports have suggested that several proin-flammatory cytokines such as TNF-120572 IL-1120573 and IL-6 playan important role in boosting proinflammatory roles ofmacrophages [43ndash45] We therefore further tested whetherthese proinflammatory cytokines can be also suppressedby Pc-ME using LPS-treated RAW2647 cells The mRNAanalysis of these cytokines by RT-PCR in RAW2647 cells(Figure 3(c)) and by real-time PCR in U937 cells (Figures3(d)ndash3(f)) revealed that mRNA levels of TNF-120572 IL-1120573 andIL-6 were strongly upregulated by LPS treatment while Pc-ME significantly and dose-dependently (100 and 300120583gmL)inhibited such upregulation indicating that AP-1 suppressionby Pc-ME may be associated with blockade of these proin-flammatory cytokines as well as its suppressive activity onthe expression of iNOS and COX-2 [17] In fact a number ofstudies have also reported thatmany knownherbalmedicinessuch as Polygonum hydropiper Pistacia integerrima Phase-olus angularis Morus bombycis Koidzumi and Sanguisorbaofficinalis possess AP-1 pathway inhibitory activity as their

8 Evidence-Based Complementary and Alternative Medicine

ALT

(UL

)

minus +0

5000

10000

15000

20000

25000

lowastlowast

Pc-ME (200mgkg)

LPS (10120583gkg)D-GalN (1mgkg)

(a)

AST

(UL

)

0

5000

10000

15000

20000

minus +

lowastlowast

Pc-ME (200mgkg)

LPS (10120583gkg)D-GalN (1mgkg)

(b)

HampE staining

Normal LPSD-GalN Pc-ME (200mgkg)

(c)

Liver lysate

minus

minus

+minus

++

MKK4

c-Fos

p-c-Fos

LPSD-GalN

p-MKK4

120573-actin

Pc-ME (200mgkg)

(d)

Figure 5 Effect of Pc-ME on LPSD-GalN-induced hepatitis in mice Mice were orally treated with Pc-ME (200mgkg) for six days beforeintraperitoneal injection of LPSD-GalN After 1 h mice were sacrificed to collect blood samples and liver sections for biochemical parameteranalysis of (a) ALT (b) AST and (c) histopathological examination (d) Phospho- or total protein levels of MKK4 c-Fos and 120573-actin in liverlysates were determined by immunoblot analysis

pharmacological target [26 46ndash49] Therefore the fact thatPc-ME is able to inhibit AP-1 pathway could be also acceptedas a general anti-inflammatory mechanism of this plant

As MAPKs play a vital role in the regulation of LPS-induced inflammation by controlling AP-1 activation [21] weexamine themolecular inhibitory effects of Pc-MEon theAP-1 pathway Toward this goal we analyzed the inhibitory effectof Pc-ME on MAPKs and their upstream signaling enzymes

[50]The results of our study demonstrated that Pc-ME treat-ment time-dependently (5 15 30 and 60min) blocked ERKand JNK phosphorylation (Figure 4(a) left panel) poten-tially leading to significant attenuation of AP-1 activationin response to LPS The dose-dependent (50 to 300 120583gmL)inhibition pattern of the same MAPK phosphorylation bythis extract (Figure 4(a) right panel) strongly supported ourexperimental condition and hypothesisThe phosphorylation

Evidence-Based Complementary and Alternative Medicine 9A

P-1-

med

iate

d lu

cife

rase

activ

ity (f

old

incr

ease

)

Tag2MyD88

0

1

2

3

4

5

+

minusminus

minus

+minus

minus

+20

minus

+40

minus

+80

lowastlowastlowastlowast

lowastlowast

Quercetin (120583M)

Figure 6 Effect of quercetin on the activation of upstream signalingenzymes of AP-1 in a reporter gene assay The promoter bindingactivity of the transcription factor AP-1 was analyzed using areporter gene assay in HEK293 cells transfected with plasmidconstructs AP-1-Luc (1 120583gmL) and 120573-gal (as a transfection control)with 1 120583gmL of MyD88 in the presence of quercetin Luciferaseactivity was measured using a luminometer lowastlowast119875 lt 001 comparedwith control

of MEK12 and MKK4 the upstream enzymes of ERK andJNK respectively was also strikingly suppressed by Pc-MEin LPS challenges of 2 3 and 5min (Figure 4(b)) confirmingthe MAPK inhibitory activity of this extract

MAPK activation and subsequent AP-1 activation arestrongly linked to the induction of hepatitis [22 23] Sowe guess that AP-1-inhibitory extract Pc-ME is capable ofattenuating hepatitis symptoms To test this hypothesis weemployed LPSD-GalN-intoxicated acute liver injury modelwhich is a classical system for screening hepatoprotectiveremedy in vivo [32] Our previous study indicating thatPc-ME can protect against HClEtOH-induced gastritis byinhibiting SrcSyk of NF-120581B [17] has demonstrated the oraleffectiveness of this extract In the present study expectedlyPc-ME treatment (200mgkg) effectively ameliorated theLPSD-GalN-induced liver damage (Figure 5(c)) includingreversion of LPSD-GalN-elevated hepatic ALT (Figure 5(a))and AST (Figure 5(b)) enzyme levels In the in vivo hepatictissue the upregulated phosphorylation of MKK4 and c-Fos(component of AP-1) was also noticeably blocked by Pc-MEtreatment (Figure 5(d)) which strongly authenticated ourfindings In addition quercetin a major antioxidative andanti-inflammatory compound of P chinensis [17] also drasti-cally diminished theAP-1 activation in a dose-dependent pat-tern (Figure 6) supporting that MAPKAP-1-targeted anti-inflammatory activity of Pc-ME could be quercetin-derivedanti-inflammatory action Although numerous numbers ofmedicinal plants or edible fruits such as Panax ginsengFagonia schweinfurthii fermented soybean Davilla ellipticaand Boesenbergia rotunda have been reported to show anti-hepatitis activities [51ndash55] only few plants are now clinicallyprescribed It was revealed that Pc-ME is able to stronglysuppress both NF-120581B [17] and AP-1 activity we will further

TLR4

LPS

Pc-ME

Tissue damage

MyD88

MAPK

ERK JNK

c-Fos

AP-1

TRIF

IL-6 IL-1120573

TNF-120572

TNF-120572

IL-6 IL-1120573

Figure 7 Putative mechanism of Pc-ME-mediated anti-inflam-matory responses

validate whether Pc-ME can be also clinically developed as anew antihepatitis herbal drug

In summary our in vivo and in vitro assays demonstratedthat Pc-ME significantly reduced the levels of LPS-mediatedproinflammatory cytokines (TNF-120572 IL-1120573 and IL-6) andthat MAPKAP-1 inactivation by this extract contributes tothese inhibitory effects as summarized in Figure 7The strongantihepatotoxic activity of Pc-ME in vivo was observed in amousemodel of LPSD-GalN-induced liver injury indicatingthat Pc-ME could potentially be used as a hepatoprotectiveremedy

Conflict of Interests

The authors report no conflict of interests The authors aloneare responsible for the content and writing of the paper

Authorsrsquo Contribution

Muhammad Jahangir Hossen and Seung Cheol Kim equallycontributed to this work

Acknowledgment

This study was supported by a grant of the Korean HealthTechnology RampD Project Ministry of Health amp WelfareRepublic of Korea (HI12C0050)

References

[1] C-K Tseng C-K Lin H-W Chang et al ldquoAqueous extractof Gracilaria tenuistipitata suppresses LPS-induced NF-120581Band MAPK activation in RAW 2647 and rat peritonealmacrophages and exerts hepatoprotective effects on carbon

10 Evidence-Based Complementary and Alternative Medicine

tetrachloride-treated ratrdquo PLoS ONE vol 9 no 1 Article IDe86557 2014

[2] H C Steel R Cockeran R Anderson and C Feldman ldquoOver-viewof community-acquired pneumonia and the role of inflam-matory mechanisms in the immunopathogenesis of severepneumococcal diseaserdquo Mediators of Inflammation vol 2013Article ID 490346 18 pages 2013

[3] M Pasparakis ldquoRegulation of tissue homeostasis by NF-Bsignalling implications for inflammatory diseasesrdquo NatureReviews Immunology vol 9 no 11 pp 778ndash788 2009

[4] J-K Kim and G-M Park ldquoIndirubin-3-monoxime exhibitsanti-inflammatory properties by down-regulating NF-120581Band JNK signaling pathways in lipopolysaccharide- treatedRAW2647 cellsrdquo Inflammation Research vol 61 no 4 pp319ndash325 2012

[5] MHamandAMoon ldquoInflammatory andmicroenvironmentalfactors involved in breast cancer progressionrdquo Archives ofPharmacal Research vol 36 no 12 pp 1419ndash1431 2013

[6] M-S Lee ldquoRole of innate immunity in diabetes and metab-olism recent progress in the study of inflammasomesrdquo ImmuneNetwork vol 11 no 2 pp 95ndash99 2011

[7] Y Ayele J-A Kim E Park et al ldquoA methanol extract of Adan-sonia digitata L leaves inhibits pro-inflammatory iNOS possi-bly via the inhibition of NF-120581B activationrdquo Biomolecules andTherapeutics vol 21 no 2 pp 146ndash152 2013

[8] D H Kim J H Chung J S Yoon et al ldquoGinsenoside Rdinhibits the expressions of iNOS andCOX-2 by suppressingNF-120581B in LPS-stimulated RAW2647 cells and mouse liverrdquo Journalof Ginseng Research vol 37 no 1 pp 54ndash63 2013

[9] M Fujihara M Muroi K-I Tanamoto T Suzuki H Azumaand H Ikeda ldquoMolecular mechanisms of macrophage activa-tion and deactivation by lipopolysaccharide roles of the recep-tor complexrdquo Pharmacology and Therapeutics vol 100 no 2pp 171ndash194 2003

[10] T Yu Y J Li A H Bian et al ldquoThe regulatory role of activat-ing transcription factor 2 in inflammationrdquoMediators of Inflam-mation vol 2014 Article ID 950472 10 pages 2014

[11] I-T Lee and C-M Yang ldquoInflammatory signalings involvedin airway and pulmonary diseasesrdquoMediators of Inflammationvol 2013 Article ID 791231 12 pages 2013

[12] E D Chan and D W H Riches ldquoIFN-120574 + LPS induction ofiNOS is modulated by ERK JNKSAPK and p38mapk in amouse macrophage cell linerdquo The American Journal of Physi-ologymdashCell Physiology vol 280 no 3 pp C441ndashC450 2001

[13] I N Crispe ldquoThe liver as a lymphoid organrdquo Annual Review ofImmunology vol 27 pp 147ndash163 2009

[14] F Tacke T Luedde and C Trautwein ldquoInflammatory pathwaysin liver homeostasis and liver injuryrdquoClinical Reviews in Allergyamp Immunology vol 36 no 1 pp 4ndash12 2009

[15] M Y Jia Y P Jing Q Ai et al ldquoPotential role of catalase inmicewith lipopolysaccharideD-galactosamine-induced fulminantliver injuryrdquo Hepatology Research vol 44 no 11 pp 1151ndash11582014

[16] Q Ai Y Jing R Jiang et al ldquoRotenone a mitochondrial res-piratory complex i inhibitor ameliorates lipopolysaccharideD-galactosamine-induced fulminant hepatitis in micerdquo Interna-tional Immunopharmacology vol 21 no 1 pp 200ndash207 2014

[17] M J Hossen K-S Baek E Kim et al ldquoIn vivo and in vitroanti-inflammatory activities of Persicaria chinensis methanolicextract targeting SrcSykNF-120581Brdquo Journal of Ethnopharmacol-ogy vol 159 pp 9ndash16 2015

[18] D R Luitel M B Rokaya B Timsina and Z MunzbergovaldquoMedicinal plants used by the Tamang community in theMakawanpur district of central Nepalrdquo Journal of Ethnobiologyand Ethnomedicine vol 10 no 1 article 5 2014

[19] W M May The reproductive biology and cytotoxic activity ofpersicaria chinensis (L) H gross var chinensis (Polygonaceae)[Dissertation] University of Malaya 2012

[20] S M Lai D Sudhahar and K Anandarajagopal ldquoEvaluationof antibacterial and antifungal activities of Persicaria chinensisleavesrdquo International Journal of Pharmaceutical Sciences ampResearch vol 3 p 8 2012

[21] B Veres B Radnai F Gallyas Jr et al ldquoRegulation of kinase cas-cades and transcription factors by a poly(ADP-ribose) polym-erase-1 inhibitor 4-hydroxyquinazoline in lipopolysaccharide-induced inflammation in micerdquo Journal of Pharmacology andExperimental Therapeutics vol 310 no 1 pp 247ndash255 2004

[22] M Panteva H Korkaya and S Jameel ldquoHepatitis viruses andthe MAPK pathway is this a survival strategyrdquo Virus Researchvol 92 no 2 pp 131ndash140 2003

[23] A Laliena B S Miguel I Crespo M Alvarez J Gonzalez-Gallego and M J Tunon ldquoMelatonin attenuates inflammationand promotes regeneration in rabbits with fulminant hepatitisof viral originrdquo Journal of Pineal Research vol 53 no 3 pp 270ndash278 2012

[24] S E Byeon T Yu Y Yang et al ldquoHydroquinone regulateshemeoxygenase-1 expression via modulation of Src kinaseactivity through thiolation of cysteine residuesrdquo Free RadicalBiology and Medicine vol 57 pp 105ndash118 2013

[25] S E Byeon T Yu Y Yang et al ldquoHydroquinone regulateshemeoxygenase-1 expression via modulation of Src kinaseactivity through thiolation of cysteine residuesrdquo Free RadicalBiology and Medicine vol 57 pp 105ndash118 2013

[26] Y Yang T Yu H-J Jang et al ldquoIn vitro and in vivo anti-inflammatory activities of Polygonum hydropiper methanolextractrdquo Journal of Ethnopharmacology vol 139 no 2 pp 616ndash625 2012

[27] M-Y Kim and J Y Cho ldquo20S-dihydroprotopanaxadiol aginsenoside derivative boosts innate immune responses ofmonocytes and macrophagesrdquo Journal of Ginseng Research vol37 no 3 pp 293ndash299 2013

[28] E H Jho K Kang S Oidovsambuu et al ldquoGymnaster koraien-sis and its major components 35-di-O-caffeoylquinic acid andgymnasterkoreayne B reduce oxidative damage induced bytert-butyl hydroperoxide or acetaminophen in hepG2 cellsrdquoBMB Reports vol 46 no 10 pp 513ndash518 2013

[29] Y Yang T Yu Y G Lee et al ldquoMethanol extract ofHopea odor-ata suppresses inflammatory responses via the direct inhibitionof multiple kinasesrdquo Journal of Ethnopharmacology vol 145 no2 pp 598ndash607 2013

[30] S Sun Back J Kim D Choi E S Lee S Y Choi and K HanldquoCooperative transcriptional activation of ATP-binding cassettesterol transporters ABCG5 and ABCG8 genes by nuclear recep-tors including Liver-X-Receptorrdquo BMB Reports vol 46 no 6pp 322ndash327 2013

[31] C Liang Y Ding S B Song et al ldquoOleanane-triterpenoidsfrom Panax stipuleanatus inhibit NF-120581Brdquo Journal of GinsengResearch vol 37 no 1 pp 74ndash79 2013

[32] J Y Cho J D Yeon J Y Kim E S Yoo YH Yu andMH ParkldquoHepatoprotection by human epidermal growth factor (hEGF)against experimental hepatitis induced byD-galactosamine (D-GalN) or D-GalNlipopolysacchariderdquo Biological amp Pharma-ceutical Bulletin vol 23 no 10 pp 1243ndash1246 2000

Evidence-Based Complementary and Alternative Medicine 11

[33] C-W Lee F-L Yen H-W Huang et al ldquoResveratrol nanopar-ticle system improves dissolution properties and enhances thehepatoprotective effect of resveratrol through antioxidant andanti-inflammatory pathwaysrdquo Journal of Agricultural and FoodChemistry vol 60 no 18 pp 4662ndash4671 2012

[34] T Yu J Lee Y G Lee et al ldquoIn vitro and in vivo anti-inflam-matory effects of ethanol extract from Acer tegmentosumrdquoJournal of Ethnopharmacology vol 128 no 1 pp 139ndash147 2010

[35] Y-H Jeong J-W Hyun T K van Le D-H Kim and H-SKim ldquoKalopanaxsaponin A exerts anti-inflammatory effects inlipopolysaccharide-stimulated microglia via inhibition of JNKand NF-120581BAP-1 pathwaysrdquo Biomolecules andTherapeutics vol21 no 5 pp 332ndash337 2013

[36] M Feldmann ldquoMany cytokines are very useful therapeutictargets in diseaserdquoThe Journal of Clinical Investigation vol 118no 11 pp 3533ndash3536 2008

[37] B Kaminska ldquoMAPK signalling pathways as molecular targetsfor anti-inflammatory therapymdashfrom molecular mechanismsto therapeutic benefitsrdquoBiochimica et Biophysica ActamdashProteinsand Proteomics vol 1754 no 1-2 pp 253ndash262 2005

[38] Y Yang S C Kim T Yu et al ldquoFunctional roles of p38mitogen-activated protein kinase in macrophage-mediated inflamma-tory responsesrdquoMediators of Inflammation vol 2014 Article ID352371 13 pages 2014

[39] Y Yang J Lee M H Rhee et al ldquoMolecular mechanism ofprotopanaxadiol saponin fraction-mediated anti-inflammatoryactionsrdquo Journal of Ginseng Research vol 39 no 1 pp 61ndash682015

[40] L A J OrsquoNeill K A Fitzgerald and A G Bowie ldquoThe Toll-IL-1 receptor adaptor family grows to five membersrdquo Trends inImmunology vol 24 no 6 pp 286ndash289 2003

[41] S E Byeon J Lee B C Yoo et al ldquoP38-targeted inhibition ofinterleukin-12 expression by ethanol extract from Cordycepsbassiana in lipopolysaccharide-activated macrophagesrdquo Immu-nopharmacology and Immunotoxicology vol 33 no 1 pp 90ndash96 2011

[42] M H Kim D S Yoo S Y Lee et al ldquoThe TRIFTBK1IRF-3activation pathway is the primary inhibitory target of resver-atrol contributing to its broad-spectrum anti-inflammatoryeffectsrdquo Pharmazie vol 66 no 4 pp 293ndash300 2011

[43] S Ghosh and M S Hayden ldquoNew regulators of NF-120581B ininflammationrdquo Nature Reviews Immunology vol 8 no 11 pp837ndash848 2008

[44] R Medzhitov and T Horng ldquoTranscriptional control of theinflammatory responserdquoNature Reviews Immunology vol 9 no10 pp 692ndash703 2009

[45] T Kawai and S Akira ldquoToll-like receptors and their crosstalkwith other innate receptors in infection and immunityrdquo Immu-nity vol 34 no 5 pp 637ndash650 2011

[46] K Mehla S Balwani A Kulshreshtha D Nandi P Jaisankarand B Ghosh ldquoEthyl gallate isolated from Pistacia integerrimaLinn inhibits cell adhesion molecules by blocking AP-1 tran-scription factorrdquo Journal of Ethnopharmacology vol 137 no 3pp 1345ndash1352 2011

[47] T Yu H M Ahn T Shen et al ldquoAnti-inflammatory activity ofethanol extract derived fromPhaseolus angularis beansrdquo Journalof Ethnopharmacology vol 137 no 3 pp 1197ndash1206 2011

[48] H S Kim A-R Kim H J Park et al ldquoMorus bombycis Koid-zumi extract suppresses collagen-induced arthritis by inhibitingthe activation of nuclear factor-120581B and activator protein-1 inmicerdquo Journal of Ethnopharmacology vol 136 no 3 pp 392ndash398 2011

[49] T Yu Y J Lee H M Yang et al ldquoInhibitory effect of San-guisorba officinalis ethanol extract onNO and PGE

2production

is mediated by suppression of NF-120581B and AP-1 activationsignaling cascaderdquo Journal of Ethnopharmacology vol 134 no1 pp 11ndash17 2011

[50] M Guha and N Mackman ldquoLPS induction of gene expressionin human monocytesrdquo Cellular Signalling vol 13 no 2 pp 85ndash94 2001

[51] S-J Seo J Y Cho Y H Jeong and Y-S Choi ldquoEffect of Koreanred ginseng extract on liver damage induced by shorttermand long-term ethanol treatment in ratsrdquo Journal of GinsengResearch vol 37 no 2 pp 194ndash200 2013

[52] A Pareek A Godavarthi R Issarani and B P Nagori ldquoAntiox-idant and hepatoprotective activity of Fagonia schweinfurthii(Hadidi) Hadidi extract in carbon tetrachloride induced hep-atotoxicity in HepG2 cell line and ratsrdquo Journal of Ethnophar-macology vol 150 no 3 pp 973ndash981 2013

[53] H Mohd Yusof N M Ali S K Yeap et al ldquoHepatoprotectiveeffect of fermented soybean (nutrient enriched soybean tem-peh) against alcohol-induced liver damage in micerdquo Evidence-Based Complementary and Alternative Medicine vol 2013Article ID 274274 8 pages 2013

[54] J J Campos A De Oliveira Azevedo J D De Souza FilhoA Castro Perez and F Castro Braga ldquoBioguided isolation ofmyricetin-3-O-120573-galactopyranoside with antinociceptive activ-ity from the aerial part of Davilla elliptica St-Hilrdquo Journal ofEthnopharmacology vol 150 no 1 pp 270ndash274 2013

[55] S M Salama M A Abdulla A S Alrashdi and A H A HadildquoMechanism of hepatoprotective effect of Boesenbergia rotundain thioacetamide-induced liver damage in ratsrdquo Evidence-basedComplementary and Alternative Medicine vol 2013 Article ID157456 13 pages 2013

Submit your manuscripts athttpwwwhindawicom

Stem CellsInternational

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

MEDIATORSINFLAMMATION

of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Behavioural Neurology

EndocrinologyInternational Journal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Disease Markers

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

BioMed Research International

OncologyJournal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Oxidative Medicine and Cellular Longevity

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

PPAR Research

The Scientific World JournalHindawi Publishing Corporation httpwwwhindawicom Volume 2014

Immunology ResearchHindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Journal of

ObesityJournal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Computational and Mathematical Methods in Medicine

OphthalmologyJournal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Diabetes ResearchJournal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Research and TreatmentAIDS

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Gastroenterology Research and Practice

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Parkinsonrsquos Disease

Evidence-Based Complementary and Alternative Medicine

Volume 2014Hindawi Publishing Corporationhttpwwwhindawicom

2 Evidence-Based Complementary and Alternative Medicine

can result in the development of various chronic diseases suchas autoimmune disorders cancer and vascular diseases [5 6]Lipopolysaccharide (LPS) stimulates several proinflamma-tory mediator cytokines such as interferon interleukin-1120573(IL-1120573) interleukin-6 (IL-6) and tumor necrosis factor-120572(TNF-120572) [1 7 8]

During LPS-induced inflammation LPS binds to toll-likereceptor 4 (TLR4) and stimulates the recruitment of bothcytoplasmic MyD88 and TRIF adaptor proteins which acti-vate mitogen-activated protein kinase (MAPK) signaling [9]The MAPK family consists of extracellular signal-regulatedkinase (ERK) c-Jun N-terminal kinase (JNK) and p38 Con-tinual activation of the MAPK signaling pathway has beenshown to increase the activation of activator protein- (AP-) 1a heterodimeric transcription factor composed of c-Fos c-Jun ATF and JDP families [10] Activated AP-1 eventuallyupregulates the transcription of inflammatory genes contain-ing the 12-O-tetradecanoylphorbol-13-acetate (TPA) DNAresponse element (TRE 51015840-TGAGCTCA-31015840) [11] Indeed itis known that the development of numerous human inflam-matory diseases is accompanied with the activation of AP-1[12] Hence targeting MAPKAP-1 pathways is an attractiveanti-inflammatory therapeutic approach

Hepatitis a liver disease associated with severe hepa-tocyte damage is highly associated with acute or chronicinflammation caused by other infections alcohol ingestioncertain medications some industrial organic solvents andplants and autoimmune diseases [13 14] Liver inflammationrecruits numerous types of immune cells such as naturalkiller cells T cells dendritic cells andmacrophages [13] Likeother inflammatory diseases the hepatic macrophages dis-play prime pathophysiological roles in inducing liver injuryby enormous production of reactive oxygennitrogen speciesand proinflammatory cytokines such as TNF-120572 IL-1120573 andIL-6 [13] LPSD-galactosamine- (D-GalN-) induced hepati-tis in mice is a classical experimental model of severe liverinjury involving the production of inflammatory cytokinesand recruitment of inflammatory cells leading to liverdamage and dysfunction [15 16]

Persicaria chinensis L (Polygonaceae) is one of the rep-resentative medicinal plants that are widely used in tropicaland subtropical Eastern Asia [17] The Malaysian Chinesecommunity and Tamang community of Nepal have beenknown to prescribe this plant to treat various lung diseases[18 19] Malaysian communities and Indian tribes have usedthe methanolic extract of leaves to cope with infectiousdiseases and ulcers [17 20] In addition numerous previousstudies have reported the importance of P chinensis as ananti-inflammatory plant [18ndash20] but the molecular ethno-pharmacological evidence is still ambiguous Recently wedemonstrated that 95 methanol extract of the aerialparts of this plant (Pc-ME) can effectively ameliorateinflammatory responses in HClEtOH-induced gastritis andTLR4-activated macrophages through the suppression ofSykSrcNF-120581B [17] Previously it was stated that MAPKsplay an important role in the regulation of LPS-inducedinflammation by controlling AP-1 activation [21] and arestrongly linked to the induction of hepatitis [22 23] This

prompted us to further examine the molecular inhibitoryeffects of Pc-ME on the AP-1 pathway and we assumedthat this extract may be capable of attenuating hepatitissymptoms To conquer our hypothesis we used lipopolysac-charide- (LPS-) treated macrophages RAW2647 cell line andhuman pleurapleural effusion monocyte-like cell line U937and LPSD-GalN-induced hepatitis mouse model Holis-tic molecular approaches including reporter gene assaysimmunoprecipitation analysis and histopathological andhematopathological investigation were also used to confirmour assumption

2 Materials and Methods

21 Materials Quercetin 3-(45-dimethylthiazol-2-yl)-25-diphenyltetrazolium bromide (MTT) and lipopolysaccha-ride (LPS E coli 0111B4) were purchased from Sigma Chem-ical Co (St Louis MO USA) Luciferase constructs contain-ing promoters for AP-1 were a gift from Professor ChungHae Young (Pusan National University Pusan Korea) Fetalbovine serum (FBS) and RPMI1640 were obtained fromGibco (Grand Island NY USA) RAW2647 cells a BALBc-derived murine macrophage cell line (number TIB-71) U937cells a human pleurapleural effusionmonocyte-like cell line(number CRL-15932) and HEK293 cells a human embry-onic kidney cell line (number CRL-1573) were purchasedfromAmerican Tissue Culture Center (Rockville MD USA)Luciferase constructs containing binding sites for AP-1 wereused as reported previously [24 25] All other chemicals wereobtained from Sigma Phosphospecific or total antibodies tolaminAC c-Fos c-Jun ERK JNK p38MEK12MKK4 and120573-actin used in this studywere purchased fromCell SignalingTechnology (Beverly MA USA)

22 Pc-ME Preparation Pc-ME (Code number PBID110601) was obtained from the Plant Extract Bank in the PlantDiversity Research Center (Daejeon Korea httpextractkribbrekrextractfhtm e-mail mplantextkribbrekr) asreported previously [17]

23 Drug Treatment In case of cellular experiments Pc-MEprepared in 100 DMSO at a concentration of 100mgmLwas diluted with culture medium For animal experimentPc-ME (200mgkg) was resuspended in 1 sodium car-boxymethylcellulose (CMC) as reported previously [26] andLPS (10 120583gkg)D-GalN (1 gkg) was dissolved in phosphate-buffered saline (PBS)

24 In Vitro Studies241 Cell Culture The cancerous macrophage lineRAW2647 and human pleurapleural effusion monocyte-like cell line U937 were maintained in RPMI1640 whilehuman embryonic kidney cell line HEK293 was culturedin DMEM medium each supplemented with 10 heat-inactivated FBS glutamine and penicillinstreptomycin at37∘C during 5 CO

2 Before Pc-ME treatment U937 cells

were treated with PMA (20 nM) for 12 h

Evidence-Based Complementary and Alternative Medicine 3

Table 1 RT-PCR and real-time PCR primers used in this study

(a) RT-PCR primers

Name Sequence (51015840 to 31015840)

TNF-120572 F TTGACCTCAGCGCTGAGTTGR CCTGTAGCCCACGTCGTAGC

IL-6 F GGAAATCGTGGAAATGAGR GCTTAGGCATAACGCACT

IL-1120573 F CAGGATGAGGACATGAGCACR CTCTGCAGACTCAAACTCCA

GAPDH F CAA TGA ATA CGG CTA CAG CAA CR AGG GAG ATG CTC AGT GTT GG

(b) Real-time PCR primers

Name Sequence (51015840 to 31015840)

TNF-120572 F GAAAGCATGATCCGGGACGTGR GATGGCAGAGAGGAGGTTGAC

IL-6 F AAGCCAGAGCTGTGCAGATGAGTAR CTTGGTCACCGACGTCCTGT

IL-1120573 F CCGACCACCACTACAGCAAGR GGGCAGGGAACCAGCATCTT

GAPDH F TGGAAGGACTCATGACCACAR AGGGGTCTACATGGCAACTG

242 Cell Viability Test After preincubation of RAW2647HEK 293 andU937 cells (1 times 106 cellsmL) for 18 h Pc-ME (0100 200 and 300 120583gmL) was added to the cell suspensionsand incubated for 24 h The effect of Pc-ME on cell viabilitywas tested by a conventional MTT assay according toprevious reports [27 28] In brief at 3 h prior to culture ter-mination 10 120583L of MTT solutions (10mgmL in phosphate-buffered saline pH 74) was added and cells were continu-ously cultured until assay termination The incubation washalted by the addition of 15 sodium dodecyl sulphate toeach well to solubilize the formazan and absorbance at 570ndash630 nm (OD

570ndash630) was measured using a Spectramax 250microplate reader

243 mRNA Analysis by Semiquantitative Reverse Tran-scriptase-Polymerase Chain Reaction (RT-PCR) and Real-Time PCR To determine mRNA expression levels of proin-flammatory cytokine genes RAW2647 or U937 cells wereexposed to Pc-ME (0 100 and 300120583gmL) for 30min(RAW2647 cells) or 3 h (U937 cells) before incubation withLPS (1 120583gmL for RAW2647 cells and 10 120583gmL for U937cells) for 6 h (RAW2647 cells) or 12 h (U937 cells) TotalRNA was prepared with TRIzol reagent (Gibco) according tothe manufacturerrsquos instructions and stored at minus70∘C for lateruse Semiquantitative RT-PCR and real-time PCR reactionswere also carried out according to previous report [29] Theprimers (Bioneer Seoul Korea) used in this study are listedin Table 1

244 Plasmid Transfection and Luciferase Reporter GeneActivity Assay HEK293 cells (1 times 106 cellsmL in 12-wellplates) were transfected with plasmids (120573-galactosidase and

AP-1-Luc) under cotransfection with an inducing molecule(MyD88 TRIF or PMA) using the polyethyleneimine (PEI)method The cells were treated with Pc-ME (0 100 200and 300 120583gmL) or quercetin (0 20 40 and 80 120583M) for 12 huntil harvesting Luciferase activity was determined by theLuciferase Assay System (Promega Madison WI USA) aspreviously reported [30 31]

25 In Vivo Studies251 Animals Male C57BL6 mice (6ndash8 weeks old 17ndash21 g) were purchased from DAEHAN BIOLINK (ChungbukKorea) and were housed in groups of 6ndash8 mice under a12 h lightdark cycle (lights on at 6 am) Water and pelletdiets (Samyang Daejeon Korea) were supplied ad libitumAnimals were cared for in accordance with the guidelinesissued by theNational Institute ofHealth for the Care andUseof Laboratory Animals (NIH Publication 80-23 revised in1996) Studies were performed in accordance with guidelinesestablished by the Institutional Animal Care and Use Com-mittee at Sungkyunkwan University (Suwon Korea approvalID SKKUBBI 12-6-1)

252 LPSD-GalN-Induced Hepatitis Mouse Model Amodelof experimental liver inflammationwas induced by LPS injec-tion according to a previously publishedmethod [32] Brieflyfive-week-old C57BL6 mice were treated orally with Pc-ME(200mgkg) once a day for six days with the aid of cropneedles One hour after the final administration of Pc-MELPS (10 120583gkg) and D-GalN (1 gkg) were injected intraperi-toneally Each animal was anesthetized with an overdose ofurethane 1 hour after administration of hepatitis inducersand blood was collected by cardiac puncture The livers werethen excised and gently rinsed with PBS Serumwas obtainedby centrifugation of blood at 3000 rpm for 15min Thelevels of serum alanine aminotransferase (ALT) and aspartateaminotransferase (AST) were measured with a Roche Modu-lar spectrophotometric autoanalyzer

253 Histopathology The histopathological observation wasalso performed as previously described [33] Briefly tissuesamples taken from the liver of the mice at 8 h after challengewith LPS and D-GalN were fixed with 10 formalin in PBSand then embedded in paraffin Approximately 4 120583m thintissue sections were stained with hematoxylin and eosin forhistopathological examination

26 Preparation of Total Lysates Nuclear Extracts andImmunoblotting In vivo samples (liver tissues from micetreated with Pc-ME (0 and 200mgkg)) or in vitro samples(RAW2647 cells (5 times 106 cellsmL) stimulated with LPS forvarious time points (2 3 5 15 30 and 60min) in the presenceor absence of Pc-ME (0 to 300120583gmL) or PMA-treated U937cells stimulated with LPS for 30 and 60min during Pc-ME(0 and 300 120583gmL) exposure) were washed three times incold PBS with 1mM sodium orthovanadate and lysed by asonicator or a Tissuemizer in lysis buffer (20mM Tris-HClpH 74 2mM EDTA 2mM ethyleneglycotetraacetic acid50mM 120573-glycerophosphate 1mM sodium orthovanadate

4 Evidence-Based Complementary and Alternative Medicine

1mM dithiothreitol 1 Triton X-100 10 glycerol 10 120583gmLaprotinin 10 120583gmL pepstatin 1mM benzamide and 2mMPMSF) for 30min with rotation at 4∘CThe lysates were clari-fied by centrifugation at 16000timesg for 10min at 4∘Cand storedat minus20∘C until needed

Nuclear extracts were prepared in a three-step procedurewith RAW2647 cells stimulated with LPS for 15 30 60and 120min in the presence or absence of Pc-ME (0 and300 120583gmL) as reported previously [34] The cells werecollected with a rubber policeman washed with 1 times PBSand lysed in 500 120583L lysis buffer containing 50mM KCl 05Nonidet P-40 25mM HEPES (pH 78) 1mM phenylmethyl-sulfonyl fluoride 10 120583gmL leupeptin 20120583gmL aprotininand 100 120583M 14-dithiothreitol (DTT) on ice for 4min Celllysates were then centrifuged at 19326timesg for 1min in amicro-centrifuge In the second step the pellet (the nuclear fraction)waswashed once inwashing buffer whichwas the same as thelysis buffer but without Nonidet P-40 In the final step nucleiwere treated with an extraction buffer (lysis buffer containing500mM KCl and 10 glycerol) The nucleiextraction buffermixture was frozen at minus80∘C and then thawed on ice andcentrifuged at 19326timesg for 5min The supernatant wascollected as a nuclear extract

Soluble cell lysates or the nuclear extracts were immunob-lotted and total or phosphorylated protein levels of transcrip-tion factors (lamin AC c-Fos and c-Jun) ERK JNK p38MEK12 MKK4 and 120573-actin (as a control) were visualizedaccording to a previously published method [35]

27 Statistical Analysis All data are expressed as the mean plusmnstandard deviation (SD) of an experiment performed with six(Figures 1 2 and 6) or three (Figures 3 4 and 5) samples for invitro test and sixmice of each group for in vivo tests (Figure 5)Statistical comparisons were carried out by ANOVAScheffersquospost hoc test and Kruskal-WallisMann-Whitney tests A 119875value lt005 was considered statistically significant All statis-tical tests were performed with the computer program SPSS17 for Windows XP Similar results were found in an addi-tional independent set of in vitro and in vivo experimentsperformed under the same conditions

3 Results

31 Effect of Pc-ME on Cell Viability As shown in Figure 1the viability of RAW2647 HEK293 and U937 cells wasnot significantly affected by treatment with Pc-ME up to300 120583gmL compared with that of the cells receiving no LPStreatment

32 Effect of Pc-ME on the Transcriptional Activation of AP-1We next performed a transfection experiment with the AP-1-Luc construct and HEK293 cells and used luciferase assays toexaminewhether Pc-ME suppressed the functional activationof AP-1 We found that AP-1-mediated luciferase activity wasincreased by PMA treatment (up to 50-fold) or cotransfectionwith adaptormolecules TRIF (up to 45-fold) andMyD88 (upto 8-fold) whereas Pc-ME treatment significantly (119875 lt 001)and dose-dependently (100 200 and 300120583gmL) inhibited

Cel

l via

bilit

y (

of c

ontro

l)

2000 100 3000

20

40

60

80

100

120

RAW2647 cellsHEK293 cellsU937 cells

Pc-ME (120583gmL)

Figure 1 Cell viability of RAW2647 HEK293 and U937 cells wasdetermined using the MTT assay

this upregulation (Figure 2) suggesting that AP-1 activationis a major pharmacological target of Pc-ME

AP-1 transcription factor is known to have a major reg-ulatory role in inflammatory gene expression so we exam-ined the suppressive effect of Pc-Me on the activation andtranslocation of AP-1 after treatment with Pc-ME Figure 3(a)shows the increase in nuclear level of the AP-1 c-Fos subunitdue to time-dependent inhibition by Pc-ME (15 30 60 and120min) Similar time-dependent (30 and 60min) inhibitorypatterns of c-Fos expression were confirmed by whole lysateextraction from U937 cells (Figure 3(b))

33 Effects of Pc-ME on LPS-Induced Proinflammatory Cytok-ine Production Lee et al [33] and Feldmann [36] have sug-gested that TNF-120572 IL-1120573 and IL-6 are crucial mediators ofthe development of inflammatory diseases We further inves-tigated the effect of Pc-ME on proinflammatory gene expres-sion in RAW2647 cells and U937 cells after LPS treatmentRT-PCR results demonstrated a significant concentration-dependent decrease in LPS-induced upregulation of TNF-120572IL-1120573 and IL-6 mRNA levels in Pc-ME-treated RAW2647cells (Figure 3(c)) In parallel real-time PCR (Figures 3(d)to 3(f)) in U937 cells clearly showed that LPS was able toinduce the upregulation of proinflammatory cytokines suchas TNF-120572 up to 6460-fold IL-1120573 up to 1360-fold and IL-6 upto 20-fold whereas Pc-ME (300 120583gmL) strongly (119875 lt 001)inhibited this

34 Effect of Pc-ME on Upstream Signaling for AP-1 Acti-vation It has been reported [37] that phosphorylation ofMAPK (ERK JNK and p38) plays a pivotal role in theregulation of LPS-induced inflammatory mediators so weperformed Western blot analysis to determine the inhibitoryactivity of Pc-ME on proinflammatorymediators LPS signif-icantly elevated the phosphorylation of ERK JNK and p38whereas Pc-ME pretreatment strongly and time-dependently(5 15 30 and 60min) suppressed LPS-induced phospho-rylation of JNK and ERK but not that of p38 (Figure 4(a)

Evidence-Based Complementary and Alternative Medicine 5

Tag2 +minus

minus

minus

+minus

minus

+100

minus

+200

minus

+300

MyD88

0

2

4

6

8

10

lowastlowast lowastlowastlowastlowast

Pc-ME (120583gmL)

AP-1-

med

iate

d lu

cife

rase

ac

tivity

(fol

d in

crea

se)

(a)

pcDNA +minusminus

minus

+minus

minus

+100

minus

+200

minus

+300

TRIF

0

1

2

3

4

5

6

lowastlowast

lowastlowast

lowast

Pc-ME (120583gmL)

AP-1-

med

iate

d lu

cife

rase

ac

tivity

(fol

d in

crea

se)

(b)

0

10

20

30

40

50

60

minus

minus

+

minus

+100

+200

+300

lowastlowast

lowastlowast

Pc-ME (120583gmL)PMA (100nM)

AP-1-

med

iate

d lu

cife

rase

activ

ity (f

old

incr

ease

)

(c)

Figure 2 Effect of Pc-ME on the reporter gene assay The promoter binding activity of the transcription factor AP-1 was analyzed using areporter gene assay in HEK293 cells transfected with plasmid constructs AP-1-Luc (1 120583gmL) or 120573-gal (as a transfection control) with 1120583gmLof MyD88 (a) or TRIF (b) and 100 nM PMA (c) in the presence of Pc-ME Luciferase activity was measured using a luminometer lowastlowast119875 lt 001compared with control

left panel) in RAW2647 cells The right panel in Figure 4(a)shows that Pc-ME (50 100 200 and 300120583gmL) dose-dependently blocked the phosphorylation of ERK and JNKwhich validates our experimental findings and confirmsour expectations Upstream signaling enzymes (MEK12 andMKK4) contributing to ERK and JNK phosphorylation wereappreciably blocked by Pc-ME at 2 3 and 5min of LPS treat-ment (Figure 4(b)) which demonstrates that MEK12 andMKK4 might be targeted by Pc-ME in its AP-1-suppressiveanti-inflammatory actions in LPS-stimulated RAW2647cells In concurrence with our LPSD-GalN-treated micehepatitis experimental model the upregulation of phospho-rylated MKK4 and c-Fos in the liver tissue was markedlysuppressed by orally administered Pc-ME (Figure 5(d))

35 Hepatoprotective Effect of Pc-ME on LPSD-GalN-InducedLiver Injury in Mice We used a mouse model of LPSD-GalN-induced liver injury to investigate the in vivo hep-atoprotective effect of Pc-ME LPSD-GalN-triggered ALT

(14000UL) and AST (10000UL) protein levels were sig-nificantly (119875 lt 001) decreased by Pc-ME (Figures 5(a)and 5(b))Moreover histopathological analysis demonstratedthat the liver sections of the LPSD-GalN group displayedmore neutrophil recruitment as assessed by bigger sized andincreased numbers dark spots (see arrows in Figure 5(c))compared with the saline-treated control groups in contrastthe Pc-ME-treated groups exhibited lower neutrophil num-bers (Figure 5(c)) which demonstrates the strong hepatopro-tective activity of Pc-ME

36 Effect of Quercetin on AP-1 Activity Cotransfectionwith the adaptor molecule MyD88 enhanced AP-1-mediatedluciferase activity by 45-fold quercetin a major flavonoidfrom Pc-ME [17] significantly (119875 lt 001) and dose-dependently inhibited this upregulation (Figure 6) whichdemonstrates that AP-1 activation is amajor pharmacologicaltarget of Pc-ME and its ingredient quercetin

6 Evidence-Based Complementary and Alternative Medicine

Lamin AC

+

minus

+

300

+

minus

+

300

+

minus

+

300

+

minus

+

300

Nuclear fraction (RAW2647 cells)

minus

minus

c-Fos

c-Jun

Pc-ME (120583gmL)

15min 30min 60min 120min

LPS (1120583gmL)

(a)

+

minus

+

minus

+

300

U937 cells

minus

minus

+

300

p-c-Fos

c-Fos

Pc-ME (120583gmL)

30min 60min

120573-actin

LPS (10120583gmL)

(b)

minus

minus

+

minus

+

100

+

300

GAPDH

IL-6

Pc-ME (120583gmL)LPS (1120583gmL)

RAW2647 cells (6h)

TNF-120572

IL-1120573

(c)

0

1000

2000

3000

4000

5000

6000

7000

minus minus 300

lowastlowast

Pc-ME (120583gmL)

TNF-120572

expr

essio

n (r

elat

ive q

uant

ity)

U937 cells (12h)

LPS (10120583gmL)(d)

0

200

400

600

800

1000

1200

1400

1600

minus minus 300

lowastlowast

Pc-ME (120583gmL)

IL-1120573

expr

essio

n (r

elat

ive q

uant

ity)

LPS (10120583gmL)

U937 cells (12h)

(e)

0

5

10

15

20

25

IL-6

gen

e exp

ress

ion

(rel

ativ

e qua

ntity

)

minus minus 300

lowastlowast

Pc-ME (120583gmL)

U937 cells (12h)

LPS (10120583gmL)

(f)

Figure 3 Effect of Pc-ME on the activation of proinflammatory cytokines and transcriptional regulation (a) Levels of c-Fos c-Jun andlamin AC in nuclear fractions were determined by immunoblot analysis in RAW2647 cells (b) Phospho- or total protein levels of c-Fosand 120573-actin in cell lysates were determined by immunoblot analysis in U937 cells (c) mRNA levels of TNF-120572 IL-1120573 IL-6 and GAPDH weredetermined by semiquantitative RT-PCR in RAW2647 cells (dndashf) mRNA levels of TNF-120572 IL-1120573 and IL-6 were determined by real-timeRT-PCR in U937 cells

4 Discussion

While P chinensis has high ethnopharmacological worthin Eastern Asian countries the molecular mechanisms

underlying its anti-inflammatory activity are still unknownRecently our studies have revealed that P chinensismethanolextract exhibits strong antigastritis activity and is able toblock NF-120581B activation via suppression of Src and Syk

Evidence-Based Complementary and Alternative Medicine 7

15min 30min 60min5min RAW2647 cells (30min)

p-ERK

ERK

p-JNK

JNKp-JNK

ERK

p-ERK

p-p38

p38

JNK

RAW2647 cells

minus

minus

+

minus

+

50

+

100

+

200

+

300

minus

minus

+

minus

+

300

+

minus

+

300

+

minus

+

300

+

minus

+

300Pc-ME (120583gmL)LPS (1120583gmL)

Pc-ME (120583gmL)LPS (1120583gmL)

120573-actin

120573-actin

(a)

5min3min2minminus

minus

+

minus

+

300

+

minus

+

300

+

minus

+

300

p-MEK12

MEK12

MKK4

p-MKK4

RAW2647 cells

Pc-ME (120583gmL)LPS (1120583gmL)

120573-actin

(b)

Figure 4 Effect of Pc-ME on the activation of upstream signaling enzymes of AP-1 translocation (a and b) Phospho- and total protein levelsof ERK JNK p38 MEK12 MKK4 and 120573-actin in cell lysates were determined by immunoblotting analysis

activities [17] However SrcSyk-linked activation of NF-120581Bis not the only important regulatory loop of inflammatoryreaction In addition it has been reported that AP-1 activatedby MAPK plays another crucial roles in inflammatory reac-tion [11 38 39] In the present study therefore we aimed toelucidate inhibitory mechanism of Pc-ME on AP-1 functionin vitro and in vivo by using LPS-activated macrophages andLPSD-GalN-triggered hepatitis model

It has been shown that reporter gene luciferase assayperformed in conjunction with HEK293 cells transfectedwith Luc constructs and adaptor molecules essential for TLRsignaling [40] is a reasonable approach for studying func-tional activation of transcription factors [41 42] Thereforeto examine the ability of Pc-ME to suppress AP-1 functionwe first employed the luciferase assay using HEK293 cellstransfected with the AP-1-Luc construct As expected AP-1-mediated luciferase activity was enhanced up to 45- to485-fold by PMA treatment or cotransfection with adaptormolecules (TRIF and MyD88) and Pc-ME notably inhibitedthis upregulation in a dose-dependent manner (Figure 2)Moreover nuclear translocation of c-Fos was reduced by Pc-ME treatment in a time-dependent manner (Figure 3(a))

implying that AP-1 family of transcription factors can befunctionally inactivated and that their upstream kinasesresponsible for AP-1 phosphorylation can be targeted

Several earlier reports have suggested that several proin-flammatory cytokines such as TNF-120572 IL-1120573 and IL-6 playan important role in boosting proinflammatory roles ofmacrophages [43ndash45] We therefore further tested whetherthese proinflammatory cytokines can be also suppressedby Pc-ME using LPS-treated RAW2647 cells The mRNAanalysis of these cytokines by RT-PCR in RAW2647 cells(Figure 3(c)) and by real-time PCR in U937 cells (Figures3(d)ndash3(f)) revealed that mRNA levels of TNF-120572 IL-1120573 andIL-6 were strongly upregulated by LPS treatment while Pc-ME significantly and dose-dependently (100 and 300120583gmL)inhibited such upregulation indicating that AP-1 suppressionby Pc-ME may be associated with blockade of these proin-flammatory cytokines as well as its suppressive activity onthe expression of iNOS and COX-2 [17] In fact a number ofstudies have also reported thatmany knownherbalmedicinessuch as Polygonum hydropiper Pistacia integerrima Phase-olus angularis Morus bombycis Koidzumi and Sanguisorbaofficinalis possess AP-1 pathway inhibitory activity as their

8 Evidence-Based Complementary and Alternative Medicine

ALT

(UL

)

minus +0

5000

10000

15000

20000

25000

lowastlowast

Pc-ME (200mgkg)

LPS (10120583gkg)D-GalN (1mgkg)

(a)

AST

(UL

)

0

5000

10000

15000

20000

minus +

lowastlowast

Pc-ME (200mgkg)

LPS (10120583gkg)D-GalN (1mgkg)

(b)

HampE staining

Normal LPSD-GalN Pc-ME (200mgkg)

(c)

Liver lysate

minus

minus

+minus

++

MKK4

c-Fos

p-c-Fos

LPSD-GalN

p-MKK4

120573-actin

Pc-ME (200mgkg)

(d)

Figure 5 Effect of Pc-ME on LPSD-GalN-induced hepatitis in mice Mice were orally treated with Pc-ME (200mgkg) for six days beforeintraperitoneal injection of LPSD-GalN After 1 h mice were sacrificed to collect blood samples and liver sections for biochemical parameteranalysis of (a) ALT (b) AST and (c) histopathological examination (d) Phospho- or total protein levels of MKK4 c-Fos and 120573-actin in liverlysates were determined by immunoblot analysis

pharmacological target [26 46ndash49] Therefore the fact thatPc-ME is able to inhibit AP-1 pathway could be also acceptedas a general anti-inflammatory mechanism of this plant

As MAPKs play a vital role in the regulation of LPS-induced inflammation by controlling AP-1 activation [21] weexamine themolecular inhibitory effects of Pc-MEon theAP-1 pathway Toward this goal we analyzed the inhibitory effectof Pc-ME on MAPKs and their upstream signaling enzymes

[50]The results of our study demonstrated that Pc-ME treat-ment time-dependently (5 15 30 and 60min) blocked ERKand JNK phosphorylation (Figure 4(a) left panel) poten-tially leading to significant attenuation of AP-1 activationin response to LPS The dose-dependent (50 to 300 120583gmL)inhibition pattern of the same MAPK phosphorylation bythis extract (Figure 4(a) right panel) strongly supported ourexperimental condition and hypothesisThe phosphorylation

Evidence-Based Complementary and Alternative Medicine 9A

P-1-

med

iate

d lu

cife

rase

activ

ity (f

old

incr

ease

)

Tag2MyD88

0

1

2

3

4

5

+

minusminus

minus

+minus

minus

+20

minus

+40

minus

+80

lowastlowastlowastlowast

lowastlowast

Quercetin (120583M)

Figure 6 Effect of quercetin on the activation of upstream signalingenzymes of AP-1 in a reporter gene assay The promoter bindingactivity of the transcription factor AP-1 was analyzed using areporter gene assay in HEK293 cells transfected with plasmidconstructs AP-1-Luc (1 120583gmL) and 120573-gal (as a transfection control)with 1 120583gmL of MyD88 in the presence of quercetin Luciferaseactivity was measured using a luminometer lowastlowast119875 lt 001 comparedwith control

of MEK12 and MKK4 the upstream enzymes of ERK andJNK respectively was also strikingly suppressed by Pc-MEin LPS challenges of 2 3 and 5min (Figure 4(b)) confirmingthe MAPK inhibitory activity of this extract

MAPK activation and subsequent AP-1 activation arestrongly linked to the induction of hepatitis [22 23] Sowe guess that AP-1-inhibitory extract Pc-ME is capable ofattenuating hepatitis symptoms To test this hypothesis weemployed LPSD-GalN-intoxicated acute liver injury modelwhich is a classical system for screening hepatoprotectiveremedy in vivo [32] Our previous study indicating thatPc-ME can protect against HClEtOH-induced gastritis byinhibiting SrcSyk of NF-120581B [17] has demonstrated the oraleffectiveness of this extract In the present study expectedlyPc-ME treatment (200mgkg) effectively ameliorated theLPSD-GalN-induced liver damage (Figure 5(c)) includingreversion of LPSD-GalN-elevated hepatic ALT (Figure 5(a))and AST (Figure 5(b)) enzyme levels In the in vivo hepatictissue the upregulated phosphorylation of MKK4 and c-Fos(component of AP-1) was also noticeably blocked by Pc-MEtreatment (Figure 5(d)) which strongly authenticated ourfindings In addition quercetin a major antioxidative andanti-inflammatory compound of P chinensis [17] also drasti-cally diminished theAP-1 activation in a dose-dependent pat-tern (Figure 6) supporting that MAPKAP-1-targeted anti-inflammatory activity of Pc-ME could be quercetin-derivedanti-inflammatory action Although numerous numbers ofmedicinal plants or edible fruits such as Panax ginsengFagonia schweinfurthii fermented soybean Davilla ellipticaand Boesenbergia rotunda have been reported to show anti-hepatitis activities [51ndash55] only few plants are now clinicallyprescribed It was revealed that Pc-ME is able to stronglysuppress both NF-120581B [17] and AP-1 activity we will further

TLR4

LPS

Pc-ME

Tissue damage

MyD88

MAPK

ERK JNK

c-Fos

AP-1

TRIF

IL-6 IL-1120573

TNF-120572

TNF-120572

IL-6 IL-1120573

Figure 7 Putative mechanism of Pc-ME-mediated anti-inflam-matory responses

validate whether Pc-ME can be also clinically developed as anew antihepatitis herbal drug

In summary our in vivo and in vitro assays demonstratedthat Pc-ME significantly reduced the levels of LPS-mediatedproinflammatory cytokines (TNF-120572 IL-1120573 and IL-6) andthat MAPKAP-1 inactivation by this extract contributes tothese inhibitory effects as summarized in Figure 7The strongantihepatotoxic activity of Pc-ME in vivo was observed in amousemodel of LPSD-GalN-induced liver injury indicatingthat Pc-ME could potentially be used as a hepatoprotectiveremedy

Conflict of Interests

The authors report no conflict of interests The authors aloneare responsible for the content and writing of the paper

Authorsrsquo Contribution

Muhammad Jahangir Hossen and Seung Cheol Kim equallycontributed to this work

Acknowledgment

This study was supported by a grant of the Korean HealthTechnology RampD Project Ministry of Health amp WelfareRepublic of Korea (HI12C0050)

References

[1] C-K Tseng C-K Lin H-W Chang et al ldquoAqueous extractof Gracilaria tenuistipitata suppresses LPS-induced NF-120581Band MAPK activation in RAW 2647 and rat peritonealmacrophages and exerts hepatoprotective effects on carbon

10 Evidence-Based Complementary and Alternative Medicine

tetrachloride-treated ratrdquo PLoS ONE vol 9 no 1 Article IDe86557 2014

[2] H C Steel R Cockeran R Anderson and C Feldman ldquoOver-viewof community-acquired pneumonia and the role of inflam-matory mechanisms in the immunopathogenesis of severepneumococcal diseaserdquo Mediators of Inflammation vol 2013Article ID 490346 18 pages 2013

[3] M Pasparakis ldquoRegulation of tissue homeostasis by NF-Bsignalling implications for inflammatory diseasesrdquo NatureReviews Immunology vol 9 no 11 pp 778ndash788 2009

[4] J-K Kim and G-M Park ldquoIndirubin-3-monoxime exhibitsanti-inflammatory properties by down-regulating NF-120581Band JNK signaling pathways in lipopolysaccharide- treatedRAW2647 cellsrdquo Inflammation Research vol 61 no 4 pp319ndash325 2012

[5] MHamandAMoon ldquoInflammatory andmicroenvironmentalfactors involved in breast cancer progressionrdquo Archives ofPharmacal Research vol 36 no 12 pp 1419ndash1431 2013

[6] M-S Lee ldquoRole of innate immunity in diabetes and metab-olism recent progress in the study of inflammasomesrdquo ImmuneNetwork vol 11 no 2 pp 95ndash99 2011

[7] Y Ayele J-A Kim E Park et al ldquoA methanol extract of Adan-sonia digitata L leaves inhibits pro-inflammatory iNOS possi-bly via the inhibition of NF-120581B activationrdquo Biomolecules andTherapeutics vol 21 no 2 pp 146ndash152 2013

[8] D H Kim J H Chung J S Yoon et al ldquoGinsenoside Rdinhibits the expressions of iNOS andCOX-2 by suppressingNF-120581B in LPS-stimulated RAW2647 cells and mouse liverrdquo Journalof Ginseng Research vol 37 no 1 pp 54ndash63 2013

[9] M Fujihara M Muroi K-I Tanamoto T Suzuki H Azumaand H Ikeda ldquoMolecular mechanisms of macrophage activa-tion and deactivation by lipopolysaccharide roles of the recep-tor complexrdquo Pharmacology and Therapeutics vol 100 no 2pp 171ndash194 2003

[10] T Yu Y J Li A H Bian et al ldquoThe regulatory role of activat-ing transcription factor 2 in inflammationrdquoMediators of Inflam-mation vol 2014 Article ID 950472 10 pages 2014

[11] I-T Lee and C-M Yang ldquoInflammatory signalings involvedin airway and pulmonary diseasesrdquoMediators of Inflammationvol 2013 Article ID 791231 12 pages 2013

[12] E D Chan and D W H Riches ldquoIFN-120574 + LPS induction ofiNOS is modulated by ERK JNKSAPK and p38mapk in amouse macrophage cell linerdquo The American Journal of Physi-ologymdashCell Physiology vol 280 no 3 pp C441ndashC450 2001

[13] I N Crispe ldquoThe liver as a lymphoid organrdquo Annual Review ofImmunology vol 27 pp 147ndash163 2009

[14] F Tacke T Luedde and C Trautwein ldquoInflammatory pathwaysin liver homeostasis and liver injuryrdquoClinical Reviews in Allergyamp Immunology vol 36 no 1 pp 4ndash12 2009

[15] M Y Jia Y P Jing Q Ai et al ldquoPotential role of catalase inmicewith lipopolysaccharideD-galactosamine-induced fulminantliver injuryrdquo Hepatology Research vol 44 no 11 pp 1151ndash11582014

[16] Q Ai Y Jing R Jiang et al ldquoRotenone a mitochondrial res-piratory complex i inhibitor ameliorates lipopolysaccharideD-galactosamine-induced fulminant hepatitis in micerdquo Interna-tional Immunopharmacology vol 21 no 1 pp 200ndash207 2014

[17] M J Hossen K-S Baek E Kim et al ldquoIn vivo and in vitroanti-inflammatory activities of Persicaria chinensis methanolicextract targeting SrcSykNF-120581Brdquo Journal of Ethnopharmacol-ogy vol 159 pp 9ndash16 2015

[18] D R Luitel M B Rokaya B Timsina and Z MunzbergovaldquoMedicinal plants used by the Tamang community in theMakawanpur district of central Nepalrdquo Journal of Ethnobiologyand Ethnomedicine vol 10 no 1 article 5 2014

[19] W M May The reproductive biology and cytotoxic activity ofpersicaria chinensis (L) H gross var chinensis (Polygonaceae)[Dissertation] University of Malaya 2012

[20] S M Lai D Sudhahar and K Anandarajagopal ldquoEvaluationof antibacterial and antifungal activities of Persicaria chinensisleavesrdquo International Journal of Pharmaceutical Sciences ampResearch vol 3 p 8 2012

[21] B Veres B Radnai F Gallyas Jr et al ldquoRegulation of kinase cas-cades and transcription factors by a poly(ADP-ribose) polym-erase-1 inhibitor 4-hydroxyquinazoline in lipopolysaccharide-induced inflammation in micerdquo Journal of Pharmacology andExperimental Therapeutics vol 310 no 1 pp 247ndash255 2004

[22] M Panteva H Korkaya and S Jameel ldquoHepatitis viruses andthe MAPK pathway is this a survival strategyrdquo Virus Researchvol 92 no 2 pp 131ndash140 2003

[23] A Laliena B S Miguel I Crespo M Alvarez J Gonzalez-Gallego and M J Tunon ldquoMelatonin attenuates inflammationand promotes regeneration in rabbits with fulminant hepatitisof viral originrdquo Journal of Pineal Research vol 53 no 3 pp 270ndash278 2012

[24] S E Byeon T Yu Y Yang et al ldquoHydroquinone regulateshemeoxygenase-1 expression via modulation of Src kinaseactivity through thiolation of cysteine residuesrdquo Free RadicalBiology and Medicine vol 57 pp 105ndash118 2013

[25] S E Byeon T Yu Y Yang et al ldquoHydroquinone regulateshemeoxygenase-1 expression via modulation of Src kinaseactivity through thiolation of cysteine residuesrdquo Free RadicalBiology and Medicine vol 57 pp 105ndash118 2013

[26] Y Yang T Yu H-J Jang et al ldquoIn vitro and in vivo anti-inflammatory activities of Polygonum hydropiper methanolextractrdquo Journal of Ethnopharmacology vol 139 no 2 pp 616ndash625 2012

[27] M-Y Kim and J Y Cho ldquo20S-dihydroprotopanaxadiol aginsenoside derivative boosts innate immune responses ofmonocytes and macrophagesrdquo Journal of Ginseng Research vol37 no 3 pp 293ndash299 2013

[28] E H Jho K Kang S Oidovsambuu et al ldquoGymnaster koraien-sis and its major components 35-di-O-caffeoylquinic acid andgymnasterkoreayne B reduce oxidative damage induced bytert-butyl hydroperoxide or acetaminophen in hepG2 cellsrdquoBMB Reports vol 46 no 10 pp 513ndash518 2013

[29] Y Yang T Yu Y G Lee et al ldquoMethanol extract ofHopea odor-ata suppresses inflammatory responses via the direct inhibitionof multiple kinasesrdquo Journal of Ethnopharmacology vol 145 no2 pp 598ndash607 2013

[30] S Sun Back J Kim D Choi E S Lee S Y Choi and K HanldquoCooperative transcriptional activation of ATP-binding cassettesterol transporters ABCG5 and ABCG8 genes by nuclear recep-tors including Liver-X-Receptorrdquo BMB Reports vol 46 no 6pp 322ndash327 2013

[31] C Liang Y Ding S B Song et al ldquoOleanane-triterpenoidsfrom Panax stipuleanatus inhibit NF-120581Brdquo Journal of GinsengResearch vol 37 no 1 pp 74ndash79 2013

[32] J Y Cho J D Yeon J Y Kim E S Yoo YH Yu andMH ParkldquoHepatoprotection by human epidermal growth factor (hEGF)against experimental hepatitis induced byD-galactosamine (D-GalN) or D-GalNlipopolysacchariderdquo Biological amp Pharma-ceutical Bulletin vol 23 no 10 pp 1243ndash1246 2000

Evidence-Based Complementary and Alternative Medicine 11

[33] C-W Lee F-L Yen H-W Huang et al ldquoResveratrol nanopar-ticle system improves dissolution properties and enhances thehepatoprotective effect of resveratrol through antioxidant andanti-inflammatory pathwaysrdquo Journal of Agricultural and FoodChemistry vol 60 no 18 pp 4662ndash4671 2012

[34] T Yu J Lee Y G Lee et al ldquoIn vitro and in vivo anti-inflam-matory effects of ethanol extract from Acer tegmentosumrdquoJournal of Ethnopharmacology vol 128 no 1 pp 139ndash147 2010

[35] Y-H Jeong J-W Hyun T K van Le D-H Kim and H-SKim ldquoKalopanaxsaponin A exerts anti-inflammatory effects inlipopolysaccharide-stimulated microglia via inhibition of JNKand NF-120581BAP-1 pathwaysrdquo Biomolecules andTherapeutics vol21 no 5 pp 332ndash337 2013

[36] M Feldmann ldquoMany cytokines are very useful therapeutictargets in diseaserdquoThe Journal of Clinical Investigation vol 118no 11 pp 3533ndash3536 2008

[37] B Kaminska ldquoMAPK signalling pathways as molecular targetsfor anti-inflammatory therapymdashfrom molecular mechanismsto therapeutic benefitsrdquoBiochimica et Biophysica ActamdashProteinsand Proteomics vol 1754 no 1-2 pp 253ndash262 2005

[38] Y Yang S C Kim T Yu et al ldquoFunctional roles of p38mitogen-activated protein kinase in macrophage-mediated inflamma-tory responsesrdquoMediators of Inflammation vol 2014 Article ID352371 13 pages 2014

[39] Y Yang J Lee M H Rhee et al ldquoMolecular mechanism ofprotopanaxadiol saponin fraction-mediated anti-inflammatoryactionsrdquo Journal of Ginseng Research vol 39 no 1 pp 61ndash682015

[40] L A J OrsquoNeill K A Fitzgerald and A G Bowie ldquoThe Toll-IL-1 receptor adaptor family grows to five membersrdquo Trends inImmunology vol 24 no 6 pp 286ndash289 2003

[41] S E Byeon J Lee B C Yoo et al ldquoP38-targeted inhibition ofinterleukin-12 expression by ethanol extract from Cordycepsbassiana in lipopolysaccharide-activated macrophagesrdquo Immu-nopharmacology and Immunotoxicology vol 33 no 1 pp 90ndash96 2011

[42] M H Kim D S Yoo S Y Lee et al ldquoThe TRIFTBK1IRF-3activation pathway is the primary inhibitory target of resver-atrol contributing to its broad-spectrum anti-inflammatoryeffectsrdquo Pharmazie vol 66 no 4 pp 293ndash300 2011

[43] S Ghosh and M S Hayden ldquoNew regulators of NF-120581B ininflammationrdquo Nature Reviews Immunology vol 8 no 11 pp837ndash848 2008

[44] R Medzhitov and T Horng ldquoTranscriptional control of theinflammatory responserdquoNature Reviews Immunology vol 9 no10 pp 692ndash703 2009

[45] T Kawai and S Akira ldquoToll-like receptors and their crosstalkwith other innate receptors in infection and immunityrdquo Immu-nity vol 34 no 5 pp 637ndash650 2011

[46] K Mehla S Balwani A Kulshreshtha D Nandi P Jaisankarand B Ghosh ldquoEthyl gallate isolated from Pistacia integerrimaLinn inhibits cell adhesion molecules by blocking AP-1 tran-scription factorrdquo Journal of Ethnopharmacology vol 137 no 3pp 1345ndash1352 2011

[47] T Yu H M Ahn T Shen et al ldquoAnti-inflammatory activity ofethanol extract derived fromPhaseolus angularis beansrdquo Journalof Ethnopharmacology vol 137 no 3 pp 1197ndash1206 2011

[48] H S Kim A-R Kim H J Park et al ldquoMorus bombycis Koid-zumi extract suppresses collagen-induced arthritis by inhibitingthe activation of nuclear factor-120581B and activator protein-1 inmicerdquo Journal of Ethnopharmacology vol 136 no 3 pp 392ndash398 2011

[49] T Yu Y J Lee H M Yang et al ldquoInhibitory effect of San-guisorba officinalis ethanol extract onNO and PGE

2production

is mediated by suppression of NF-120581B and AP-1 activationsignaling cascaderdquo Journal of Ethnopharmacology vol 134 no1 pp 11ndash17 2011

[50] M Guha and N Mackman ldquoLPS induction of gene expressionin human monocytesrdquo Cellular Signalling vol 13 no 2 pp 85ndash94 2001

[51] S-J Seo J Y Cho Y H Jeong and Y-S Choi ldquoEffect of Koreanred ginseng extract on liver damage induced by shorttermand long-term ethanol treatment in ratsrdquo Journal of GinsengResearch vol 37 no 2 pp 194ndash200 2013

[52] A Pareek A Godavarthi R Issarani and B P Nagori ldquoAntiox-idant and hepatoprotective activity of Fagonia schweinfurthii(Hadidi) Hadidi extract in carbon tetrachloride induced hep-atotoxicity in HepG2 cell line and ratsrdquo Journal of Ethnophar-macology vol 150 no 3 pp 973ndash981 2013

[53] H Mohd Yusof N M Ali S K Yeap et al ldquoHepatoprotectiveeffect of fermented soybean (nutrient enriched soybean tem-peh) against alcohol-induced liver damage in micerdquo Evidence-Based Complementary and Alternative Medicine vol 2013Article ID 274274 8 pages 2013

[54] J J Campos A De Oliveira Azevedo J D De Souza FilhoA Castro Perez and F Castro Braga ldquoBioguided isolation ofmyricetin-3-O-120573-galactopyranoside with antinociceptive activ-ity from the aerial part of Davilla elliptica St-Hilrdquo Journal ofEthnopharmacology vol 150 no 1 pp 270ndash274 2013

[55] S M Salama M A Abdulla A S Alrashdi and A H A HadildquoMechanism of hepatoprotective effect of Boesenbergia rotundain thioacetamide-induced liver damage in ratsrdquo Evidence-basedComplementary and Alternative Medicine vol 2013 Article ID157456 13 pages 2013

Submit your manuscripts athttpwwwhindawicom

Stem CellsInternational

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

MEDIATORSINFLAMMATION

of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Behavioural Neurology

EndocrinologyInternational Journal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Disease Markers

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

BioMed Research International

OncologyJournal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Oxidative Medicine and Cellular Longevity

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

PPAR Research

The Scientific World JournalHindawi Publishing Corporation httpwwwhindawicom Volume 2014

Immunology ResearchHindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Journal of

ObesityJournal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Computational and Mathematical Methods in Medicine

OphthalmologyJournal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Diabetes ResearchJournal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Research and TreatmentAIDS

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Gastroenterology Research and Practice

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Parkinsonrsquos Disease

Evidence-Based Complementary and Alternative Medicine

Volume 2014Hindawi Publishing Corporationhttpwwwhindawicom

Evidence-Based Complementary and Alternative Medicine 3

Table 1 RT-PCR and real-time PCR primers used in this study

(a) RT-PCR primers

Name Sequence (51015840 to 31015840)

TNF-120572 F TTGACCTCAGCGCTGAGTTGR CCTGTAGCCCACGTCGTAGC

IL-6 F GGAAATCGTGGAAATGAGR GCTTAGGCATAACGCACT

IL-1120573 F CAGGATGAGGACATGAGCACR CTCTGCAGACTCAAACTCCA

GAPDH F CAA TGA ATA CGG CTA CAG CAA CR AGG GAG ATG CTC AGT GTT GG

(b) Real-time PCR primers

Name Sequence (51015840 to 31015840)

TNF-120572 F GAAAGCATGATCCGGGACGTGR GATGGCAGAGAGGAGGTTGAC

IL-6 F AAGCCAGAGCTGTGCAGATGAGTAR CTTGGTCACCGACGTCCTGT

IL-1120573 F CCGACCACCACTACAGCAAGR GGGCAGGGAACCAGCATCTT

GAPDH F TGGAAGGACTCATGACCACAR AGGGGTCTACATGGCAACTG

242 Cell Viability Test After preincubation of RAW2647HEK 293 andU937 cells (1 times 106 cellsmL) for 18 h Pc-ME (0100 200 and 300 120583gmL) was added to the cell suspensionsand incubated for 24 h The effect of Pc-ME on cell viabilitywas tested by a conventional MTT assay according toprevious reports [27 28] In brief at 3 h prior to culture ter-mination 10 120583L of MTT solutions (10mgmL in phosphate-buffered saline pH 74) was added and cells were continu-ously cultured until assay termination The incubation washalted by the addition of 15 sodium dodecyl sulphate toeach well to solubilize the formazan and absorbance at 570ndash630 nm (OD

570ndash630) was measured using a Spectramax 250microplate reader

243 mRNA Analysis by Semiquantitative Reverse Tran-scriptase-Polymerase Chain Reaction (RT-PCR) and Real-Time PCR To determine mRNA expression levels of proin-flammatory cytokine genes RAW2647 or U937 cells wereexposed to Pc-ME (0 100 and 300120583gmL) for 30min(RAW2647 cells) or 3 h (U937 cells) before incubation withLPS (1 120583gmL for RAW2647 cells and 10 120583gmL for U937cells) for 6 h (RAW2647 cells) or 12 h (U937 cells) TotalRNA was prepared with TRIzol reagent (Gibco) according tothe manufacturerrsquos instructions and stored at minus70∘C for lateruse Semiquantitative RT-PCR and real-time PCR reactionswere also carried out according to previous report [29] Theprimers (Bioneer Seoul Korea) used in this study are listedin Table 1

244 Plasmid Transfection and Luciferase Reporter GeneActivity Assay HEK293 cells (1 times 106 cellsmL in 12-wellplates) were transfected with plasmids (120573-galactosidase and

AP-1-Luc) under cotransfection with an inducing molecule(MyD88 TRIF or PMA) using the polyethyleneimine (PEI)method The cells were treated with Pc-ME (0 100 200and 300 120583gmL) or quercetin (0 20 40 and 80 120583M) for 12 huntil harvesting Luciferase activity was determined by theLuciferase Assay System (Promega Madison WI USA) aspreviously reported [30 31]

25 In Vivo Studies251 Animals Male C57BL6 mice (6ndash8 weeks old 17ndash21 g) were purchased from DAEHAN BIOLINK (ChungbukKorea) and were housed in groups of 6ndash8 mice under a12 h lightdark cycle (lights on at 6 am) Water and pelletdiets (Samyang Daejeon Korea) were supplied ad libitumAnimals were cared for in accordance with the guidelinesissued by theNational Institute ofHealth for the Care andUseof Laboratory Animals (NIH Publication 80-23 revised in1996) Studies were performed in accordance with guidelinesestablished by the Institutional Animal Care and Use Com-mittee at Sungkyunkwan University (Suwon Korea approvalID SKKUBBI 12-6-1)

252 LPSD-GalN-Induced Hepatitis Mouse Model Amodelof experimental liver inflammationwas induced by LPS injec-tion according to a previously publishedmethod [32] Brieflyfive-week-old C57BL6 mice were treated orally with Pc-ME(200mgkg) once a day for six days with the aid of cropneedles One hour after the final administration of Pc-MELPS (10 120583gkg) and D-GalN (1 gkg) were injected intraperi-toneally Each animal was anesthetized with an overdose ofurethane 1 hour after administration of hepatitis inducersand blood was collected by cardiac puncture The livers werethen excised and gently rinsed with PBS Serumwas obtainedby centrifugation of blood at 3000 rpm for 15min Thelevels of serum alanine aminotransferase (ALT) and aspartateaminotransferase (AST) were measured with a Roche Modu-lar spectrophotometric autoanalyzer

253 Histopathology The histopathological observation wasalso performed as previously described [33] Briefly tissuesamples taken from the liver of the mice at 8 h after challengewith LPS and D-GalN were fixed with 10 formalin in PBSand then embedded in paraffin Approximately 4 120583m thintissue sections were stained with hematoxylin and eosin forhistopathological examination

26 Preparation of Total Lysates Nuclear Extracts andImmunoblotting In vivo samples (liver tissues from micetreated with Pc-ME (0 and 200mgkg)) or in vitro samples(RAW2647 cells (5 times 106 cellsmL) stimulated with LPS forvarious time points (2 3 5 15 30 and 60min) in the presenceor absence of Pc-ME (0 to 300120583gmL) or PMA-treated U937cells stimulated with LPS for 30 and 60min during Pc-ME(0 and 300 120583gmL) exposure) were washed three times incold PBS with 1mM sodium orthovanadate and lysed by asonicator or a Tissuemizer in lysis buffer (20mM Tris-HClpH 74 2mM EDTA 2mM ethyleneglycotetraacetic acid50mM 120573-glycerophosphate 1mM sodium orthovanadate

4 Evidence-Based Complementary and Alternative Medicine

1mM dithiothreitol 1 Triton X-100 10 glycerol 10 120583gmLaprotinin 10 120583gmL pepstatin 1mM benzamide and 2mMPMSF) for 30min with rotation at 4∘CThe lysates were clari-fied by centrifugation at 16000timesg for 10min at 4∘Cand storedat minus20∘C until needed

Nuclear extracts were prepared in a three-step procedurewith RAW2647 cells stimulated with LPS for 15 30 60and 120min in the presence or absence of Pc-ME (0 and300 120583gmL) as reported previously [34] The cells werecollected with a rubber policeman washed with 1 times PBSand lysed in 500 120583L lysis buffer containing 50mM KCl 05Nonidet P-40 25mM HEPES (pH 78) 1mM phenylmethyl-sulfonyl fluoride 10 120583gmL leupeptin 20120583gmL aprotininand 100 120583M 14-dithiothreitol (DTT) on ice for 4min Celllysates were then centrifuged at 19326timesg for 1min in amicro-centrifuge In the second step the pellet (the nuclear fraction)waswashed once inwashing buffer whichwas the same as thelysis buffer but without Nonidet P-40 In the final step nucleiwere treated with an extraction buffer (lysis buffer containing500mM KCl and 10 glycerol) The nucleiextraction buffermixture was frozen at minus80∘C and then thawed on ice andcentrifuged at 19326timesg for 5min The supernatant wascollected as a nuclear extract

Soluble cell lysates or the nuclear extracts were immunob-lotted and total or phosphorylated protein levels of transcrip-tion factors (lamin AC c-Fos and c-Jun) ERK JNK p38MEK12 MKK4 and 120573-actin (as a control) were visualizedaccording to a previously published method [35]

27 Statistical Analysis All data are expressed as the mean plusmnstandard deviation (SD) of an experiment performed with six(Figures 1 2 and 6) or three (Figures 3 4 and 5) samples for invitro test and sixmice of each group for in vivo tests (Figure 5)Statistical comparisons were carried out by ANOVAScheffersquospost hoc test and Kruskal-WallisMann-Whitney tests A 119875value lt005 was considered statistically significant All statis-tical tests were performed with the computer program SPSS17 for Windows XP Similar results were found in an addi-tional independent set of in vitro and in vivo experimentsperformed under the same conditions

3 Results

31 Effect of Pc-ME on Cell Viability As shown in Figure 1the viability of RAW2647 HEK293 and U937 cells wasnot significantly affected by treatment with Pc-ME up to300 120583gmL compared with that of the cells receiving no LPStreatment

32 Effect of Pc-ME on the Transcriptional Activation of AP-1We next performed a transfection experiment with the AP-1-Luc construct and HEK293 cells and used luciferase assays toexaminewhether Pc-ME suppressed the functional activationof AP-1 We found that AP-1-mediated luciferase activity wasincreased by PMA treatment (up to 50-fold) or cotransfectionwith adaptormolecules TRIF (up to 45-fold) andMyD88 (upto 8-fold) whereas Pc-ME treatment significantly (119875 lt 001)and dose-dependently (100 200 and 300120583gmL) inhibited

Cel

l via

bilit

y (

of c

ontro

l)

2000 100 3000

20

40

60

80

100

120

RAW2647 cellsHEK293 cellsU937 cells

Pc-ME (120583gmL)

Figure 1 Cell viability of RAW2647 HEK293 and U937 cells wasdetermined using the MTT assay

this upregulation (Figure 2) suggesting that AP-1 activationis a major pharmacological target of Pc-ME

AP-1 transcription factor is known to have a major reg-ulatory role in inflammatory gene expression so we exam-ined the suppressive effect of Pc-Me on the activation andtranslocation of AP-1 after treatment with Pc-ME Figure 3(a)shows the increase in nuclear level of the AP-1 c-Fos subunitdue to time-dependent inhibition by Pc-ME (15 30 60 and120min) Similar time-dependent (30 and 60min) inhibitorypatterns of c-Fos expression were confirmed by whole lysateextraction from U937 cells (Figure 3(b))

33 Effects of Pc-ME on LPS-Induced Proinflammatory Cytok-ine Production Lee et al [33] and Feldmann [36] have sug-gested that TNF-120572 IL-1120573 and IL-6 are crucial mediators ofthe development of inflammatory diseases We further inves-tigated the effect of Pc-ME on proinflammatory gene expres-sion in RAW2647 cells and U937 cells after LPS treatmentRT-PCR results demonstrated a significant concentration-dependent decrease in LPS-induced upregulation of TNF-120572IL-1120573 and IL-6 mRNA levels in Pc-ME-treated RAW2647cells (Figure 3(c)) In parallel real-time PCR (Figures 3(d)to 3(f)) in U937 cells clearly showed that LPS was able toinduce the upregulation of proinflammatory cytokines suchas TNF-120572 up to 6460-fold IL-1120573 up to 1360-fold and IL-6 upto 20-fold whereas Pc-ME (300 120583gmL) strongly (119875 lt 001)inhibited this

34 Effect of Pc-ME on Upstream Signaling for AP-1 Acti-vation It has been reported [37] that phosphorylation ofMAPK (ERK JNK and p38) plays a pivotal role in theregulation of LPS-induced inflammatory mediators so weperformed Western blot analysis to determine the inhibitoryactivity of Pc-ME on proinflammatorymediators LPS signif-icantly elevated the phosphorylation of ERK JNK and p38whereas Pc-ME pretreatment strongly and time-dependently(5 15 30 and 60min) suppressed LPS-induced phospho-rylation of JNK and ERK but not that of p38 (Figure 4(a)

Evidence-Based Complementary and Alternative Medicine 5

Tag2 +minus

minus

minus

+minus

minus

+100

minus

+200

minus

+300

MyD88

0

2

4

6

8

10

lowastlowast lowastlowastlowastlowast

Pc-ME (120583gmL)

AP-1-

med

iate

d lu

cife

rase

ac

tivity

(fol

d in

crea

se)

(a)

pcDNA +minusminus

minus

+minus

minus

+100

minus

+200

minus

+300

TRIF

0

1

2

3

4

5

6

lowastlowast

lowastlowast

lowast

Pc-ME (120583gmL)

AP-1-

med

iate

d lu

cife

rase

ac

tivity

(fol

d in

crea

se)

(b)

0

10

20

30

40

50

60

minus

minus

+

minus

+100

+200

+300

lowastlowast

lowastlowast

Pc-ME (120583gmL)PMA (100nM)

AP-1-

med

iate

d lu

cife

rase

activ

ity (f

old

incr

ease

)

(c)

Figure 2 Effect of Pc-ME on the reporter gene assay The promoter binding activity of the transcription factor AP-1 was analyzed using areporter gene assay in HEK293 cells transfected with plasmid constructs AP-1-Luc (1 120583gmL) or 120573-gal (as a transfection control) with 1120583gmLof MyD88 (a) or TRIF (b) and 100 nM PMA (c) in the presence of Pc-ME Luciferase activity was measured using a luminometer lowastlowast119875 lt 001compared with control

left panel) in RAW2647 cells The right panel in Figure 4(a)shows that Pc-ME (50 100 200 and 300120583gmL) dose-dependently blocked the phosphorylation of ERK and JNKwhich validates our experimental findings and confirmsour expectations Upstream signaling enzymes (MEK12 andMKK4) contributing to ERK and JNK phosphorylation wereappreciably blocked by Pc-ME at 2 3 and 5min of LPS treat-ment (Figure 4(b)) which demonstrates that MEK12 andMKK4 might be targeted by Pc-ME in its AP-1-suppressiveanti-inflammatory actions in LPS-stimulated RAW2647cells In concurrence with our LPSD-GalN-treated micehepatitis experimental model the upregulation of phospho-rylated MKK4 and c-Fos in the liver tissue was markedlysuppressed by orally administered Pc-ME (Figure 5(d))

35 Hepatoprotective Effect of Pc-ME on LPSD-GalN-InducedLiver Injury in Mice We used a mouse model of LPSD-GalN-induced liver injury to investigate the in vivo hep-atoprotective effect of Pc-ME LPSD-GalN-triggered ALT

(14000UL) and AST (10000UL) protein levels were sig-nificantly (119875 lt 001) decreased by Pc-ME (Figures 5(a)and 5(b))Moreover histopathological analysis demonstratedthat the liver sections of the LPSD-GalN group displayedmore neutrophil recruitment as assessed by bigger sized andincreased numbers dark spots (see arrows in Figure 5(c))compared with the saline-treated control groups in contrastthe Pc-ME-treated groups exhibited lower neutrophil num-bers (Figure 5(c)) which demonstrates the strong hepatopro-tective activity of Pc-ME

36 Effect of Quercetin on AP-1 Activity Cotransfectionwith the adaptor molecule MyD88 enhanced AP-1-mediatedluciferase activity by 45-fold quercetin a major flavonoidfrom Pc-ME [17] significantly (119875 lt 001) and dose-dependently inhibited this upregulation (Figure 6) whichdemonstrates that AP-1 activation is amajor pharmacologicaltarget of Pc-ME and its ingredient quercetin

6 Evidence-Based Complementary and Alternative Medicine

Lamin AC

+

minus

+

300

+

minus

+

300

+

minus

+

300

+

minus

+

300

Nuclear fraction (RAW2647 cells)

minus

minus

c-Fos

c-Jun

Pc-ME (120583gmL)

15min 30min 60min 120min

LPS (1120583gmL)

(a)

+

minus

+

minus

+

300

U937 cells

minus

minus

+

300

p-c-Fos

c-Fos

Pc-ME (120583gmL)

30min 60min

120573-actin

LPS (10120583gmL)

(b)

minus

minus

+

minus

+

100

+

300

GAPDH

IL-6

Pc-ME (120583gmL)LPS (1120583gmL)

RAW2647 cells (6h)

TNF-120572

IL-1120573

(c)

0

1000

2000

3000

4000

5000

6000

7000

minus minus 300

lowastlowast

Pc-ME (120583gmL)

TNF-120572

expr

essio

n (r

elat

ive q

uant

ity)

U937 cells (12h)

LPS (10120583gmL)(d)

0

200

400

600

800

1000

1200

1400

1600

minus minus 300

lowastlowast

Pc-ME (120583gmL)

IL-1120573

expr

essio

n (r

elat

ive q

uant

ity)

LPS (10120583gmL)

U937 cells (12h)

(e)

0

5

10

15

20

25

IL-6

gen

e exp

ress

ion

(rel

ativ

e qua

ntity

)

minus minus 300

lowastlowast

Pc-ME (120583gmL)

U937 cells (12h)

LPS (10120583gmL)

(f)

Figure 3 Effect of Pc-ME on the activation of proinflammatory cytokines and transcriptional regulation (a) Levels of c-Fos c-Jun andlamin AC in nuclear fractions were determined by immunoblot analysis in RAW2647 cells (b) Phospho- or total protein levels of c-Fosand 120573-actin in cell lysates were determined by immunoblot analysis in U937 cells (c) mRNA levels of TNF-120572 IL-1120573 IL-6 and GAPDH weredetermined by semiquantitative RT-PCR in RAW2647 cells (dndashf) mRNA levels of TNF-120572 IL-1120573 and IL-6 were determined by real-timeRT-PCR in U937 cells

4 Discussion

While P chinensis has high ethnopharmacological worthin Eastern Asian countries the molecular mechanisms

underlying its anti-inflammatory activity are still unknownRecently our studies have revealed that P chinensismethanolextract exhibits strong antigastritis activity and is able toblock NF-120581B activation via suppression of Src and Syk

Evidence-Based Complementary and Alternative Medicine 7

15min 30min 60min5min RAW2647 cells (30min)

p-ERK

ERK

p-JNK

JNKp-JNK

ERK

p-ERK

p-p38

p38

JNK

RAW2647 cells

minus

minus

+

minus

+

50

+

100

+

200

+

300

minus

minus

+

minus

+

300

+

minus

+

300

+

minus

+

300

+

minus

+

300Pc-ME (120583gmL)LPS (1120583gmL)

Pc-ME (120583gmL)LPS (1120583gmL)

120573-actin

120573-actin

(a)

5min3min2minminus

minus

+

minus

+

300

+

minus

+

300

+

minus

+

300

p-MEK12

MEK12

MKK4

p-MKK4

RAW2647 cells

Pc-ME (120583gmL)LPS (1120583gmL)

120573-actin

(b)

Figure 4 Effect of Pc-ME on the activation of upstream signaling enzymes of AP-1 translocation (a and b) Phospho- and total protein levelsof ERK JNK p38 MEK12 MKK4 and 120573-actin in cell lysates were determined by immunoblotting analysis

activities [17] However SrcSyk-linked activation of NF-120581Bis not the only important regulatory loop of inflammatoryreaction In addition it has been reported that AP-1 activatedby MAPK plays another crucial roles in inflammatory reac-tion [11 38 39] In the present study therefore we aimed toelucidate inhibitory mechanism of Pc-ME on AP-1 functionin vitro and in vivo by using LPS-activated macrophages andLPSD-GalN-triggered hepatitis model

It has been shown that reporter gene luciferase assayperformed in conjunction with HEK293 cells transfectedwith Luc constructs and adaptor molecules essential for TLRsignaling [40] is a reasonable approach for studying func-tional activation of transcription factors [41 42] Thereforeto examine the ability of Pc-ME to suppress AP-1 functionwe first employed the luciferase assay using HEK293 cellstransfected with the AP-1-Luc construct As expected AP-1-mediated luciferase activity was enhanced up to 45- to485-fold by PMA treatment or cotransfection with adaptormolecules (TRIF and MyD88) and Pc-ME notably inhibitedthis upregulation in a dose-dependent manner (Figure 2)Moreover nuclear translocation of c-Fos was reduced by Pc-ME treatment in a time-dependent manner (Figure 3(a))

implying that AP-1 family of transcription factors can befunctionally inactivated and that their upstream kinasesresponsible for AP-1 phosphorylation can be targeted

Several earlier reports have suggested that several proin-flammatory cytokines such as TNF-120572 IL-1120573 and IL-6 playan important role in boosting proinflammatory roles ofmacrophages [43ndash45] We therefore further tested whetherthese proinflammatory cytokines can be also suppressedby Pc-ME using LPS-treated RAW2647 cells The mRNAanalysis of these cytokines by RT-PCR in RAW2647 cells(Figure 3(c)) and by real-time PCR in U937 cells (Figures3(d)ndash3(f)) revealed that mRNA levels of TNF-120572 IL-1120573 andIL-6 were strongly upregulated by LPS treatment while Pc-ME significantly and dose-dependently (100 and 300120583gmL)inhibited such upregulation indicating that AP-1 suppressionby Pc-ME may be associated with blockade of these proin-flammatory cytokines as well as its suppressive activity onthe expression of iNOS and COX-2 [17] In fact a number ofstudies have also reported thatmany knownherbalmedicinessuch as Polygonum hydropiper Pistacia integerrima Phase-olus angularis Morus bombycis Koidzumi and Sanguisorbaofficinalis possess AP-1 pathway inhibitory activity as their

8 Evidence-Based Complementary and Alternative Medicine

ALT

(UL

)

minus +0

5000

10000

15000

20000

25000

lowastlowast

Pc-ME (200mgkg)

LPS (10120583gkg)D-GalN (1mgkg)

(a)

AST

(UL

)

0

5000

10000

15000

20000

minus +

lowastlowast

Pc-ME (200mgkg)

LPS (10120583gkg)D-GalN (1mgkg)

(b)

HampE staining

Normal LPSD-GalN Pc-ME (200mgkg)

(c)

Liver lysate

minus

minus

+minus

++

MKK4

c-Fos

p-c-Fos

LPSD-GalN

p-MKK4

120573-actin

Pc-ME (200mgkg)

(d)

Figure 5 Effect of Pc-ME on LPSD-GalN-induced hepatitis in mice Mice were orally treated with Pc-ME (200mgkg) for six days beforeintraperitoneal injection of LPSD-GalN After 1 h mice were sacrificed to collect blood samples and liver sections for biochemical parameteranalysis of (a) ALT (b) AST and (c) histopathological examination (d) Phospho- or total protein levels of MKK4 c-Fos and 120573-actin in liverlysates were determined by immunoblot analysis

pharmacological target [26 46ndash49] Therefore the fact thatPc-ME is able to inhibit AP-1 pathway could be also acceptedas a general anti-inflammatory mechanism of this plant

As MAPKs play a vital role in the regulation of LPS-induced inflammation by controlling AP-1 activation [21] weexamine themolecular inhibitory effects of Pc-MEon theAP-1 pathway Toward this goal we analyzed the inhibitory effectof Pc-ME on MAPKs and their upstream signaling enzymes

[50]The results of our study demonstrated that Pc-ME treat-ment time-dependently (5 15 30 and 60min) blocked ERKand JNK phosphorylation (Figure 4(a) left panel) poten-tially leading to significant attenuation of AP-1 activationin response to LPS The dose-dependent (50 to 300 120583gmL)inhibition pattern of the same MAPK phosphorylation bythis extract (Figure 4(a) right panel) strongly supported ourexperimental condition and hypothesisThe phosphorylation

Evidence-Based Complementary and Alternative Medicine 9A

P-1-

med

iate

d lu

cife

rase

activ

ity (f

old

incr

ease

)

Tag2MyD88

0

1

2

3

4

5

+

minusminus

minus

+minus

minus

+20

minus

+40

minus

+80

lowastlowastlowastlowast

lowastlowast

Quercetin (120583M)

Figure 6 Effect of quercetin on the activation of upstream signalingenzymes of AP-1 in a reporter gene assay The promoter bindingactivity of the transcription factor AP-1 was analyzed using areporter gene assay in HEK293 cells transfected with plasmidconstructs AP-1-Luc (1 120583gmL) and 120573-gal (as a transfection control)with 1 120583gmL of MyD88 in the presence of quercetin Luciferaseactivity was measured using a luminometer lowastlowast119875 lt 001 comparedwith control

of MEK12 and MKK4 the upstream enzymes of ERK andJNK respectively was also strikingly suppressed by Pc-MEin LPS challenges of 2 3 and 5min (Figure 4(b)) confirmingthe MAPK inhibitory activity of this extract

MAPK activation and subsequent AP-1 activation arestrongly linked to the induction of hepatitis [22 23] Sowe guess that AP-1-inhibitory extract Pc-ME is capable ofattenuating hepatitis symptoms To test this hypothesis weemployed LPSD-GalN-intoxicated acute liver injury modelwhich is a classical system for screening hepatoprotectiveremedy in vivo [32] Our previous study indicating thatPc-ME can protect against HClEtOH-induced gastritis byinhibiting SrcSyk of NF-120581B [17] has demonstrated the oraleffectiveness of this extract In the present study expectedlyPc-ME treatment (200mgkg) effectively ameliorated theLPSD-GalN-induced liver damage (Figure 5(c)) includingreversion of LPSD-GalN-elevated hepatic ALT (Figure 5(a))and AST (Figure 5(b)) enzyme levels In the in vivo hepatictissue the upregulated phosphorylation of MKK4 and c-Fos(component of AP-1) was also noticeably blocked by Pc-MEtreatment (Figure 5(d)) which strongly authenticated ourfindings In addition quercetin a major antioxidative andanti-inflammatory compound of P chinensis [17] also drasti-cally diminished theAP-1 activation in a dose-dependent pat-tern (Figure 6) supporting that MAPKAP-1-targeted anti-inflammatory activity of Pc-ME could be quercetin-derivedanti-inflammatory action Although numerous numbers ofmedicinal plants or edible fruits such as Panax ginsengFagonia schweinfurthii fermented soybean Davilla ellipticaand Boesenbergia rotunda have been reported to show anti-hepatitis activities [51ndash55] only few plants are now clinicallyprescribed It was revealed that Pc-ME is able to stronglysuppress both NF-120581B [17] and AP-1 activity we will further

TLR4

LPS

Pc-ME

Tissue damage

MyD88

MAPK

ERK JNK

c-Fos

AP-1

TRIF

IL-6 IL-1120573

TNF-120572

TNF-120572

IL-6 IL-1120573

Figure 7 Putative mechanism of Pc-ME-mediated anti-inflam-matory responses

validate whether Pc-ME can be also clinically developed as anew antihepatitis herbal drug

In summary our in vivo and in vitro assays demonstratedthat Pc-ME significantly reduced the levels of LPS-mediatedproinflammatory cytokines (TNF-120572 IL-1120573 and IL-6) andthat MAPKAP-1 inactivation by this extract contributes tothese inhibitory effects as summarized in Figure 7The strongantihepatotoxic activity of Pc-ME in vivo was observed in amousemodel of LPSD-GalN-induced liver injury indicatingthat Pc-ME could potentially be used as a hepatoprotectiveremedy

Conflict of Interests

The authors report no conflict of interests The authors aloneare responsible for the content and writing of the paper

Authorsrsquo Contribution

Muhammad Jahangir Hossen and Seung Cheol Kim equallycontributed to this work

Acknowledgment

This study was supported by a grant of the Korean HealthTechnology RampD Project Ministry of Health amp WelfareRepublic of Korea (HI12C0050)

References

[1] C-K Tseng C-K Lin H-W Chang et al ldquoAqueous extractof Gracilaria tenuistipitata suppresses LPS-induced NF-120581Band MAPK activation in RAW 2647 and rat peritonealmacrophages and exerts hepatoprotective effects on carbon

10 Evidence-Based Complementary and Alternative Medicine

tetrachloride-treated ratrdquo PLoS ONE vol 9 no 1 Article IDe86557 2014

[2] H C Steel R Cockeran R Anderson and C Feldman ldquoOver-viewof community-acquired pneumonia and the role of inflam-matory mechanisms in the immunopathogenesis of severepneumococcal diseaserdquo Mediators of Inflammation vol 2013Article ID 490346 18 pages 2013

[3] M Pasparakis ldquoRegulation of tissue homeostasis by NF-Bsignalling implications for inflammatory diseasesrdquo NatureReviews Immunology vol 9 no 11 pp 778ndash788 2009

[4] J-K Kim and G-M Park ldquoIndirubin-3-monoxime exhibitsanti-inflammatory properties by down-regulating NF-120581Band JNK signaling pathways in lipopolysaccharide- treatedRAW2647 cellsrdquo Inflammation Research vol 61 no 4 pp319ndash325 2012

[5] MHamandAMoon ldquoInflammatory andmicroenvironmentalfactors involved in breast cancer progressionrdquo Archives ofPharmacal Research vol 36 no 12 pp 1419ndash1431 2013

[6] M-S Lee ldquoRole of innate immunity in diabetes and metab-olism recent progress in the study of inflammasomesrdquo ImmuneNetwork vol 11 no 2 pp 95ndash99 2011

[7] Y Ayele J-A Kim E Park et al ldquoA methanol extract of Adan-sonia digitata L leaves inhibits pro-inflammatory iNOS possi-bly via the inhibition of NF-120581B activationrdquo Biomolecules andTherapeutics vol 21 no 2 pp 146ndash152 2013

[8] D H Kim J H Chung J S Yoon et al ldquoGinsenoside Rdinhibits the expressions of iNOS andCOX-2 by suppressingNF-120581B in LPS-stimulated RAW2647 cells and mouse liverrdquo Journalof Ginseng Research vol 37 no 1 pp 54ndash63 2013

[9] M Fujihara M Muroi K-I Tanamoto T Suzuki H Azumaand H Ikeda ldquoMolecular mechanisms of macrophage activa-tion and deactivation by lipopolysaccharide roles of the recep-tor complexrdquo Pharmacology and Therapeutics vol 100 no 2pp 171ndash194 2003

[10] T Yu Y J Li A H Bian et al ldquoThe regulatory role of activat-ing transcription factor 2 in inflammationrdquoMediators of Inflam-mation vol 2014 Article ID 950472 10 pages 2014

[11] I-T Lee and C-M Yang ldquoInflammatory signalings involvedin airway and pulmonary diseasesrdquoMediators of Inflammationvol 2013 Article ID 791231 12 pages 2013

[12] E D Chan and D W H Riches ldquoIFN-120574 + LPS induction ofiNOS is modulated by ERK JNKSAPK and p38mapk in amouse macrophage cell linerdquo The American Journal of Physi-ologymdashCell Physiology vol 280 no 3 pp C441ndashC450 2001

[13] I N Crispe ldquoThe liver as a lymphoid organrdquo Annual Review ofImmunology vol 27 pp 147ndash163 2009

[14] F Tacke T Luedde and C Trautwein ldquoInflammatory pathwaysin liver homeostasis and liver injuryrdquoClinical Reviews in Allergyamp Immunology vol 36 no 1 pp 4ndash12 2009

[15] M Y Jia Y P Jing Q Ai et al ldquoPotential role of catalase inmicewith lipopolysaccharideD-galactosamine-induced fulminantliver injuryrdquo Hepatology Research vol 44 no 11 pp 1151ndash11582014

[16] Q Ai Y Jing R Jiang et al ldquoRotenone a mitochondrial res-piratory complex i inhibitor ameliorates lipopolysaccharideD-galactosamine-induced fulminant hepatitis in micerdquo Interna-tional Immunopharmacology vol 21 no 1 pp 200ndash207 2014

[17] M J Hossen K-S Baek E Kim et al ldquoIn vivo and in vitroanti-inflammatory activities of Persicaria chinensis methanolicextract targeting SrcSykNF-120581Brdquo Journal of Ethnopharmacol-ogy vol 159 pp 9ndash16 2015

[18] D R Luitel M B Rokaya B Timsina and Z MunzbergovaldquoMedicinal plants used by the Tamang community in theMakawanpur district of central Nepalrdquo Journal of Ethnobiologyand Ethnomedicine vol 10 no 1 article 5 2014

[19] W M May The reproductive biology and cytotoxic activity ofpersicaria chinensis (L) H gross var chinensis (Polygonaceae)[Dissertation] University of Malaya 2012

[20] S M Lai D Sudhahar and K Anandarajagopal ldquoEvaluationof antibacterial and antifungal activities of Persicaria chinensisleavesrdquo International Journal of Pharmaceutical Sciences ampResearch vol 3 p 8 2012

[21] B Veres B Radnai F Gallyas Jr et al ldquoRegulation of kinase cas-cades and transcription factors by a poly(ADP-ribose) polym-erase-1 inhibitor 4-hydroxyquinazoline in lipopolysaccharide-induced inflammation in micerdquo Journal of Pharmacology andExperimental Therapeutics vol 310 no 1 pp 247ndash255 2004

[22] M Panteva H Korkaya and S Jameel ldquoHepatitis viruses andthe MAPK pathway is this a survival strategyrdquo Virus Researchvol 92 no 2 pp 131ndash140 2003

[23] A Laliena B S Miguel I Crespo M Alvarez J Gonzalez-Gallego and M J Tunon ldquoMelatonin attenuates inflammationand promotes regeneration in rabbits with fulminant hepatitisof viral originrdquo Journal of Pineal Research vol 53 no 3 pp 270ndash278 2012

[24] S E Byeon T Yu Y Yang et al ldquoHydroquinone regulateshemeoxygenase-1 expression via modulation of Src kinaseactivity through thiolation of cysteine residuesrdquo Free RadicalBiology and Medicine vol 57 pp 105ndash118 2013

[25] S E Byeon T Yu Y Yang et al ldquoHydroquinone regulateshemeoxygenase-1 expression via modulation of Src kinaseactivity through thiolation of cysteine residuesrdquo Free RadicalBiology and Medicine vol 57 pp 105ndash118 2013

[26] Y Yang T Yu H-J Jang et al ldquoIn vitro and in vivo anti-inflammatory activities of Polygonum hydropiper methanolextractrdquo Journal of Ethnopharmacology vol 139 no 2 pp 616ndash625 2012

[27] M-Y Kim and J Y Cho ldquo20S-dihydroprotopanaxadiol aginsenoside derivative boosts innate immune responses ofmonocytes and macrophagesrdquo Journal of Ginseng Research vol37 no 3 pp 293ndash299 2013

[28] E H Jho K Kang S Oidovsambuu et al ldquoGymnaster koraien-sis and its major components 35-di-O-caffeoylquinic acid andgymnasterkoreayne B reduce oxidative damage induced bytert-butyl hydroperoxide or acetaminophen in hepG2 cellsrdquoBMB Reports vol 46 no 10 pp 513ndash518 2013

[29] Y Yang T Yu Y G Lee et al ldquoMethanol extract ofHopea odor-ata suppresses inflammatory responses via the direct inhibitionof multiple kinasesrdquo Journal of Ethnopharmacology vol 145 no2 pp 598ndash607 2013

[30] S Sun Back J Kim D Choi E S Lee S Y Choi and K HanldquoCooperative transcriptional activation of ATP-binding cassettesterol transporters ABCG5 and ABCG8 genes by nuclear recep-tors including Liver-X-Receptorrdquo BMB Reports vol 46 no 6pp 322ndash327 2013

[31] C Liang Y Ding S B Song et al ldquoOleanane-triterpenoidsfrom Panax stipuleanatus inhibit NF-120581Brdquo Journal of GinsengResearch vol 37 no 1 pp 74ndash79 2013

[32] J Y Cho J D Yeon J Y Kim E S Yoo YH Yu andMH ParkldquoHepatoprotection by human epidermal growth factor (hEGF)against experimental hepatitis induced byD-galactosamine (D-GalN) or D-GalNlipopolysacchariderdquo Biological amp Pharma-ceutical Bulletin vol 23 no 10 pp 1243ndash1246 2000

Evidence-Based Complementary and Alternative Medicine 11

[33] C-W Lee F-L Yen H-W Huang et al ldquoResveratrol nanopar-ticle system improves dissolution properties and enhances thehepatoprotective effect of resveratrol through antioxidant andanti-inflammatory pathwaysrdquo Journal of Agricultural and FoodChemistry vol 60 no 18 pp 4662ndash4671 2012

[34] T Yu J Lee Y G Lee et al ldquoIn vitro and in vivo anti-inflam-matory effects of ethanol extract from Acer tegmentosumrdquoJournal of Ethnopharmacology vol 128 no 1 pp 139ndash147 2010

[35] Y-H Jeong J-W Hyun T K van Le D-H Kim and H-SKim ldquoKalopanaxsaponin A exerts anti-inflammatory effects inlipopolysaccharide-stimulated microglia via inhibition of JNKand NF-120581BAP-1 pathwaysrdquo Biomolecules andTherapeutics vol21 no 5 pp 332ndash337 2013

[36] M Feldmann ldquoMany cytokines are very useful therapeutictargets in diseaserdquoThe Journal of Clinical Investigation vol 118no 11 pp 3533ndash3536 2008

[37] B Kaminska ldquoMAPK signalling pathways as molecular targetsfor anti-inflammatory therapymdashfrom molecular mechanismsto therapeutic benefitsrdquoBiochimica et Biophysica ActamdashProteinsand Proteomics vol 1754 no 1-2 pp 253ndash262 2005

[38] Y Yang S C Kim T Yu et al ldquoFunctional roles of p38mitogen-activated protein kinase in macrophage-mediated inflamma-tory responsesrdquoMediators of Inflammation vol 2014 Article ID352371 13 pages 2014

[39] Y Yang J Lee M H Rhee et al ldquoMolecular mechanism ofprotopanaxadiol saponin fraction-mediated anti-inflammatoryactionsrdquo Journal of Ginseng Research vol 39 no 1 pp 61ndash682015

[40] L A J OrsquoNeill K A Fitzgerald and A G Bowie ldquoThe Toll-IL-1 receptor adaptor family grows to five membersrdquo Trends inImmunology vol 24 no 6 pp 286ndash289 2003

[41] S E Byeon J Lee B C Yoo et al ldquoP38-targeted inhibition ofinterleukin-12 expression by ethanol extract from Cordycepsbassiana in lipopolysaccharide-activated macrophagesrdquo Immu-nopharmacology and Immunotoxicology vol 33 no 1 pp 90ndash96 2011

[42] M H Kim D S Yoo S Y Lee et al ldquoThe TRIFTBK1IRF-3activation pathway is the primary inhibitory target of resver-atrol contributing to its broad-spectrum anti-inflammatoryeffectsrdquo Pharmazie vol 66 no 4 pp 293ndash300 2011

[43] S Ghosh and M S Hayden ldquoNew regulators of NF-120581B ininflammationrdquo Nature Reviews Immunology vol 8 no 11 pp837ndash848 2008

[44] R Medzhitov and T Horng ldquoTranscriptional control of theinflammatory responserdquoNature Reviews Immunology vol 9 no10 pp 692ndash703 2009

[45] T Kawai and S Akira ldquoToll-like receptors and their crosstalkwith other innate receptors in infection and immunityrdquo Immu-nity vol 34 no 5 pp 637ndash650 2011

[46] K Mehla S Balwani A Kulshreshtha D Nandi P Jaisankarand B Ghosh ldquoEthyl gallate isolated from Pistacia integerrimaLinn inhibits cell adhesion molecules by blocking AP-1 tran-scription factorrdquo Journal of Ethnopharmacology vol 137 no 3pp 1345ndash1352 2011

[47] T Yu H M Ahn T Shen et al ldquoAnti-inflammatory activity ofethanol extract derived fromPhaseolus angularis beansrdquo Journalof Ethnopharmacology vol 137 no 3 pp 1197ndash1206 2011

[48] H S Kim A-R Kim H J Park et al ldquoMorus bombycis Koid-zumi extract suppresses collagen-induced arthritis by inhibitingthe activation of nuclear factor-120581B and activator protein-1 inmicerdquo Journal of Ethnopharmacology vol 136 no 3 pp 392ndash398 2011

[49] T Yu Y J Lee H M Yang et al ldquoInhibitory effect of San-guisorba officinalis ethanol extract onNO and PGE

2production

is mediated by suppression of NF-120581B and AP-1 activationsignaling cascaderdquo Journal of Ethnopharmacology vol 134 no1 pp 11ndash17 2011

[50] M Guha and N Mackman ldquoLPS induction of gene expressionin human monocytesrdquo Cellular Signalling vol 13 no 2 pp 85ndash94 2001

[51] S-J Seo J Y Cho Y H Jeong and Y-S Choi ldquoEffect of Koreanred ginseng extract on liver damage induced by shorttermand long-term ethanol treatment in ratsrdquo Journal of GinsengResearch vol 37 no 2 pp 194ndash200 2013

[52] A Pareek A Godavarthi R Issarani and B P Nagori ldquoAntiox-idant and hepatoprotective activity of Fagonia schweinfurthii(Hadidi) Hadidi extract in carbon tetrachloride induced hep-atotoxicity in HepG2 cell line and ratsrdquo Journal of Ethnophar-macology vol 150 no 3 pp 973ndash981 2013

[53] H Mohd Yusof N M Ali S K Yeap et al ldquoHepatoprotectiveeffect of fermented soybean (nutrient enriched soybean tem-peh) against alcohol-induced liver damage in micerdquo Evidence-Based Complementary and Alternative Medicine vol 2013Article ID 274274 8 pages 2013

[54] J J Campos A De Oliveira Azevedo J D De Souza FilhoA Castro Perez and F Castro Braga ldquoBioguided isolation ofmyricetin-3-O-120573-galactopyranoside with antinociceptive activ-ity from the aerial part of Davilla elliptica St-Hilrdquo Journal ofEthnopharmacology vol 150 no 1 pp 270ndash274 2013

[55] S M Salama M A Abdulla A S Alrashdi and A H A HadildquoMechanism of hepatoprotective effect of Boesenbergia rotundain thioacetamide-induced liver damage in ratsrdquo Evidence-basedComplementary and Alternative Medicine vol 2013 Article ID157456 13 pages 2013

Submit your manuscripts athttpwwwhindawicom

Stem CellsInternational

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

MEDIATORSINFLAMMATION

of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Behavioural Neurology

EndocrinologyInternational Journal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Disease Markers

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

BioMed Research International

OncologyJournal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Oxidative Medicine and Cellular Longevity

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

PPAR Research

The Scientific World JournalHindawi Publishing Corporation httpwwwhindawicom Volume 2014

Immunology ResearchHindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Journal of

ObesityJournal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Computational and Mathematical Methods in Medicine

OphthalmologyJournal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Diabetes ResearchJournal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Research and TreatmentAIDS

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Gastroenterology Research and Practice

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Parkinsonrsquos Disease

Evidence-Based Complementary and Alternative Medicine

Volume 2014Hindawi Publishing Corporationhttpwwwhindawicom

4 Evidence-Based Complementary and Alternative Medicine

1mM dithiothreitol 1 Triton X-100 10 glycerol 10 120583gmLaprotinin 10 120583gmL pepstatin 1mM benzamide and 2mMPMSF) for 30min with rotation at 4∘CThe lysates were clari-fied by centrifugation at 16000timesg for 10min at 4∘Cand storedat minus20∘C until needed

Nuclear extracts were prepared in a three-step procedurewith RAW2647 cells stimulated with LPS for 15 30 60and 120min in the presence or absence of Pc-ME (0 and300 120583gmL) as reported previously [34] The cells werecollected with a rubber policeman washed with 1 times PBSand lysed in 500 120583L lysis buffer containing 50mM KCl 05Nonidet P-40 25mM HEPES (pH 78) 1mM phenylmethyl-sulfonyl fluoride 10 120583gmL leupeptin 20120583gmL aprotininand 100 120583M 14-dithiothreitol (DTT) on ice for 4min Celllysates were then centrifuged at 19326timesg for 1min in amicro-centrifuge In the second step the pellet (the nuclear fraction)waswashed once inwashing buffer whichwas the same as thelysis buffer but without Nonidet P-40 In the final step nucleiwere treated with an extraction buffer (lysis buffer containing500mM KCl and 10 glycerol) The nucleiextraction buffermixture was frozen at minus80∘C and then thawed on ice andcentrifuged at 19326timesg for 5min The supernatant wascollected as a nuclear extract

Soluble cell lysates or the nuclear extracts were immunob-lotted and total or phosphorylated protein levels of transcrip-tion factors (lamin AC c-Fos and c-Jun) ERK JNK p38MEK12 MKK4 and 120573-actin (as a control) were visualizedaccording to a previously published method [35]

27 Statistical Analysis All data are expressed as the mean plusmnstandard deviation (SD) of an experiment performed with six(Figures 1 2 and 6) or three (Figures 3 4 and 5) samples for invitro test and sixmice of each group for in vivo tests (Figure 5)Statistical comparisons were carried out by ANOVAScheffersquospost hoc test and Kruskal-WallisMann-Whitney tests A 119875value lt005 was considered statistically significant All statis-tical tests were performed with the computer program SPSS17 for Windows XP Similar results were found in an addi-tional independent set of in vitro and in vivo experimentsperformed under the same conditions

3 Results

31 Effect of Pc-ME on Cell Viability As shown in Figure 1the viability of RAW2647 HEK293 and U937 cells wasnot significantly affected by treatment with Pc-ME up to300 120583gmL compared with that of the cells receiving no LPStreatment

32 Effect of Pc-ME on the Transcriptional Activation of AP-1We next performed a transfection experiment with the AP-1-Luc construct and HEK293 cells and used luciferase assays toexaminewhether Pc-ME suppressed the functional activationof AP-1 We found that AP-1-mediated luciferase activity wasincreased by PMA treatment (up to 50-fold) or cotransfectionwith adaptormolecules TRIF (up to 45-fold) andMyD88 (upto 8-fold) whereas Pc-ME treatment significantly (119875 lt 001)and dose-dependently (100 200 and 300120583gmL) inhibited

Cel

l via

bilit

y (

of c

ontro

l)

2000 100 3000

20

40

60

80

100

120

RAW2647 cellsHEK293 cellsU937 cells

Pc-ME (120583gmL)

Figure 1 Cell viability of RAW2647 HEK293 and U937 cells wasdetermined using the MTT assay

this upregulation (Figure 2) suggesting that AP-1 activationis a major pharmacological target of Pc-ME

AP-1 transcription factor is known to have a major reg-ulatory role in inflammatory gene expression so we exam-ined the suppressive effect of Pc-Me on the activation andtranslocation of AP-1 after treatment with Pc-ME Figure 3(a)shows the increase in nuclear level of the AP-1 c-Fos subunitdue to time-dependent inhibition by Pc-ME (15 30 60 and120min) Similar time-dependent (30 and 60min) inhibitorypatterns of c-Fos expression were confirmed by whole lysateextraction from U937 cells (Figure 3(b))

33 Effects of Pc-ME on LPS-Induced Proinflammatory Cytok-ine Production Lee et al [33] and Feldmann [36] have sug-gested that TNF-120572 IL-1120573 and IL-6 are crucial mediators ofthe development of inflammatory diseases We further inves-tigated the effect of Pc-ME on proinflammatory gene expres-sion in RAW2647 cells and U937 cells after LPS treatmentRT-PCR results demonstrated a significant concentration-dependent decrease in LPS-induced upregulation of TNF-120572IL-1120573 and IL-6 mRNA levels in Pc-ME-treated RAW2647cells (Figure 3(c)) In parallel real-time PCR (Figures 3(d)to 3(f)) in U937 cells clearly showed that LPS was able toinduce the upregulation of proinflammatory cytokines suchas TNF-120572 up to 6460-fold IL-1120573 up to 1360-fold and IL-6 upto 20-fold whereas Pc-ME (300 120583gmL) strongly (119875 lt 001)inhibited this

34 Effect of Pc-ME on Upstream Signaling for AP-1 Acti-vation It has been reported [37] that phosphorylation ofMAPK (ERK JNK and p38) plays a pivotal role in theregulation of LPS-induced inflammatory mediators so weperformed Western blot analysis to determine the inhibitoryactivity of Pc-ME on proinflammatorymediators LPS signif-icantly elevated the phosphorylation of ERK JNK and p38whereas Pc-ME pretreatment strongly and time-dependently(5 15 30 and 60min) suppressed LPS-induced phospho-rylation of JNK and ERK but not that of p38 (Figure 4(a)

Evidence-Based Complementary and Alternative Medicine 5

Tag2 +minus

minus

minus

+minus

minus

+100

minus

+200

minus

+300

MyD88

0

2

4

6

8

10

lowastlowast lowastlowastlowastlowast

Pc-ME (120583gmL)

AP-1-

med

iate

d lu

cife

rase

ac

tivity

(fol

d in

crea

se)

(a)

pcDNA +minusminus

minus

+minus

minus

+100

minus

+200

minus

+300

TRIF

0

1

2

3

4

5

6

lowastlowast

lowastlowast

lowast

Pc-ME (120583gmL)

AP-1-

med

iate

d lu

cife

rase

ac

tivity

(fol

d in

crea

se)

(b)

0

10

20

30

40

50

60

minus

minus

+

minus

+100

+200

+300

lowastlowast

lowastlowast

Pc-ME (120583gmL)PMA (100nM)

AP-1-

med

iate

d lu

cife

rase

activ

ity (f

old

incr

ease

)

(c)

Figure 2 Effect of Pc-ME on the reporter gene assay The promoter binding activity of the transcription factor AP-1 was analyzed using areporter gene assay in HEK293 cells transfected with plasmid constructs AP-1-Luc (1 120583gmL) or 120573-gal (as a transfection control) with 1120583gmLof MyD88 (a) or TRIF (b) and 100 nM PMA (c) in the presence of Pc-ME Luciferase activity was measured using a luminometer lowastlowast119875 lt 001compared with control

left panel) in RAW2647 cells The right panel in Figure 4(a)shows that Pc-ME (50 100 200 and 300120583gmL) dose-dependently blocked the phosphorylation of ERK and JNKwhich validates our experimental findings and confirmsour expectations Upstream signaling enzymes (MEK12 andMKK4) contributing to ERK and JNK phosphorylation wereappreciably blocked by Pc-ME at 2 3 and 5min of LPS treat-ment (Figure 4(b)) which demonstrates that MEK12 andMKK4 might be targeted by Pc-ME in its AP-1-suppressiveanti-inflammatory actions in LPS-stimulated RAW2647cells In concurrence with our LPSD-GalN-treated micehepatitis experimental model the upregulation of phospho-rylated MKK4 and c-Fos in the liver tissue was markedlysuppressed by orally administered Pc-ME (Figure 5(d))

35 Hepatoprotective Effect of Pc-ME on LPSD-GalN-InducedLiver Injury in Mice We used a mouse model of LPSD-GalN-induced liver injury to investigate the in vivo hep-atoprotective effect of Pc-ME LPSD-GalN-triggered ALT

(14000UL) and AST (10000UL) protein levels were sig-nificantly (119875 lt 001) decreased by Pc-ME (Figures 5(a)and 5(b))Moreover histopathological analysis demonstratedthat the liver sections of the LPSD-GalN group displayedmore neutrophil recruitment as assessed by bigger sized andincreased numbers dark spots (see arrows in Figure 5(c))compared with the saline-treated control groups in contrastthe Pc-ME-treated groups exhibited lower neutrophil num-bers (Figure 5(c)) which demonstrates the strong hepatopro-tective activity of Pc-ME

36 Effect of Quercetin on AP-1 Activity Cotransfectionwith the adaptor molecule MyD88 enhanced AP-1-mediatedluciferase activity by 45-fold quercetin a major flavonoidfrom Pc-ME [17] significantly (119875 lt 001) and dose-dependently inhibited this upregulation (Figure 6) whichdemonstrates that AP-1 activation is amajor pharmacologicaltarget of Pc-ME and its ingredient quercetin

6 Evidence-Based Complementary and Alternative Medicine

Lamin AC

+

minus

+

300

+

minus

+

300

+

minus

+

300

+

minus

+

300

Nuclear fraction (RAW2647 cells)

minus

minus

c-Fos

c-Jun

Pc-ME (120583gmL)

15min 30min 60min 120min

LPS (1120583gmL)

(a)

+

minus

+

minus

+

300

U937 cells

minus

minus

+

300

p-c-Fos

c-Fos

Pc-ME (120583gmL)

30min 60min

120573-actin

LPS (10120583gmL)

(b)

minus

minus

+

minus

+

100

+

300

GAPDH

IL-6

Pc-ME (120583gmL)LPS (1120583gmL)

RAW2647 cells (6h)

TNF-120572

IL-1120573

(c)

0

1000

2000

3000

4000

5000

6000

7000

minus minus 300

lowastlowast

Pc-ME (120583gmL)

TNF-120572

expr

essio

n (r

elat

ive q

uant

ity)

U937 cells (12h)

LPS (10120583gmL)(d)

0

200

400

600

800

1000

1200

1400

1600

minus minus 300

lowastlowast

Pc-ME (120583gmL)

IL-1120573

expr

essio

n (r

elat

ive q

uant

ity)

LPS (10120583gmL)

U937 cells (12h)

(e)

0

5

10

15

20

25

IL-6

gen

e exp

ress

ion

(rel

ativ

e qua

ntity

)

minus minus 300

lowastlowast

Pc-ME (120583gmL)

U937 cells (12h)

LPS (10120583gmL)

(f)

Figure 3 Effect of Pc-ME on the activation of proinflammatory cytokines and transcriptional regulation (a) Levels of c-Fos c-Jun andlamin AC in nuclear fractions were determined by immunoblot analysis in RAW2647 cells (b) Phospho- or total protein levels of c-Fosand 120573-actin in cell lysates were determined by immunoblot analysis in U937 cells (c) mRNA levels of TNF-120572 IL-1120573 IL-6 and GAPDH weredetermined by semiquantitative RT-PCR in RAW2647 cells (dndashf) mRNA levels of TNF-120572 IL-1120573 and IL-6 were determined by real-timeRT-PCR in U937 cells

4 Discussion

While P chinensis has high ethnopharmacological worthin Eastern Asian countries the molecular mechanisms

underlying its anti-inflammatory activity are still unknownRecently our studies have revealed that P chinensismethanolextract exhibits strong antigastritis activity and is able toblock NF-120581B activation via suppression of Src and Syk

Evidence-Based Complementary and Alternative Medicine 7

15min 30min 60min5min RAW2647 cells (30min)

p-ERK

ERK

p-JNK

JNKp-JNK

ERK

p-ERK

p-p38

p38

JNK

RAW2647 cells

minus

minus

+

minus

+

50

+

100

+

200

+

300

minus

minus

+

minus

+

300

+

minus

+

300

+

minus

+

300

+

minus

+

300Pc-ME (120583gmL)LPS (1120583gmL)

Pc-ME (120583gmL)LPS (1120583gmL)

120573-actin

120573-actin

(a)

5min3min2minminus

minus

+

minus

+

300

+

minus

+

300

+

minus

+

300

p-MEK12

MEK12

MKK4

p-MKK4

RAW2647 cells

Pc-ME (120583gmL)LPS (1120583gmL)

120573-actin

(b)

Figure 4 Effect of Pc-ME on the activation of upstream signaling enzymes of AP-1 translocation (a and b) Phospho- and total protein levelsof ERK JNK p38 MEK12 MKK4 and 120573-actin in cell lysates were determined by immunoblotting analysis

activities [17] However SrcSyk-linked activation of NF-120581Bis not the only important regulatory loop of inflammatoryreaction In addition it has been reported that AP-1 activatedby MAPK plays another crucial roles in inflammatory reac-tion [11 38 39] In the present study therefore we aimed toelucidate inhibitory mechanism of Pc-ME on AP-1 functionin vitro and in vivo by using LPS-activated macrophages andLPSD-GalN-triggered hepatitis model

It has been shown that reporter gene luciferase assayperformed in conjunction with HEK293 cells transfectedwith Luc constructs and adaptor molecules essential for TLRsignaling [40] is a reasonable approach for studying func-tional activation of transcription factors [41 42] Thereforeto examine the ability of Pc-ME to suppress AP-1 functionwe first employed the luciferase assay using HEK293 cellstransfected with the AP-1-Luc construct As expected AP-1-mediated luciferase activity was enhanced up to 45- to485-fold by PMA treatment or cotransfection with adaptormolecules (TRIF and MyD88) and Pc-ME notably inhibitedthis upregulation in a dose-dependent manner (Figure 2)Moreover nuclear translocation of c-Fos was reduced by Pc-ME treatment in a time-dependent manner (Figure 3(a))

implying that AP-1 family of transcription factors can befunctionally inactivated and that their upstream kinasesresponsible for AP-1 phosphorylation can be targeted

Several earlier reports have suggested that several proin-flammatory cytokines such as TNF-120572 IL-1120573 and IL-6 playan important role in boosting proinflammatory roles ofmacrophages [43ndash45] We therefore further tested whetherthese proinflammatory cytokines can be also suppressedby Pc-ME using LPS-treated RAW2647 cells The mRNAanalysis of these cytokines by RT-PCR in RAW2647 cells(Figure 3(c)) and by real-time PCR in U937 cells (Figures3(d)ndash3(f)) revealed that mRNA levels of TNF-120572 IL-1120573 andIL-6 were strongly upregulated by LPS treatment while Pc-ME significantly and dose-dependently (100 and 300120583gmL)inhibited such upregulation indicating that AP-1 suppressionby Pc-ME may be associated with blockade of these proin-flammatory cytokines as well as its suppressive activity onthe expression of iNOS and COX-2 [17] In fact a number ofstudies have also reported thatmany knownherbalmedicinessuch as Polygonum hydropiper Pistacia integerrima Phase-olus angularis Morus bombycis Koidzumi and Sanguisorbaofficinalis possess AP-1 pathway inhibitory activity as their

8 Evidence-Based Complementary and Alternative Medicine

ALT

(UL

)

minus +0

5000

10000

15000

20000

25000

lowastlowast

Pc-ME (200mgkg)

LPS (10120583gkg)D-GalN (1mgkg)

(a)

AST

(UL

)

0

5000

10000

15000

20000

minus +

lowastlowast

Pc-ME (200mgkg)

LPS (10120583gkg)D-GalN (1mgkg)

(b)

HampE staining

Normal LPSD-GalN Pc-ME (200mgkg)

(c)

Liver lysate

minus

minus

+minus

++

MKK4

c-Fos

p-c-Fos

LPSD-GalN

p-MKK4

120573-actin

Pc-ME (200mgkg)

(d)

Figure 5 Effect of Pc-ME on LPSD-GalN-induced hepatitis in mice Mice were orally treated with Pc-ME (200mgkg) for six days beforeintraperitoneal injection of LPSD-GalN After 1 h mice were sacrificed to collect blood samples and liver sections for biochemical parameteranalysis of (a) ALT (b) AST and (c) histopathological examination (d) Phospho- or total protein levels of MKK4 c-Fos and 120573-actin in liverlysates were determined by immunoblot analysis

pharmacological target [26 46ndash49] Therefore the fact thatPc-ME is able to inhibit AP-1 pathway could be also acceptedas a general anti-inflammatory mechanism of this plant

As MAPKs play a vital role in the regulation of LPS-induced inflammation by controlling AP-1 activation [21] weexamine themolecular inhibitory effects of Pc-MEon theAP-1 pathway Toward this goal we analyzed the inhibitory effectof Pc-ME on MAPKs and their upstream signaling enzymes

[50]The results of our study demonstrated that Pc-ME treat-ment time-dependently (5 15 30 and 60min) blocked ERKand JNK phosphorylation (Figure 4(a) left panel) poten-tially leading to significant attenuation of AP-1 activationin response to LPS The dose-dependent (50 to 300 120583gmL)inhibition pattern of the same MAPK phosphorylation bythis extract (Figure 4(a) right panel) strongly supported ourexperimental condition and hypothesisThe phosphorylation

Evidence-Based Complementary and Alternative Medicine 9A

P-1-

med

iate

d lu

cife

rase

activ

ity (f

old

incr

ease

)

Tag2MyD88

0

1

2

3

4

5

+

minusminus

minus

+minus

minus

+20

minus

+40

minus

+80

lowastlowastlowastlowast

lowastlowast

Quercetin (120583M)

Figure 6 Effect of quercetin on the activation of upstream signalingenzymes of AP-1 in a reporter gene assay The promoter bindingactivity of the transcription factor AP-1 was analyzed using areporter gene assay in HEK293 cells transfected with plasmidconstructs AP-1-Luc (1 120583gmL) and 120573-gal (as a transfection control)with 1 120583gmL of MyD88 in the presence of quercetin Luciferaseactivity was measured using a luminometer lowastlowast119875 lt 001 comparedwith control

of MEK12 and MKK4 the upstream enzymes of ERK andJNK respectively was also strikingly suppressed by Pc-MEin LPS challenges of 2 3 and 5min (Figure 4(b)) confirmingthe MAPK inhibitory activity of this extract

MAPK activation and subsequent AP-1 activation arestrongly linked to the induction of hepatitis [22 23] Sowe guess that AP-1-inhibitory extract Pc-ME is capable ofattenuating hepatitis symptoms To test this hypothesis weemployed LPSD-GalN-intoxicated acute liver injury modelwhich is a classical system for screening hepatoprotectiveremedy in vivo [32] Our previous study indicating thatPc-ME can protect against HClEtOH-induced gastritis byinhibiting SrcSyk of NF-120581B [17] has demonstrated the oraleffectiveness of this extract In the present study expectedlyPc-ME treatment (200mgkg) effectively ameliorated theLPSD-GalN-induced liver damage (Figure 5(c)) includingreversion of LPSD-GalN-elevated hepatic ALT (Figure 5(a))and AST (Figure 5(b)) enzyme levels In the in vivo hepatictissue the upregulated phosphorylation of MKK4 and c-Fos(component of AP-1) was also noticeably blocked by Pc-MEtreatment (Figure 5(d)) which strongly authenticated ourfindings In addition quercetin a major antioxidative andanti-inflammatory compound of P chinensis [17] also drasti-cally diminished theAP-1 activation in a dose-dependent pat-tern (Figure 6) supporting that MAPKAP-1-targeted anti-inflammatory activity of Pc-ME could be quercetin-derivedanti-inflammatory action Although numerous numbers ofmedicinal plants or edible fruits such as Panax ginsengFagonia schweinfurthii fermented soybean Davilla ellipticaand Boesenbergia rotunda have been reported to show anti-hepatitis activities [51ndash55] only few plants are now clinicallyprescribed It was revealed that Pc-ME is able to stronglysuppress both NF-120581B [17] and AP-1 activity we will further

TLR4

LPS

Pc-ME

Tissue damage

MyD88

MAPK

ERK JNK

c-Fos

AP-1

TRIF

IL-6 IL-1120573

TNF-120572

TNF-120572

IL-6 IL-1120573

Figure 7 Putative mechanism of Pc-ME-mediated anti-inflam-matory responses

validate whether Pc-ME can be also clinically developed as anew antihepatitis herbal drug

In summary our in vivo and in vitro assays demonstratedthat Pc-ME significantly reduced the levels of LPS-mediatedproinflammatory cytokines (TNF-120572 IL-1120573 and IL-6) andthat MAPKAP-1 inactivation by this extract contributes tothese inhibitory effects as summarized in Figure 7The strongantihepatotoxic activity of Pc-ME in vivo was observed in amousemodel of LPSD-GalN-induced liver injury indicatingthat Pc-ME could potentially be used as a hepatoprotectiveremedy

Conflict of Interests

The authors report no conflict of interests The authors aloneare responsible for the content and writing of the paper

Authorsrsquo Contribution

Muhammad Jahangir Hossen and Seung Cheol Kim equallycontributed to this work

Acknowledgment

This study was supported by a grant of the Korean HealthTechnology RampD Project Ministry of Health amp WelfareRepublic of Korea (HI12C0050)

References

[1] C-K Tseng C-K Lin H-W Chang et al ldquoAqueous extractof Gracilaria tenuistipitata suppresses LPS-induced NF-120581Band MAPK activation in RAW 2647 and rat peritonealmacrophages and exerts hepatoprotective effects on carbon

10 Evidence-Based Complementary and Alternative Medicine

tetrachloride-treated ratrdquo PLoS ONE vol 9 no 1 Article IDe86557 2014

[2] H C Steel R Cockeran R Anderson and C Feldman ldquoOver-viewof community-acquired pneumonia and the role of inflam-matory mechanisms in the immunopathogenesis of severepneumococcal diseaserdquo Mediators of Inflammation vol 2013Article ID 490346 18 pages 2013

[3] M Pasparakis ldquoRegulation of tissue homeostasis by NF-Bsignalling implications for inflammatory diseasesrdquo NatureReviews Immunology vol 9 no 11 pp 778ndash788 2009

[4] J-K Kim and G-M Park ldquoIndirubin-3-monoxime exhibitsanti-inflammatory properties by down-regulating NF-120581Band JNK signaling pathways in lipopolysaccharide- treatedRAW2647 cellsrdquo Inflammation Research vol 61 no 4 pp319ndash325 2012

[5] MHamandAMoon ldquoInflammatory andmicroenvironmentalfactors involved in breast cancer progressionrdquo Archives ofPharmacal Research vol 36 no 12 pp 1419ndash1431 2013

[6] M-S Lee ldquoRole of innate immunity in diabetes and metab-olism recent progress in the study of inflammasomesrdquo ImmuneNetwork vol 11 no 2 pp 95ndash99 2011

[7] Y Ayele J-A Kim E Park et al ldquoA methanol extract of Adan-sonia digitata L leaves inhibits pro-inflammatory iNOS possi-bly via the inhibition of NF-120581B activationrdquo Biomolecules andTherapeutics vol 21 no 2 pp 146ndash152 2013

[8] D H Kim J H Chung J S Yoon et al ldquoGinsenoside Rdinhibits the expressions of iNOS andCOX-2 by suppressingNF-120581B in LPS-stimulated RAW2647 cells and mouse liverrdquo Journalof Ginseng Research vol 37 no 1 pp 54ndash63 2013

[9] M Fujihara M Muroi K-I Tanamoto T Suzuki H Azumaand H Ikeda ldquoMolecular mechanisms of macrophage activa-tion and deactivation by lipopolysaccharide roles of the recep-tor complexrdquo Pharmacology and Therapeutics vol 100 no 2pp 171ndash194 2003

[10] T Yu Y J Li A H Bian et al ldquoThe regulatory role of activat-ing transcription factor 2 in inflammationrdquoMediators of Inflam-mation vol 2014 Article ID 950472 10 pages 2014

[11] I-T Lee and C-M Yang ldquoInflammatory signalings involvedin airway and pulmonary diseasesrdquoMediators of Inflammationvol 2013 Article ID 791231 12 pages 2013

[12] E D Chan and D W H Riches ldquoIFN-120574 + LPS induction ofiNOS is modulated by ERK JNKSAPK and p38mapk in amouse macrophage cell linerdquo The American Journal of Physi-ologymdashCell Physiology vol 280 no 3 pp C441ndashC450 2001

[13] I N Crispe ldquoThe liver as a lymphoid organrdquo Annual Review ofImmunology vol 27 pp 147ndash163 2009

[14] F Tacke T Luedde and C Trautwein ldquoInflammatory pathwaysin liver homeostasis and liver injuryrdquoClinical Reviews in Allergyamp Immunology vol 36 no 1 pp 4ndash12 2009

[15] M Y Jia Y P Jing Q Ai et al ldquoPotential role of catalase inmicewith lipopolysaccharideD-galactosamine-induced fulminantliver injuryrdquo Hepatology Research vol 44 no 11 pp 1151ndash11582014

[16] Q Ai Y Jing R Jiang et al ldquoRotenone a mitochondrial res-piratory complex i inhibitor ameliorates lipopolysaccharideD-galactosamine-induced fulminant hepatitis in micerdquo Interna-tional Immunopharmacology vol 21 no 1 pp 200ndash207 2014

[17] M J Hossen K-S Baek E Kim et al ldquoIn vivo and in vitroanti-inflammatory activities of Persicaria chinensis methanolicextract targeting SrcSykNF-120581Brdquo Journal of Ethnopharmacol-ogy vol 159 pp 9ndash16 2015

[18] D R Luitel M B Rokaya B Timsina and Z MunzbergovaldquoMedicinal plants used by the Tamang community in theMakawanpur district of central Nepalrdquo Journal of Ethnobiologyand Ethnomedicine vol 10 no 1 article 5 2014

[19] W M May The reproductive biology and cytotoxic activity ofpersicaria chinensis (L) H gross var chinensis (Polygonaceae)[Dissertation] University of Malaya 2012

[20] S M Lai D Sudhahar and K Anandarajagopal ldquoEvaluationof antibacterial and antifungal activities of Persicaria chinensisleavesrdquo International Journal of Pharmaceutical Sciences ampResearch vol 3 p 8 2012

[21] B Veres B Radnai F Gallyas Jr et al ldquoRegulation of kinase cas-cades and transcription factors by a poly(ADP-ribose) polym-erase-1 inhibitor 4-hydroxyquinazoline in lipopolysaccharide-induced inflammation in micerdquo Journal of Pharmacology andExperimental Therapeutics vol 310 no 1 pp 247ndash255 2004

[22] M Panteva H Korkaya and S Jameel ldquoHepatitis viruses andthe MAPK pathway is this a survival strategyrdquo Virus Researchvol 92 no 2 pp 131ndash140 2003

[23] A Laliena B S Miguel I Crespo M Alvarez J Gonzalez-Gallego and M J Tunon ldquoMelatonin attenuates inflammationand promotes regeneration in rabbits with fulminant hepatitisof viral originrdquo Journal of Pineal Research vol 53 no 3 pp 270ndash278 2012

[24] S E Byeon T Yu Y Yang et al ldquoHydroquinone regulateshemeoxygenase-1 expression via modulation of Src kinaseactivity through thiolation of cysteine residuesrdquo Free RadicalBiology and Medicine vol 57 pp 105ndash118 2013

[25] S E Byeon T Yu Y Yang et al ldquoHydroquinone regulateshemeoxygenase-1 expression via modulation of Src kinaseactivity through thiolation of cysteine residuesrdquo Free RadicalBiology and Medicine vol 57 pp 105ndash118 2013

[26] Y Yang T Yu H-J Jang et al ldquoIn vitro and in vivo anti-inflammatory activities of Polygonum hydropiper methanolextractrdquo Journal of Ethnopharmacology vol 139 no 2 pp 616ndash625 2012

[27] M-Y Kim and J Y Cho ldquo20S-dihydroprotopanaxadiol aginsenoside derivative boosts innate immune responses ofmonocytes and macrophagesrdquo Journal of Ginseng Research vol37 no 3 pp 293ndash299 2013

[28] E H Jho K Kang S Oidovsambuu et al ldquoGymnaster koraien-sis and its major components 35-di-O-caffeoylquinic acid andgymnasterkoreayne B reduce oxidative damage induced bytert-butyl hydroperoxide or acetaminophen in hepG2 cellsrdquoBMB Reports vol 46 no 10 pp 513ndash518 2013

[29] Y Yang T Yu Y G Lee et al ldquoMethanol extract ofHopea odor-ata suppresses inflammatory responses via the direct inhibitionof multiple kinasesrdquo Journal of Ethnopharmacology vol 145 no2 pp 598ndash607 2013

[30] S Sun Back J Kim D Choi E S Lee S Y Choi and K HanldquoCooperative transcriptional activation of ATP-binding cassettesterol transporters ABCG5 and ABCG8 genes by nuclear recep-tors including Liver-X-Receptorrdquo BMB Reports vol 46 no 6pp 322ndash327 2013

[31] C Liang Y Ding S B Song et al ldquoOleanane-triterpenoidsfrom Panax stipuleanatus inhibit NF-120581Brdquo Journal of GinsengResearch vol 37 no 1 pp 74ndash79 2013

[32] J Y Cho J D Yeon J Y Kim E S Yoo YH Yu andMH ParkldquoHepatoprotection by human epidermal growth factor (hEGF)against experimental hepatitis induced byD-galactosamine (D-GalN) or D-GalNlipopolysacchariderdquo Biological amp Pharma-ceutical Bulletin vol 23 no 10 pp 1243ndash1246 2000

Evidence-Based Complementary and Alternative Medicine 11

[33] C-W Lee F-L Yen H-W Huang et al ldquoResveratrol nanopar-ticle system improves dissolution properties and enhances thehepatoprotective effect of resveratrol through antioxidant andanti-inflammatory pathwaysrdquo Journal of Agricultural and FoodChemistry vol 60 no 18 pp 4662ndash4671 2012

[34] T Yu J Lee Y G Lee et al ldquoIn vitro and in vivo anti-inflam-matory effects of ethanol extract from Acer tegmentosumrdquoJournal of Ethnopharmacology vol 128 no 1 pp 139ndash147 2010

[35] Y-H Jeong J-W Hyun T K van Le D-H Kim and H-SKim ldquoKalopanaxsaponin A exerts anti-inflammatory effects inlipopolysaccharide-stimulated microglia via inhibition of JNKand NF-120581BAP-1 pathwaysrdquo Biomolecules andTherapeutics vol21 no 5 pp 332ndash337 2013

[36] M Feldmann ldquoMany cytokines are very useful therapeutictargets in diseaserdquoThe Journal of Clinical Investigation vol 118no 11 pp 3533ndash3536 2008

[37] B Kaminska ldquoMAPK signalling pathways as molecular targetsfor anti-inflammatory therapymdashfrom molecular mechanismsto therapeutic benefitsrdquoBiochimica et Biophysica ActamdashProteinsand Proteomics vol 1754 no 1-2 pp 253ndash262 2005

[38] Y Yang S C Kim T Yu et al ldquoFunctional roles of p38mitogen-activated protein kinase in macrophage-mediated inflamma-tory responsesrdquoMediators of Inflammation vol 2014 Article ID352371 13 pages 2014

[39] Y Yang J Lee M H Rhee et al ldquoMolecular mechanism ofprotopanaxadiol saponin fraction-mediated anti-inflammatoryactionsrdquo Journal of Ginseng Research vol 39 no 1 pp 61ndash682015

[40] L A J OrsquoNeill K A Fitzgerald and A G Bowie ldquoThe Toll-IL-1 receptor adaptor family grows to five membersrdquo Trends inImmunology vol 24 no 6 pp 286ndash289 2003

[41] S E Byeon J Lee B C Yoo et al ldquoP38-targeted inhibition ofinterleukin-12 expression by ethanol extract from Cordycepsbassiana in lipopolysaccharide-activated macrophagesrdquo Immu-nopharmacology and Immunotoxicology vol 33 no 1 pp 90ndash96 2011

[42] M H Kim D S Yoo S Y Lee et al ldquoThe TRIFTBK1IRF-3activation pathway is the primary inhibitory target of resver-atrol contributing to its broad-spectrum anti-inflammatoryeffectsrdquo Pharmazie vol 66 no 4 pp 293ndash300 2011

[43] S Ghosh and M S Hayden ldquoNew regulators of NF-120581B ininflammationrdquo Nature Reviews Immunology vol 8 no 11 pp837ndash848 2008

[44] R Medzhitov and T Horng ldquoTranscriptional control of theinflammatory responserdquoNature Reviews Immunology vol 9 no10 pp 692ndash703 2009

[45] T Kawai and S Akira ldquoToll-like receptors and their crosstalkwith other innate receptors in infection and immunityrdquo Immu-nity vol 34 no 5 pp 637ndash650 2011

[46] K Mehla S Balwani A Kulshreshtha D Nandi P Jaisankarand B Ghosh ldquoEthyl gallate isolated from Pistacia integerrimaLinn inhibits cell adhesion molecules by blocking AP-1 tran-scription factorrdquo Journal of Ethnopharmacology vol 137 no 3pp 1345ndash1352 2011

[47] T Yu H M Ahn T Shen et al ldquoAnti-inflammatory activity ofethanol extract derived fromPhaseolus angularis beansrdquo Journalof Ethnopharmacology vol 137 no 3 pp 1197ndash1206 2011

[48] H S Kim A-R Kim H J Park et al ldquoMorus bombycis Koid-zumi extract suppresses collagen-induced arthritis by inhibitingthe activation of nuclear factor-120581B and activator protein-1 inmicerdquo Journal of Ethnopharmacology vol 136 no 3 pp 392ndash398 2011

[49] T Yu Y J Lee H M Yang et al ldquoInhibitory effect of San-guisorba officinalis ethanol extract onNO and PGE

2production

is mediated by suppression of NF-120581B and AP-1 activationsignaling cascaderdquo Journal of Ethnopharmacology vol 134 no1 pp 11ndash17 2011

[50] M Guha and N Mackman ldquoLPS induction of gene expressionin human monocytesrdquo Cellular Signalling vol 13 no 2 pp 85ndash94 2001

[51] S-J Seo J Y Cho Y H Jeong and Y-S Choi ldquoEffect of Koreanred ginseng extract on liver damage induced by shorttermand long-term ethanol treatment in ratsrdquo Journal of GinsengResearch vol 37 no 2 pp 194ndash200 2013

[52] A Pareek A Godavarthi R Issarani and B P Nagori ldquoAntiox-idant and hepatoprotective activity of Fagonia schweinfurthii(Hadidi) Hadidi extract in carbon tetrachloride induced hep-atotoxicity in HepG2 cell line and ratsrdquo Journal of Ethnophar-macology vol 150 no 3 pp 973ndash981 2013

[53] H Mohd Yusof N M Ali S K Yeap et al ldquoHepatoprotectiveeffect of fermented soybean (nutrient enriched soybean tem-peh) against alcohol-induced liver damage in micerdquo Evidence-Based Complementary and Alternative Medicine vol 2013Article ID 274274 8 pages 2013

[54] J J Campos A De Oliveira Azevedo J D De Souza FilhoA Castro Perez and F Castro Braga ldquoBioguided isolation ofmyricetin-3-O-120573-galactopyranoside with antinociceptive activ-ity from the aerial part of Davilla elliptica St-Hilrdquo Journal ofEthnopharmacology vol 150 no 1 pp 270ndash274 2013

[55] S M Salama M A Abdulla A S Alrashdi and A H A HadildquoMechanism of hepatoprotective effect of Boesenbergia rotundain thioacetamide-induced liver damage in ratsrdquo Evidence-basedComplementary and Alternative Medicine vol 2013 Article ID157456 13 pages 2013

Submit your manuscripts athttpwwwhindawicom

Stem CellsInternational

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

MEDIATORSINFLAMMATION

of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Behavioural Neurology

EndocrinologyInternational Journal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Disease Markers

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

BioMed Research International

OncologyJournal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Oxidative Medicine and Cellular Longevity

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

PPAR Research

The Scientific World JournalHindawi Publishing Corporation httpwwwhindawicom Volume 2014

Immunology ResearchHindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Journal of

ObesityJournal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Computational and Mathematical Methods in Medicine

OphthalmologyJournal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Diabetes ResearchJournal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Research and TreatmentAIDS

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Gastroenterology Research and Practice

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Parkinsonrsquos Disease

Evidence-Based Complementary and Alternative Medicine

Volume 2014Hindawi Publishing Corporationhttpwwwhindawicom

Evidence-Based Complementary and Alternative Medicine 5

Tag2 +minus

minus

minus

+minus

minus

+100

minus

+200

minus

+300

MyD88

0

2

4

6

8

10

lowastlowast lowastlowastlowastlowast

Pc-ME (120583gmL)

AP-1-

med

iate

d lu

cife

rase

ac

tivity

(fol

d in

crea

se)

(a)

pcDNA +minusminus

minus

+minus

minus

+100

minus

+200

minus

+300

TRIF

0

1

2

3

4

5

6

lowastlowast

lowastlowast

lowast

Pc-ME (120583gmL)

AP-1-

med

iate

d lu

cife

rase

ac

tivity

(fol

d in

crea

se)

(b)

0

10

20

30

40

50

60

minus

minus

+

minus

+100

+200

+300

lowastlowast

lowastlowast

Pc-ME (120583gmL)PMA (100nM)

AP-1-

med

iate

d lu

cife

rase

activ

ity (f

old

incr

ease

)

(c)

Figure 2 Effect of Pc-ME on the reporter gene assay The promoter binding activity of the transcription factor AP-1 was analyzed using areporter gene assay in HEK293 cells transfected with plasmid constructs AP-1-Luc (1 120583gmL) or 120573-gal (as a transfection control) with 1120583gmLof MyD88 (a) or TRIF (b) and 100 nM PMA (c) in the presence of Pc-ME Luciferase activity was measured using a luminometer lowastlowast119875 lt 001compared with control

left panel) in RAW2647 cells The right panel in Figure 4(a)shows that Pc-ME (50 100 200 and 300120583gmL) dose-dependently blocked the phosphorylation of ERK and JNKwhich validates our experimental findings and confirmsour expectations Upstream signaling enzymes (MEK12 andMKK4) contributing to ERK and JNK phosphorylation wereappreciably blocked by Pc-ME at 2 3 and 5min of LPS treat-ment (Figure 4(b)) which demonstrates that MEK12 andMKK4 might be targeted by Pc-ME in its AP-1-suppressiveanti-inflammatory actions in LPS-stimulated RAW2647cells In concurrence with our LPSD-GalN-treated micehepatitis experimental model the upregulation of phospho-rylated MKK4 and c-Fos in the liver tissue was markedlysuppressed by orally administered Pc-ME (Figure 5(d))

35 Hepatoprotective Effect of Pc-ME on LPSD-GalN-InducedLiver Injury in Mice We used a mouse model of LPSD-GalN-induced liver injury to investigate the in vivo hep-atoprotective effect of Pc-ME LPSD-GalN-triggered ALT

(14000UL) and AST (10000UL) protein levels were sig-nificantly (119875 lt 001) decreased by Pc-ME (Figures 5(a)and 5(b))Moreover histopathological analysis demonstratedthat the liver sections of the LPSD-GalN group displayedmore neutrophil recruitment as assessed by bigger sized andincreased numbers dark spots (see arrows in Figure 5(c))compared with the saline-treated control groups in contrastthe Pc-ME-treated groups exhibited lower neutrophil num-bers (Figure 5(c)) which demonstrates the strong hepatopro-tective activity of Pc-ME

36 Effect of Quercetin on AP-1 Activity Cotransfectionwith the adaptor molecule MyD88 enhanced AP-1-mediatedluciferase activity by 45-fold quercetin a major flavonoidfrom Pc-ME [17] significantly (119875 lt 001) and dose-dependently inhibited this upregulation (Figure 6) whichdemonstrates that AP-1 activation is amajor pharmacologicaltarget of Pc-ME and its ingredient quercetin

6 Evidence-Based Complementary and Alternative Medicine

Lamin AC

+

minus

+

300

+

minus

+

300

+

minus

+

300

+

minus

+

300

Nuclear fraction (RAW2647 cells)

minus

minus

c-Fos

c-Jun

Pc-ME (120583gmL)

15min 30min 60min 120min

LPS (1120583gmL)

(a)

+

minus

+

minus

+

300

U937 cells

minus

minus

+

300

p-c-Fos

c-Fos

Pc-ME (120583gmL)

30min 60min

120573-actin

LPS (10120583gmL)

(b)

minus

minus

+

minus

+

100

+

300

GAPDH

IL-6

Pc-ME (120583gmL)LPS (1120583gmL)

RAW2647 cells (6h)

TNF-120572

IL-1120573

(c)

0

1000

2000

3000

4000

5000

6000

7000

minus minus 300

lowastlowast

Pc-ME (120583gmL)

TNF-120572

expr

essio

n (r

elat

ive q

uant

ity)

U937 cells (12h)

LPS (10120583gmL)(d)

0

200

400

600

800

1000

1200

1400

1600

minus minus 300

lowastlowast

Pc-ME (120583gmL)

IL-1120573

expr

essio

n (r

elat

ive q

uant

ity)

LPS (10120583gmL)

U937 cells (12h)

(e)

0

5

10

15

20

25

IL-6

gen

e exp

ress

ion

(rel

ativ

e qua

ntity

)

minus minus 300

lowastlowast

Pc-ME (120583gmL)

U937 cells (12h)

LPS (10120583gmL)

(f)

Figure 3 Effect of Pc-ME on the activation of proinflammatory cytokines and transcriptional regulation (a) Levels of c-Fos c-Jun andlamin AC in nuclear fractions were determined by immunoblot analysis in RAW2647 cells (b) Phospho- or total protein levels of c-Fosand 120573-actin in cell lysates were determined by immunoblot analysis in U937 cells (c) mRNA levels of TNF-120572 IL-1120573 IL-6 and GAPDH weredetermined by semiquantitative RT-PCR in RAW2647 cells (dndashf) mRNA levels of TNF-120572 IL-1120573 and IL-6 were determined by real-timeRT-PCR in U937 cells

4 Discussion

While P chinensis has high ethnopharmacological worthin Eastern Asian countries the molecular mechanisms

underlying its anti-inflammatory activity are still unknownRecently our studies have revealed that P chinensismethanolextract exhibits strong antigastritis activity and is able toblock NF-120581B activation via suppression of Src and Syk

Evidence-Based Complementary and Alternative Medicine 7

15min 30min 60min5min RAW2647 cells (30min)

p-ERK

ERK

p-JNK

JNKp-JNK

ERK

p-ERK

p-p38

p38

JNK

RAW2647 cells

minus

minus

+

minus

+

50

+

100

+

200

+

300

minus

minus

+

minus

+

300

+

minus

+

300

+

minus

+

300

+

minus

+

300Pc-ME (120583gmL)LPS (1120583gmL)

Pc-ME (120583gmL)LPS (1120583gmL)

120573-actin

120573-actin

(a)

5min3min2minminus

minus

+

minus

+

300

+

minus

+

300

+

minus

+

300

p-MEK12

MEK12

MKK4

p-MKK4

RAW2647 cells

Pc-ME (120583gmL)LPS (1120583gmL)

120573-actin

(b)

Figure 4 Effect of Pc-ME on the activation of upstream signaling enzymes of AP-1 translocation (a and b) Phospho- and total protein levelsof ERK JNK p38 MEK12 MKK4 and 120573-actin in cell lysates were determined by immunoblotting analysis

activities [17] However SrcSyk-linked activation of NF-120581Bis not the only important regulatory loop of inflammatoryreaction In addition it has been reported that AP-1 activatedby MAPK plays another crucial roles in inflammatory reac-tion [11 38 39] In the present study therefore we aimed toelucidate inhibitory mechanism of Pc-ME on AP-1 functionin vitro and in vivo by using LPS-activated macrophages andLPSD-GalN-triggered hepatitis model

It has been shown that reporter gene luciferase assayperformed in conjunction with HEK293 cells transfectedwith Luc constructs and adaptor molecules essential for TLRsignaling [40] is a reasonable approach for studying func-tional activation of transcription factors [41 42] Thereforeto examine the ability of Pc-ME to suppress AP-1 functionwe first employed the luciferase assay using HEK293 cellstransfected with the AP-1-Luc construct As expected AP-1-mediated luciferase activity was enhanced up to 45- to485-fold by PMA treatment or cotransfection with adaptormolecules (TRIF and MyD88) and Pc-ME notably inhibitedthis upregulation in a dose-dependent manner (Figure 2)Moreover nuclear translocation of c-Fos was reduced by Pc-ME treatment in a time-dependent manner (Figure 3(a))

implying that AP-1 family of transcription factors can befunctionally inactivated and that their upstream kinasesresponsible for AP-1 phosphorylation can be targeted

Several earlier reports have suggested that several proin-flammatory cytokines such as TNF-120572 IL-1120573 and IL-6 playan important role in boosting proinflammatory roles ofmacrophages [43ndash45] We therefore further tested whetherthese proinflammatory cytokines can be also suppressedby Pc-ME using LPS-treated RAW2647 cells The mRNAanalysis of these cytokines by RT-PCR in RAW2647 cells(Figure 3(c)) and by real-time PCR in U937 cells (Figures3(d)ndash3(f)) revealed that mRNA levels of TNF-120572 IL-1120573 andIL-6 were strongly upregulated by LPS treatment while Pc-ME significantly and dose-dependently (100 and 300120583gmL)inhibited such upregulation indicating that AP-1 suppressionby Pc-ME may be associated with blockade of these proin-flammatory cytokines as well as its suppressive activity onthe expression of iNOS and COX-2 [17] In fact a number ofstudies have also reported thatmany knownherbalmedicinessuch as Polygonum hydropiper Pistacia integerrima Phase-olus angularis Morus bombycis Koidzumi and Sanguisorbaofficinalis possess AP-1 pathway inhibitory activity as their

8 Evidence-Based Complementary and Alternative Medicine

ALT

(UL

)

minus +0

5000

10000

15000

20000

25000

lowastlowast

Pc-ME (200mgkg)

LPS (10120583gkg)D-GalN (1mgkg)

(a)

AST

(UL

)

0

5000

10000

15000

20000

minus +

lowastlowast

Pc-ME (200mgkg)

LPS (10120583gkg)D-GalN (1mgkg)

(b)

HampE staining

Normal LPSD-GalN Pc-ME (200mgkg)

(c)

Liver lysate

minus

minus

+minus

++

MKK4

c-Fos

p-c-Fos

LPSD-GalN

p-MKK4

120573-actin

Pc-ME (200mgkg)

(d)

Figure 5 Effect of Pc-ME on LPSD-GalN-induced hepatitis in mice Mice were orally treated with Pc-ME (200mgkg) for six days beforeintraperitoneal injection of LPSD-GalN After 1 h mice were sacrificed to collect blood samples and liver sections for biochemical parameteranalysis of (a) ALT (b) AST and (c) histopathological examination (d) Phospho- or total protein levels of MKK4 c-Fos and 120573-actin in liverlysates were determined by immunoblot analysis

pharmacological target [26 46ndash49] Therefore the fact thatPc-ME is able to inhibit AP-1 pathway could be also acceptedas a general anti-inflammatory mechanism of this plant

As MAPKs play a vital role in the regulation of LPS-induced inflammation by controlling AP-1 activation [21] weexamine themolecular inhibitory effects of Pc-MEon theAP-1 pathway Toward this goal we analyzed the inhibitory effectof Pc-ME on MAPKs and their upstream signaling enzymes

[50]The results of our study demonstrated that Pc-ME treat-ment time-dependently (5 15 30 and 60min) blocked ERKand JNK phosphorylation (Figure 4(a) left panel) poten-tially leading to significant attenuation of AP-1 activationin response to LPS The dose-dependent (50 to 300 120583gmL)inhibition pattern of the same MAPK phosphorylation bythis extract (Figure 4(a) right panel) strongly supported ourexperimental condition and hypothesisThe phosphorylation

Evidence-Based Complementary and Alternative Medicine 9A

P-1-

med

iate

d lu

cife

rase

activ

ity (f

old

incr

ease

)

Tag2MyD88

0

1

2

3

4

5

+

minusminus

minus

+minus

minus

+20

minus

+40

minus

+80

lowastlowastlowastlowast

lowastlowast

Quercetin (120583M)

Figure 6 Effect of quercetin on the activation of upstream signalingenzymes of AP-1 in a reporter gene assay The promoter bindingactivity of the transcription factor AP-1 was analyzed using areporter gene assay in HEK293 cells transfected with plasmidconstructs AP-1-Luc (1 120583gmL) and 120573-gal (as a transfection control)with 1 120583gmL of MyD88 in the presence of quercetin Luciferaseactivity was measured using a luminometer lowastlowast119875 lt 001 comparedwith control

of MEK12 and MKK4 the upstream enzymes of ERK andJNK respectively was also strikingly suppressed by Pc-MEin LPS challenges of 2 3 and 5min (Figure 4(b)) confirmingthe MAPK inhibitory activity of this extract

MAPK activation and subsequent AP-1 activation arestrongly linked to the induction of hepatitis [22 23] Sowe guess that AP-1-inhibitory extract Pc-ME is capable ofattenuating hepatitis symptoms To test this hypothesis weemployed LPSD-GalN-intoxicated acute liver injury modelwhich is a classical system for screening hepatoprotectiveremedy in vivo [32] Our previous study indicating thatPc-ME can protect against HClEtOH-induced gastritis byinhibiting SrcSyk of NF-120581B [17] has demonstrated the oraleffectiveness of this extract In the present study expectedlyPc-ME treatment (200mgkg) effectively ameliorated theLPSD-GalN-induced liver damage (Figure 5(c)) includingreversion of LPSD-GalN-elevated hepatic ALT (Figure 5(a))and AST (Figure 5(b)) enzyme levels In the in vivo hepatictissue the upregulated phosphorylation of MKK4 and c-Fos(component of AP-1) was also noticeably blocked by Pc-MEtreatment (Figure 5(d)) which strongly authenticated ourfindings In addition quercetin a major antioxidative andanti-inflammatory compound of P chinensis [17] also drasti-cally diminished theAP-1 activation in a dose-dependent pat-tern (Figure 6) supporting that MAPKAP-1-targeted anti-inflammatory activity of Pc-ME could be quercetin-derivedanti-inflammatory action Although numerous numbers ofmedicinal plants or edible fruits such as Panax ginsengFagonia schweinfurthii fermented soybean Davilla ellipticaand Boesenbergia rotunda have been reported to show anti-hepatitis activities [51ndash55] only few plants are now clinicallyprescribed It was revealed that Pc-ME is able to stronglysuppress both NF-120581B [17] and AP-1 activity we will further

TLR4

LPS

Pc-ME

Tissue damage

MyD88

MAPK

ERK JNK

c-Fos

AP-1

TRIF

IL-6 IL-1120573

TNF-120572

TNF-120572

IL-6 IL-1120573

Figure 7 Putative mechanism of Pc-ME-mediated anti-inflam-matory responses

validate whether Pc-ME can be also clinically developed as anew antihepatitis herbal drug

In summary our in vivo and in vitro assays demonstratedthat Pc-ME significantly reduced the levels of LPS-mediatedproinflammatory cytokines (TNF-120572 IL-1120573 and IL-6) andthat MAPKAP-1 inactivation by this extract contributes tothese inhibitory effects as summarized in Figure 7The strongantihepatotoxic activity of Pc-ME in vivo was observed in amousemodel of LPSD-GalN-induced liver injury indicatingthat Pc-ME could potentially be used as a hepatoprotectiveremedy

Conflict of Interests

The authors report no conflict of interests The authors aloneare responsible for the content and writing of the paper

Authorsrsquo Contribution

Muhammad Jahangir Hossen and Seung Cheol Kim equallycontributed to this work

Acknowledgment

This study was supported by a grant of the Korean HealthTechnology RampD Project Ministry of Health amp WelfareRepublic of Korea (HI12C0050)

References

[1] C-K Tseng C-K Lin H-W Chang et al ldquoAqueous extractof Gracilaria tenuistipitata suppresses LPS-induced NF-120581Band MAPK activation in RAW 2647 and rat peritonealmacrophages and exerts hepatoprotective effects on carbon

10 Evidence-Based Complementary and Alternative Medicine

tetrachloride-treated ratrdquo PLoS ONE vol 9 no 1 Article IDe86557 2014

[2] H C Steel R Cockeran R Anderson and C Feldman ldquoOver-viewof community-acquired pneumonia and the role of inflam-matory mechanisms in the immunopathogenesis of severepneumococcal diseaserdquo Mediators of Inflammation vol 2013Article ID 490346 18 pages 2013

[3] M Pasparakis ldquoRegulation of tissue homeostasis by NF-Bsignalling implications for inflammatory diseasesrdquo NatureReviews Immunology vol 9 no 11 pp 778ndash788 2009

[4] J-K Kim and G-M Park ldquoIndirubin-3-monoxime exhibitsanti-inflammatory properties by down-regulating NF-120581Band JNK signaling pathways in lipopolysaccharide- treatedRAW2647 cellsrdquo Inflammation Research vol 61 no 4 pp319ndash325 2012

[5] MHamandAMoon ldquoInflammatory andmicroenvironmentalfactors involved in breast cancer progressionrdquo Archives ofPharmacal Research vol 36 no 12 pp 1419ndash1431 2013

[6] M-S Lee ldquoRole of innate immunity in diabetes and metab-olism recent progress in the study of inflammasomesrdquo ImmuneNetwork vol 11 no 2 pp 95ndash99 2011

[7] Y Ayele J-A Kim E Park et al ldquoA methanol extract of Adan-sonia digitata L leaves inhibits pro-inflammatory iNOS possi-bly via the inhibition of NF-120581B activationrdquo Biomolecules andTherapeutics vol 21 no 2 pp 146ndash152 2013

[8] D H Kim J H Chung J S Yoon et al ldquoGinsenoside Rdinhibits the expressions of iNOS andCOX-2 by suppressingNF-120581B in LPS-stimulated RAW2647 cells and mouse liverrdquo Journalof Ginseng Research vol 37 no 1 pp 54ndash63 2013

[9] M Fujihara M Muroi K-I Tanamoto T Suzuki H Azumaand H Ikeda ldquoMolecular mechanisms of macrophage activa-tion and deactivation by lipopolysaccharide roles of the recep-tor complexrdquo Pharmacology and Therapeutics vol 100 no 2pp 171ndash194 2003

[10] T Yu Y J Li A H Bian et al ldquoThe regulatory role of activat-ing transcription factor 2 in inflammationrdquoMediators of Inflam-mation vol 2014 Article ID 950472 10 pages 2014

[11] I-T Lee and C-M Yang ldquoInflammatory signalings involvedin airway and pulmonary diseasesrdquoMediators of Inflammationvol 2013 Article ID 791231 12 pages 2013

[12] E D Chan and D W H Riches ldquoIFN-120574 + LPS induction ofiNOS is modulated by ERK JNKSAPK and p38mapk in amouse macrophage cell linerdquo The American Journal of Physi-ologymdashCell Physiology vol 280 no 3 pp C441ndashC450 2001

[13] I N Crispe ldquoThe liver as a lymphoid organrdquo Annual Review ofImmunology vol 27 pp 147ndash163 2009

[14] F Tacke T Luedde and C Trautwein ldquoInflammatory pathwaysin liver homeostasis and liver injuryrdquoClinical Reviews in Allergyamp Immunology vol 36 no 1 pp 4ndash12 2009

[15] M Y Jia Y P Jing Q Ai et al ldquoPotential role of catalase inmicewith lipopolysaccharideD-galactosamine-induced fulminantliver injuryrdquo Hepatology Research vol 44 no 11 pp 1151ndash11582014

[16] Q Ai Y Jing R Jiang et al ldquoRotenone a mitochondrial res-piratory complex i inhibitor ameliorates lipopolysaccharideD-galactosamine-induced fulminant hepatitis in micerdquo Interna-tional Immunopharmacology vol 21 no 1 pp 200ndash207 2014

[17] M J Hossen K-S Baek E Kim et al ldquoIn vivo and in vitroanti-inflammatory activities of Persicaria chinensis methanolicextract targeting SrcSykNF-120581Brdquo Journal of Ethnopharmacol-ogy vol 159 pp 9ndash16 2015

[18] D R Luitel M B Rokaya B Timsina and Z MunzbergovaldquoMedicinal plants used by the Tamang community in theMakawanpur district of central Nepalrdquo Journal of Ethnobiologyand Ethnomedicine vol 10 no 1 article 5 2014

[19] W M May The reproductive biology and cytotoxic activity ofpersicaria chinensis (L) H gross var chinensis (Polygonaceae)[Dissertation] University of Malaya 2012

[20] S M Lai D Sudhahar and K Anandarajagopal ldquoEvaluationof antibacterial and antifungal activities of Persicaria chinensisleavesrdquo International Journal of Pharmaceutical Sciences ampResearch vol 3 p 8 2012

[21] B Veres B Radnai F Gallyas Jr et al ldquoRegulation of kinase cas-cades and transcription factors by a poly(ADP-ribose) polym-erase-1 inhibitor 4-hydroxyquinazoline in lipopolysaccharide-induced inflammation in micerdquo Journal of Pharmacology andExperimental Therapeutics vol 310 no 1 pp 247ndash255 2004

[22] M Panteva H Korkaya and S Jameel ldquoHepatitis viruses andthe MAPK pathway is this a survival strategyrdquo Virus Researchvol 92 no 2 pp 131ndash140 2003

[23] A Laliena B S Miguel I Crespo M Alvarez J Gonzalez-Gallego and M J Tunon ldquoMelatonin attenuates inflammationand promotes regeneration in rabbits with fulminant hepatitisof viral originrdquo Journal of Pineal Research vol 53 no 3 pp 270ndash278 2012

[24] S E Byeon T Yu Y Yang et al ldquoHydroquinone regulateshemeoxygenase-1 expression via modulation of Src kinaseactivity through thiolation of cysteine residuesrdquo Free RadicalBiology and Medicine vol 57 pp 105ndash118 2013

[25] S E Byeon T Yu Y Yang et al ldquoHydroquinone regulateshemeoxygenase-1 expression via modulation of Src kinaseactivity through thiolation of cysteine residuesrdquo Free RadicalBiology and Medicine vol 57 pp 105ndash118 2013

[26] Y Yang T Yu H-J Jang et al ldquoIn vitro and in vivo anti-inflammatory activities of Polygonum hydropiper methanolextractrdquo Journal of Ethnopharmacology vol 139 no 2 pp 616ndash625 2012

[27] M-Y Kim and J Y Cho ldquo20S-dihydroprotopanaxadiol aginsenoside derivative boosts innate immune responses ofmonocytes and macrophagesrdquo Journal of Ginseng Research vol37 no 3 pp 293ndash299 2013

[28] E H Jho K Kang S Oidovsambuu et al ldquoGymnaster koraien-sis and its major components 35-di-O-caffeoylquinic acid andgymnasterkoreayne B reduce oxidative damage induced bytert-butyl hydroperoxide or acetaminophen in hepG2 cellsrdquoBMB Reports vol 46 no 10 pp 513ndash518 2013

[29] Y Yang T Yu Y G Lee et al ldquoMethanol extract ofHopea odor-ata suppresses inflammatory responses via the direct inhibitionof multiple kinasesrdquo Journal of Ethnopharmacology vol 145 no2 pp 598ndash607 2013

[30] S Sun Back J Kim D Choi E S Lee S Y Choi and K HanldquoCooperative transcriptional activation of ATP-binding cassettesterol transporters ABCG5 and ABCG8 genes by nuclear recep-tors including Liver-X-Receptorrdquo BMB Reports vol 46 no 6pp 322ndash327 2013

[31] C Liang Y Ding S B Song et al ldquoOleanane-triterpenoidsfrom Panax stipuleanatus inhibit NF-120581Brdquo Journal of GinsengResearch vol 37 no 1 pp 74ndash79 2013

[32] J Y Cho J D Yeon J Y Kim E S Yoo YH Yu andMH ParkldquoHepatoprotection by human epidermal growth factor (hEGF)against experimental hepatitis induced byD-galactosamine (D-GalN) or D-GalNlipopolysacchariderdquo Biological amp Pharma-ceutical Bulletin vol 23 no 10 pp 1243ndash1246 2000

Evidence-Based Complementary and Alternative Medicine 11

[33] C-W Lee F-L Yen H-W Huang et al ldquoResveratrol nanopar-ticle system improves dissolution properties and enhances thehepatoprotective effect of resveratrol through antioxidant andanti-inflammatory pathwaysrdquo Journal of Agricultural and FoodChemistry vol 60 no 18 pp 4662ndash4671 2012

[34] T Yu J Lee Y G Lee et al ldquoIn vitro and in vivo anti-inflam-matory effects of ethanol extract from Acer tegmentosumrdquoJournal of Ethnopharmacology vol 128 no 1 pp 139ndash147 2010

[35] Y-H Jeong J-W Hyun T K van Le D-H Kim and H-SKim ldquoKalopanaxsaponin A exerts anti-inflammatory effects inlipopolysaccharide-stimulated microglia via inhibition of JNKand NF-120581BAP-1 pathwaysrdquo Biomolecules andTherapeutics vol21 no 5 pp 332ndash337 2013

[36] M Feldmann ldquoMany cytokines are very useful therapeutictargets in diseaserdquoThe Journal of Clinical Investigation vol 118no 11 pp 3533ndash3536 2008

[37] B Kaminska ldquoMAPK signalling pathways as molecular targetsfor anti-inflammatory therapymdashfrom molecular mechanismsto therapeutic benefitsrdquoBiochimica et Biophysica ActamdashProteinsand Proteomics vol 1754 no 1-2 pp 253ndash262 2005

[38] Y Yang S C Kim T Yu et al ldquoFunctional roles of p38mitogen-activated protein kinase in macrophage-mediated inflamma-tory responsesrdquoMediators of Inflammation vol 2014 Article ID352371 13 pages 2014

[39] Y Yang J Lee M H Rhee et al ldquoMolecular mechanism ofprotopanaxadiol saponin fraction-mediated anti-inflammatoryactionsrdquo Journal of Ginseng Research vol 39 no 1 pp 61ndash682015

[40] L A J OrsquoNeill K A Fitzgerald and A G Bowie ldquoThe Toll-IL-1 receptor adaptor family grows to five membersrdquo Trends inImmunology vol 24 no 6 pp 286ndash289 2003

[41] S E Byeon J Lee B C Yoo et al ldquoP38-targeted inhibition ofinterleukin-12 expression by ethanol extract from Cordycepsbassiana in lipopolysaccharide-activated macrophagesrdquo Immu-nopharmacology and Immunotoxicology vol 33 no 1 pp 90ndash96 2011

[42] M H Kim D S Yoo S Y Lee et al ldquoThe TRIFTBK1IRF-3activation pathway is the primary inhibitory target of resver-atrol contributing to its broad-spectrum anti-inflammatoryeffectsrdquo Pharmazie vol 66 no 4 pp 293ndash300 2011

[43] S Ghosh and M S Hayden ldquoNew regulators of NF-120581B ininflammationrdquo Nature Reviews Immunology vol 8 no 11 pp837ndash848 2008

[44] R Medzhitov and T Horng ldquoTranscriptional control of theinflammatory responserdquoNature Reviews Immunology vol 9 no10 pp 692ndash703 2009

[45] T Kawai and S Akira ldquoToll-like receptors and their crosstalkwith other innate receptors in infection and immunityrdquo Immu-nity vol 34 no 5 pp 637ndash650 2011

[46] K Mehla S Balwani A Kulshreshtha D Nandi P Jaisankarand B Ghosh ldquoEthyl gallate isolated from Pistacia integerrimaLinn inhibits cell adhesion molecules by blocking AP-1 tran-scription factorrdquo Journal of Ethnopharmacology vol 137 no 3pp 1345ndash1352 2011

[47] T Yu H M Ahn T Shen et al ldquoAnti-inflammatory activity ofethanol extract derived fromPhaseolus angularis beansrdquo Journalof Ethnopharmacology vol 137 no 3 pp 1197ndash1206 2011

[48] H S Kim A-R Kim H J Park et al ldquoMorus bombycis Koid-zumi extract suppresses collagen-induced arthritis by inhibitingthe activation of nuclear factor-120581B and activator protein-1 inmicerdquo Journal of Ethnopharmacology vol 136 no 3 pp 392ndash398 2011

[49] T Yu Y J Lee H M Yang et al ldquoInhibitory effect of San-guisorba officinalis ethanol extract onNO and PGE

2production

is mediated by suppression of NF-120581B and AP-1 activationsignaling cascaderdquo Journal of Ethnopharmacology vol 134 no1 pp 11ndash17 2011

[50] M Guha and N Mackman ldquoLPS induction of gene expressionin human monocytesrdquo Cellular Signalling vol 13 no 2 pp 85ndash94 2001

[51] S-J Seo J Y Cho Y H Jeong and Y-S Choi ldquoEffect of Koreanred ginseng extract on liver damage induced by shorttermand long-term ethanol treatment in ratsrdquo Journal of GinsengResearch vol 37 no 2 pp 194ndash200 2013

[52] A Pareek A Godavarthi R Issarani and B P Nagori ldquoAntiox-idant and hepatoprotective activity of Fagonia schweinfurthii(Hadidi) Hadidi extract in carbon tetrachloride induced hep-atotoxicity in HepG2 cell line and ratsrdquo Journal of Ethnophar-macology vol 150 no 3 pp 973ndash981 2013

[53] H Mohd Yusof N M Ali S K Yeap et al ldquoHepatoprotectiveeffect of fermented soybean (nutrient enriched soybean tem-peh) against alcohol-induced liver damage in micerdquo Evidence-Based Complementary and Alternative Medicine vol 2013Article ID 274274 8 pages 2013

[54] J J Campos A De Oliveira Azevedo J D De Souza FilhoA Castro Perez and F Castro Braga ldquoBioguided isolation ofmyricetin-3-O-120573-galactopyranoside with antinociceptive activ-ity from the aerial part of Davilla elliptica St-Hilrdquo Journal ofEthnopharmacology vol 150 no 1 pp 270ndash274 2013

[55] S M Salama M A Abdulla A S Alrashdi and A H A HadildquoMechanism of hepatoprotective effect of Boesenbergia rotundain thioacetamide-induced liver damage in ratsrdquo Evidence-basedComplementary and Alternative Medicine vol 2013 Article ID157456 13 pages 2013

Submit your manuscripts athttpwwwhindawicom

Stem CellsInternational

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

MEDIATORSINFLAMMATION

of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Behavioural Neurology

EndocrinologyInternational Journal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Disease Markers

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

BioMed Research International

OncologyJournal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Oxidative Medicine and Cellular Longevity

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

PPAR Research

The Scientific World JournalHindawi Publishing Corporation httpwwwhindawicom Volume 2014

Immunology ResearchHindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Journal of

ObesityJournal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Computational and Mathematical Methods in Medicine

OphthalmologyJournal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Diabetes ResearchJournal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Research and TreatmentAIDS

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Gastroenterology Research and Practice

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Parkinsonrsquos Disease

Evidence-Based Complementary and Alternative Medicine

Volume 2014Hindawi Publishing Corporationhttpwwwhindawicom

6 Evidence-Based Complementary and Alternative Medicine

Lamin AC

+

minus

+

300

+

minus

+

300

+

minus

+

300

+

minus

+

300

Nuclear fraction (RAW2647 cells)

minus

minus

c-Fos

c-Jun

Pc-ME (120583gmL)

15min 30min 60min 120min

LPS (1120583gmL)

(a)

+

minus

+

minus

+

300

U937 cells

minus

minus

+

300

p-c-Fos

c-Fos

Pc-ME (120583gmL)

30min 60min

120573-actin

LPS (10120583gmL)

(b)

minus

minus

+

minus

+

100

+

300

GAPDH

IL-6

Pc-ME (120583gmL)LPS (1120583gmL)

RAW2647 cells (6h)

TNF-120572

IL-1120573

(c)

0

1000

2000

3000

4000

5000

6000

7000

minus minus 300

lowastlowast

Pc-ME (120583gmL)

TNF-120572

expr

essio

n (r

elat

ive q

uant

ity)

U937 cells (12h)

LPS (10120583gmL)(d)

0

200

400

600

800

1000

1200

1400

1600

minus minus 300

lowastlowast

Pc-ME (120583gmL)

IL-1120573

expr

essio

n (r

elat

ive q

uant

ity)

LPS (10120583gmL)

U937 cells (12h)

(e)

0

5

10

15

20

25

IL-6

gen

e exp

ress

ion

(rel

ativ

e qua

ntity

)

minus minus 300

lowastlowast

Pc-ME (120583gmL)

U937 cells (12h)

LPS (10120583gmL)

(f)

Figure 3 Effect of Pc-ME on the activation of proinflammatory cytokines and transcriptional regulation (a) Levels of c-Fos c-Jun andlamin AC in nuclear fractions were determined by immunoblot analysis in RAW2647 cells (b) Phospho- or total protein levels of c-Fosand 120573-actin in cell lysates were determined by immunoblot analysis in U937 cells (c) mRNA levels of TNF-120572 IL-1120573 IL-6 and GAPDH weredetermined by semiquantitative RT-PCR in RAW2647 cells (dndashf) mRNA levels of TNF-120572 IL-1120573 and IL-6 were determined by real-timeRT-PCR in U937 cells

4 Discussion

While P chinensis has high ethnopharmacological worthin Eastern Asian countries the molecular mechanisms

underlying its anti-inflammatory activity are still unknownRecently our studies have revealed that P chinensismethanolextract exhibits strong antigastritis activity and is able toblock NF-120581B activation via suppression of Src and Syk

Evidence-Based Complementary and Alternative Medicine 7

15min 30min 60min5min RAW2647 cells (30min)

p-ERK

ERK

p-JNK

JNKp-JNK

ERK

p-ERK

p-p38

p38

JNK

RAW2647 cells

minus

minus

+

minus

+

50

+

100

+

200

+

300

minus

minus

+

minus

+

300

+

minus

+

300

+

minus

+

300

+

minus

+

300Pc-ME (120583gmL)LPS (1120583gmL)

Pc-ME (120583gmL)LPS (1120583gmL)

120573-actin

120573-actin

(a)

5min3min2minminus

minus

+

minus

+

300

+

minus

+

300

+

minus

+

300

p-MEK12

MEK12

MKK4

p-MKK4

RAW2647 cells

Pc-ME (120583gmL)LPS (1120583gmL)

120573-actin

(b)

Figure 4 Effect of Pc-ME on the activation of upstream signaling enzymes of AP-1 translocation (a and b) Phospho- and total protein levelsof ERK JNK p38 MEK12 MKK4 and 120573-actin in cell lysates were determined by immunoblotting analysis

activities [17] However SrcSyk-linked activation of NF-120581Bis not the only important regulatory loop of inflammatoryreaction In addition it has been reported that AP-1 activatedby MAPK plays another crucial roles in inflammatory reac-tion [11 38 39] In the present study therefore we aimed toelucidate inhibitory mechanism of Pc-ME on AP-1 functionin vitro and in vivo by using LPS-activated macrophages andLPSD-GalN-triggered hepatitis model

It has been shown that reporter gene luciferase assayperformed in conjunction with HEK293 cells transfectedwith Luc constructs and adaptor molecules essential for TLRsignaling [40] is a reasonable approach for studying func-tional activation of transcription factors [41 42] Thereforeto examine the ability of Pc-ME to suppress AP-1 functionwe first employed the luciferase assay using HEK293 cellstransfected with the AP-1-Luc construct As expected AP-1-mediated luciferase activity was enhanced up to 45- to485-fold by PMA treatment or cotransfection with adaptormolecules (TRIF and MyD88) and Pc-ME notably inhibitedthis upregulation in a dose-dependent manner (Figure 2)Moreover nuclear translocation of c-Fos was reduced by Pc-ME treatment in a time-dependent manner (Figure 3(a))

implying that AP-1 family of transcription factors can befunctionally inactivated and that their upstream kinasesresponsible for AP-1 phosphorylation can be targeted

Several earlier reports have suggested that several proin-flammatory cytokines such as TNF-120572 IL-1120573 and IL-6 playan important role in boosting proinflammatory roles ofmacrophages [43ndash45] We therefore further tested whetherthese proinflammatory cytokines can be also suppressedby Pc-ME using LPS-treated RAW2647 cells The mRNAanalysis of these cytokines by RT-PCR in RAW2647 cells(Figure 3(c)) and by real-time PCR in U937 cells (Figures3(d)ndash3(f)) revealed that mRNA levels of TNF-120572 IL-1120573 andIL-6 were strongly upregulated by LPS treatment while Pc-ME significantly and dose-dependently (100 and 300120583gmL)inhibited such upregulation indicating that AP-1 suppressionby Pc-ME may be associated with blockade of these proin-flammatory cytokines as well as its suppressive activity onthe expression of iNOS and COX-2 [17] In fact a number ofstudies have also reported thatmany knownherbalmedicinessuch as Polygonum hydropiper Pistacia integerrima Phase-olus angularis Morus bombycis Koidzumi and Sanguisorbaofficinalis possess AP-1 pathway inhibitory activity as their

8 Evidence-Based Complementary and Alternative Medicine

ALT

(UL

)

minus +0

5000

10000

15000

20000

25000

lowastlowast

Pc-ME (200mgkg)

LPS (10120583gkg)D-GalN (1mgkg)

(a)

AST

(UL

)

0

5000

10000

15000

20000

minus +

lowastlowast

Pc-ME (200mgkg)

LPS (10120583gkg)D-GalN (1mgkg)

(b)

HampE staining

Normal LPSD-GalN Pc-ME (200mgkg)

(c)

Liver lysate

minus

minus

+minus

++

MKK4

c-Fos

p-c-Fos

LPSD-GalN

p-MKK4

120573-actin

Pc-ME (200mgkg)

(d)

Figure 5 Effect of Pc-ME on LPSD-GalN-induced hepatitis in mice Mice were orally treated with Pc-ME (200mgkg) for six days beforeintraperitoneal injection of LPSD-GalN After 1 h mice were sacrificed to collect blood samples and liver sections for biochemical parameteranalysis of (a) ALT (b) AST and (c) histopathological examination (d) Phospho- or total protein levels of MKK4 c-Fos and 120573-actin in liverlysates were determined by immunoblot analysis

pharmacological target [26 46ndash49] Therefore the fact thatPc-ME is able to inhibit AP-1 pathway could be also acceptedas a general anti-inflammatory mechanism of this plant

As MAPKs play a vital role in the regulation of LPS-induced inflammation by controlling AP-1 activation [21] weexamine themolecular inhibitory effects of Pc-MEon theAP-1 pathway Toward this goal we analyzed the inhibitory effectof Pc-ME on MAPKs and their upstream signaling enzymes

[50]The results of our study demonstrated that Pc-ME treat-ment time-dependently (5 15 30 and 60min) blocked ERKand JNK phosphorylation (Figure 4(a) left panel) poten-tially leading to significant attenuation of AP-1 activationin response to LPS The dose-dependent (50 to 300 120583gmL)inhibition pattern of the same MAPK phosphorylation bythis extract (Figure 4(a) right panel) strongly supported ourexperimental condition and hypothesisThe phosphorylation

Evidence-Based Complementary and Alternative Medicine 9A

P-1-

med

iate

d lu

cife

rase

activ

ity (f

old

incr

ease

)

Tag2MyD88

0

1

2

3

4

5

+

minusminus

minus

+minus

minus

+20

minus

+40

minus

+80

lowastlowastlowastlowast

lowastlowast

Quercetin (120583M)

Figure 6 Effect of quercetin on the activation of upstream signalingenzymes of AP-1 in a reporter gene assay The promoter bindingactivity of the transcription factor AP-1 was analyzed using areporter gene assay in HEK293 cells transfected with plasmidconstructs AP-1-Luc (1 120583gmL) and 120573-gal (as a transfection control)with 1 120583gmL of MyD88 in the presence of quercetin Luciferaseactivity was measured using a luminometer lowastlowast119875 lt 001 comparedwith control

of MEK12 and MKK4 the upstream enzymes of ERK andJNK respectively was also strikingly suppressed by Pc-MEin LPS challenges of 2 3 and 5min (Figure 4(b)) confirmingthe MAPK inhibitory activity of this extract

MAPK activation and subsequent AP-1 activation arestrongly linked to the induction of hepatitis [22 23] Sowe guess that AP-1-inhibitory extract Pc-ME is capable ofattenuating hepatitis symptoms To test this hypothesis weemployed LPSD-GalN-intoxicated acute liver injury modelwhich is a classical system for screening hepatoprotectiveremedy in vivo [32] Our previous study indicating thatPc-ME can protect against HClEtOH-induced gastritis byinhibiting SrcSyk of NF-120581B [17] has demonstrated the oraleffectiveness of this extract In the present study expectedlyPc-ME treatment (200mgkg) effectively ameliorated theLPSD-GalN-induced liver damage (Figure 5(c)) includingreversion of LPSD-GalN-elevated hepatic ALT (Figure 5(a))and AST (Figure 5(b)) enzyme levels In the in vivo hepatictissue the upregulated phosphorylation of MKK4 and c-Fos(component of AP-1) was also noticeably blocked by Pc-MEtreatment (Figure 5(d)) which strongly authenticated ourfindings In addition quercetin a major antioxidative andanti-inflammatory compound of P chinensis [17] also drasti-cally diminished theAP-1 activation in a dose-dependent pat-tern (Figure 6) supporting that MAPKAP-1-targeted anti-inflammatory activity of Pc-ME could be quercetin-derivedanti-inflammatory action Although numerous numbers ofmedicinal plants or edible fruits such as Panax ginsengFagonia schweinfurthii fermented soybean Davilla ellipticaand Boesenbergia rotunda have been reported to show anti-hepatitis activities [51ndash55] only few plants are now clinicallyprescribed It was revealed that Pc-ME is able to stronglysuppress both NF-120581B [17] and AP-1 activity we will further

TLR4

LPS

Pc-ME

Tissue damage

MyD88

MAPK

ERK JNK

c-Fos

AP-1

TRIF

IL-6 IL-1120573

TNF-120572

TNF-120572

IL-6 IL-1120573

Figure 7 Putative mechanism of Pc-ME-mediated anti-inflam-matory responses

validate whether Pc-ME can be also clinically developed as anew antihepatitis herbal drug

In summary our in vivo and in vitro assays demonstratedthat Pc-ME significantly reduced the levels of LPS-mediatedproinflammatory cytokines (TNF-120572 IL-1120573 and IL-6) andthat MAPKAP-1 inactivation by this extract contributes tothese inhibitory effects as summarized in Figure 7The strongantihepatotoxic activity of Pc-ME in vivo was observed in amousemodel of LPSD-GalN-induced liver injury indicatingthat Pc-ME could potentially be used as a hepatoprotectiveremedy

Conflict of Interests

The authors report no conflict of interests The authors aloneare responsible for the content and writing of the paper

Authorsrsquo Contribution

Muhammad Jahangir Hossen and Seung Cheol Kim equallycontributed to this work

Acknowledgment

This study was supported by a grant of the Korean HealthTechnology RampD Project Ministry of Health amp WelfareRepublic of Korea (HI12C0050)

References

[1] C-K Tseng C-K Lin H-W Chang et al ldquoAqueous extractof Gracilaria tenuistipitata suppresses LPS-induced NF-120581Band MAPK activation in RAW 2647 and rat peritonealmacrophages and exerts hepatoprotective effects on carbon

10 Evidence-Based Complementary and Alternative Medicine

tetrachloride-treated ratrdquo PLoS ONE vol 9 no 1 Article IDe86557 2014

[2] H C Steel R Cockeran R Anderson and C Feldman ldquoOver-viewof community-acquired pneumonia and the role of inflam-matory mechanisms in the immunopathogenesis of severepneumococcal diseaserdquo Mediators of Inflammation vol 2013Article ID 490346 18 pages 2013

[3] M Pasparakis ldquoRegulation of tissue homeostasis by NF-Bsignalling implications for inflammatory diseasesrdquo NatureReviews Immunology vol 9 no 11 pp 778ndash788 2009

[4] J-K Kim and G-M Park ldquoIndirubin-3-monoxime exhibitsanti-inflammatory properties by down-regulating NF-120581Band JNK signaling pathways in lipopolysaccharide- treatedRAW2647 cellsrdquo Inflammation Research vol 61 no 4 pp319ndash325 2012

[5] MHamandAMoon ldquoInflammatory andmicroenvironmentalfactors involved in breast cancer progressionrdquo Archives ofPharmacal Research vol 36 no 12 pp 1419ndash1431 2013

[6] M-S Lee ldquoRole of innate immunity in diabetes and metab-olism recent progress in the study of inflammasomesrdquo ImmuneNetwork vol 11 no 2 pp 95ndash99 2011

[7] Y Ayele J-A Kim E Park et al ldquoA methanol extract of Adan-sonia digitata L leaves inhibits pro-inflammatory iNOS possi-bly via the inhibition of NF-120581B activationrdquo Biomolecules andTherapeutics vol 21 no 2 pp 146ndash152 2013

[8] D H Kim J H Chung J S Yoon et al ldquoGinsenoside Rdinhibits the expressions of iNOS andCOX-2 by suppressingNF-120581B in LPS-stimulated RAW2647 cells and mouse liverrdquo Journalof Ginseng Research vol 37 no 1 pp 54ndash63 2013

[9] M Fujihara M Muroi K-I Tanamoto T Suzuki H Azumaand H Ikeda ldquoMolecular mechanisms of macrophage activa-tion and deactivation by lipopolysaccharide roles of the recep-tor complexrdquo Pharmacology and Therapeutics vol 100 no 2pp 171ndash194 2003

[10] T Yu Y J Li A H Bian et al ldquoThe regulatory role of activat-ing transcription factor 2 in inflammationrdquoMediators of Inflam-mation vol 2014 Article ID 950472 10 pages 2014

[11] I-T Lee and C-M Yang ldquoInflammatory signalings involvedin airway and pulmonary diseasesrdquoMediators of Inflammationvol 2013 Article ID 791231 12 pages 2013

[12] E D Chan and D W H Riches ldquoIFN-120574 + LPS induction ofiNOS is modulated by ERK JNKSAPK and p38mapk in amouse macrophage cell linerdquo The American Journal of Physi-ologymdashCell Physiology vol 280 no 3 pp C441ndashC450 2001

[13] I N Crispe ldquoThe liver as a lymphoid organrdquo Annual Review ofImmunology vol 27 pp 147ndash163 2009

[14] F Tacke T Luedde and C Trautwein ldquoInflammatory pathwaysin liver homeostasis and liver injuryrdquoClinical Reviews in Allergyamp Immunology vol 36 no 1 pp 4ndash12 2009

[15] M Y Jia Y P Jing Q Ai et al ldquoPotential role of catalase inmicewith lipopolysaccharideD-galactosamine-induced fulminantliver injuryrdquo Hepatology Research vol 44 no 11 pp 1151ndash11582014

[16] Q Ai Y Jing R Jiang et al ldquoRotenone a mitochondrial res-piratory complex i inhibitor ameliorates lipopolysaccharideD-galactosamine-induced fulminant hepatitis in micerdquo Interna-tional Immunopharmacology vol 21 no 1 pp 200ndash207 2014

[17] M J Hossen K-S Baek E Kim et al ldquoIn vivo and in vitroanti-inflammatory activities of Persicaria chinensis methanolicextract targeting SrcSykNF-120581Brdquo Journal of Ethnopharmacol-ogy vol 159 pp 9ndash16 2015

[18] D R Luitel M B Rokaya B Timsina and Z MunzbergovaldquoMedicinal plants used by the Tamang community in theMakawanpur district of central Nepalrdquo Journal of Ethnobiologyand Ethnomedicine vol 10 no 1 article 5 2014

[19] W M May The reproductive biology and cytotoxic activity ofpersicaria chinensis (L) H gross var chinensis (Polygonaceae)[Dissertation] University of Malaya 2012

[20] S M Lai D Sudhahar and K Anandarajagopal ldquoEvaluationof antibacterial and antifungal activities of Persicaria chinensisleavesrdquo International Journal of Pharmaceutical Sciences ampResearch vol 3 p 8 2012

[21] B Veres B Radnai F Gallyas Jr et al ldquoRegulation of kinase cas-cades and transcription factors by a poly(ADP-ribose) polym-erase-1 inhibitor 4-hydroxyquinazoline in lipopolysaccharide-induced inflammation in micerdquo Journal of Pharmacology andExperimental Therapeutics vol 310 no 1 pp 247ndash255 2004

[22] M Panteva H Korkaya and S Jameel ldquoHepatitis viruses andthe MAPK pathway is this a survival strategyrdquo Virus Researchvol 92 no 2 pp 131ndash140 2003

[23] A Laliena B S Miguel I Crespo M Alvarez J Gonzalez-Gallego and M J Tunon ldquoMelatonin attenuates inflammationand promotes regeneration in rabbits with fulminant hepatitisof viral originrdquo Journal of Pineal Research vol 53 no 3 pp 270ndash278 2012

[24] S E Byeon T Yu Y Yang et al ldquoHydroquinone regulateshemeoxygenase-1 expression via modulation of Src kinaseactivity through thiolation of cysteine residuesrdquo Free RadicalBiology and Medicine vol 57 pp 105ndash118 2013

[25] S E Byeon T Yu Y Yang et al ldquoHydroquinone regulateshemeoxygenase-1 expression via modulation of Src kinaseactivity through thiolation of cysteine residuesrdquo Free RadicalBiology and Medicine vol 57 pp 105ndash118 2013

[26] Y Yang T Yu H-J Jang et al ldquoIn vitro and in vivo anti-inflammatory activities of Polygonum hydropiper methanolextractrdquo Journal of Ethnopharmacology vol 139 no 2 pp 616ndash625 2012

[27] M-Y Kim and J Y Cho ldquo20S-dihydroprotopanaxadiol aginsenoside derivative boosts innate immune responses ofmonocytes and macrophagesrdquo Journal of Ginseng Research vol37 no 3 pp 293ndash299 2013

[28] E H Jho K Kang S Oidovsambuu et al ldquoGymnaster koraien-sis and its major components 35-di-O-caffeoylquinic acid andgymnasterkoreayne B reduce oxidative damage induced bytert-butyl hydroperoxide or acetaminophen in hepG2 cellsrdquoBMB Reports vol 46 no 10 pp 513ndash518 2013

[29] Y Yang T Yu Y G Lee et al ldquoMethanol extract ofHopea odor-ata suppresses inflammatory responses via the direct inhibitionof multiple kinasesrdquo Journal of Ethnopharmacology vol 145 no2 pp 598ndash607 2013

[30] S Sun Back J Kim D Choi E S Lee S Y Choi and K HanldquoCooperative transcriptional activation of ATP-binding cassettesterol transporters ABCG5 and ABCG8 genes by nuclear recep-tors including Liver-X-Receptorrdquo BMB Reports vol 46 no 6pp 322ndash327 2013

[31] C Liang Y Ding S B Song et al ldquoOleanane-triterpenoidsfrom Panax stipuleanatus inhibit NF-120581Brdquo Journal of GinsengResearch vol 37 no 1 pp 74ndash79 2013

[32] J Y Cho J D Yeon J Y Kim E S Yoo YH Yu andMH ParkldquoHepatoprotection by human epidermal growth factor (hEGF)against experimental hepatitis induced byD-galactosamine (D-GalN) or D-GalNlipopolysacchariderdquo Biological amp Pharma-ceutical Bulletin vol 23 no 10 pp 1243ndash1246 2000

Evidence-Based Complementary and Alternative Medicine 11

[33] C-W Lee F-L Yen H-W Huang et al ldquoResveratrol nanopar-ticle system improves dissolution properties and enhances thehepatoprotective effect of resveratrol through antioxidant andanti-inflammatory pathwaysrdquo Journal of Agricultural and FoodChemistry vol 60 no 18 pp 4662ndash4671 2012

[34] T Yu J Lee Y G Lee et al ldquoIn vitro and in vivo anti-inflam-matory effects of ethanol extract from Acer tegmentosumrdquoJournal of Ethnopharmacology vol 128 no 1 pp 139ndash147 2010

[35] Y-H Jeong J-W Hyun T K van Le D-H Kim and H-SKim ldquoKalopanaxsaponin A exerts anti-inflammatory effects inlipopolysaccharide-stimulated microglia via inhibition of JNKand NF-120581BAP-1 pathwaysrdquo Biomolecules andTherapeutics vol21 no 5 pp 332ndash337 2013

[36] M Feldmann ldquoMany cytokines are very useful therapeutictargets in diseaserdquoThe Journal of Clinical Investigation vol 118no 11 pp 3533ndash3536 2008

[37] B Kaminska ldquoMAPK signalling pathways as molecular targetsfor anti-inflammatory therapymdashfrom molecular mechanismsto therapeutic benefitsrdquoBiochimica et Biophysica ActamdashProteinsand Proteomics vol 1754 no 1-2 pp 253ndash262 2005

[38] Y Yang S C Kim T Yu et al ldquoFunctional roles of p38mitogen-activated protein kinase in macrophage-mediated inflamma-tory responsesrdquoMediators of Inflammation vol 2014 Article ID352371 13 pages 2014

[39] Y Yang J Lee M H Rhee et al ldquoMolecular mechanism ofprotopanaxadiol saponin fraction-mediated anti-inflammatoryactionsrdquo Journal of Ginseng Research vol 39 no 1 pp 61ndash682015

[40] L A J OrsquoNeill K A Fitzgerald and A G Bowie ldquoThe Toll-IL-1 receptor adaptor family grows to five membersrdquo Trends inImmunology vol 24 no 6 pp 286ndash289 2003

[41] S E Byeon J Lee B C Yoo et al ldquoP38-targeted inhibition ofinterleukin-12 expression by ethanol extract from Cordycepsbassiana in lipopolysaccharide-activated macrophagesrdquo Immu-nopharmacology and Immunotoxicology vol 33 no 1 pp 90ndash96 2011

[42] M H Kim D S Yoo S Y Lee et al ldquoThe TRIFTBK1IRF-3activation pathway is the primary inhibitory target of resver-atrol contributing to its broad-spectrum anti-inflammatoryeffectsrdquo Pharmazie vol 66 no 4 pp 293ndash300 2011

[43] S Ghosh and M S Hayden ldquoNew regulators of NF-120581B ininflammationrdquo Nature Reviews Immunology vol 8 no 11 pp837ndash848 2008

[44] R Medzhitov and T Horng ldquoTranscriptional control of theinflammatory responserdquoNature Reviews Immunology vol 9 no10 pp 692ndash703 2009

[45] T Kawai and S Akira ldquoToll-like receptors and their crosstalkwith other innate receptors in infection and immunityrdquo Immu-nity vol 34 no 5 pp 637ndash650 2011

[46] K Mehla S Balwani A Kulshreshtha D Nandi P Jaisankarand B Ghosh ldquoEthyl gallate isolated from Pistacia integerrimaLinn inhibits cell adhesion molecules by blocking AP-1 tran-scription factorrdquo Journal of Ethnopharmacology vol 137 no 3pp 1345ndash1352 2011

[47] T Yu H M Ahn T Shen et al ldquoAnti-inflammatory activity ofethanol extract derived fromPhaseolus angularis beansrdquo Journalof Ethnopharmacology vol 137 no 3 pp 1197ndash1206 2011

[48] H S Kim A-R Kim H J Park et al ldquoMorus bombycis Koid-zumi extract suppresses collagen-induced arthritis by inhibitingthe activation of nuclear factor-120581B and activator protein-1 inmicerdquo Journal of Ethnopharmacology vol 136 no 3 pp 392ndash398 2011

[49] T Yu Y J Lee H M Yang et al ldquoInhibitory effect of San-guisorba officinalis ethanol extract onNO and PGE

2production

is mediated by suppression of NF-120581B and AP-1 activationsignaling cascaderdquo Journal of Ethnopharmacology vol 134 no1 pp 11ndash17 2011

[50] M Guha and N Mackman ldquoLPS induction of gene expressionin human monocytesrdquo Cellular Signalling vol 13 no 2 pp 85ndash94 2001

[51] S-J Seo J Y Cho Y H Jeong and Y-S Choi ldquoEffect of Koreanred ginseng extract on liver damage induced by shorttermand long-term ethanol treatment in ratsrdquo Journal of GinsengResearch vol 37 no 2 pp 194ndash200 2013

[52] A Pareek A Godavarthi R Issarani and B P Nagori ldquoAntiox-idant and hepatoprotective activity of Fagonia schweinfurthii(Hadidi) Hadidi extract in carbon tetrachloride induced hep-atotoxicity in HepG2 cell line and ratsrdquo Journal of Ethnophar-macology vol 150 no 3 pp 973ndash981 2013

[53] H Mohd Yusof N M Ali S K Yeap et al ldquoHepatoprotectiveeffect of fermented soybean (nutrient enriched soybean tem-peh) against alcohol-induced liver damage in micerdquo Evidence-Based Complementary and Alternative Medicine vol 2013Article ID 274274 8 pages 2013

[54] J J Campos A De Oliveira Azevedo J D De Souza FilhoA Castro Perez and F Castro Braga ldquoBioguided isolation ofmyricetin-3-O-120573-galactopyranoside with antinociceptive activ-ity from the aerial part of Davilla elliptica St-Hilrdquo Journal ofEthnopharmacology vol 150 no 1 pp 270ndash274 2013

[55] S M Salama M A Abdulla A S Alrashdi and A H A HadildquoMechanism of hepatoprotective effect of Boesenbergia rotundain thioacetamide-induced liver damage in ratsrdquo Evidence-basedComplementary and Alternative Medicine vol 2013 Article ID157456 13 pages 2013

Submit your manuscripts athttpwwwhindawicom

Stem CellsInternational

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

MEDIATORSINFLAMMATION

of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Behavioural Neurology

EndocrinologyInternational Journal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Disease Markers

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

BioMed Research International

OncologyJournal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Oxidative Medicine and Cellular Longevity

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

PPAR Research

The Scientific World JournalHindawi Publishing Corporation httpwwwhindawicom Volume 2014

Immunology ResearchHindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Journal of

ObesityJournal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Computational and Mathematical Methods in Medicine

OphthalmologyJournal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Diabetes ResearchJournal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Research and TreatmentAIDS

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Gastroenterology Research and Practice

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Parkinsonrsquos Disease

Evidence-Based Complementary and Alternative Medicine

Volume 2014Hindawi Publishing Corporationhttpwwwhindawicom

Evidence-Based Complementary and Alternative Medicine 7

15min 30min 60min5min RAW2647 cells (30min)

p-ERK

ERK

p-JNK

JNKp-JNK

ERK

p-ERK

p-p38

p38

JNK

RAW2647 cells

minus

minus

+

minus

+

50

+

100

+

200

+

300

minus

minus

+

minus

+

300

+

minus

+

300

+

minus

+

300

+

minus

+

300Pc-ME (120583gmL)LPS (1120583gmL)

Pc-ME (120583gmL)LPS (1120583gmL)

120573-actin

120573-actin

(a)

5min3min2minminus

minus

+

minus

+

300

+

minus

+

300

+

minus

+

300

p-MEK12

MEK12

MKK4

p-MKK4

RAW2647 cells

Pc-ME (120583gmL)LPS (1120583gmL)

120573-actin

(b)

Figure 4 Effect of Pc-ME on the activation of upstream signaling enzymes of AP-1 translocation (a and b) Phospho- and total protein levelsof ERK JNK p38 MEK12 MKK4 and 120573-actin in cell lysates were determined by immunoblotting analysis

activities [17] However SrcSyk-linked activation of NF-120581Bis not the only important regulatory loop of inflammatoryreaction In addition it has been reported that AP-1 activatedby MAPK plays another crucial roles in inflammatory reac-tion [11 38 39] In the present study therefore we aimed toelucidate inhibitory mechanism of Pc-ME on AP-1 functionin vitro and in vivo by using LPS-activated macrophages andLPSD-GalN-triggered hepatitis model

It has been shown that reporter gene luciferase assayperformed in conjunction with HEK293 cells transfectedwith Luc constructs and adaptor molecules essential for TLRsignaling [40] is a reasonable approach for studying func-tional activation of transcription factors [41 42] Thereforeto examine the ability of Pc-ME to suppress AP-1 functionwe first employed the luciferase assay using HEK293 cellstransfected with the AP-1-Luc construct As expected AP-1-mediated luciferase activity was enhanced up to 45- to485-fold by PMA treatment or cotransfection with adaptormolecules (TRIF and MyD88) and Pc-ME notably inhibitedthis upregulation in a dose-dependent manner (Figure 2)Moreover nuclear translocation of c-Fos was reduced by Pc-ME treatment in a time-dependent manner (Figure 3(a))

implying that AP-1 family of transcription factors can befunctionally inactivated and that their upstream kinasesresponsible for AP-1 phosphorylation can be targeted

Several earlier reports have suggested that several proin-flammatory cytokines such as TNF-120572 IL-1120573 and IL-6 playan important role in boosting proinflammatory roles ofmacrophages [43ndash45] We therefore further tested whetherthese proinflammatory cytokines can be also suppressedby Pc-ME using LPS-treated RAW2647 cells The mRNAanalysis of these cytokines by RT-PCR in RAW2647 cells(Figure 3(c)) and by real-time PCR in U937 cells (Figures3(d)ndash3(f)) revealed that mRNA levels of TNF-120572 IL-1120573 andIL-6 were strongly upregulated by LPS treatment while Pc-ME significantly and dose-dependently (100 and 300120583gmL)inhibited such upregulation indicating that AP-1 suppressionby Pc-ME may be associated with blockade of these proin-flammatory cytokines as well as its suppressive activity onthe expression of iNOS and COX-2 [17] In fact a number ofstudies have also reported thatmany knownherbalmedicinessuch as Polygonum hydropiper Pistacia integerrima Phase-olus angularis Morus bombycis Koidzumi and Sanguisorbaofficinalis possess AP-1 pathway inhibitory activity as their

8 Evidence-Based Complementary and Alternative Medicine

ALT

(UL

)

minus +0

5000

10000

15000

20000

25000

lowastlowast

Pc-ME (200mgkg)

LPS (10120583gkg)D-GalN (1mgkg)

(a)

AST

(UL

)

0

5000

10000

15000

20000

minus +

lowastlowast

Pc-ME (200mgkg)

LPS (10120583gkg)D-GalN (1mgkg)

(b)

HampE staining

Normal LPSD-GalN Pc-ME (200mgkg)

(c)

Liver lysate

minus

minus

+minus

++

MKK4

c-Fos

p-c-Fos

LPSD-GalN

p-MKK4

120573-actin

Pc-ME (200mgkg)

(d)

Figure 5 Effect of Pc-ME on LPSD-GalN-induced hepatitis in mice Mice were orally treated with Pc-ME (200mgkg) for six days beforeintraperitoneal injection of LPSD-GalN After 1 h mice were sacrificed to collect blood samples and liver sections for biochemical parameteranalysis of (a) ALT (b) AST and (c) histopathological examination (d) Phospho- or total protein levels of MKK4 c-Fos and 120573-actin in liverlysates were determined by immunoblot analysis

pharmacological target [26 46ndash49] Therefore the fact thatPc-ME is able to inhibit AP-1 pathway could be also acceptedas a general anti-inflammatory mechanism of this plant

As MAPKs play a vital role in the regulation of LPS-induced inflammation by controlling AP-1 activation [21] weexamine themolecular inhibitory effects of Pc-MEon theAP-1 pathway Toward this goal we analyzed the inhibitory effectof Pc-ME on MAPKs and their upstream signaling enzymes

[50]The results of our study demonstrated that Pc-ME treat-ment time-dependently (5 15 30 and 60min) blocked ERKand JNK phosphorylation (Figure 4(a) left panel) poten-tially leading to significant attenuation of AP-1 activationin response to LPS The dose-dependent (50 to 300 120583gmL)inhibition pattern of the same MAPK phosphorylation bythis extract (Figure 4(a) right panel) strongly supported ourexperimental condition and hypothesisThe phosphorylation

Evidence-Based Complementary and Alternative Medicine 9A

P-1-

med

iate

d lu

cife

rase

activ

ity (f

old

incr

ease

)

Tag2MyD88

0

1

2

3

4

5

+

minusminus

minus

+minus

minus

+20

minus

+40

minus

+80

lowastlowastlowastlowast

lowastlowast

Quercetin (120583M)

Figure 6 Effect of quercetin on the activation of upstream signalingenzymes of AP-1 in a reporter gene assay The promoter bindingactivity of the transcription factor AP-1 was analyzed using areporter gene assay in HEK293 cells transfected with plasmidconstructs AP-1-Luc (1 120583gmL) and 120573-gal (as a transfection control)with 1 120583gmL of MyD88 in the presence of quercetin Luciferaseactivity was measured using a luminometer lowastlowast119875 lt 001 comparedwith control

of MEK12 and MKK4 the upstream enzymes of ERK andJNK respectively was also strikingly suppressed by Pc-MEin LPS challenges of 2 3 and 5min (Figure 4(b)) confirmingthe MAPK inhibitory activity of this extract

MAPK activation and subsequent AP-1 activation arestrongly linked to the induction of hepatitis [22 23] Sowe guess that AP-1-inhibitory extract Pc-ME is capable ofattenuating hepatitis symptoms To test this hypothesis weemployed LPSD-GalN-intoxicated acute liver injury modelwhich is a classical system for screening hepatoprotectiveremedy in vivo [32] Our previous study indicating thatPc-ME can protect against HClEtOH-induced gastritis byinhibiting SrcSyk of NF-120581B [17] has demonstrated the oraleffectiveness of this extract In the present study expectedlyPc-ME treatment (200mgkg) effectively ameliorated theLPSD-GalN-induced liver damage (Figure 5(c)) includingreversion of LPSD-GalN-elevated hepatic ALT (Figure 5(a))and AST (Figure 5(b)) enzyme levels In the in vivo hepatictissue the upregulated phosphorylation of MKK4 and c-Fos(component of AP-1) was also noticeably blocked by Pc-MEtreatment (Figure 5(d)) which strongly authenticated ourfindings In addition quercetin a major antioxidative andanti-inflammatory compound of P chinensis [17] also drasti-cally diminished theAP-1 activation in a dose-dependent pat-tern (Figure 6) supporting that MAPKAP-1-targeted anti-inflammatory activity of Pc-ME could be quercetin-derivedanti-inflammatory action Although numerous numbers ofmedicinal plants or edible fruits such as Panax ginsengFagonia schweinfurthii fermented soybean Davilla ellipticaand Boesenbergia rotunda have been reported to show anti-hepatitis activities [51ndash55] only few plants are now clinicallyprescribed It was revealed that Pc-ME is able to stronglysuppress both NF-120581B [17] and AP-1 activity we will further

TLR4

LPS

Pc-ME

Tissue damage

MyD88

MAPK

ERK JNK

c-Fos

AP-1

TRIF

IL-6 IL-1120573

TNF-120572

TNF-120572

IL-6 IL-1120573

Figure 7 Putative mechanism of Pc-ME-mediated anti-inflam-matory responses

validate whether Pc-ME can be also clinically developed as anew antihepatitis herbal drug

In summary our in vivo and in vitro assays demonstratedthat Pc-ME significantly reduced the levels of LPS-mediatedproinflammatory cytokines (TNF-120572 IL-1120573 and IL-6) andthat MAPKAP-1 inactivation by this extract contributes tothese inhibitory effects as summarized in Figure 7The strongantihepatotoxic activity of Pc-ME in vivo was observed in amousemodel of LPSD-GalN-induced liver injury indicatingthat Pc-ME could potentially be used as a hepatoprotectiveremedy

Conflict of Interests

The authors report no conflict of interests The authors aloneare responsible for the content and writing of the paper

Authorsrsquo Contribution

Muhammad Jahangir Hossen and Seung Cheol Kim equallycontributed to this work

Acknowledgment

This study was supported by a grant of the Korean HealthTechnology RampD Project Ministry of Health amp WelfareRepublic of Korea (HI12C0050)

References

[1] C-K Tseng C-K Lin H-W Chang et al ldquoAqueous extractof Gracilaria tenuistipitata suppresses LPS-induced NF-120581Band MAPK activation in RAW 2647 and rat peritonealmacrophages and exerts hepatoprotective effects on carbon

10 Evidence-Based Complementary and Alternative Medicine

tetrachloride-treated ratrdquo PLoS ONE vol 9 no 1 Article IDe86557 2014

[2] H C Steel R Cockeran R Anderson and C Feldman ldquoOver-viewof community-acquired pneumonia and the role of inflam-matory mechanisms in the immunopathogenesis of severepneumococcal diseaserdquo Mediators of Inflammation vol 2013Article ID 490346 18 pages 2013

[3] M Pasparakis ldquoRegulation of tissue homeostasis by NF-Bsignalling implications for inflammatory diseasesrdquo NatureReviews Immunology vol 9 no 11 pp 778ndash788 2009

[4] J-K Kim and G-M Park ldquoIndirubin-3-monoxime exhibitsanti-inflammatory properties by down-regulating NF-120581Band JNK signaling pathways in lipopolysaccharide- treatedRAW2647 cellsrdquo Inflammation Research vol 61 no 4 pp319ndash325 2012

[5] MHamandAMoon ldquoInflammatory andmicroenvironmentalfactors involved in breast cancer progressionrdquo Archives ofPharmacal Research vol 36 no 12 pp 1419ndash1431 2013

[6] M-S Lee ldquoRole of innate immunity in diabetes and metab-olism recent progress in the study of inflammasomesrdquo ImmuneNetwork vol 11 no 2 pp 95ndash99 2011

[7] Y Ayele J-A Kim E Park et al ldquoA methanol extract of Adan-sonia digitata L leaves inhibits pro-inflammatory iNOS possi-bly via the inhibition of NF-120581B activationrdquo Biomolecules andTherapeutics vol 21 no 2 pp 146ndash152 2013

[8] D H Kim J H Chung J S Yoon et al ldquoGinsenoside Rdinhibits the expressions of iNOS andCOX-2 by suppressingNF-120581B in LPS-stimulated RAW2647 cells and mouse liverrdquo Journalof Ginseng Research vol 37 no 1 pp 54ndash63 2013

[9] M Fujihara M Muroi K-I Tanamoto T Suzuki H Azumaand H Ikeda ldquoMolecular mechanisms of macrophage activa-tion and deactivation by lipopolysaccharide roles of the recep-tor complexrdquo Pharmacology and Therapeutics vol 100 no 2pp 171ndash194 2003

[10] T Yu Y J Li A H Bian et al ldquoThe regulatory role of activat-ing transcription factor 2 in inflammationrdquoMediators of Inflam-mation vol 2014 Article ID 950472 10 pages 2014

[11] I-T Lee and C-M Yang ldquoInflammatory signalings involvedin airway and pulmonary diseasesrdquoMediators of Inflammationvol 2013 Article ID 791231 12 pages 2013

[12] E D Chan and D W H Riches ldquoIFN-120574 + LPS induction ofiNOS is modulated by ERK JNKSAPK and p38mapk in amouse macrophage cell linerdquo The American Journal of Physi-ologymdashCell Physiology vol 280 no 3 pp C441ndashC450 2001

[13] I N Crispe ldquoThe liver as a lymphoid organrdquo Annual Review ofImmunology vol 27 pp 147ndash163 2009

[14] F Tacke T Luedde and C Trautwein ldquoInflammatory pathwaysin liver homeostasis and liver injuryrdquoClinical Reviews in Allergyamp Immunology vol 36 no 1 pp 4ndash12 2009

[15] M Y Jia Y P Jing Q Ai et al ldquoPotential role of catalase inmicewith lipopolysaccharideD-galactosamine-induced fulminantliver injuryrdquo Hepatology Research vol 44 no 11 pp 1151ndash11582014

[16] Q Ai Y Jing R Jiang et al ldquoRotenone a mitochondrial res-piratory complex i inhibitor ameliorates lipopolysaccharideD-galactosamine-induced fulminant hepatitis in micerdquo Interna-tional Immunopharmacology vol 21 no 1 pp 200ndash207 2014

[17] M J Hossen K-S Baek E Kim et al ldquoIn vivo and in vitroanti-inflammatory activities of Persicaria chinensis methanolicextract targeting SrcSykNF-120581Brdquo Journal of Ethnopharmacol-ogy vol 159 pp 9ndash16 2015

[18] D R Luitel M B Rokaya B Timsina and Z MunzbergovaldquoMedicinal plants used by the Tamang community in theMakawanpur district of central Nepalrdquo Journal of Ethnobiologyand Ethnomedicine vol 10 no 1 article 5 2014

[19] W M May The reproductive biology and cytotoxic activity ofpersicaria chinensis (L) H gross var chinensis (Polygonaceae)[Dissertation] University of Malaya 2012

[20] S M Lai D Sudhahar and K Anandarajagopal ldquoEvaluationof antibacterial and antifungal activities of Persicaria chinensisleavesrdquo International Journal of Pharmaceutical Sciences ampResearch vol 3 p 8 2012

[21] B Veres B Radnai F Gallyas Jr et al ldquoRegulation of kinase cas-cades and transcription factors by a poly(ADP-ribose) polym-erase-1 inhibitor 4-hydroxyquinazoline in lipopolysaccharide-induced inflammation in micerdquo Journal of Pharmacology andExperimental Therapeutics vol 310 no 1 pp 247ndash255 2004

[22] M Panteva H Korkaya and S Jameel ldquoHepatitis viruses andthe MAPK pathway is this a survival strategyrdquo Virus Researchvol 92 no 2 pp 131ndash140 2003

[23] A Laliena B S Miguel I Crespo M Alvarez J Gonzalez-Gallego and M J Tunon ldquoMelatonin attenuates inflammationand promotes regeneration in rabbits with fulminant hepatitisof viral originrdquo Journal of Pineal Research vol 53 no 3 pp 270ndash278 2012

[24] S E Byeon T Yu Y Yang et al ldquoHydroquinone regulateshemeoxygenase-1 expression via modulation of Src kinaseactivity through thiolation of cysteine residuesrdquo Free RadicalBiology and Medicine vol 57 pp 105ndash118 2013

[25] S E Byeon T Yu Y Yang et al ldquoHydroquinone regulateshemeoxygenase-1 expression via modulation of Src kinaseactivity through thiolation of cysteine residuesrdquo Free RadicalBiology and Medicine vol 57 pp 105ndash118 2013

[26] Y Yang T Yu H-J Jang et al ldquoIn vitro and in vivo anti-inflammatory activities of Polygonum hydropiper methanolextractrdquo Journal of Ethnopharmacology vol 139 no 2 pp 616ndash625 2012

[27] M-Y Kim and J Y Cho ldquo20S-dihydroprotopanaxadiol aginsenoside derivative boosts innate immune responses ofmonocytes and macrophagesrdquo Journal of Ginseng Research vol37 no 3 pp 293ndash299 2013

[28] E H Jho K Kang S Oidovsambuu et al ldquoGymnaster koraien-sis and its major components 35-di-O-caffeoylquinic acid andgymnasterkoreayne B reduce oxidative damage induced bytert-butyl hydroperoxide or acetaminophen in hepG2 cellsrdquoBMB Reports vol 46 no 10 pp 513ndash518 2013

[29] Y Yang T Yu Y G Lee et al ldquoMethanol extract ofHopea odor-ata suppresses inflammatory responses via the direct inhibitionof multiple kinasesrdquo Journal of Ethnopharmacology vol 145 no2 pp 598ndash607 2013

[30] S Sun Back J Kim D Choi E S Lee S Y Choi and K HanldquoCooperative transcriptional activation of ATP-binding cassettesterol transporters ABCG5 and ABCG8 genes by nuclear recep-tors including Liver-X-Receptorrdquo BMB Reports vol 46 no 6pp 322ndash327 2013

[31] C Liang Y Ding S B Song et al ldquoOleanane-triterpenoidsfrom Panax stipuleanatus inhibit NF-120581Brdquo Journal of GinsengResearch vol 37 no 1 pp 74ndash79 2013

[32] J Y Cho J D Yeon J Y Kim E S Yoo YH Yu andMH ParkldquoHepatoprotection by human epidermal growth factor (hEGF)against experimental hepatitis induced byD-galactosamine (D-GalN) or D-GalNlipopolysacchariderdquo Biological amp Pharma-ceutical Bulletin vol 23 no 10 pp 1243ndash1246 2000

Evidence-Based Complementary and Alternative Medicine 11

[33] C-W Lee F-L Yen H-W Huang et al ldquoResveratrol nanopar-ticle system improves dissolution properties and enhances thehepatoprotective effect of resveratrol through antioxidant andanti-inflammatory pathwaysrdquo Journal of Agricultural and FoodChemistry vol 60 no 18 pp 4662ndash4671 2012

[34] T Yu J Lee Y G Lee et al ldquoIn vitro and in vivo anti-inflam-matory effects of ethanol extract from Acer tegmentosumrdquoJournal of Ethnopharmacology vol 128 no 1 pp 139ndash147 2010

[35] Y-H Jeong J-W Hyun T K van Le D-H Kim and H-SKim ldquoKalopanaxsaponin A exerts anti-inflammatory effects inlipopolysaccharide-stimulated microglia via inhibition of JNKand NF-120581BAP-1 pathwaysrdquo Biomolecules andTherapeutics vol21 no 5 pp 332ndash337 2013

[36] M Feldmann ldquoMany cytokines are very useful therapeutictargets in diseaserdquoThe Journal of Clinical Investigation vol 118no 11 pp 3533ndash3536 2008

[37] B Kaminska ldquoMAPK signalling pathways as molecular targetsfor anti-inflammatory therapymdashfrom molecular mechanismsto therapeutic benefitsrdquoBiochimica et Biophysica ActamdashProteinsand Proteomics vol 1754 no 1-2 pp 253ndash262 2005

[38] Y Yang S C Kim T Yu et al ldquoFunctional roles of p38mitogen-activated protein kinase in macrophage-mediated inflamma-tory responsesrdquoMediators of Inflammation vol 2014 Article ID352371 13 pages 2014

[39] Y Yang J Lee M H Rhee et al ldquoMolecular mechanism ofprotopanaxadiol saponin fraction-mediated anti-inflammatoryactionsrdquo Journal of Ginseng Research vol 39 no 1 pp 61ndash682015

[40] L A J OrsquoNeill K A Fitzgerald and A G Bowie ldquoThe Toll-IL-1 receptor adaptor family grows to five membersrdquo Trends inImmunology vol 24 no 6 pp 286ndash289 2003

[41] S E Byeon J Lee B C Yoo et al ldquoP38-targeted inhibition ofinterleukin-12 expression by ethanol extract from Cordycepsbassiana in lipopolysaccharide-activated macrophagesrdquo Immu-nopharmacology and Immunotoxicology vol 33 no 1 pp 90ndash96 2011

[42] M H Kim D S Yoo S Y Lee et al ldquoThe TRIFTBK1IRF-3activation pathway is the primary inhibitory target of resver-atrol contributing to its broad-spectrum anti-inflammatoryeffectsrdquo Pharmazie vol 66 no 4 pp 293ndash300 2011

[43] S Ghosh and M S Hayden ldquoNew regulators of NF-120581B ininflammationrdquo Nature Reviews Immunology vol 8 no 11 pp837ndash848 2008

[44] R Medzhitov and T Horng ldquoTranscriptional control of theinflammatory responserdquoNature Reviews Immunology vol 9 no10 pp 692ndash703 2009

[45] T Kawai and S Akira ldquoToll-like receptors and their crosstalkwith other innate receptors in infection and immunityrdquo Immu-nity vol 34 no 5 pp 637ndash650 2011

[46] K Mehla S Balwani A Kulshreshtha D Nandi P Jaisankarand B Ghosh ldquoEthyl gallate isolated from Pistacia integerrimaLinn inhibits cell adhesion molecules by blocking AP-1 tran-scription factorrdquo Journal of Ethnopharmacology vol 137 no 3pp 1345ndash1352 2011

[47] T Yu H M Ahn T Shen et al ldquoAnti-inflammatory activity ofethanol extract derived fromPhaseolus angularis beansrdquo Journalof Ethnopharmacology vol 137 no 3 pp 1197ndash1206 2011

[48] H S Kim A-R Kim H J Park et al ldquoMorus bombycis Koid-zumi extract suppresses collagen-induced arthritis by inhibitingthe activation of nuclear factor-120581B and activator protein-1 inmicerdquo Journal of Ethnopharmacology vol 136 no 3 pp 392ndash398 2011

[49] T Yu Y J Lee H M Yang et al ldquoInhibitory effect of San-guisorba officinalis ethanol extract onNO and PGE

2production

is mediated by suppression of NF-120581B and AP-1 activationsignaling cascaderdquo Journal of Ethnopharmacology vol 134 no1 pp 11ndash17 2011

[50] M Guha and N Mackman ldquoLPS induction of gene expressionin human monocytesrdquo Cellular Signalling vol 13 no 2 pp 85ndash94 2001

[51] S-J Seo J Y Cho Y H Jeong and Y-S Choi ldquoEffect of Koreanred ginseng extract on liver damage induced by shorttermand long-term ethanol treatment in ratsrdquo Journal of GinsengResearch vol 37 no 2 pp 194ndash200 2013

[52] A Pareek A Godavarthi R Issarani and B P Nagori ldquoAntiox-idant and hepatoprotective activity of Fagonia schweinfurthii(Hadidi) Hadidi extract in carbon tetrachloride induced hep-atotoxicity in HepG2 cell line and ratsrdquo Journal of Ethnophar-macology vol 150 no 3 pp 973ndash981 2013

[53] H Mohd Yusof N M Ali S K Yeap et al ldquoHepatoprotectiveeffect of fermented soybean (nutrient enriched soybean tem-peh) against alcohol-induced liver damage in micerdquo Evidence-Based Complementary and Alternative Medicine vol 2013Article ID 274274 8 pages 2013

[54] J J Campos A De Oliveira Azevedo J D De Souza FilhoA Castro Perez and F Castro Braga ldquoBioguided isolation ofmyricetin-3-O-120573-galactopyranoside with antinociceptive activ-ity from the aerial part of Davilla elliptica St-Hilrdquo Journal ofEthnopharmacology vol 150 no 1 pp 270ndash274 2013

[55] S M Salama M A Abdulla A S Alrashdi and A H A HadildquoMechanism of hepatoprotective effect of Boesenbergia rotundain thioacetamide-induced liver damage in ratsrdquo Evidence-basedComplementary and Alternative Medicine vol 2013 Article ID157456 13 pages 2013

Submit your manuscripts athttpwwwhindawicom

Stem CellsInternational

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

MEDIATORSINFLAMMATION

of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Behavioural Neurology

EndocrinologyInternational Journal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Disease Markers

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

BioMed Research International

OncologyJournal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Oxidative Medicine and Cellular Longevity

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

PPAR Research

The Scientific World JournalHindawi Publishing Corporation httpwwwhindawicom Volume 2014

Immunology ResearchHindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Journal of

ObesityJournal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Computational and Mathematical Methods in Medicine

OphthalmologyJournal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Diabetes ResearchJournal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Research and TreatmentAIDS

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Gastroenterology Research and Practice

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Parkinsonrsquos Disease

Evidence-Based Complementary and Alternative Medicine

Volume 2014Hindawi Publishing Corporationhttpwwwhindawicom

8 Evidence-Based Complementary and Alternative Medicine

ALT

(UL

)

minus +0

5000

10000

15000

20000

25000

lowastlowast

Pc-ME (200mgkg)

LPS (10120583gkg)D-GalN (1mgkg)

(a)

AST

(UL

)

0

5000

10000

15000

20000

minus +

lowastlowast

Pc-ME (200mgkg)

LPS (10120583gkg)D-GalN (1mgkg)

(b)

HampE staining

Normal LPSD-GalN Pc-ME (200mgkg)

(c)

Liver lysate

minus

minus

+minus

++

MKK4

c-Fos

p-c-Fos

LPSD-GalN

p-MKK4

120573-actin

Pc-ME (200mgkg)

(d)

Figure 5 Effect of Pc-ME on LPSD-GalN-induced hepatitis in mice Mice were orally treated with Pc-ME (200mgkg) for six days beforeintraperitoneal injection of LPSD-GalN After 1 h mice were sacrificed to collect blood samples and liver sections for biochemical parameteranalysis of (a) ALT (b) AST and (c) histopathological examination (d) Phospho- or total protein levels of MKK4 c-Fos and 120573-actin in liverlysates were determined by immunoblot analysis

pharmacological target [26 46ndash49] Therefore the fact thatPc-ME is able to inhibit AP-1 pathway could be also acceptedas a general anti-inflammatory mechanism of this plant

As MAPKs play a vital role in the regulation of LPS-induced inflammation by controlling AP-1 activation [21] weexamine themolecular inhibitory effects of Pc-MEon theAP-1 pathway Toward this goal we analyzed the inhibitory effectof Pc-ME on MAPKs and their upstream signaling enzymes

[50]The results of our study demonstrated that Pc-ME treat-ment time-dependently (5 15 30 and 60min) blocked ERKand JNK phosphorylation (Figure 4(a) left panel) poten-tially leading to significant attenuation of AP-1 activationin response to LPS The dose-dependent (50 to 300 120583gmL)inhibition pattern of the same MAPK phosphorylation bythis extract (Figure 4(a) right panel) strongly supported ourexperimental condition and hypothesisThe phosphorylation

Evidence-Based Complementary and Alternative Medicine 9A

P-1-

med

iate

d lu

cife

rase

activ

ity (f

old

incr

ease

)

Tag2MyD88

0

1

2

3

4

5

+

minusminus

minus

+minus

minus

+20

minus

+40

minus

+80

lowastlowastlowastlowast

lowastlowast

Quercetin (120583M)

Figure 6 Effect of quercetin on the activation of upstream signalingenzymes of AP-1 in a reporter gene assay The promoter bindingactivity of the transcription factor AP-1 was analyzed using areporter gene assay in HEK293 cells transfected with plasmidconstructs AP-1-Luc (1 120583gmL) and 120573-gal (as a transfection control)with 1 120583gmL of MyD88 in the presence of quercetin Luciferaseactivity was measured using a luminometer lowastlowast119875 lt 001 comparedwith control

of MEK12 and MKK4 the upstream enzymes of ERK andJNK respectively was also strikingly suppressed by Pc-MEin LPS challenges of 2 3 and 5min (Figure 4(b)) confirmingthe MAPK inhibitory activity of this extract

MAPK activation and subsequent AP-1 activation arestrongly linked to the induction of hepatitis [22 23] Sowe guess that AP-1-inhibitory extract Pc-ME is capable ofattenuating hepatitis symptoms To test this hypothesis weemployed LPSD-GalN-intoxicated acute liver injury modelwhich is a classical system for screening hepatoprotectiveremedy in vivo [32] Our previous study indicating thatPc-ME can protect against HClEtOH-induced gastritis byinhibiting SrcSyk of NF-120581B [17] has demonstrated the oraleffectiveness of this extract In the present study expectedlyPc-ME treatment (200mgkg) effectively ameliorated theLPSD-GalN-induced liver damage (Figure 5(c)) includingreversion of LPSD-GalN-elevated hepatic ALT (Figure 5(a))and AST (Figure 5(b)) enzyme levels In the in vivo hepatictissue the upregulated phosphorylation of MKK4 and c-Fos(component of AP-1) was also noticeably blocked by Pc-MEtreatment (Figure 5(d)) which strongly authenticated ourfindings In addition quercetin a major antioxidative andanti-inflammatory compound of P chinensis [17] also drasti-cally diminished theAP-1 activation in a dose-dependent pat-tern (Figure 6) supporting that MAPKAP-1-targeted anti-inflammatory activity of Pc-ME could be quercetin-derivedanti-inflammatory action Although numerous numbers ofmedicinal plants or edible fruits such as Panax ginsengFagonia schweinfurthii fermented soybean Davilla ellipticaand Boesenbergia rotunda have been reported to show anti-hepatitis activities [51ndash55] only few plants are now clinicallyprescribed It was revealed that Pc-ME is able to stronglysuppress both NF-120581B [17] and AP-1 activity we will further

TLR4

LPS

Pc-ME

Tissue damage

MyD88

MAPK

ERK JNK

c-Fos

AP-1

TRIF

IL-6 IL-1120573

TNF-120572

TNF-120572

IL-6 IL-1120573

Figure 7 Putative mechanism of Pc-ME-mediated anti-inflam-matory responses

validate whether Pc-ME can be also clinically developed as anew antihepatitis herbal drug

In summary our in vivo and in vitro assays demonstratedthat Pc-ME significantly reduced the levels of LPS-mediatedproinflammatory cytokines (TNF-120572 IL-1120573 and IL-6) andthat MAPKAP-1 inactivation by this extract contributes tothese inhibitory effects as summarized in Figure 7The strongantihepatotoxic activity of Pc-ME in vivo was observed in amousemodel of LPSD-GalN-induced liver injury indicatingthat Pc-ME could potentially be used as a hepatoprotectiveremedy

Conflict of Interests

The authors report no conflict of interests The authors aloneare responsible for the content and writing of the paper

Authorsrsquo Contribution

Muhammad Jahangir Hossen and Seung Cheol Kim equallycontributed to this work

Acknowledgment

This study was supported by a grant of the Korean HealthTechnology RampD Project Ministry of Health amp WelfareRepublic of Korea (HI12C0050)

References

[1] C-K Tseng C-K Lin H-W Chang et al ldquoAqueous extractof Gracilaria tenuistipitata suppresses LPS-induced NF-120581Band MAPK activation in RAW 2647 and rat peritonealmacrophages and exerts hepatoprotective effects on carbon

10 Evidence-Based Complementary and Alternative Medicine

tetrachloride-treated ratrdquo PLoS ONE vol 9 no 1 Article IDe86557 2014

[2] H C Steel R Cockeran R Anderson and C Feldman ldquoOver-viewof community-acquired pneumonia and the role of inflam-matory mechanisms in the immunopathogenesis of severepneumococcal diseaserdquo Mediators of Inflammation vol 2013Article ID 490346 18 pages 2013

[3] M Pasparakis ldquoRegulation of tissue homeostasis by NF-Bsignalling implications for inflammatory diseasesrdquo NatureReviews Immunology vol 9 no 11 pp 778ndash788 2009

[4] J-K Kim and G-M Park ldquoIndirubin-3-monoxime exhibitsanti-inflammatory properties by down-regulating NF-120581Band JNK signaling pathways in lipopolysaccharide- treatedRAW2647 cellsrdquo Inflammation Research vol 61 no 4 pp319ndash325 2012

[5] MHamandAMoon ldquoInflammatory andmicroenvironmentalfactors involved in breast cancer progressionrdquo Archives ofPharmacal Research vol 36 no 12 pp 1419ndash1431 2013

[6] M-S Lee ldquoRole of innate immunity in diabetes and metab-olism recent progress in the study of inflammasomesrdquo ImmuneNetwork vol 11 no 2 pp 95ndash99 2011

[7] Y Ayele J-A Kim E Park et al ldquoA methanol extract of Adan-sonia digitata L leaves inhibits pro-inflammatory iNOS possi-bly via the inhibition of NF-120581B activationrdquo Biomolecules andTherapeutics vol 21 no 2 pp 146ndash152 2013

[8] D H Kim J H Chung J S Yoon et al ldquoGinsenoside Rdinhibits the expressions of iNOS andCOX-2 by suppressingNF-120581B in LPS-stimulated RAW2647 cells and mouse liverrdquo Journalof Ginseng Research vol 37 no 1 pp 54ndash63 2013

[9] M Fujihara M Muroi K-I Tanamoto T Suzuki H Azumaand H Ikeda ldquoMolecular mechanisms of macrophage activa-tion and deactivation by lipopolysaccharide roles of the recep-tor complexrdquo Pharmacology and Therapeutics vol 100 no 2pp 171ndash194 2003

[10] T Yu Y J Li A H Bian et al ldquoThe regulatory role of activat-ing transcription factor 2 in inflammationrdquoMediators of Inflam-mation vol 2014 Article ID 950472 10 pages 2014

[11] I-T Lee and C-M Yang ldquoInflammatory signalings involvedin airway and pulmonary diseasesrdquoMediators of Inflammationvol 2013 Article ID 791231 12 pages 2013

[12] E D Chan and D W H Riches ldquoIFN-120574 + LPS induction ofiNOS is modulated by ERK JNKSAPK and p38mapk in amouse macrophage cell linerdquo The American Journal of Physi-ologymdashCell Physiology vol 280 no 3 pp C441ndashC450 2001

[13] I N Crispe ldquoThe liver as a lymphoid organrdquo Annual Review ofImmunology vol 27 pp 147ndash163 2009

[14] F Tacke T Luedde and C Trautwein ldquoInflammatory pathwaysin liver homeostasis and liver injuryrdquoClinical Reviews in Allergyamp Immunology vol 36 no 1 pp 4ndash12 2009

[15] M Y Jia Y P Jing Q Ai et al ldquoPotential role of catalase inmicewith lipopolysaccharideD-galactosamine-induced fulminantliver injuryrdquo Hepatology Research vol 44 no 11 pp 1151ndash11582014

[16] Q Ai Y Jing R Jiang et al ldquoRotenone a mitochondrial res-piratory complex i inhibitor ameliorates lipopolysaccharideD-galactosamine-induced fulminant hepatitis in micerdquo Interna-tional Immunopharmacology vol 21 no 1 pp 200ndash207 2014

[17] M J Hossen K-S Baek E Kim et al ldquoIn vivo and in vitroanti-inflammatory activities of Persicaria chinensis methanolicextract targeting SrcSykNF-120581Brdquo Journal of Ethnopharmacol-ogy vol 159 pp 9ndash16 2015

[18] D R Luitel M B Rokaya B Timsina and Z MunzbergovaldquoMedicinal plants used by the Tamang community in theMakawanpur district of central Nepalrdquo Journal of Ethnobiologyand Ethnomedicine vol 10 no 1 article 5 2014

[19] W M May The reproductive biology and cytotoxic activity ofpersicaria chinensis (L) H gross var chinensis (Polygonaceae)[Dissertation] University of Malaya 2012

[20] S M Lai D Sudhahar and K Anandarajagopal ldquoEvaluationof antibacterial and antifungal activities of Persicaria chinensisleavesrdquo International Journal of Pharmaceutical Sciences ampResearch vol 3 p 8 2012

[21] B Veres B Radnai F Gallyas Jr et al ldquoRegulation of kinase cas-cades and transcription factors by a poly(ADP-ribose) polym-erase-1 inhibitor 4-hydroxyquinazoline in lipopolysaccharide-induced inflammation in micerdquo Journal of Pharmacology andExperimental Therapeutics vol 310 no 1 pp 247ndash255 2004

[22] M Panteva H Korkaya and S Jameel ldquoHepatitis viruses andthe MAPK pathway is this a survival strategyrdquo Virus Researchvol 92 no 2 pp 131ndash140 2003

[23] A Laliena B S Miguel I Crespo M Alvarez J Gonzalez-Gallego and M J Tunon ldquoMelatonin attenuates inflammationand promotes regeneration in rabbits with fulminant hepatitisof viral originrdquo Journal of Pineal Research vol 53 no 3 pp 270ndash278 2012

[24] S E Byeon T Yu Y Yang et al ldquoHydroquinone regulateshemeoxygenase-1 expression via modulation of Src kinaseactivity through thiolation of cysteine residuesrdquo Free RadicalBiology and Medicine vol 57 pp 105ndash118 2013

[25] S E Byeon T Yu Y Yang et al ldquoHydroquinone regulateshemeoxygenase-1 expression via modulation of Src kinaseactivity through thiolation of cysteine residuesrdquo Free RadicalBiology and Medicine vol 57 pp 105ndash118 2013

[26] Y Yang T Yu H-J Jang et al ldquoIn vitro and in vivo anti-inflammatory activities of Polygonum hydropiper methanolextractrdquo Journal of Ethnopharmacology vol 139 no 2 pp 616ndash625 2012

[27] M-Y Kim and J Y Cho ldquo20S-dihydroprotopanaxadiol aginsenoside derivative boosts innate immune responses ofmonocytes and macrophagesrdquo Journal of Ginseng Research vol37 no 3 pp 293ndash299 2013

[28] E H Jho K Kang S Oidovsambuu et al ldquoGymnaster koraien-sis and its major components 35-di-O-caffeoylquinic acid andgymnasterkoreayne B reduce oxidative damage induced bytert-butyl hydroperoxide or acetaminophen in hepG2 cellsrdquoBMB Reports vol 46 no 10 pp 513ndash518 2013

[29] Y Yang T Yu Y G Lee et al ldquoMethanol extract ofHopea odor-ata suppresses inflammatory responses via the direct inhibitionof multiple kinasesrdquo Journal of Ethnopharmacology vol 145 no2 pp 598ndash607 2013

[30] S Sun Back J Kim D Choi E S Lee S Y Choi and K HanldquoCooperative transcriptional activation of ATP-binding cassettesterol transporters ABCG5 and ABCG8 genes by nuclear recep-tors including Liver-X-Receptorrdquo BMB Reports vol 46 no 6pp 322ndash327 2013

[31] C Liang Y Ding S B Song et al ldquoOleanane-triterpenoidsfrom Panax stipuleanatus inhibit NF-120581Brdquo Journal of GinsengResearch vol 37 no 1 pp 74ndash79 2013

[32] J Y Cho J D Yeon J Y Kim E S Yoo YH Yu andMH ParkldquoHepatoprotection by human epidermal growth factor (hEGF)against experimental hepatitis induced byD-galactosamine (D-GalN) or D-GalNlipopolysacchariderdquo Biological amp Pharma-ceutical Bulletin vol 23 no 10 pp 1243ndash1246 2000

Evidence-Based Complementary and Alternative Medicine 11

[33] C-W Lee F-L Yen H-W Huang et al ldquoResveratrol nanopar-ticle system improves dissolution properties and enhances thehepatoprotective effect of resveratrol through antioxidant andanti-inflammatory pathwaysrdquo Journal of Agricultural and FoodChemistry vol 60 no 18 pp 4662ndash4671 2012

[34] T Yu J Lee Y G Lee et al ldquoIn vitro and in vivo anti-inflam-matory effects of ethanol extract from Acer tegmentosumrdquoJournal of Ethnopharmacology vol 128 no 1 pp 139ndash147 2010

[35] Y-H Jeong J-W Hyun T K van Le D-H Kim and H-SKim ldquoKalopanaxsaponin A exerts anti-inflammatory effects inlipopolysaccharide-stimulated microglia via inhibition of JNKand NF-120581BAP-1 pathwaysrdquo Biomolecules andTherapeutics vol21 no 5 pp 332ndash337 2013

[36] M Feldmann ldquoMany cytokines are very useful therapeutictargets in diseaserdquoThe Journal of Clinical Investigation vol 118no 11 pp 3533ndash3536 2008

[37] B Kaminska ldquoMAPK signalling pathways as molecular targetsfor anti-inflammatory therapymdashfrom molecular mechanismsto therapeutic benefitsrdquoBiochimica et Biophysica ActamdashProteinsand Proteomics vol 1754 no 1-2 pp 253ndash262 2005

[38] Y Yang S C Kim T Yu et al ldquoFunctional roles of p38mitogen-activated protein kinase in macrophage-mediated inflamma-tory responsesrdquoMediators of Inflammation vol 2014 Article ID352371 13 pages 2014

[39] Y Yang J Lee M H Rhee et al ldquoMolecular mechanism ofprotopanaxadiol saponin fraction-mediated anti-inflammatoryactionsrdquo Journal of Ginseng Research vol 39 no 1 pp 61ndash682015

[40] L A J OrsquoNeill K A Fitzgerald and A G Bowie ldquoThe Toll-IL-1 receptor adaptor family grows to five membersrdquo Trends inImmunology vol 24 no 6 pp 286ndash289 2003

[41] S E Byeon J Lee B C Yoo et al ldquoP38-targeted inhibition ofinterleukin-12 expression by ethanol extract from Cordycepsbassiana in lipopolysaccharide-activated macrophagesrdquo Immu-nopharmacology and Immunotoxicology vol 33 no 1 pp 90ndash96 2011

[42] M H Kim D S Yoo S Y Lee et al ldquoThe TRIFTBK1IRF-3activation pathway is the primary inhibitory target of resver-atrol contributing to its broad-spectrum anti-inflammatoryeffectsrdquo Pharmazie vol 66 no 4 pp 293ndash300 2011

[43] S Ghosh and M S Hayden ldquoNew regulators of NF-120581B ininflammationrdquo Nature Reviews Immunology vol 8 no 11 pp837ndash848 2008

[44] R Medzhitov and T Horng ldquoTranscriptional control of theinflammatory responserdquoNature Reviews Immunology vol 9 no10 pp 692ndash703 2009

[45] T Kawai and S Akira ldquoToll-like receptors and their crosstalkwith other innate receptors in infection and immunityrdquo Immu-nity vol 34 no 5 pp 637ndash650 2011

[46] K Mehla S Balwani A Kulshreshtha D Nandi P Jaisankarand B Ghosh ldquoEthyl gallate isolated from Pistacia integerrimaLinn inhibits cell adhesion molecules by blocking AP-1 tran-scription factorrdquo Journal of Ethnopharmacology vol 137 no 3pp 1345ndash1352 2011

[47] T Yu H M Ahn T Shen et al ldquoAnti-inflammatory activity ofethanol extract derived fromPhaseolus angularis beansrdquo Journalof Ethnopharmacology vol 137 no 3 pp 1197ndash1206 2011

[48] H S Kim A-R Kim H J Park et al ldquoMorus bombycis Koid-zumi extract suppresses collagen-induced arthritis by inhibitingthe activation of nuclear factor-120581B and activator protein-1 inmicerdquo Journal of Ethnopharmacology vol 136 no 3 pp 392ndash398 2011

[49] T Yu Y J Lee H M Yang et al ldquoInhibitory effect of San-guisorba officinalis ethanol extract onNO and PGE

2production

is mediated by suppression of NF-120581B and AP-1 activationsignaling cascaderdquo Journal of Ethnopharmacology vol 134 no1 pp 11ndash17 2011

[50] M Guha and N Mackman ldquoLPS induction of gene expressionin human monocytesrdquo Cellular Signalling vol 13 no 2 pp 85ndash94 2001

[51] S-J Seo J Y Cho Y H Jeong and Y-S Choi ldquoEffect of Koreanred ginseng extract on liver damage induced by shorttermand long-term ethanol treatment in ratsrdquo Journal of GinsengResearch vol 37 no 2 pp 194ndash200 2013

[52] A Pareek A Godavarthi R Issarani and B P Nagori ldquoAntiox-idant and hepatoprotective activity of Fagonia schweinfurthii(Hadidi) Hadidi extract in carbon tetrachloride induced hep-atotoxicity in HepG2 cell line and ratsrdquo Journal of Ethnophar-macology vol 150 no 3 pp 973ndash981 2013

[53] H Mohd Yusof N M Ali S K Yeap et al ldquoHepatoprotectiveeffect of fermented soybean (nutrient enriched soybean tem-peh) against alcohol-induced liver damage in micerdquo Evidence-Based Complementary and Alternative Medicine vol 2013Article ID 274274 8 pages 2013

[54] J J Campos A De Oliveira Azevedo J D De Souza FilhoA Castro Perez and F Castro Braga ldquoBioguided isolation ofmyricetin-3-O-120573-galactopyranoside with antinociceptive activ-ity from the aerial part of Davilla elliptica St-Hilrdquo Journal ofEthnopharmacology vol 150 no 1 pp 270ndash274 2013

[55] S M Salama M A Abdulla A S Alrashdi and A H A HadildquoMechanism of hepatoprotective effect of Boesenbergia rotundain thioacetamide-induced liver damage in ratsrdquo Evidence-basedComplementary and Alternative Medicine vol 2013 Article ID157456 13 pages 2013

Submit your manuscripts athttpwwwhindawicom

Stem CellsInternational

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

MEDIATORSINFLAMMATION

of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Behavioural Neurology

EndocrinologyInternational Journal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Disease Markers

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

BioMed Research International

OncologyJournal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Oxidative Medicine and Cellular Longevity

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

PPAR Research

The Scientific World JournalHindawi Publishing Corporation httpwwwhindawicom Volume 2014

Immunology ResearchHindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Journal of

ObesityJournal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Computational and Mathematical Methods in Medicine

OphthalmologyJournal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Diabetes ResearchJournal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Research and TreatmentAIDS

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Gastroenterology Research and Practice

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Parkinsonrsquos Disease

Evidence-Based Complementary and Alternative Medicine

Volume 2014Hindawi Publishing Corporationhttpwwwhindawicom

Evidence-Based Complementary and Alternative Medicine 9A

P-1-

med

iate

d lu

cife

rase

activ

ity (f

old

incr

ease

)

Tag2MyD88

0

1

2

3

4

5

+

minusminus

minus

+minus

minus

+20

minus

+40

minus

+80

lowastlowastlowastlowast

lowastlowast

Quercetin (120583M)

Figure 6 Effect of quercetin on the activation of upstream signalingenzymes of AP-1 in a reporter gene assay The promoter bindingactivity of the transcription factor AP-1 was analyzed using areporter gene assay in HEK293 cells transfected with plasmidconstructs AP-1-Luc (1 120583gmL) and 120573-gal (as a transfection control)with 1 120583gmL of MyD88 in the presence of quercetin Luciferaseactivity was measured using a luminometer lowastlowast119875 lt 001 comparedwith control

of MEK12 and MKK4 the upstream enzymes of ERK andJNK respectively was also strikingly suppressed by Pc-MEin LPS challenges of 2 3 and 5min (Figure 4(b)) confirmingthe MAPK inhibitory activity of this extract

MAPK activation and subsequent AP-1 activation arestrongly linked to the induction of hepatitis [22 23] Sowe guess that AP-1-inhibitory extract Pc-ME is capable ofattenuating hepatitis symptoms To test this hypothesis weemployed LPSD-GalN-intoxicated acute liver injury modelwhich is a classical system for screening hepatoprotectiveremedy in vivo [32] Our previous study indicating thatPc-ME can protect against HClEtOH-induced gastritis byinhibiting SrcSyk of NF-120581B [17] has demonstrated the oraleffectiveness of this extract In the present study expectedlyPc-ME treatment (200mgkg) effectively ameliorated theLPSD-GalN-induced liver damage (Figure 5(c)) includingreversion of LPSD-GalN-elevated hepatic ALT (Figure 5(a))and AST (Figure 5(b)) enzyme levels In the in vivo hepatictissue the upregulated phosphorylation of MKK4 and c-Fos(component of AP-1) was also noticeably blocked by Pc-MEtreatment (Figure 5(d)) which strongly authenticated ourfindings In addition quercetin a major antioxidative andanti-inflammatory compound of P chinensis [17] also drasti-cally diminished theAP-1 activation in a dose-dependent pat-tern (Figure 6) supporting that MAPKAP-1-targeted anti-inflammatory activity of Pc-ME could be quercetin-derivedanti-inflammatory action Although numerous numbers ofmedicinal plants or edible fruits such as Panax ginsengFagonia schweinfurthii fermented soybean Davilla ellipticaand Boesenbergia rotunda have been reported to show anti-hepatitis activities [51ndash55] only few plants are now clinicallyprescribed It was revealed that Pc-ME is able to stronglysuppress both NF-120581B [17] and AP-1 activity we will further

TLR4

LPS

Pc-ME

Tissue damage

MyD88

MAPK

ERK JNK

c-Fos

AP-1

TRIF

IL-6 IL-1120573

TNF-120572

TNF-120572

IL-6 IL-1120573

Figure 7 Putative mechanism of Pc-ME-mediated anti-inflam-matory responses

validate whether Pc-ME can be also clinically developed as anew antihepatitis herbal drug

In summary our in vivo and in vitro assays demonstratedthat Pc-ME significantly reduced the levels of LPS-mediatedproinflammatory cytokines (TNF-120572 IL-1120573 and IL-6) andthat MAPKAP-1 inactivation by this extract contributes tothese inhibitory effects as summarized in Figure 7The strongantihepatotoxic activity of Pc-ME in vivo was observed in amousemodel of LPSD-GalN-induced liver injury indicatingthat Pc-ME could potentially be used as a hepatoprotectiveremedy

Conflict of Interests

The authors report no conflict of interests The authors aloneare responsible for the content and writing of the paper

Authorsrsquo Contribution

Muhammad Jahangir Hossen and Seung Cheol Kim equallycontributed to this work

Acknowledgment

This study was supported by a grant of the Korean HealthTechnology RampD Project Ministry of Health amp WelfareRepublic of Korea (HI12C0050)

References

[1] C-K Tseng C-K Lin H-W Chang et al ldquoAqueous extractof Gracilaria tenuistipitata suppresses LPS-induced NF-120581Band MAPK activation in RAW 2647 and rat peritonealmacrophages and exerts hepatoprotective effects on carbon

10 Evidence-Based Complementary and Alternative Medicine

tetrachloride-treated ratrdquo PLoS ONE vol 9 no 1 Article IDe86557 2014

[2] H C Steel R Cockeran R Anderson and C Feldman ldquoOver-viewof community-acquired pneumonia and the role of inflam-matory mechanisms in the immunopathogenesis of severepneumococcal diseaserdquo Mediators of Inflammation vol 2013Article ID 490346 18 pages 2013

[3] M Pasparakis ldquoRegulation of tissue homeostasis by NF-Bsignalling implications for inflammatory diseasesrdquo NatureReviews Immunology vol 9 no 11 pp 778ndash788 2009

[4] J-K Kim and G-M Park ldquoIndirubin-3-monoxime exhibitsanti-inflammatory properties by down-regulating NF-120581Band JNK signaling pathways in lipopolysaccharide- treatedRAW2647 cellsrdquo Inflammation Research vol 61 no 4 pp319ndash325 2012

[5] MHamandAMoon ldquoInflammatory andmicroenvironmentalfactors involved in breast cancer progressionrdquo Archives ofPharmacal Research vol 36 no 12 pp 1419ndash1431 2013

[6] M-S Lee ldquoRole of innate immunity in diabetes and metab-olism recent progress in the study of inflammasomesrdquo ImmuneNetwork vol 11 no 2 pp 95ndash99 2011

[7] Y Ayele J-A Kim E Park et al ldquoA methanol extract of Adan-sonia digitata L leaves inhibits pro-inflammatory iNOS possi-bly via the inhibition of NF-120581B activationrdquo Biomolecules andTherapeutics vol 21 no 2 pp 146ndash152 2013

[8] D H Kim J H Chung J S Yoon et al ldquoGinsenoside Rdinhibits the expressions of iNOS andCOX-2 by suppressingNF-120581B in LPS-stimulated RAW2647 cells and mouse liverrdquo Journalof Ginseng Research vol 37 no 1 pp 54ndash63 2013

[9] M Fujihara M Muroi K-I Tanamoto T Suzuki H Azumaand H Ikeda ldquoMolecular mechanisms of macrophage activa-tion and deactivation by lipopolysaccharide roles of the recep-tor complexrdquo Pharmacology and Therapeutics vol 100 no 2pp 171ndash194 2003

[10] T Yu Y J Li A H Bian et al ldquoThe regulatory role of activat-ing transcription factor 2 in inflammationrdquoMediators of Inflam-mation vol 2014 Article ID 950472 10 pages 2014

[11] I-T Lee and C-M Yang ldquoInflammatory signalings involvedin airway and pulmonary diseasesrdquoMediators of Inflammationvol 2013 Article ID 791231 12 pages 2013

[12] E D Chan and D W H Riches ldquoIFN-120574 + LPS induction ofiNOS is modulated by ERK JNKSAPK and p38mapk in amouse macrophage cell linerdquo The American Journal of Physi-ologymdashCell Physiology vol 280 no 3 pp C441ndashC450 2001

[13] I N Crispe ldquoThe liver as a lymphoid organrdquo Annual Review ofImmunology vol 27 pp 147ndash163 2009

[14] F Tacke T Luedde and C Trautwein ldquoInflammatory pathwaysin liver homeostasis and liver injuryrdquoClinical Reviews in Allergyamp Immunology vol 36 no 1 pp 4ndash12 2009

[15] M Y Jia Y P Jing Q Ai et al ldquoPotential role of catalase inmicewith lipopolysaccharideD-galactosamine-induced fulminantliver injuryrdquo Hepatology Research vol 44 no 11 pp 1151ndash11582014

[16] Q Ai Y Jing R Jiang et al ldquoRotenone a mitochondrial res-piratory complex i inhibitor ameliorates lipopolysaccharideD-galactosamine-induced fulminant hepatitis in micerdquo Interna-tional Immunopharmacology vol 21 no 1 pp 200ndash207 2014

[17] M J Hossen K-S Baek E Kim et al ldquoIn vivo and in vitroanti-inflammatory activities of Persicaria chinensis methanolicextract targeting SrcSykNF-120581Brdquo Journal of Ethnopharmacol-ogy vol 159 pp 9ndash16 2015

[18] D R Luitel M B Rokaya B Timsina and Z MunzbergovaldquoMedicinal plants used by the Tamang community in theMakawanpur district of central Nepalrdquo Journal of Ethnobiologyand Ethnomedicine vol 10 no 1 article 5 2014

[19] W M May The reproductive biology and cytotoxic activity ofpersicaria chinensis (L) H gross var chinensis (Polygonaceae)[Dissertation] University of Malaya 2012

[20] S M Lai D Sudhahar and K Anandarajagopal ldquoEvaluationof antibacterial and antifungal activities of Persicaria chinensisleavesrdquo International Journal of Pharmaceutical Sciences ampResearch vol 3 p 8 2012

[21] B Veres B Radnai F Gallyas Jr et al ldquoRegulation of kinase cas-cades and transcription factors by a poly(ADP-ribose) polym-erase-1 inhibitor 4-hydroxyquinazoline in lipopolysaccharide-induced inflammation in micerdquo Journal of Pharmacology andExperimental Therapeutics vol 310 no 1 pp 247ndash255 2004

[22] M Panteva H Korkaya and S Jameel ldquoHepatitis viruses andthe MAPK pathway is this a survival strategyrdquo Virus Researchvol 92 no 2 pp 131ndash140 2003

[23] A Laliena B S Miguel I Crespo M Alvarez J Gonzalez-Gallego and M J Tunon ldquoMelatonin attenuates inflammationand promotes regeneration in rabbits with fulminant hepatitisof viral originrdquo Journal of Pineal Research vol 53 no 3 pp 270ndash278 2012

[24] S E Byeon T Yu Y Yang et al ldquoHydroquinone regulateshemeoxygenase-1 expression via modulation of Src kinaseactivity through thiolation of cysteine residuesrdquo Free RadicalBiology and Medicine vol 57 pp 105ndash118 2013

[25] S E Byeon T Yu Y Yang et al ldquoHydroquinone regulateshemeoxygenase-1 expression via modulation of Src kinaseactivity through thiolation of cysteine residuesrdquo Free RadicalBiology and Medicine vol 57 pp 105ndash118 2013

[26] Y Yang T Yu H-J Jang et al ldquoIn vitro and in vivo anti-inflammatory activities of Polygonum hydropiper methanolextractrdquo Journal of Ethnopharmacology vol 139 no 2 pp 616ndash625 2012

[27] M-Y Kim and J Y Cho ldquo20S-dihydroprotopanaxadiol aginsenoside derivative boosts innate immune responses ofmonocytes and macrophagesrdquo Journal of Ginseng Research vol37 no 3 pp 293ndash299 2013

[28] E H Jho K Kang S Oidovsambuu et al ldquoGymnaster koraien-sis and its major components 35-di-O-caffeoylquinic acid andgymnasterkoreayne B reduce oxidative damage induced bytert-butyl hydroperoxide or acetaminophen in hepG2 cellsrdquoBMB Reports vol 46 no 10 pp 513ndash518 2013

[29] Y Yang T Yu Y G Lee et al ldquoMethanol extract ofHopea odor-ata suppresses inflammatory responses via the direct inhibitionof multiple kinasesrdquo Journal of Ethnopharmacology vol 145 no2 pp 598ndash607 2013

[30] S Sun Back J Kim D Choi E S Lee S Y Choi and K HanldquoCooperative transcriptional activation of ATP-binding cassettesterol transporters ABCG5 and ABCG8 genes by nuclear recep-tors including Liver-X-Receptorrdquo BMB Reports vol 46 no 6pp 322ndash327 2013

[31] C Liang Y Ding S B Song et al ldquoOleanane-triterpenoidsfrom Panax stipuleanatus inhibit NF-120581Brdquo Journal of GinsengResearch vol 37 no 1 pp 74ndash79 2013

[32] J Y Cho J D Yeon J Y Kim E S Yoo YH Yu andMH ParkldquoHepatoprotection by human epidermal growth factor (hEGF)against experimental hepatitis induced byD-galactosamine (D-GalN) or D-GalNlipopolysacchariderdquo Biological amp Pharma-ceutical Bulletin vol 23 no 10 pp 1243ndash1246 2000

Evidence-Based Complementary and Alternative Medicine 11

[33] C-W Lee F-L Yen H-W Huang et al ldquoResveratrol nanopar-ticle system improves dissolution properties and enhances thehepatoprotective effect of resveratrol through antioxidant andanti-inflammatory pathwaysrdquo Journal of Agricultural and FoodChemistry vol 60 no 18 pp 4662ndash4671 2012

[34] T Yu J Lee Y G Lee et al ldquoIn vitro and in vivo anti-inflam-matory effects of ethanol extract from Acer tegmentosumrdquoJournal of Ethnopharmacology vol 128 no 1 pp 139ndash147 2010

[35] Y-H Jeong J-W Hyun T K van Le D-H Kim and H-SKim ldquoKalopanaxsaponin A exerts anti-inflammatory effects inlipopolysaccharide-stimulated microglia via inhibition of JNKand NF-120581BAP-1 pathwaysrdquo Biomolecules andTherapeutics vol21 no 5 pp 332ndash337 2013

[36] M Feldmann ldquoMany cytokines are very useful therapeutictargets in diseaserdquoThe Journal of Clinical Investigation vol 118no 11 pp 3533ndash3536 2008

[37] B Kaminska ldquoMAPK signalling pathways as molecular targetsfor anti-inflammatory therapymdashfrom molecular mechanismsto therapeutic benefitsrdquoBiochimica et Biophysica ActamdashProteinsand Proteomics vol 1754 no 1-2 pp 253ndash262 2005

[38] Y Yang S C Kim T Yu et al ldquoFunctional roles of p38mitogen-activated protein kinase in macrophage-mediated inflamma-tory responsesrdquoMediators of Inflammation vol 2014 Article ID352371 13 pages 2014

[39] Y Yang J Lee M H Rhee et al ldquoMolecular mechanism ofprotopanaxadiol saponin fraction-mediated anti-inflammatoryactionsrdquo Journal of Ginseng Research vol 39 no 1 pp 61ndash682015

[40] L A J OrsquoNeill K A Fitzgerald and A G Bowie ldquoThe Toll-IL-1 receptor adaptor family grows to five membersrdquo Trends inImmunology vol 24 no 6 pp 286ndash289 2003

[41] S E Byeon J Lee B C Yoo et al ldquoP38-targeted inhibition ofinterleukin-12 expression by ethanol extract from Cordycepsbassiana in lipopolysaccharide-activated macrophagesrdquo Immu-nopharmacology and Immunotoxicology vol 33 no 1 pp 90ndash96 2011

[42] M H Kim D S Yoo S Y Lee et al ldquoThe TRIFTBK1IRF-3activation pathway is the primary inhibitory target of resver-atrol contributing to its broad-spectrum anti-inflammatoryeffectsrdquo Pharmazie vol 66 no 4 pp 293ndash300 2011

[43] S Ghosh and M S Hayden ldquoNew regulators of NF-120581B ininflammationrdquo Nature Reviews Immunology vol 8 no 11 pp837ndash848 2008

[44] R Medzhitov and T Horng ldquoTranscriptional control of theinflammatory responserdquoNature Reviews Immunology vol 9 no10 pp 692ndash703 2009

[45] T Kawai and S Akira ldquoToll-like receptors and their crosstalkwith other innate receptors in infection and immunityrdquo Immu-nity vol 34 no 5 pp 637ndash650 2011

[46] K Mehla S Balwani A Kulshreshtha D Nandi P Jaisankarand B Ghosh ldquoEthyl gallate isolated from Pistacia integerrimaLinn inhibits cell adhesion molecules by blocking AP-1 tran-scription factorrdquo Journal of Ethnopharmacology vol 137 no 3pp 1345ndash1352 2011

[47] T Yu H M Ahn T Shen et al ldquoAnti-inflammatory activity ofethanol extract derived fromPhaseolus angularis beansrdquo Journalof Ethnopharmacology vol 137 no 3 pp 1197ndash1206 2011

[48] H S Kim A-R Kim H J Park et al ldquoMorus bombycis Koid-zumi extract suppresses collagen-induced arthritis by inhibitingthe activation of nuclear factor-120581B and activator protein-1 inmicerdquo Journal of Ethnopharmacology vol 136 no 3 pp 392ndash398 2011

[49] T Yu Y J Lee H M Yang et al ldquoInhibitory effect of San-guisorba officinalis ethanol extract onNO and PGE

2production

is mediated by suppression of NF-120581B and AP-1 activationsignaling cascaderdquo Journal of Ethnopharmacology vol 134 no1 pp 11ndash17 2011

[50] M Guha and N Mackman ldquoLPS induction of gene expressionin human monocytesrdquo Cellular Signalling vol 13 no 2 pp 85ndash94 2001

[51] S-J Seo J Y Cho Y H Jeong and Y-S Choi ldquoEffect of Koreanred ginseng extract on liver damage induced by shorttermand long-term ethanol treatment in ratsrdquo Journal of GinsengResearch vol 37 no 2 pp 194ndash200 2013

[52] A Pareek A Godavarthi R Issarani and B P Nagori ldquoAntiox-idant and hepatoprotective activity of Fagonia schweinfurthii(Hadidi) Hadidi extract in carbon tetrachloride induced hep-atotoxicity in HepG2 cell line and ratsrdquo Journal of Ethnophar-macology vol 150 no 3 pp 973ndash981 2013

[53] H Mohd Yusof N M Ali S K Yeap et al ldquoHepatoprotectiveeffect of fermented soybean (nutrient enriched soybean tem-peh) against alcohol-induced liver damage in micerdquo Evidence-Based Complementary and Alternative Medicine vol 2013Article ID 274274 8 pages 2013

[54] J J Campos A De Oliveira Azevedo J D De Souza FilhoA Castro Perez and F Castro Braga ldquoBioguided isolation ofmyricetin-3-O-120573-galactopyranoside with antinociceptive activ-ity from the aerial part of Davilla elliptica St-Hilrdquo Journal ofEthnopharmacology vol 150 no 1 pp 270ndash274 2013

[55] S M Salama M A Abdulla A S Alrashdi and A H A HadildquoMechanism of hepatoprotective effect of Boesenbergia rotundain thioacetamide-induced liver damage in ratsrdquo Evidence-basedComplementary and Alternative Medicine vol 2013 Article ID157456 13 pages 2013

Submit your manuscripts athttpwwwhindawicom

Stem CellsInternational

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

MEDIATORSINFLAMMATION

of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Behavioural Neurology

EndocrinologyInternational Journal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Disease Markers

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

BioMed Research International

OncologyJournal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Oxidative Medicine and Cellular Longevity

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

PPAR Research

The Scientific World JournalHindawi Publishing Corporation httpwwwhindawicom Volume 2014

Immunology ResearchHindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Journal of

ObesityJournal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Computational and Mathematical Methods in Medicine

OphthalmologyJournal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Diabetes ResearchJournal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Research and TreatmentAIDS

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Gastroenterology Research and Practice

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Parkinsonrsquos Disease

Evidence-Based Complementary and Alternative Medicine

Volume 2014Hindawi Publishing Corporationhttpwwwhindawicom

10 Evidence-Based Complementary and Alternative Medicine

tetrachloride-treated ratrdquo PLoS ONE vol 9 no 1 Article IDe86557 2014

[2] H C Steel R Cockeran R Anderson and C Feldman ldquoOver-viewof community-acquired pneumonia and the role of inflam-matory mechanisms in the immunopathogenesis of severepneumococcal diseaserdquo Mediators of Inflammation vol 2013Article ID 490346 18 pages 2013

[3] M Pasparakis ldquoRegulation of tissue homeostasis by NF-Bsignalling implications for inflammatory diseasesrdquo NatureReviews Immunology vol 9 no 11 pp 778ndash788 2009

[4] J-K Kim and G-M Park ldquoIndirubin-3-monoxime exhibitsanti-inflammatory properties by down-regulating NF-120581Band JNK signaling pathways in lipopolysaccharide- treatedRAW2647 cellsrdquo Inflammation Research vol 61 no 4 pp319ndash325 2012

[5] MHamandAMoon ldquoInflammatory andmicroenvironmentalfactors involved in breast cancer progressionrdquo Archives ofPharmacal Research vol 36 no 12 pp 1419ndash1431 2013

[6] M-S Lee ldquoRole of innate immunity in diabetes and metab-olism recent progress in the study of inflammasomesrdquo ImmuneNetwork vol 11 no 2 pp 95ndash99 2011

[7] Y Ayele J-A Kim E Park et al ldquoA methanol extract of Adan-sonia digitata L leaves inhibits pro-inflammatory iNOS possi-bly via the inhibition of NF-120581B activationrdquo Biomolecules andTherapeutics vol 21 no 2 pp 146ndash152 2013

[8] D H Kim J H Chung J S Yoon et al ldquoGinsenoside Rdinhibits the expressions of iNOS andCOX-2 by suppressingNF-120581B in LPS-stimulated RAW2647 cells and mouse liverrdquo Journalof Ginseng Research vol 37 no 1 pp 54ndash63 2013

[9] M Fujihara M Muroi K-I Tanamoto T Suzuki H Azumaand H Ikeda ldquoMolecular mechanisms of macrophage activa-tion and deactivation by lipopolysaccharide roles of the recep-tor complexrdquo Pharmacology and Therapeutics vol 100 no 2pp 171ndash194 2003

[10] T Yu Y J Li A H Bian et al ldquoThe regulatory role of activat-ing transcription factor 2 in inflammationrdquoMediators of Inflam-mation vol 2014 Article ID 950472 10 pages 2014

[11] I-T Lee and C-M Yang ldquoInflammatory signalings involvedin airway and pulmonary diseasesrdquoMediators of Inflammationvol 2013 Article ID 791231 12 pages 2013

[12] E D Chan and D W H Riches ldquoIFN-120574 + LPS induction ofiNOS is modulated by ERK JNKSAPK and p38mapk in amouse macrophage cell linerdquo The American Journal of Physi-ologymdashCell Physiology vol 280 no 3 pp C441ndashC450 2001

[13] I N Crispe ldquoThe liver as a lymphoid organrdquo Annual Review ofImmunology vol 27 pp 147ndash163 2009

[14] F Tacke T Luedde and C Trautwein ldquoInflammatory pathwaysin liver homeostasis and liver injuryrdquoClinical Reviews in Allergyamp Immunology vol 36 no 1 pp 4ndash12 2009

[15] M Y Jia Y P Jing Q Ai et al ldquoPotential role of catalase inmicewith lipopolysaccharideD-galactosamine-induced fulminantliver injuryrdquo Hepatology Research vol 44 no 11 pp 1151ndash11582014

[16] Q Ai Y Jing R Jiang et al ldquoRotenone a mitochondrial res-piratory complex i inhibitor ameliorates lipopolysaccharideD-galactosamine-induced fulminant hepatitis in micerdquo Interna-tional Immunopharmacology vol 21 no 1 pp 200ndash207 2014

[17] M J Hossen K-S Baek E Kim et al ldquoIn vivo and in vitroanti-inflammatory activities of Persicaria chinensis methanolicextract targeting SrcSykNF-120581Brdquo Journal of Ethnopharmacol-ogy vol 159 pp 9ndash16 2015

[18] D R Luitel M B Rokaya B Timsina and Z MunzbergovaldquoMedicinal plants used by the Tamang community in theMakawanpur district of central Nepalrdquo Journal of Ethnobiologyand Ethnomedicine vol 10 no 1 article 5 2014

[19] W M May The reproductive biology and cytotoxic activity ofpersicaria chinensis (L) H gross var chinensis (Polygonaceae)[Dissertation] University of Malaya 2012

[20] S M Lai D Sudhahar and K Anandarajagopal ldquoEvaluationof antibacterial and antifungal activities of Persicaria chinensisleavesrdquo International Journal of Pharmaceutical Sciences ampResearch vol 3 p 8 2012

[21] B Veres B Radnai F Gallyas Jr et al ldquoRegulation of kinase cas-cades and transcription factors by a poly(ADP-ribose) polym-erase-1 inhibitor 4-hydroxyquinazoline in lipopolysaccharide-induced inflammation in micerdquo Journal of Pharmacology andExperimental Therapeutics vol 310 no 1 pp 247ndash255 2004

[22] M Panteva H Korkaya and S Jameel ldquoHepatitis viruses andthe MAPK pathway is this a survival strategyrdquo Virus Researchvol 92 no 2 pp 131ndash140 2003

[23] A Laliena B S Miguel I Crespo M Alvarez J Gonzalez-Gallego and M J Tunon ldquoMelatonin attenuates inflammationand promotes regeneration in rabbits with fulminant hepatitisof viral originrdquo Journal of Pineal Research vol 53 no 3 pp 270ndash278 2012

[24] S E Byeon T Yu Y Yang et al ldquoHydroquinone regulateshemeoxygenase-1 expression via modulation of Src kinaseactivity through thiolation of cysteine residuesrdquo Free RadicalBiology and Medicine vol 57 pp 105ndash118 2013

[25] S E Byeon T Yu Y Yang et al ldquoHydroquinone regulateshemeoxygenase-1 expression via modulation of Src kinaseactivity through thiolation of cysteine residuesrdquo Free RadicalBiology and Medicine vol 57 pp 105ndash118 2013

[26] Y Yang T Yu H-J Jang et al ldquoIn vitro and in vivo anti-inflammatory activities of Polygonum hydropiper methanolextractrdquo Journal of Ethnopharmacology vol 139 no 2 pp 616ndash625 2012

[27] M-Y Kim and J Y Cho ldquo20S-dihydroprotopanaxadiol aginsenoside derivative boosts innate immune responses ofmonocytes and macrophagesrdquo Journal of Ginseng Research vol37 no 3 pp 293ndash299 2013

[28] E H Jho K Kang S Oidovsambuu et al ldquoGymnaster koraien-sis and its major components 35-di-O-caffeoylquinic acid andgymnasterkoreayne B reduce oxidative damage induced bytert-butyl hydroperoxide or acetaminophen in hepG2 cellsrdquoBMB Reports vol 46 no 10 pp 513ndash518 2013

[29] Y Yang T Yu Y G Lee et al ldquoMethanol extract ofHopea odor-ata suppresses inflammatory responses via the direct inhibitionof multiple kinasesrdquo Journal of Ethnopharmacology vol 145 no2 pp 598ndash607 2013

[30] S Sun Back J Kim D Choi E S Lee S Y Choi and K HanldquoCooperative transcriptional activation of ATP-binding cassettesterol transporters ABCG5 and ABCG8 genes by nuclear recep-tors including Liver-X-Receptorrdquo BMB Reports vol 46 no 6pp 322ndash327 2013

[31] C Liang Y Ding S B Song et al ldquoOleanane-triterpenoidsfrom Panax stipuleanatus inhibit NF-120581Brdquo Journal of GinsengResearch vol 37 no 1 pp 74ndash79 2013

[32] J Y Cho J D Yeon J Y Kim E S Yoo YH Yu andMH ParkldquoHepatoprotection by human epidermal growth factor (hEGF)against experimental hepatitis induced byD-galactosamine (D-GalN) or D-GalNlipopolysacchariderdquo Biological amp Pharma-ceutical Bulletin vol 23 no 10 pp 1243ndash1246 2000

Evidence-Based Complementary and Alternative Medicine 11

[33] C-W Lee F-L Yen H-W Huang et al ldquoResveratrol nanopar-ticle system improves dissolution properties and enhances thehepatoprotective effect of resveratrol through antioxidant andanti-inflammatory pathwaysrdquo Journal of Agricultural and FoodChemistry vol 60 no 18 pp 4662ndash4671 2012

[34] T Yu J Lee Y G Lee et al ldquoIn vitro and in vivo anti-inflam-matory effects of ethanol extract from Acer tegmentosumrdquoJournal of Ethnopharmacology vol 128 no 1 pp 139ndash147 2010

[35] Y-H Jeong J-W Hyun T K van Le D-H Kim and H-SKim ldquoKalopanaxsaponin A exerts anti-inflammatory effects inlipopolysaccharide-stimulated microglia via inhibition of JNKand NF-120581BAP-1 pathwaysrdquo Biomolecules andTherapeutics vol21 no 5 pp 332ndash337 2013

[36] M Feldmann ldquoMany cytokines are very useful therapeutictargets in diseaserdquoThe Journal of Clinical Investigation vol 118no 11 pp 3533ndash3536 2008

[37] B Kaminska ldquoMAPK signalling pathways as molecular targetsfor anti-inflammatory therapymdashfrom molecular mechanismsto therapeutic benefitsrdquoBiochimica et Biophysica ActamdashProteinsand Proteomics vol 1754 no 1-2 pp 253ndash262 2005

[38] Y Yang S C Kim T Yu et al ldquoFunctional roles of p38mitogen-activated protein kinase in macrophage-mediated inflamma-tory responsesrdquoMediators of Inflammation vol 2014 Article ID352371 13 pages 2014

[39] Y Yang J Lee M H Rhee et al ldquoMolecular mechanism ofprotopanaxadiol saponin fraction-mediated anti-inflammatoryactionsrdquo Journal of Ginseng Research vol 39 no 1 pp 61ndash682015

[40] L A J OrsquoNeill K A Fitzgerald and A G Bowie ldquoThe Toll-IL-1 receptor adaptor family grows to five membersrdquo Trends inImmunology vol 24 no 6 pp 286ndash289 2003

[41] S E Byeon J Lee B C Yoo et al ldquoP38-targeted inhibition ofinterleukin-12 expression by ethanol extract from Cordycepsbassiana in lipopolysaccharide-activated macrophagesrdquo Immu-nopharmacology and Immunotoxicology vol 33 no 1 pp 90ndash96 2011

[42] M H Kim D S Yoo S Y Lee et al ldquoThe TRIFTBK1IRF-3activation pathway is the primary inhibitory target of resver-atrol contributing to its broad-spectrum anti-inflammatoryeffectsrdquo Pharmazie vol 66 no 4 pp 293ndash300 2011

[43] S Ghosh and M S Hayden ldquoNew regulators of NF-120581B ininflammationrdquo Nature Reviews Immunology vol 8 no 11 pp837ndash848 2008

[44] R Medzhitov and T Horng ldquoTranscriptional control of theinflammatory responserdquoNature Reviews Immunology vol 9 no10 pp 692ndash703 2009

[45] T Kawai and S Akira ldquoToll-like receptors and their crosstalkwith other innate receptors in infection and immunityrdquo Immu-nity vol 34 no 5 pp 637ndash650 2011

[46] K Mehla S Balwani A Kulshreshtha D Nandi P Jaisankarand B Ghosh ldquoEthyl gallate isolated from Pistacia integerrimaLinn inhibits cell adhesion molecules by blocking AP-1 tran-scription factorrdquo Journal of Ethnopharmacology vol 137 no 3pp 1345ndash1352 2011

[47] T Yu H M Ahn T Shen et al ldquoAnti-inflammatory activity ofethanol extract derived fromPhaseolus angularis beansrdquo Journalof Ethnopharmacology vol 137 no 3 pp 1197ndash1206 2011

[48] H S Kim A-R Kim H J Park et al ldquoMorus bombycis Koid-zumi extract suppresses collagen-induced arthritis by inhibitingthe activation of nuclear factor-120581B and activator protein-1 inmicerdquo Journal of Ethnopharmacology vol 136 no 3 pp 392ndash398 2011

[49] T Yu Y J Lee H M Yang et al ldquoInhibitory effect of San-guisorba officinalis ethanol extract onNO and PGE

2production

is mediated by suppression of NF-120581B and AP-1 activationsignaling cascaderdquo Journal of Ethnopharmacology vol 134 no1 pp 11ndash17 2011

[50] M Guha and N Mackman ldquoLPS induction of gene expressionin human monocytesrdquo Cellular Signalling vol 13 no 2 pp 85ndash94 2001

[51] S-J Seo J Y Cho Y H Jeong and Y-S Choi ldquoEffect of Koreanred ginseng extract on liver damage induced by shorttermand long-term ethanol treatment in ratsrdquo Journal of GinsengResearch vol 37 no 2 pp 194ndash200 2013

[52] A Pareek A Godavarthi R Issarani and B P Nagori ldquoAntiox-idant and hepatoprotective activity of Fagonia schweinfurthii(Hadidi) Hadidi extract in carbon tetrachloride induced hep-atotoxicity in HepG2 cell line and ratsrdquo Journal of Ethnophar-macology vol 150 no 3 pp 973ndash981 2013

[53] H Mohd Yusof N M Ali S K Yeap et al ldquoHepatoprotectiveeffect of fermented soybean (nutrient enriched soybean tem-peh) against alcohol-induced liver damage in micerdquo Evidence-Based Complementary and Alternative Medicine vol 2013Article ID 274274 8 pages 2013

[54] J J Campos A De Oliveira Azevedo J D De Souza FilhoA Castro Perez and F Castro Braga ldquoBioguided isolation ofmyricetin-3-O-120573-galactopyranoside with antinociceptive activ-ity from the aerial part of Davilla elliptica St-Hilrdquo Journal ofEthnopharmacology vol 150 no 1 pp 270ndash274 2013

[55] S M Salama M A Abdulla A S Alrashdi and A H A HadildquoMechanism of hepatoprotective effect of Boesenbergia rotundain thioacetamide-induced liver damage in ratsrdquo Evidence-basedComplementary and Alternative Medicine vol 2013 Article ID157456 13 pages 2013

Submit your manuscripts athttpwwwhindawicom

Stem CellsInternational

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

MEDIATORSINFLAMMATION

of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Behavioural Neurology

EndocrinologyInternational Journal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Disease Markers

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

BioMed Research International

OncologyJournal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Oxidative Medicine and Cellular Longevity

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

PPAR Research

The Scientific World JournalHindawi Publishing Corporation httpwwwhindawicom Volume 2014

Immunology ResearchHindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Journal of

ObesityJournal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Computational and Mathematical Methods in Medicine

OphthalmologyJournal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Diabetes ResearchJournal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Research and TreatmentAIDS

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Gastroenterology Research and Practice

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Parkinsonrsquos Disease

Evidence-Based Complementary and Alternative Medicine

Volume 2014Hindawi Publishing Corporationhttpwwwhindawicom

Evidence-Based Complementary and Alternative Medicine 11

[33] C-W Lee F-L Yen H-W Huang et al ldquoResveratrol nanopar-ticle system improves dissolution properties and enhances thehepatoprotective effect of resveratrol through antioxidant andanti-inflammatory pathwaysrdquo Journal of Agricultural and FoodChemistry vol 60 no 18 pp 4662ndash4671 2012

[34] T Yu J Lee Y G Lee et al ldquoIn vitro and in vivo anti-inflam-matory effects of ethanol extract from Acer tegmentosumrdquoJournal of Ethnopharmacology vol 128 no 1 pp 139ndash147 2010

[35] Y-H Jeong J-W Hyun T K van Le D-H Kim and H-SKim ldquoKalopanaxsaponin A exerts anti-inflammatory effects inlipopolysaccharide-stimulated microglia via inhibition of JNKand NF-120581BAP-1 pathwaysrdquo Biomolecules andTherapeutics vol21 no 5 pp 332ndash337 2013

[36] M Feldmann ldquoMany cytokines are very useful therapeutictargets in diseaserdquoThe Journal of Clinical Investigation vol 118no 11 pp 3533ndash3536 2008

[37] B Kaminska ldquoMAPK signalling pathways as molecular targetsfor anti-inflammatory therapymdashfrom molecular mechanismsto therapeutic benefitsrdquoBiochimica et Biophysica ActamdashProteinsand Proteomics vol 1754 no 1-2 pp 253ndash262 2005

[38] Y Yang S C Kim T Yu et al ldquoFunctional roles of p38mitogen-activated protein kinase in macrophage-mediated inflamma-tory responsesrdquoMediators of Inflammation vol 2014 Article ID352371 13 pages 2014

[39] Y Yang J Lee M H Rhee et al ldquoMolecular mechanism ofprotopanaxadiol saponin fraction-mediated anti-inflammatoryactionsrdquo Journal of Ginseng Research vol 39 no 1 pp 61ndash682015

[40] L A J OrsquoNeill K A Fitzgerald and A G Bowie ldquoThe Toll-IL-1 receptor adaptor family grows to five membersrdquo Trends inImmunology vol 24 no 6 pp 286ndash289 2003

[41] S E Byeon J Lee B C Yoo et al ldquoP38-targeted inhibition ofinterleukin-12 expression by ethanol extract from Cordycepsbassiana in lipopolysaccharide-activated macrophagesrdquo Immu-nopharmacology and Immunotoxicology vol 33 no 1 pp 90ndash96 2011

[42] M H Kim D S Yoo S Y Lee et al ldquoThe TRIFTBK1IRF-3activation pathway is the primary inhibitory target of resver-atrol contributing to its broad-spectrum anti-inflammatoryeffectsrdquo Pharmazie vol 66 no 4 pp 293ndash300 2011

[43] S Ghosh and M S Hayden ldquoNew regulators of NF-120581B ininflammationrdquo Nature Reviews Immunology vol 8 no 11 pp837ndash848 2008

[44] R Medzhitov and T Horng ldquoTranscriptional control of theinflammatory responserdquoNature Reviews Immunology vol 9 no10 pp 692ndash703 2009

[45] T Kawai and S Akira ldquoToll-like receptors and their crosstalkwith other innate receptors in infection and immunityrdquo Immu-nity vol 34 no 5 pp 637ndash650 2011

[46] K Mehla S Balwani A Kulshreshtha D Nandi P Jaisankarand B Ghosh ldquoEthyl gallate isolated from Pistacia integerrimaLinn inhibits cell adhesion molecules by blocking AP-1 tran-scription factorrdquo Journal of Ethnopharmacology vol 137 no 3pp 1345ndash1352 2011

[47] T Yu H M Ahn T Shen et al ldquoAnti-inflammatory activity ofethanol extract derived fromPhaseolus angularis beansrdquo Journalof Ethnopharmacology vol 137 no 3 pp 1197ndash1206 2011

[48] H S Kim A-R Kim H J Park et al ldquoMorus bombycis Koid-zumi extract suppresses collagen-induced arthritis by inhibitingthe activation of nuclear factor-120581B and activator protein-1 inmicerdquo Journal of Ethnopharmacology vol 136 no 3 pp 392ndash398 2011

[49] T Yu Y J Lee H M Yang et al ldquoInhibitory effect of San-guisorba officinalis ethanol extract onNO and PGE

2production

is mediated by suppression of NF-120581B and AP-1 activationsignaling cascaderdquo Journal of Ethnopharmacology vol 134 no1 pp 11ndash17 2011

[50] M Guha and N Mackman ldquoLPS induction of gene expressionin human monocytesrdquo Cellular Signalling vol 13 no 2 pp 85ndash94 2001

[51] S-J Seo J Y Cho Y H Jeong and Y-S Choi ldquoEffect of Koreanred ginseng extract on liver damage induced by shorttermand long-term ethanol treatment in ratsrdquo Journal of GinsengResearch vol 37 no 2 pp 194ndash200 2013

[52] A Pareek A Godavarthi R Issarani and B P Nagori ldquoAntiox-idant and hepatoprotective activity of Fagonia schweinfurthii(Hadidi) Hadidi extract in carbon tetrachloride induced hep-atotoxicity in HepG2 cell line and ratsrdquo Journal of Ethnophar-macology vol 150 no 3 pp 973ndash981 2013

[53] H Mohd Yusof N M Ali S K Yeap et al ldquoHepatoprotectiveeffect of fermented soybean (nutrient enriched soybean tem-peh) against alcohol-induced liver damage in micerdquo Evidence-Based Complementary and Alternative Medicine vol 2013Article ID 274274 8 pages 2013

[54] J J Campos A De Oliveira Azevedo J D De Souza FilhoA Castro Perez and F Castro Braga ldquoBioguided isolation ofmyricetin-3-O-120573-galactopyranoside with antinociceptive activ-ity from the aerial part of Davilla elliptica St-Hilrdquo Journal ofEthnopharmacology vol 150 no 1 pp 270ndash274 2013

[55] S M Salama M A Abdulla A S Alrashdi and A H A HadildquoMechanism of hepatoprotective effect of Boesenbergia rotundain thioacetamide-induced liver damage in ratsrdquo Evidence-basedComplementary and Alternative Medicine vol 2013 Article ID157456 13 pages 2013

Submit your manuscripts athttpwwwhindawicom

Stem CellsInternational

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

MEDIATORSINFLAMMATION

of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Behavioural Neurology

EndocrinologyInternational Journal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Disease Markers

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

BioMed Research International

OncologyJournal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Oxidative Medicine and Cellular Longevity

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

PPAR Research

The Scientific World JournalHindawi Publishing Corporation httpwwwhindawicom Volume 2014

Immunology ResearchHindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Journal of

ObesityJournal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Computational and Mathematical Methods in Medicine

OphthalmologyJournal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Diabetes ResearchJournal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Research and TreatmentAIDS

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Gastroenterology Research and Practice

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Parkinsonrsquos Disease

Evidence-Based Complementary and Alternative Medicine

Volume 2014Hindawi Publishing Corporationhttpwwwhindawicom

Submit your manuscripts athttpwwwhindawicom

Stem CellsInternational

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

MEDIATORSINFLAMMATION

of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Behavioural Neurology

EndocrinologyInternational Journal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Disease Markers

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

BioMed Research International

OncologyJournal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Oxidative Medicine and Cellular Longevity

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

PPAR Research

The Scientific World JournalHindawi Publishing Corporation httpwwwhindawicom Volume 2014

Immunology ResearchHindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Journal of

ObesityJournal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Computational and Mathematical Methods in Medicine

OphthalmologyJournal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Diabetes ResearchJournal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Research and TreatmentAIDS

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Gastroenterology Research and Practice

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Parkinsonrsquos Disease

Evidence-Based Complementary and Alternative Medicine

Volume 2014Hindawi Publishing Corporationhttpwwwhindawicom