Reprints

ORIGINAL ARTICLE

Effect of Hydrophobicity of PEO–PPO–PEO Block Copolymerson Micellization and Solubilization of a Model Drug Nimesulide

Arpan Parmar • Usha Yerramilli • Pratap Bahadur

Received: 29 July 2011 / Accepted: 11 October 2011

� AOCS 2011

Abstract The present work explored the molecular

implications governing the solubilization of a model drug

nimesulide (NIM) in micelles of ethylene oxide-propylene

oxide (EO–PO) triblock copolymers. The aggregation

behavior and solubilization studies on four copolymers each

with the same mol mass of central PPO block equal to 2,250

and varying % PEO was examined by means of UV–VIS.

Moreover, high-sensitivity differential scanning calorimetry,

and Fourier transform infrared spectrometry measurements

were used to evaluate the critical micellization temperature.

The solubilization at different temperatures (30, 37, 45 �C),

pH (2 to 10) and in the presence of added sodium chloride

(0–2 M) was monitored and the partition coefficient (P) and

the free energy of solubilization (DGso) were calculated. The

site of solubilization of NIM in micelles was also probed. The

NIM solubility decreased with increases in the PEO molec-

ular weight; the drug resides in the micelle core.

Keywords Solubilization � Micelle � Block copolymer �Nimesulide

Introduction

A newly developed active pharmaceutical ingredient is

often not preferred because of low aqueous solubility that

reduces bioavailability and poor patient compliance. Con-

sidering such solubility problems, the development of

application vehicles is a challenging research topic in

pharmaceutical technology [1]. Efforts to improve the

solubility of drugs using a suitable carrier such as inclusion

complexes with cyclodextrins, micelles, microemulsions,

dendrimers or liposome formulations have been carried out

[2–4]. Over the past few years, there has been significant

interest in amphiphilic block copolymers as potential drug-

delivery agents and polymeric micelles have proven

effective for site-specific delivery of drugs [5, 6]. Solubi-

lization of doxorubicin-conjugated block copolymer

micelles was introduced as drug delivery systems in the

early 1990s by Professor Kataoka’s group [7]. Currently,

polymeric micelles are proving their effectiveness and it is

essential that the excipients used be biocompatible and

biodegradable [8]. Block copolymers with amphiphilic

character, having a large solubility difference between

hydrophilic and hydrophobic segments, self-assemble in an

aqueous medium into micelles with a mesoscopic size

range [9]. Such micelles consist of a core–shell structure;

the inner core is the hydrophobic part of the block

copolymer, which would encapsulate drug, whereas the

outer shell of the hydrophilic block protects the drug from

the aqueous environment and stabilizes micelles against

recognition in vivo by the reticuloendothelial system [8].

Polymeric micelles are very stable and often form at a very

low critical micelle concentration (CMC) [10]. Amphi-

philic block copolymers form various supramolecular

structures such as spherical/cylindrical/worm-like micelles,

vesicles and different liquid crystalline phases depending

on their molecular characteristics and solution conditions

[11]. Direct information about the structure of individual

micelles and their microstructural arrangement is impera-

tive for the control of properties for many applications.

A. Parmar (&) � U. Yerramilli � P. Bahadur

Department of Chemistry, Veer Narmad South Gujarat

University, Surat 395 007, India

e-mail: Arpan_parmar1985@yahoo.co.in

U. Yerramilli

e-mail: usha97@hotmail.com

P. Bahadur

e-mail: pbahadur2002@yahoo.com

123

J Surfact Deterg

DOI 10.1007/s11743-011-1308-x

N-(4-Nitro-2-phenoxyphenyl) methanesulfonamide (NIM),

belongs to a common sulfonamide class of non-steroidal anti-

inflammatory drugs (NSAID) and is a prototype of a relatively

selective cyclooxygenase-2 (COX-2) inhibitor [12]. The sul-

fanilamide moiety in NIM makes it different from other

NSAID. In its neutral form, NIM is sparingly soluble in water

(*0.01 mg/mL [13]) and due to such low aqueous solubility

many difficulties in pharmaceutical formulations for oral or

parenteral delivery arise, which may lead to variable bio-

availability. To overcome these disadvantages, increasing the

aqueous solubility is an important goal and efforts to develop

formulations that promote the drug solubility have been

investigated by several researchers [13–21]. On the other hand,

there has not been any systematic study on solubilization of

nimesulide in copolymer micelles.

In the present study, micellization of four copolymers

with varying hydrophilicity (P84, P85, F87 and F88) and

the solubilization of NIM were systematically examined

(Scheme 1). Our findings strongly support that the hydro-

phobicity is the key parameter governing the micellization

and encapsulation of NIM. The results on solubilities of

NIM and partition coefficients of the drug between

micelles and the aqueous solution are reported and the

thermodynamic viewpoint is discussed in terms of changes

in the free energy of solubilization (DGso). The site of NIM

in micelles was probed by UV–visible spectroscopy.

Materials and Methods

Materials

Four Pluronic� block copolymers viz. P84, P85, F87 and

F88 were from the BASF Corp. (Parsippany, NJ, USA) and

used without further purification. The molecular charac-

teristics are described in Table 1. Nimesulide was from

Arti ltd, India, and used as received. All other reagents

were of analytical grade.

Ultraviolet Spectroscopy (UV)

A Shimadzu (UV-2450) UV–visible double beam spec-

trophotometer was used to determine the solubility of the

drug by measuring absorbance at 299 nm. Dilute solutions

of the drugs ranging from 0 to 0.1 mg/mL dissolved in

methanol gave a satisfactory calibration Beer-Lambert plot

with R2 = 0.9991. For drug solubility measurements,

excess amounts of the drug were added to 5 mL of micellar

solutions in vials which were then shaken in a thermo-

statted water bath at constant temperature (30, 37, 45 �C)

for at least 48 h. The solutions were filtered (Millipore,

0.45 lm) to remove unsolubilized drug and the filtered

solutions were diluted properly with methanol. All data

reported are the average of at least three independent

samples.

The critical micellization temperature (CMT) of

copolymers was determined by the iodine UV spectroscopy

method. To prepare a standard KI/I2 solution, 0.5 g of

iodine and 1 g of potassium iodide were dissolved in 50 mL

distilled water. For CMT determination, 25 lL KI/I2 stan-

dard preparation was added to the copolymer solution

before measurement and the absorbance at 366 nm was

measured at different temperature using a thermoelectri-

cally controlled cell. The absorption intensity was plotted

against the temperature. The temperature was scanned at a

heating rate of 1 �C/min. The CMT values correspond to the

temperature at which the sharp increase in absorbance is

observed.

High-Sensitivity Differential Scanning Calorimetry

(HSDSC)

Calorimetric measurements were carried out using a Mic-

rocal MC-2 instrument (Microcal Inc., Amherst, MA).

Samples were equilibrated in the HSDSC cells for a

Scheme 1 Structural formula of

nimesulide (left) and PEO–

PPO–PEO block copolymer

(right)

Table 1 Physicochemical characteristics of PEO–PPO–PEO block

copolymers

Copolymer Mol wt. of PO % of PEO HLBa CPa of 1% (�C)

P84 2,520 40 14 74

P85 2,300 50 16 84

F87 2,310 70 24 [100

F88 2,280 80 28 [100

a HLB values and the cloud points were provided by the

manufacturer

J Surfact Deterg

123

minimum of 60 min prior to each run, and scans performed

at a scan rate of 60 K/h.

Fourier Transform Infrared (FTIR) Spectroscopy

Copolymer solutions were spread between two CaF2 win-

dows separated by a 56 mm Teflon spacer. The spectra at

different temperatures were recorded with a Bruker Vector

22 Fourier transform infrared spectrometer equipped with a

DTGS detector.

Dynamic Light Scattering (DLS)

In order to determine the sizes and distribution of

copolymer micelles, dynamic light scattering (DLS) mea-

surements were carried out at a 90� scattering angle on

solutions using a Zetasizer 4800 (Malvern Instruments,

UK) equipped with a 192 channel digital correlator (7132)

and a coherent (Innova) Ar-ion laser at a wavelength of

514.5 nm. The average diffusion coefficient and hence the

hydrodynamic size was obtained by the method of cumu-

lants. Each measurement was repeated at least six times.

All samples were prepared in triply distilled water.

Results and Discussion

Micellization

The CMTs of copolymers were determined spectroscopi-

cally by using iodine as a hydrophobic probe at several

different temperatures of copolymers and. Solubilized I2

prefers to partition in the hydrophobic microenvironment

of micelles, causing the conversion of I3- to I2 from the

excess KI in the solution, in order to maintain the saturated

aqueous concentration of I2.

Less hydrophobic copolymers (higher EO/PO ratio)

or lower molecular weight do not aggregate at room

temperature but start to form micelles at higher tempera-

tures. The CMT values of 1% copolymer solutions viz.

P84, P85, F87 and F88 were determined as 24.1, 27.0, 32.0,

and 36.2 �C, respectively (Fig. 1a). These CMT values

correlate well with the HLB of copolymers. As shown in

Fig. 1, for species P84, P85, F87 and F88, the increase of

the PEO mass does not favour aggregation, and therefore

micelles form at a higher temperature as shown in inset

figure (Fig. 1a). However, the CMT also depends on

copolymer concentration; Fig. 1b shows the effect of the

copolymer (F87 as representative) concentration; the CMT

values for 0.5, 1.0, 2.5, 5 and 10% F87 were 34.8, 32.5, 30,

25 and 20.4 �C, respectively. A marked decrease in CMT

with an increase in copolymer concentration was always

noticed. At low temperatures, low iodine intensity was

observed but beyond a specific temperature iodine intensity

increased significantly due to the micelle formation.

Increases in iodine intensity are due to the solubilized I2

which prefers to participate in the hydrophobic microen-

vironment of copolymers, causing the conversion of I3- to

I2 from the excess KI in the solution, in order to maintain

the saturated aqueous concentration of I2.

Micellization of block copolymers depends on the

compositional parameters and environmental factors. Due

to the relevance of this phenomenon, a concise description

of the parameters affecting the process is herein included.

A thorough work on the micellization of PEO–PPO–PEO

copolymers has been reported by several researchers [9, 11,

22–26]. The CMTs are the main parameters in determining

the stability of the micellar carrier and the drug release in

equilibrium conditions. It has been shown that micelliza-

tion is strongly driven by an entropy gain and the free

energy of micellization is mainly a function of the PPO

block. This entropy gain is caused by dehydration of water

molecules ordered around the PPO segments and is related

to the release upon heating of hydration water molecules

ordered around the hydrophobic segment (PPO). An

increase in the content of PPO results in lowering the CMT

Fig. 1 Plot of UV intensity of

I2 versus temperature a for 1%

copolymer b for different

concentrations of F87

J Surfact Deterg

123

values and vice versa for the content of PEO. CMT values

decrease with increasing molecular weight for copolymers

displaying similar EO/PO ratios [11].

Calorimetric and FTIR experiments were also used to

obtain the CMT of copolymers. The HSDSC traces along

with FTIR results for 5% F87 in water within the tem-

perature range of 10–60 �C are shown in Fig. 2. An intense

and broad peak appearing at temperature 27.5 �C obtained

by HSDSC (Fig. 2) is indicative of micelle formation by

the PEO–PPO–PEO copolymers, corresponds to the CMT.

The broadening of the micellization phase transition is due

to temperature dependence on the amount of unimers in

equilibrium with the micelles (as temperature increases

more copolymer changes from the unimer into the micellar

state), as well as the size polydispersity inherent in

copolymers. The FTIR results of the F87 solution showing

the changes of frequency of the symmetric deformation

band of the hydrated methyl groups as a function of tem-

perature are also presented in Fig. 2. As the temperature is

increased, a shift in the wavenumber of the methyl groups

was observed due to decreased interaction between the

methyl groups and water molecules with a decrease in the

polarity of the microenvironment around the hydrated

methyl groups.

DLS measurements for 10% F87 and F88 in water at

temperatures ranging from 25 to 60 �C (Fig. 3) show peaks

for monomers, micelles, and clusters at lower temperatures

(*25–30 �C) but the peaks due to monomers and clusters

disappear, leaving the micelle peak alone with decreasing

polydispersity with a progressive increase in temperature.

Higher concentration and temperature favor micelle for-

mation and thus increase micellar concentration and

therefore the monomers and clusters disappear (as all the

added copolymer forms the micelles and dissolves the

clusters) [27]. We consider the copolymer micelles as

hydrated spheres and hence the apparent size (hydrody-

namic diameter, Dh) was calculated by using the Stock-

Einstein equation. Higher temperatures favor the micelle

formation and micelle peaks become more compact due to

dehydration of the PEO blocks. Increasing hydrodynamic

size for F88 at higher temperature is perhaps due to the

increase in aggregation number and micellar growth at this

temperature which is closer to its cloud point.

Solubilization of the Drug Nimesulide (NIM) in Micelles

Effect of Copolymer Concentration

The solubilization of NIM in aqueous solutions of P84,

P85, F87 and F88 was examined at different copolymer

concentrations at 37 �C. The enhanced solubility of NIM

with copolymer concentration (normalized to the saturated

concentration of NIM in water 0.032 mM) is shown in

Fig. 4. It can be seen that in all cases the solubility

increases almost linearly with increasing copolymer con-

centration; the solubilization capacity is highest for P84

closely followed by P85, F87 and substantially less for F88.

Fig. 2 FTIR (filled circles) and HSDSC (filled squares) output for an

up-scan and a down-scan of 5% F87 in water

Fig. 3 a Intensity versus size plot for 10% F87 at different

temperatures. b Intensity versus size plot for 10% F88 at different

temperatures

J Surfact Deterg

123

A more hydrophobic copolymer (with less % PEO) was

better for solubilization of NIM.

Effect of Temperature and Salt

The increase in temperature and salt favor the solubility of

the drug in the copolymer as shown in Figs. 5 and 6. The

addition of NaCl dehydrates the PEO shell by its ‘‘salting

out’’ action, similar to the effect of temperature, and

induces hydrophobicity in the PPO block of the copoly-

mer. In general, a gradual decrease in the CMC and the

CMT has been observed with the increase in salt con-

centration [24, 28–32]. Kadam et al. [18, 19] have shown

increases in solubilization of hydrophobic drug in the

presence of NaCl.

Effect of pH

The solubilization of NIM was examined in the pH range

2–10 and is illustrated in Fig. 7. These copolymers do not

display pH-sensitive moieties in their structure. Thus, the

study of the pH influence on the aggregation behavior is

limited. Many drugs comprise ionizable compounds whose

solubility varies considerably with the change in pH-value

[33, 34]. The pH in the gastro-intestinal tract varies greatly

according to location, with a pH of 1.2 in the empty

stomach, 5–7 in the small intestine and 6–7.5 in the colon

[35] and if the solubility of the drug is too low in any of

the regions of the gastro-intestinal tract, it will most likely

be excreted without the possibility of passage from the

gastrointestinal tract into the systemic circulation. The

solubility of NIM increases with the increase in pH from

2 to10 for the entire concentration range (1–5%) of P84,

P85, F87 and F88.

The solubility of the drug is significantly increased as

the pH of the solution is raised from 6 to 10 (Fig. 7).

Higher solubility of NIM at alkaline pH is due to its acidic

nature by virtue of its sulfonanilide group. Such an increase

in solubility of NIM in alkaline pH is due to the ionic form

which partitions into the hydrophilic PEO shell of the

micelle.

Effect of Hydrophobic Drug

The drug may alter the micellization and phase behaviour

of the copolymer solution; this leads to changes in CMC,

CMT and CP. With this viewpoint, CPs and CMTs were

determined in the presence of nimesulide. Figure 8 repre-

sents the CMT for 2.5%, F87 in the presence and absence

of salt. A decrease in CMT indicates that the presence of

Fig. 4 Solubility of NIM versus copolymer concentration at 37 �C

Fig. 5 Solubility of NIM versus copolymer P84 concentration at

different temperatures

Fig. 6 Solubility of NIM in 1% copolymer solutions as a function of

[NaCl] at 37 �C

J Surfact Deterg

123

NIM induces micelle formation or it interacts with the

copolymer chain itself as reported for other systems

[36, 37]. This change in micellar properties is caused by the

hydrophobic nature of NIM.

Partition Coefficient and Thermodynamics

of Solubilization

The drug-micelle interaction can be better explained by

determining its magnitude through the elucidation of the

micelle-water partition coefficient (P) and thermodynamic

parameter (DGso) of solubilization.

P ¼ Cm=Cw

where Cm and Cw are the concentrations of drugs in the

micelles (based upon total polymer mass) and in the water,

respectively.

The solubilization can be considered as a normal parti-

tioning of the drug between the micelles and aqueous

phases and the standard free energy of solubilization (DGso)

can be represented by the following expression:

DGos ¼ �RT lnP:

The progressive decrease in DGso indicates that the

migration of the drug molecules in the unimer state to the

air–water interface is a spontaneous process favored by

their hydrophobicity. However, more negative DGso for

copolymers with increasing concentration (1–5%) indicates

more favored solubilization of NIM. Figures 9 and 10

demonstrate the effect of salt on the partition coefficient

and DGso for NIM solubilized at 37 �C. A significant

increase in the partition coefficient can be seen and DGso

values are also in agreement with the results obtained.

Locus of Solubilization

The structure and polarity of the solubilizate determine its

site in the micelle. The solubilizate can be on the surface of

a micelle, within the hydrophilic head group, on the pali-

sade layer between the hydrophilic head group and first few

carbon atoms, beyond the palisade layer, and in the core of

the micelle [38]. The location of the solubilizates in the

micelle gives an idea about the extent of solubilization, the

chemical reactivity of the solubilizates, as well as the rate

of their release from the micelles [39, 40]. With an increase

Fig. 7 Solubility of NIM versus copolymer concentration at different

pH at 37 �C (empty circles show the solubility of NIM in water at

37 �C)

Fig. 8 Plot of UV intensity of I2 versus temperature profile of F87 in

presence (filled circles) and absence (open circles) of the drug

Fig. 9 Effect of salt concentration on partition coefficient for

solubilized NIM for 1% of different copolymers

J Surfact Deterg

123

in salinity, micelles swell and enlarge the hydrophobic

core, causing solubilization in the micelles to be prefer-

entially in the core. As a result, increasing salinity can

cause the solubilization ratio to approach the excess phase

value.

An idea about the site of solubilization can be obtained

by comparing kmax of the drug in micellar solution to that

in model solvents (having similar structure and polarity). In

the present study, polyethylene glycol (PEG) and poly-

propylene glycol (PPG) were chosen as model solvents that

mimic the polarity of different regions of the micelle; PEG

resembles the polar corona and PPG the micellar core.

Figure 11 shows the kmax of NIM at 308, 302 and

304 nm for PEG, PPG and P84 respectively. NIM has kmax

at 299 nm (in methanol) and it shifts towards the longer

wavelength 304 nm including a shoulder around 400 nm

(red shift). Such a shift in the kmax may be due to the

presence of electron donor/acceptor groups, charge transfer

or interaction between the drug molecule and the micelle

forming substance [41, 42]. From Fig. 11 it can be seen

that when NIM is solubilized in P84, kmax shifts towards

the PPG region indicates that solubilized NIM molecules

reside in the microenvironment of the hydrophobic core.

This could be due to the higher drug concentration,

which leads to the saturation of the micellar interface;

consequently the micelle core would participate in the

solubilization of the drug molecules [43, 44]. This result is

in agreement to an earlier study on the solubilization

behavior of naproxen [45].

Conclusion

In the present work, we aimed at an understanding of the

solubilization behavior of the model drug NIM in micellar

solutions of four EO–PO block copolymers with varying

hydrophilicity under the influence of different stimuli, such

as changes in pH, or temperature, or salt, and with varying

concentrations. The CMT and CMC values of P84, P85,

F87 and F88 are reported. The NIM solubilization can be

increased by increasing copolymer/salt concentrations and

temperature or with increasing pH, micelles swell signifi-

cantly upon the addition of the NIM, and lead to a decrease

in the critical micelle temperature (CMT). Furthermore, the

partition coefficient and thermodynamic parameter (DGso)

of the solubilized drug in micelles show the affinity of the

drug to the vehicle systems which could be helpful for

different pharmaceutical formulations. Spectroscopic data

suggests that the location of solubilization is within the

core of the micelles. The results indicate that polymeric

micelles offer excellent potential for further preclinical and

clinical solubilization studies using NIM.

Acknowledgments Pratap Bahadur thanks the University Grants

Commission, New Delhi [Project No. 37-527/2009 (SR)] for a

research grant.

References

1. Rupp C, Steckel H, Muller BW (2010) Solubilization of poorly

water-soluble drugs by mixed micelles based on hydrogenated

phosphatidylcholine. Int J Pharm 395:272–280

2. Muller BW, Albers E (1992) Complexation of dihydropyridine

derivatives with cyclodextrins and 2-hydroxypropyl-b-cyclodex-

trin in solution. Int J Pharm 79:273–288

3. Lawrence MJ, Rees GD (2000) Microemulsion-based media as

novel drug delivery systems. Adv Drug Deliv Rev 45:89–121

4. Barenholz Y (2001) Liposome application: problems and pros-

pects. Curr Opin Colloid Interface Sci 6:66–77

5. Yokoyama M (2006) Polymeric micelles drug carriers for tumor

targeting. In: Svenson S (ed) Polymeric drug delivery ACS

Fig. 10 The standard free energy change for NIM solubilized in

aqueous block copolymers at 37 �C

Fig. 11 The UV–visible spectra for NIM in PEG, PPG and P84

J Surfact Deterg

123

symposium series 924, Chap 3, ACS Publications, Washington,

p 27

6. Wang L, Zeng R, Li C, Qiao R (2009) Self-assembled polypep-

tide-block-poly (vinylpyrrolidone) as prospective drug-delivery

systems. Colloid Surf B 74:284–292

7. Yokoyama M, Kwon GS, Okano T, Sakurai Y, Seto TK, Kataoka

K (1992) Preparation of micelle-forming polymer-drug conju-

gates. Bioconjug Chem 3:295–301

8. Kedar U, Phutane P, Shidhaye S, Kadam V (2010) Advances in

polymeric micelles for drug delivery and tumor targeting.

Nanomedicine 6:714–729

9. Almgren M, Bahadur P, Jansson M, Li P, Brown W, Bahadur A

(1992) Static and dynamic properties of a (PEO–PPO–PEO)

block copolymer in aqueous solution. J Colloid Interface Sci

151:157–165

10. Torchilin VP (2001) Structure and design of polymeric surfactant

based drug delivery systems. J Control Release 73:137–172

11. Wanka G, Hoffmann H, Ulbricht W (1994) Phase-diagrams and

aggregation behavior of poly(oxyethylene)-poly(oxypropylene)-

poly(oxyethylene) triblock copolymers in aqueous solutions.

Macromolecules 27:4145–4159

12. Bhattacharya A, Kankanala K, Pal SA, Mukherjee K (2010) A

nimesulide derivative with potential anti-inflammatory activity:

synthesis, X-ray powder structure analysis and DFT study. J Mol

Struct 975:40–46

13. Piel G, Pirotte B, Delneuville I, Neven P, Llabres G, Delarge J,

Delattr L (1997) Study of the influence of both cyclodextrins and

L-lysine on the aqueous solubility of nimesulide; isolation and

characterization of nimesulide–L-lysine–cyclodextrin. J Pharm

Sci 86:475–480

14. Joudieh S, Lahiani-Skiba M, Bon P, Ba O, Le Breton JM, Skiba

M (2008) Nimesulide apparent solubility enhancement with

natural cyclodextrins and their polymers. Lett Drug Design Dis-

cov 5:406–415

15. Agrawal S, Pancholi SS, Jain NK, Agrawal GP (2004) Hydro-

tropic solubilization of nimesulide for parenteral administration.

Int J Pharm 274:149–155

16. Dutet J, Lahiani-Skiba M, Didier L, Jezequel S, Bounoure F,

Barbot C, Arnaud P, Skiba M (2007) Nimesulide/cyclodextrin/

PEG 6000 ternary complexes: physico-chemical characterization,

dissolution studies and bioavailability in rats. J Incl Phenom

Macrocycl Chem 57:203–209

17. Moneghini M, Kikic I, Perissutti B, Franceschinis E, Cortesi A

(2004) Characterisation of nimesulide-betacyclodextrins systems

prepared by supercritical fluid impregnation. Eur J Pharm Biop-

harm 58:637–644

18. Kadam Y, Yerramilli U, Bahadur A (2009) A Solubilization of

poorly water-soluble drug carbamezapine in Pluronic� micelles:

effect of molecular characteristics, temperature and added salt on

the solubilizing capacity. Colloid Surf B 72:141–147

19. Kadam Y, Yerramilli U, Bahadur A, Bahadur P (2011) Micelles

from PEO–PPO–PEO block copolymers as nanocontainers for

solubilization of a poorly water soluble drug hydrochlorothiazide.

Colloid Surf B 83:49–57

20. Parekh P, Singh K, Marangoni DG, Bahadur P (2011) Micelli-

zation and solubilization of a model hydrophobic drug nimesulide

in aqueous salt solutions of Tetronic T904. Colloid Surf B

83:69–77

21. Parmar A, Singh K, Bahadur A, Marangoni G, Bahadur P (2011)

Interaction and solubilization of some phenolic antioxidants in

Pluronic� micelles. Colloids Surf B 86:319–326

22. Alexandridis P, Hatton TA (1995) Poly (ethylene oxide)-poly

(propylene oxide)-poly (ethylene oxide) block copolymer sur-

factants in aqueous solutions and at interfaces: thermody-

namics, structure, dynamics, and modeling. Colloid Surf A

96:1–46

23. Goldmints I, von Gottberg FK, Smith KA, Hatton TA (1997)

Small-angle neutron scattering study of PEO–PPO–PEO micelle

structure in the unimer-to-micelle transition region. Langmuir

13:3659–3664

24. Matthias JK, Cornelia B, Alexandridis P, Hatton TA, Holzwarth

JF (1999) Micellization dynamics and impurity solubilization of

the block-copolymer L64 in an aqueous solution. Langmuir

15:322–325

25. Kadam Y, Ganguly R, Kumbhakar M, Aswal VK, Hassan PA,

Bahadur P (2009) Time dependent sphere-to-rod growth of the

Pluronic� micelles: investigating the role of core and corona

solvation in determining the micellar growth rate. J Phys Chem B

113:16296–16302

26. Alexandridis P, Holzwarth JF, Hatton TA (1994) Micellization of

poly(ethylene oxide)-poly(propylene oxide)-poly(ethylene oxide)

triblock copolymers in aqueous solutions: thermodynamics of

copolymer association. Macromolecules 27:2414–2425

27. Parekh P, Bahadur P (2011) Dynamic light scattering studies on

the effect of 1-alkanols, alkanediols and alkoxyethanols on the

micelles of a moderately hydrophobic/hydrophilic PEO–PPO–

PEO triblock copolymer. J Surf Deterg 14:425–432

28. Jain NJ, Aswal VK, Goyal PS, Bahadur P (1998) Micellar

structure of an ethylene oxide-propylene oxide block copolymer:

a small-angle neutron scattering study. J Phys Chem B

102:8452–8458

29. Jain NJ, Aswal VK, Goyal PS, Bahadur P (2000) Salt induced

micellization and micelle structures of PEO/PPO/PEO block

copolymers in aqueous solution. Colloid Surf A 173:85–94

30. Elisseeva OV, Besseling NAM, Koopal LK, Cohen Stuart MA

(2005) Influence of NaCl on the behavior of PEO–PPO–PEO

triblock copolymers in solution, at interfaces, and in asymmetric

liquid films. Langmuir 21:4954–4963

31. Nakashima K, Bahadur P (2006) Aggregation of water-soluble

block copolymers in aqueous Solutions: recent trends. Adv Col-

loid Interface Sci 123–126:75–96

32. Desai M, Jain N, Sharma R, Bahadur P (2000) Temperature and

salt-induced micellization of some block copolymers in aqueous

solution. J Surf Deterg 3:193–199

33. Comer JEA (2003) In: van de Waterbeemd H (ed) Drug bio-

availability, vol 1, Chap. 2. Wiley-VCH, New York, pp 21–45

34. Bergstrom CAS, Luthman K, Artursson P (2004) Accuracy of

calculated pH-dependent aqueous drug solubility. Eur J Pharm

Sci 22:387–398

35. Gaucher G, Satturwar P, Jones M, Furtos Leroux J (2010)

Polymeric micelles for oral drug delivery. Eur J Pharma Bio-

pharma 76:147–158

36. Momot KI, Kuchel PW, Chapman BE, Deo P, Whittaker D

(2003) NMR study of the association of propofol with nonionic

surfactants. Langmuir 19:2088–2095

37. Hecht E, Hoffmann H (1995) Kinetic and calorimetric investi-

gations on micelle formation of block copolymers of the polox-

amer type. Colloid Surf A 96:181–197

38. Rosen MJ (2004) Surfactant and Interfacial Phenomena, 3rd edn.

Wiley-Interscience. Hoboken, NJ

39. Mukerjee P (1967) The nature of the association equilibria and

hydrophobic bonding in aqueous solutions of association colloids.

Adv Colloid Interface Sci 1:242–275

40. Kim BJ, Im SS, Oh SG (2001) Investigation on the Solubilization

locus of aniline-HCl salt in SDS micelles with 1H NMR spec-

troscopy. Langmuir 17:565–566

41. Enache M, Anghelache I, Volanschi E (2010) Coupled spectral

and electrochemical evaluation of the anticancer drug mitoxan-

trone-sodium dodecyl sulfate interaction. Int J Pharm

390:100–106

42. Cudina O, Karljikovic-Rajic K, Ruvarac-Bugarcic I, Jankovic I

(2005) Interaction of hydrochlorothiazide with cationic surfactant

J Surfact Deterg

123

micelles of cetyltrimethylammonium bromide. Colloids Surf A:

Physicochem Eng Asp 256(2-3):225–232

43. Liu GG, Roy D, Rosen MJ (2000) A simple method to estimate

the surfactant micelle-water distribution coefficients of aromatic

hydrocarbons. Langmuir 16:3595–3605

44. Heindl A, Strnad J, Kohler HH (1993) Effect of aromatic solu-

bilizates on the shape of CTABr micelles. J Phys Chem B

97:742–746

45. Bhat PA, Rather GM, Dar AA (2009) Effect of surfactant mixing

on partitioning of model hydrophobic drug, naproxen, between

aqueous and micellar phases. J Phys Chem B 113:997–1006

Author Biographies

Arpan Parmar M.Phil, is pursuing a Ph.D. with a GIJCOST

fellowship at Veer Narmad South Gujarat University, Surat, India.

Usha Yerramilli M.Sc, M.Tech. is pursuing a Ph.D. at Veer Narmad

South Gujarat University, Surat, India.

Pratap Bahadur Ph.D, D.Sc. has been a professor of chemistry at

Veer Narmad South Gujarat University Surat, India since 1988.

J Surfact Deterg

123

This article appeared in a journal published by Elsevier. The attachedcopy is furnished to the author for internal non-commercial researchand education use, including for instruction at the authors institution

and sharing with colleagues.

Other uses, including reproduction and distribution, or selling orlicensing copies, or posting to personal, institutional or third party

websites are prohibited.

In most cases authors are permitted to post their version of thearticle (e.g. in Word or Tex form) to their personal website orinstitutional repository. Authors requiring further information

regarding Elsevier’s archiving and manuscript policies areencouraged to visit:

http://www.elsevier.com/copyright

Author's personal copy

Colloids and Surfaces B: Biointerfaces 83 (2011) 49–57

Contents lists available at ScienceDirect

Colloids and Surfaces B: Biointerfaces

journa l homepage: www.e lsev ier .com/ locate /co lsur fb

Micelles from PEO–PPO–PEO block copolymers as nanocontainers forsolubilization of a poorly water soluble drug hydrochlorothiazide

Yogesh Kadama,∗, Usha Yerramilli a, Anita Bahadurb, Pratap Bahadura

a Department of Chemistry, Veer Narmad South Gujarat University, Surat 395 007, Indiab Department of Zoology, Sir P. T. Sarvajanik College of Science, Surat 395 001, India

a r t i c l e i n f o

Article history:Received 28 July 2010Received in revised form 22 October 2010Accepted 23 October 2010Available online 2 November 2010

Keywords:SolubilizationMicelleBlock copolymerThermodynamic parameters

a b s t r a c t

The effect of molecular characteristics of EO–PO triblock copolymers viz. Pluronic® P103 (EO17PO60PEO17),P123 (EO19PO69EO19), and F127 (EO100PO65EO100) on micellar behavior and solubilization of a diureticdrug, hydrochlorothiazide (HCT) was investigated. The critical micellization temperatures (CMTs) andsize for empty as well as drug loaded micelles are reported. The CMTs and micelle size depended onthe hydrophobicity and molecular weight of the copolymer; a decrease in CMT and increase in size wasobserved on solubilization. The solubilization of the drug hydrochlorothiazide (HCT) in the block copoly-mer nanoaggregates at different temperatures (28, 37, 45 ◦C), pH (3.7, 5.0, 6.7) and in the presence ofadded salt (NaCl) was monitored by using UV–vis spectroscopy and solubility data were used to calculatethe solubilization characteristics; micelle–water partition coefficient (P) and thermodynamic parame-ters of solubilization viz. Gibbs free energy (�Gs

◦), enthalpy (�Hs◦) and entropy (�Ss

◦). The solubility ofthe drug in copolymer increases with the trend: P103 > P123 > F127. The solubilized drug decreased thecloud point (CP) of copolymers. Results show that the drug solubility increases in the presence of salt butsignificantly enhances with the increase in the temperature and at a lower pH in which drug remains inthe non-ionized form.

© 2010 Elsevier B.V. All rights reserved.

1. Introduction

Block copolymers are composed of at least two generally incom-patible polymer segments that differ in physicochemical propertiese.g., charge and/or polarity and self-assemble in selective solvent(good for one block but poor solvent for the other) to form micelleslike conventional surfactants [1–10]. Amphiphilic block copoly-mers (copolymeric surfactants) have hydrophobic and hydrophilicmoieties and they do aggregate to form nano size micelles in aque-ous media.

Micellization of polymeric surfactants has been examined indetail and the most extensively studied copolymers are ethyleneoxide–propylene oxide based symmetrical triblock copolymers.Poly(ethylene oxide)–poly(propylene oxide)–poly(ethylene oxide)(PEO–PPO–PEO) amphiphilic copolymers are often known bytheir trade name Pluronic® (BASF) and have numerous industrialapplications as detergents, dispersants, stabilizers, solubilizers,emulsifiers etc. In aqueous solutions, Pluronics® behave as non-ionic surfactants and form micelles of core–shell architecture above

∗ Corresponding author. Tel.: +91 9998481106; fax: +91 261 2256012.E-mail addresses: yogeshkadam2010@yahoo.com (Y. Kadam),

usha97@hotmail.com (U. Yerramilli), anita26p@gmail.com (A. Bahadur),pbahadur2002@yahoo.com (P. Bahadur).

a certain temperature called the critical micellization temperature,CMT, which depends on the concentration/molecular character-istics of the copolymer. These micelles have hydrophobic coreformed by PPO chains and hydrophilic shell formed by PEO chains;the micellization is an entropy-driven process as a consequenceof hydrophobic interactions and alteration in water structure inthe vicinity of the polymer chains. The self-assembled structurescan be spheroidal/ellipsoidal/cylindrical/worm-like or vesiclesdepending upon the EO/PO ratio, total molecular weight andconcentration of block copolymer. These structures are stronglyaffected by temperature and the presence of additives like elec-trolytes/nonelectrolytes, hydrotropes or conventional surfactants[2]. The micelle formation and phase behavior of Pluronic® hasbeen investigated by several workers and is extensively reviewed[1,2,9,10].

Pluronics® are being examined as drug delivery vehicles dueto their surfactant abilities, low toxicity and minimal immuneresponse [11–15]. The core formed by PO chains is water incompat-ible and is separated from the aqueous compartment by hydratedchains of EO corona and serves as a reservoir for the hydrophobiccompounds. Another important feature of the polymeric micelleswhich makes them efficient drug delivery carrier is the size ofthe micelles. The average hydrodynamic diameter of sphericalPluronic® micelle is ca. 2 to about 30 nm and aggregation num-ber ca. 10 to hundred [11–19] which increase on micellar fractions

0927-7765/$ – see front matter © 2010 Elsevier B.V. All rights reserved.doi:10.1016/j.colsurfb.2010.10.041

Author's personal copy

50 Y. Kadam et al. / Colloids and Surfaces B: Biointerfaces 83 (2011) 49–57

Table 1Physicochemical characteristics of Pluronic® block copolymers.

Pluronic® MWa Structure HLBb CP (1%), ◦Cb CMCc (g l−1) at 30 ◦C

P103 4950 EO17PO60EO17 9 86 3.0 × 10−2

P123 5750 EO19PO69EO19 8 90 2.5 × 10−2

F127 12,600 EO100PO65EO100 22 >100 3.5 × 10−2

a The average molecular weights provided by the manufacturer (BASF, Wyandotte, MI).b HLB values of the copolymers; the cloud points were determined by the manufacturer.c CMC values were determined using pyrene probe Ref. [27].

usually for systems close to cloud point. This nanoscale size varia-tion strongly affects the blood circulation time and bioavailability ofthe drugs within the body. Following the systemic administration,particles ranging from 70 to 200 nm have the most prolonged circu-lation time; particles larger than 200 nm are frequently sequesteredby the spleen due to mechanical filtration followed by even-tual removal by the cells of the phagocyte system. On the otherhand, particles smaller than 5–10 nm are rapidly removed throughextravasations and renal clearance. As compared to the conven-tional surfactants, block copolymers have much less CMCs makingtheir micelles thermodynamically more stable. In case of water sol-uble EO–PO block copolymers with adequate hydrophobicity, theCMC is remarkably reduced at elevated temperatures. Increasedthermodynamic stability of micelles makes them less prone todisassembly at low concentration than low molecular weight sur-factants [16–19]. For the above mentioned reasons, Pluronic® ormodified Pluronic® micelles are considered ideal drug deliveryvehicles as they have preferred blood circulating properties, ade-quate stability in the blood and high drug loading capacity forpoorly water soluble drugs [12–14,18]. Other potential advantagesof micellar drug delivery include passive tumor targeting, alter-ation of drug residence time in the body and protection of drugsfrom metabolism and degradation in the bloodstream [11,16–18].While amphoteric and ionic surfactants have been used for formu-lation purposes, the non-ionics generally offer the most advantages.Non-ionic surfactants are typically less toxic, less hemolytic, lessirritating to the skin and tend to maintain near physiological pHvalues when in solution [12,13]. Several drug formulations basedon polymeric micelles are now in phase I–III clinical trials, and soona number of them will be expected to be released in the market[14–18].

Incorporation of drug into core of polymeric micelles maybe carried out by chemical conjugation or physical entrapment[16,18]. Depending on steric properties and interrelations ofdrug and polymer, a drug can be solubilized with polymer ofsuitable molecular geometry and composition. Hydrochloroth-iazide (HCT) (6-chloro-3,4-dihydro-2H-1,2,4-benzo-tiodiazine-7-sulfonamide1,1dioxide), is a diuretic and anti-hypertensive drugused for the treatment of diabetes [20–22]. It has a half-life ofabout 5.6–4.8 h and is eliminated through kidney. Although HCThas high intestinal permeability, the bioavailability is limited by itslow water solubility. The reactivity and biological activity of HCT inrelation to other compounds of the thiazide family have been exten-sively studied by Latosinska [21]. There exists very few reports on

Scheme 1. Structural formula of the Pluronic® block copolymers.

pharmaceutical application of HCT in the presence of Pluronics®

[23,24]. Desai et al. [23] studied Povidone and Pluronic® medi-ated degradation of HCT and found improved stability of the drug,whereas the potential utility of copolymers comprising Pluronic®

covalently conjugated with poly(acrylic acid) (PAA) as excipientsfor sustained-release tablets of HCT and other drugs was exploredby Barreiro-Iglesias et al. [24]. However, there has not been anysystematic study on solubilization of HCT in Pluronic® micelleswith varying structure and molecular characteristics, at differenttemperatures, pH and added salt concentrations.

The objective of the present study is to investigate micellarstructure of Pluronic® (P103, P123 and F127) block copolymernanoaggregates under different conditions and their applicationfor solubilization of a model drug, hydrochlorothiazide (HCT). Theeffect of temperature, pH and salt (NaCl) concentration on the sol-ubility of the drug in the micelles of three Pluronic® is examined.Dynamic light scattering was used to characterize the dimen-sion of micellar aggregates which changed dramatically due tointeraction with hydrophobic drug. The drug solubility and themicelle–water partition coefficient (P) were measured using ultra-violet spectroscopy. Thermodynamic parameters of solubilizationviz. changes in Gibbs free energy (�Gs

◦), enthalpy (�Hs◦) and

entropy (�Ss◦) are also discussed.

2. Materials and methods

2.1. Materials

Pluronics® P103, P123 and F127 (Scheme 1) were receivedas gifts from BASF Corp. Parsippany, NJ, USA and used withoutfurther purification. Their molecular characteristics are describedin Table 1. Hydrochlorothiazide (6-chloro-3,4-dihydro-2H-1,2,4-benzo-tiodiazine-7-sulfonamide1,1dioxide) (Scheme 2) was fromSigma–Aldrich, Co. (St. Louis, MO) and used as received.

Scheme 2. Structural formula of hydrochlorothiazide (HCT) at different pKa [25]. MW = 297.74 g/mol, the aqueous solubility at 37 ◦C = 3.3 × 10−3 mol l−1 [3.6 × 10−3 mol l−1

[26]].

Author's personal copy

Y. Kadam et al. / Colloids and Surfaces B: Biointerfaces 83 (2011) 49–57 51

Fig. 1. Calibration plot for hydrochlorothiazide (HCT).

The details of “2.2. High-sensitivity differential scanningcalorimetry (HSDSC)”, “2.3. Fourier transfer infrared (FTIR) spec-troscopy to determine CMTs” and “2.4. Small angle neutronscattering (SANS)” are reported elsewhere [28]. The CMTs were alsodetermined by UV–visible spectroscopy (please see Supplementarymaterial for detail).

2.5. Dynamic light scattering (DLS)

Dynamic light scattering (DLS) was used to determine micellesize and polydispersity. DLS measurements were carried out at 130◦

scattering angle on solutions using Autosizer 4800 (Malvern Instru-ments, UK) equipped with 192 channel digital correlator (7132)and coherent (Innova) Ar-ion laser in vacuum at a wavelength of514.5 nm. The average diffusion coefficients and hence the hydro-dynamic diameter were obtained by the method of cumulants.

2.6. Ultraviolet spectroscopy (UV)

Drug solubilization measurements were carried out on Shi-madzu (UV-2450) UV–visible double beam spectrophotometerwith matched pair of stoppered fused silica cells of 1 cm opti-cal path length. Saturated drug-loaded solutions were preparedin glass vessels by mixing excess powdered drug with copolymersolution and stirring at constant temperature (28, 37 or 45 ◦C) at200 rpm for 2 days. To study the effect of pH, acetate buffer for pH3.7 and potassium phosphate buffers for pH 5.0 and pH 6.7 wereprepared using double distilled water as per USP. The solutionswere filtered (Millipore, 0.45 �m) to remove unsolubilized drug.Blank experiments, without copolymer, were done to determinethe solubility of the drug in water. The amount of drug solubilizedwas determined by measuring absorbance at 271 nm. Calibrationwith dilute solutions of the drug dissolved in methanol gave satis-factory Beer–Lambert plot (Fig. 1) with R2 = 0.9991. In solubilizationexperiments, the filtered solution was diluted 60–120 times withmethanol, the amount of water after dilution was low enough toallow direct use of the calibration plot (Fig. 1). Each solubility valuewas determined in triplicate and the results are reported as themean of the three.

2.7. Cloud point (CP)

Cloud points of 1% copolymer solutions in water and in salt(NaCl) solution, with and without drug were determined by gen-tly heating solution in thin 20 ml glass tubes immersed in a beakercontaining water well stirred with a magnetic bar. Temperature ofthe first appearance of turbidity was taken as the cloud point. Theobtained results were reproducible up to ±0.5 ◦C.

3. Results and discussion

3.1. Micellar behavior of Pluronic® in water

The formation and structure of Pluronic® micelles have beenextensively examined from scattering, thermal and spectral meth-ods by several researchers [29–36]. In particular, such studiesimprove the understanding of solubilization by such micelles[11,14,19]. There are only a few reports on the micellization dynam-ics along with solubilization [2,9,14–18,35]. We have performed anextensive characterization of the micellar parameters of Pluronics®

(P103, P123 and F127) by combining small angle neutron scattering(SANS), high-sensitivity differential scanning calorimetry (HSDSC)and Fourier transfer infrared (FTIR) spectroscopy.

3.1.1. Small angle neutron scattering (SANS)There have been detailed studies of the microscopic structure

of linear PEO–PPO–PEO copolymer (Pluronic®) micelles in waterusing small angle neutron scattering (SANS) [31,37,38]. We haveperformed SANS study on 5% solutions of P123, P103 and F127 with-out drug at 30 ◦C and results are presented in Fig. 2. The micellarparameters; core radii (Rc), hard sphere radii (Rhs), volume frac-tion (˚) and aggregation number (Nagg) calculated by analysis aresummarized in Table 2. It is clear that P103 and P123 show consider-ably more aggregation than F127, reacted in the stronger intensityof scattering at low Q (Fig. 2). The more hydrophobic nature ofP103/P123 (HLB ∼8/9, Table 1) would render it least stable inaqueous solution [39,40]. Unsurprisingly, P103 and P123 displaysimilar aggregation to one another. In fact, our fits to SANS datareveal that P103/P123 have very close values of Rc = 4.2/4.4 nm,Rhs = 9/10 nm and ˚ = 0.09/0.10 at 30 ◦C (Table 2). The SANS fits

Author's personal copy

52 Y. Kadam et al. / Colloids and Surfaces B: Biointerfaces 83 (2011) 49–57

0.1

0

20

40

60

80

dΣ/

dΩ

(cm

-1)

Q (Å)-1

Fig. 2. SANS distributions for 5% Pluronics® at 30 ◦C. (�) P123, (�) P103, (�) F127.

show that the aggregation number of the polymeric micellesdecreases with an increase in the polymer size and hydrophilicity[37–40], as observed for F127 being the most hydrophilic amongthe three polymers studied, with Nagg = 42 and the volume frac-tion (˚) = 0.19. The obtained micellar size (Rhs ∼ 10 nm) for all threecopolymer make them ideal choice for their use as a nano-containerof hydrophobic drug [11–19].

3.1.2. HSDSC and FTIRHSDSC and FTIR have been extensively used to study the micel-

lization behavior and to determine the CMT of copolymer micellesin aqueous solution [41–49]. The HSDSC and FTIR results for 5%copolymers in water within the temperature range of 10–60 ◦C areshown in Fig. 3 and Fig. 4 respectively.

In HSDSC an intense and broad peak maximum (Tm) that appearsat temperatures 21.2, 19.9 and 24.5 ◦C for P103, P123 and F127,respectively, corresponds to the CMTs (Table 2). This type of tran-sition has been documented by DSC to denote the CMT in somestudies [41–44]. Batsberg et al. [41] pointed out that the temper-ature of peak maximum (Tm) characterizes the CMT much betterthan Tonset (defined as the onset temperature obtained by the inter-section of two lines drawn tangential to the pretransitional andascending portion of the signal), since Tonset is more influenced bythe polydispersity of copolymers [44]. The changes in frequencyof the symmetric deformation band of hydrated methyl groupsin FTIR as a function of temperature shifts with increase temper-ature indicating a reduction of the interaction between methylgroups and water molecules with a decrease of the polarity of themicroenvironment around hydrated methyl groups [45–49]. Whenthe micelles are formed, the methyl groups exist in a more fixedposition; therefore, there is a dramatic decrease in the mobilityof methyl groups. At transition temperatures, water molecules are

Table 2Micellar parameters for different Pluronics® in water.

SANS data for different Pluronic® in water at 30 ◦C CMT, ◦C

[Pluronic ®], 5% w/v Rc, nm Rhs, nm Rh, nm Nagg DSC FTIR

P103 4.2 9.0 9.0 59 21.2 21.2P123 4.4 10.0 10.0 107 19.9 19.7F127 5.3 10.0 10.4 42 24.5 24.6

Nagg, aggregation number; Rc, core radius; Rhs, hard sphere radius; Rh, hydrodynamicradius (by DLS).

5040302010

0

20

40

60

80

F12

7

P12

3

P10

3

Cp

, Cal

. ºC

-1

Temperature, ºC

Fig. 3. HSDSC thermograms for 5% Pluronic® copolymers.

removed from the central part of the copolymer containing methylgroups and micelles with PO nuclei are formed [45]. The CMT val-ues obtained from the first derivative of the wavenumber versustemperature sigmoidal curve [47] are in excellent agreement withthe values obtained from HSDSC. A more detailed explanation onthe use of FTIR in probing copolymer micelles has been providedby Zheng et al. [48] and is not further elaborated here. To observethe effect of drug on CMT of Pluronic®, UV–visible spectral methodwas also performed to evaluate CMT of 5% F127 copolymer in waterand in presence of drug HCT (please see Supplementary material fordetail of the method and for Fig. Supl-1). As shown in Fig. Supl-1,it can be seen that CMT of the copolymer (∼24.6 ◦C) is markedlydecreased in the presence of the drug (∼21.8 ◦C), which is the sig-nature of solubilized drug in the copolymer micelle.

3.2. Solubilization of hydrochlorothiazide (HCT)

3.2.1. Effect of molecular characteristicsThe solubilization of HCT in aqueous Pluronics® solutions was

monitored by UV-spectroscopy. The plots of drug HCT solubilizedin P103, P123 and F127 are presented in Fig. 5, which shows an

403020102970

2972

2974

2976

2978

2980

2982

F12

7

P10

3

Wav

enu

mb

ers

Temperature, ºC

P12

3

Fig. 4. FTIR spectral changes for 5% Pluronic® copolymers.

Author's personal copy

Y. Kadam et al. / Colloids and Surfaces B: Biointerfaces 83 (2011) 49–57 53

543210

3

6

9

12

F127

P123

P103

[HC

T],

M X

10 -3

[Copolymer], %w/v

Fig. 5. Solubility of HCT vs. copolymer concentration at 37 ◦C.

increase in solubility of the drug with increase in copolymer con-centration. The enhanced solubility of drug can be attributed toincreased interaction between drug and copolymer molecules andmore number of micelles formed at higher concentration [11–19].In the entire concentration range studied, the solubility of HCT washigher in hydrophobic copolymers (P103, P123) than in hydrophilic(F127).

The amount of drug solubilized in micelles and hydrodynamicsize at different Pluronic concentrations were measured usingUV-spectroscopy and DLS, respectively. A representative plot forF127 as shown in Fig. 6 reveals that solubilization is significantlyincreased as the concentration of the polymer is increased from1% w/v to 5% w/v but no significant increase in the micelles sizewas observed. Therefore the increase in solubility could be dueto the more number of micelles formed at higher polymer con-centration [19]. The solubility of drug in copolymer solutions wasfound to increase as the hydrophobicity of the polymer increasesP103 > P123 > F127 in the entire concentration range (1–5%). Thisobservation can be explained on the basis of solubilization of drugpartly in the polyoxyethylene outer mantle, and partly in the poly-

5432100

5

10

15

20

45ºC

37ºC

[HC

T],

M x

10

-3

[P103], %w/v

28ºC

Fig. 6. Solubility of HCT and hydrodynamic diameter (Dh) of Pluronic micellesloaded with drug as a function of F127 concentration at 37 ◦C.

543210

2

3

4

5

6

7

8

[F127], % w/v

[HC

T],

M X

10 -

3

20

30

40

50

Dh

, nm

Fig. 7. Solubility of HCT vs. Pluronic® P103 concentration at different temperatures.

oxypropylene inner core of the micellar aggregates as shown byseveral authors [50,51]. This is also confirmed by the nature ofdrug which coexists as charged and uncharged species [25] underexperimental condition (pH 6.7) and is discussed in detail in Sec-tion 3.2.4. Apart from this fact, the higher numbers of micelles at5% copolymer concentration contributes to increased hydrophobicinteraction, which is primarily responsible for the micellar solubi-lization of this sparingly water soluble drug. Similar results wereobtained by Tsurumi et al. [52] for the solubilization of 2-naphtholwith four different Pluronics® (P103, P105, P123, and F108), wherethey attempted to correlate the solubilization with copolymer’shydrophobicity. The amount of solubilized drug in entire concen-tration range was higher for P103 compared to P123; though bothhaving 70% PPO in their backbone but the relatively low molec-ular weight of P103 makes it more hydrophobic. This fact is alsodepicted by the ratio of core size (Rc) to hard sphere radius (Rhs)which was found to be more for P103 (Rc/Rhs = 0.47) compared toP123 (Rc/Rhs = 0.44) as obtained by the analysis of micellar parame-ters by SANS (Table 2). Hence, P103 was selected as a representativecopolymer for the detailed study of the effect of pH and temperatureon solubilizing capacity and discussed in the respective sections.

3.2.2. Effect of temperatureIt is well established that the temperature plays a key role on

the micellization of Pluronics and the solubilization in resultingaggregates [1–3,7,9,10,19,30,53–56]. The apparent solubilities ofHCT in aqueous solutions of P103 at three different temperatures(28, 37 and 45 ◦C) are shown in Fig. 7. In general, the amount ofdrug solubilized in a micellar system increases with the increase intemperature due to micellar growth. The increase in temperaturelowers the CMC [30,53]. Alexandridis and Hatton [30] explainedthis phenomenon by the decrease of PEO and PPO polarity as thetemperature rises up due to the dehydration of the PEO chains. Theapparent solubility of HCT in water is slightly increased with anincrease in temperature (i.e., 2.18 mM at 28 ◦C, 3.33 mM at 37 ◦Cand 4.05 mM at 45 ◦C), but significant enhancement observed inaqueous copolymer solutions. This can be attributed to the increasein thermal vibrations of the copolymer molecules in the micellewhich results in an increase in the space available for solubilizationof the drug in the micelle, in addition to the increased solubilityof HCT in water at higher temperatures [11,19,54–56]. The aboveresults are in good agreement with the study carried out by Saitoet al. [54] for solubilization of the drug estriol and by Fioritto et al.[55] for furosemide solubilization from NMR and UV methods.

Author's personal copy

54 Y. Kadam et al. / Colloids and Surfaces B: Biointerfaces 83 (2011) 49–57

2.01.51.00.50.02

4

6

8

10

F127

P123

P103

[HC

T],

M x

10 -3

[NaCl], M

Fig. 8. Solubility of HCT in 1% Pluronic® solutions as a function of [NaCl] at 37 ◦C.

3.2.3. Effect of saltTo study the effect of the ionic strength on the solubilization

of HCT, experiments were carried out in 1% aqueous solutions ofcopolymers (P103, P123 and F127) in, 1 M and 2 M NaCl, at 37 ◦Cand the results are shown in Fig. 8. It can be seen that for allthree Pluronic® copolymers, the amount of the solubilized drugis increased as the ionic strength of the solution is increased andeffect is more pronounced for P103.

Solubilization capacity of surfactants is greatly influenced bythe available volume in micelles for hydrophobic substances. Thesalt dehydrates the PEO shell by its “salting out” action, similarto the effect of temperature, and induces hydrophobicity in thePPO block of the copolymer [57–61]. This accounts for the observedincrease hydrodynamic size (Dh) of the copolymer micelle (Fig. 9).The results reveal this fact which shows increment in Dh, compli-mentary to the increased amount of solubilized drug in copolymermicelle with added salt (Fig. 8).

As a general trend, it appears that the presence of added inor-ganic salts depress the cloud point temperature by a “salting-out”effect [60,61]. As discussed above, salt surrounds itself with watermolecules and acts like a solvent pump to dehydrate the PEO chainsand consequently decreases the copolymer solubility. The data pre-sented in Table 3, for cloud points (CP) of 1% Pluronic® with andwithout drug (HCT) saturation in water and salt solutions are incomplete agreement with this behavior. For all the three copoly-mers, the overall observed decrease in CP was ≥30 ◦C with addedsalt (0, 1 M, 2 M) and the effect was even more when copolymerswere saturated with the drug (HCT) for the same salt concentra-tion (Table 3) with a decrease in CP >40 ◦C, which is a signatureof increased amount of micellar core volume where the solubilizedhydrophobic drug could reside, as can be seen from obtained micel-lar size (Fig. 9). Similar results were obtained by several authors[62–65]. In analogy to obtained results, Pandit et al. [62] showed

2.01.51.00.50.00

100

200

300P103

P123

F127

Dh,n

m

[NaCl], M

Fig. 9. Hydrodynamic size of drug loaded Pluronic® (1%) micelle with added salt(NaCl) at 37 ◦C.

increased solubilization of hydrophobic drug propylparaben in thepresence of inorganic salts, consistent with a larger hydropho-bic domain for solubilization with successive decrease in cloudpoint and CMT of F127. In another study Ohashi et al. [63] showedincreased solubilization of prednisolone in Pluronic P85 is governedby polymolecular micelle formation with added salts.

3.2.4. Effect of pHOut of total number of drugs available in the market, 60% com-

prise ionizable compounds whose solubility varies considerablywith the change in pH [66,67]. The pH can vary from 1 to 9throughout the different compartments of the gastrointestinal tract(GI-tract), and if the solubility of the drug is too low in any of thecompartments, it will most likely be excreted without the possi-bility of passage from the gastrointestinal tract into the systemiccirculation. In Fig. 10 solubility of HCT at three different pH 3.7,5.0 and 6.7 in water and P103 solutions (1–5% w/v) is shown at28 ◦C. The solubility of HCT increases with the decrease in pH from6.7 to 3.7 for entire concentration range (1–5% w/v) of P103. Thismay be explained by the polyfunctional nature of hydrochloroth-iazide drug with the pKa values of 7.0 and 9.2 (Scheme 2) [25]. AtpH < 6, HCT is an uncharged molecule resulting in the significantincrease in the solubilization of drug, preferably in micellar coredue to its hydropobicity. At lower pH the solubility of HCT is sig-nificantly increased from 5 mM at pH 6.7 to 16.5 mM at pH 3.7 in5% P103. As can been from Fig. 10, the aqueous solubility of theHCT decreases from 2.18 mM to 1.85 mM as the pH of the solutionis decreased from pH 6.7 to pH 3.7. This can be explained by thefact that HCT is present as an unionized molecule at lower pH. Theincrease in the solubility of HCT with the increase in polymer con-centration found much higher at pH 5.0 and pH 3.7 than at pH 6.7.Very recently, Chakraborty et al. [68] investigated the solubiliza-tion capacity of ionic and non-ionic surfactants viz., anionic-sodium

Table 3Cloud points of 1% Pluronic® with and without drug (HCT) saturation in salt solutions.

Pluronic® Cloud point (◦C)

H2O 1 M NaCl 2 M NaCl

Without drug Drug saturated Without drug Drug saturated Without drug Drug saturated

P103 86 80 74 64 56 43P123 91 86 78 65 60 48F127 >100 >100 82 79 62 51

Author's personal copy

Y. Kadam et al. / Colloids and Surfaces B: Biointerfaces 83 (2011) 49–57 55

5432100

5

10

15

20

6.7 pH

5.0 pH

3.7 pH

[HC

T],

M X

10 -

3

[P103], % w/v

Fig. 10. Solubility of HCT vs. P103 concentration at different pH at 28 ◦C.

dodecyl sulfate (SDS) and sodium taurocholate (STC), cationic-cetyltrimethylammonium bromide (CTAB) and non-ionic-Tween80 for poorly water soluble drug carvedilol at different biorele-vant pH and found that non-ionic Tween 80 showed remarkablesolubility enhancement in acidic pH.

3.3. Thermodynamics of solubilization

A better understanding of drug–micelle interaction is not onlyachieved by explaining its nature and solubilizing capacity, butalso by quantifying its magnitude through the elucidation ofmicelle–water partition coefficient (P) and thermodynamic param-eters of solubilization viz. Gibbs free energy (Gs

◦), enthalpy (�Hs◦)

and entropy (�Ss◦).

The micelle–water partition coefficient is the ratio of the drugconcentration in the micelle to that in water for a particular surfac-tant concentration, as shown below:

P = Cm

Cw(1)

where Cm and Cw are the concentrations of drugs in the micelles(based upon total polymer mass) and in the water, respectively.

From the thermodynamic point of view, the solubilization canbe considered as a normal partitioning of the drug between micelleand aqueous phases and the standard free energy of solubilization(�Gs

◦) can be represented by the following expression:

�Gs◦ = −RT ln P (2)

where R is the universal gas constant, T is the temperature in Kelvinscale, and P is the partition coefficient between the micelle andthe aqueous phase. The standard enthalpy of solubilization (�Hs

◦),can be obtained from the temperature variation by applying theGibbs–Helmholtz equation to Eq. (2):

�Hs◦ = − RT2(

d ln P

dT

)(3)

Once the Gibbs free energy and the enthalpy of micellar sol-ubilization are obtained, the entropy of micelle formation can bedetermined by

�Gs◦ = �Hs ◦ −T�Ss◦ (4)

The free energy of solubilization of the drug (�Gs◦) for differ-

ent Pluronics/temperatures/pH/with and without salt systems areshown in Tables 4 and 5. The observed more negative �Gs

◦ val-ues for copolymers with increasing concentration indicates more

Table 4Gibbs free energy of solubilization (�Gs

◦) for HCT in Pluronic® micelles at 37 ◦C.

[Pluronic®], % [NaCl], M �Gs◦ , kJ mol−1

P103 P123 F127

1.0 0.0 −1.33 −0.81 −0.181.0 1.0 −1.48 −1.09 −0.421.0 2.0 −2.54 −1.77 −1.302.0 0.0 −2.02 −1.68 −0.643.0 0.0 −2.52 −2.13 −1.194.0 0.0 −2.89 −2.53 −1.325.0 0.0 −3.23 −2.62 −1.48

Table 5Gibbs free energy of solubilization (�Gs

◦) of HCT in P103 micelles at different tem-peratures and pH.

[P103], % 28 ◦C 37 ◦C 45 ◦C

pH 6.7 pH 5 pH 3.7 pH 6.7 pH 6.7

1 −0.72 −1.14 −1.91 −1.33 −1.862 −1.48 −2.48 −3.61 −2.02 −2.553 −1.97 −3.61 −4.51 −2.52 −3.064 −2.23 −4.52 −5.33 −2.89 −3.395 −2.52 −4.92 −5.64 −3.23 −3.70

favored solubilization of HCT. It also suggests stronger hydrophobicinteraction for P103 compared to P123 and F127. The data showthat the free energy of solubilization is negative in all cases andbecomes more negative with increasing concentration of copoly-mer [11,19,54]. The �Gs

◦ decreases [62–65] with added salt (0–2 MNaCl) for all the Pluronics at (1%). The �Gs

◦ values for P103 atdifferent temperatures and pH are shown in Fig. 5. The sponta-neous solubilization of HCT in aqueous block copolymer solutionis manifested by the negative �Gs

◦ values [19,54,68]. Increasingcopolymer/salt concentration and/or temperature makes valuesmore negative which suggests appreciable increase in the aggrega-tion number/size of micelle, where as lowering of pH (<6) changesnature of drug in less/non-ionized form and hence favors sponta-neous solubilizing capacity of drug (Table 5).

To investigate the dependence of the partition coefficient (P) ofHCT on the temperature, �Gs

◦, �Hs◦ and T�Ss

◦ were calculatedusing Eqs. (1)–(4). The linear relationship of partition coefficient(ln P) vs. temperature for solubilized HCT for all concentrationsof Pluronic P103 is shown in Fig. 11. The high correlation coeffi-cient (R = 0.998–0.999) was always obtained. Table 6 shows that the

3203153103053000.0

0.5

1.0

1.5

2.0

ln P

Temperature, ºC

lnP1=0.020T - 5.967lnP2=0.021T - 6.030lnP3=0.022T - 5.972lnP4=0.023T - 6.017lnP5=0.023T - 5.954

Fig. 11. Linear relationship for partition coefficient (ln P) vs. temperature for sol-ubilized HCT in different concentrations range (1–5%) of Pluronic P103. Solid linessuggest linear fits to the data (correlation coefficient ≥ 0.998).

Author's personal copy

56 Y. Kadam et al. / Colloids and Surfaces B: Biointerfaces 83 (2011) 49–57

Table 6Thermodynamic parameters for the solubilization of HCT in P103 micelles.

Temperature, K ln P �Gs◦ , kJ mol−1 �Hs

◦ , kJ mol−1 T�Ss◦ , kJ mol−1

1% P103 (ln P1 = 0.020T − 5.967, R1 = 0.998)301 0.29 −0.72 −15.07 −14.34310 0.51 −1.33 −15.98 −14.66318 0.70 −1.86 −16.82 −14.962% P103 (ln P2 = 0.021T − 6.030, R2 = 0.999)301 0.59 −1.48 −15.82 −14.34310 0.78 −2.02 −16.78 −14.76318 0.96 −2.55 −17.66 −15.123% P103 (ln P3 = 0.022T − 5.972, R3 = 0.999)301 0.79 −1.97 −16.57 −14.61310 0.98 −2.52 −17.58 −15.06318 1.16 −3.06 −18.50 −15.444% P103 (ln P4 = 0.023T − 6.017, R4 = 0.998)301 0.89 −2.23 −17.33 −15.09310 1.12 −2.89 −18.38 −15.49318 1.28 −3.39 −19.34 −15.955% P103 (ln P5 = 0.023T − 5.954, R5 = 0.999)301 1.01 −2.52 −17.42 −14.89310 1.25 −3.23 −18.47 −15.24318 1.40 −3.70 −19.44 −15.74

P, partition coefficient; R, correlation coefficient.

Fig. 12. Schematic representation of solubilization behavior of HCT in Pluronic micelle under influence of different stimuli.

partition coefficient (P) and thermodynamic parameters of solubi-lized HCT in P103 micelle. From the enthalpy and entropy changes,listed in Table 6, it can be concluded that the hydrophobic interac-tion plays a significant role in the solubilization of HCT in micelle.The more negative values of Gibbs free energy (�Gs

◦) and enthalpy(�Hs

◦), suggest that the equilibrium moves more to the micelle sidewith increasing copolymer concentration or temperature due to theincreased strength of the affinity of drug molecule to the copolymermicelle [11,19,54,68]. Increase in the temperature or copolymerconcentration causes either micelle growth or more number ofmicelles available for solubilization of drug which decrease therandomness of the system as depicted by the more number ofmolecules of drug/unimer of copolymer can be accommodated inmicelles; this accounts for the more negative values of T�Ss

◦. Theslightly lower values of T�Ss

◦ at 5% P103 could be attributed tothe phase behavior of P103. Pluronic® copolymers with high % ofPPO, show decrease in core radius (size) at higher concentrations.This also has been reported by Yang et al. [69]. They studied thephase behavior of P103 micelles in water, which shows a decreasein the average core radius at 5%, when compared to that at lowerconcentrations. This can also be confirmed by the solubilizationresults shown in Fig. 5, both the copolymers (P123 and P103) with70% of PPO show relative decrease in solubilization at 5% and are

in complete agreement to our earlier report for solubilization ofcarbamezapine [19].

4. Conclusions

In this paper, we have investigated solubilization of a diureticdrug hydrochlorothiazide (HCT) in the Pluronic® nanoaggregatesunder the influence of different stimuli; such as changes in pH ortemperature and with varying salt/copolymer concentration. Theobtained results can be depicted by the schematic model diagramshown in Fig. 12. As can be seen from Fig. 12 one can conclude thatthe solubility of the HCT could be significantly enhanced by increas-ing copolymer concentration/salt concentration/temperature orwith lowering pH in which drug remains in non-ionized form.

It is known that entrapment of drugs in copolymeric nanopar-ticles leads to an improvement of the membrane transport and thebioavailability of drugs. We believe that the present investigationwill provide pharmaceutical researchers, adequate insight concern-ing the characterization of the hydrophobicity–hydrophilicity andto evaluate thermodynamic properties of drugs in different phar-maceutical formulations such as micelles in order to optimize theaffinity of the drugs to the vehicle systems. Furthermore the resultsalso could be helpful to develop stimuli-triggered (such as changes

Author's personal copy

Y. Kadam et al. / Colloids and Surfaces B: Biointerfaces 83 (2011) 49–57 57

in pH or temperature) drug delivery which is an effective strategyfor an enhanced drug activity at the pathological site.

Acknowledgements

Authors thanks Dr. V.K. Aswal, BARC, Mumbai, India for provid-ing facilities of SANS measurements. One of the authors, YogeshKadam is thankful to the IUC-DAE, Mumbai (CSR-M-125) and CSIR,New Delhi, India, (No. 09/1008/(0002)/2010-EMR-I) for fellowshipsin terms of project assistant and SRF respectively. P.B. thanks IUC-DAE for financial assistance.

Appendix A. Supplementary data

Supplementary data associated with this article can be found, inthe online version, at doi:10.1016/j.colsurfb.2010.10.041.

References

[1] B. Chu, Z. Zhou, V. Nace (Eds.), Physical Chemistry of Polyoxyalkylene BlockCopolymer Surfactants, Nonionic Surfactants:Polyoxyalkylene Block Copoly-mer Studies, vol. 60, Marcel-Dekker, Inc., NY, 1996.

[2] K. Nakashima, P. Bahadur, Adv. Colloid Interface Sci. 123 (2006) 7.[3] G. Riess, P. Bahadur, G. Hurtrez, Block Copolymers in Encyclopedia of Polymer

Science and Engineering, 2nd ed., Wiley, New York, 1985.[4] Z. Tuzar, P. Kratochvil, in: E. Matijevic (Ed.), Surface and Colloid Science, Plenum

Press, New York, 1993, p. 1.[5] P. Bahadur, Curr. Sci. 80 (2001) 1002.[6] N. Hadjichristidis, S. Pispas, G.A. Flaudas (Eds.), Block Copolymers: Synthetic

Strategies, Physical Properties and Applications, Advanced Materials, 2004.[7] G. Riess, Prog. Polym. Sci. 28 (2003) 1107.[8] P. Alexandridis, Curr. Opin. Colloid Interface Sci. 1 (1996) 490.[9] W. Hamley, Nanotechnology 14 (2003) 39.

[10] P. Bahadur, G. Riess, Tenside Surfact. Det. 28 (1991) 173.[11] D.A. Chiappetta, A. Sosnik, Eur. J. Pharm. Biopharm. 66 (2007) 303.[12] J.D. Jonkman-de Vries, K.P. Flora, A. Bult, J.H. Beijnen, Drug Dev. Ind. Pharm. 22

(1996) 475.[13] A.J. Tim, J. Verweij, W.J. Loos, A. Sparreboom, Clin. Pharmacokinet. 42 (2003)

665.[14] M.C. Jones, J.C. Leroux, Eur. J. Pharm. Biopharm. 48 (1999) 101.[15] K. Kataoka, G.S. Kwon, M. Yokoyama, T. Okano, Y. Sakurai, J. Control. Release 24

(1993) 119.[16] M. Yokoyama, A. Satoh, Y. Sakurai, T. Okano, Y. Matsumura, T. Kakizoe, K.

Kataoka, J. Control. Release 55 (1998) 219.[17] V.P. Torchilin, J. Control. Release 73 (2001) 137.[18] B.G. Yu, T. Okano, K. Kataoka, G. Kwon, J. Control. Release 53 (1998) 131.[19] Y. Kadam, U. Yerramilli, A. Bahadur, Colloids Surf. B: Biointerfaces 72 (2009)

141.[20] C. Dollery, Therapeutic Drugs, Churchill Livingstone, pp. H52–H57 (the drug

and its tablets are official in the USP26).[21] J.N. Latosinska, Int. J. Quantum Chem. 91 (2003) 339.[22] J.M. Aceves-Hernández, E. Agacino-Valdés, M. Paz, J. Hinojosa-Torres, J. Mol.

Struct. 786 (2006) 1.[23] D.S. Desai, B.A. Rubitski, S.A. Varia, N.B. Jain, Int. J. Pharm. 142 (1996) 61.[24] R. Barreiro-Iglesias, L. Bromberg, M. Temchenko, T.A. Hatton, C. Alvarez-

Lorenzo, A. Concheiro, Eur. J. Pharm. Sci. 26 (2005) 374.[25] C.C. Hansch, in: R.G. Sammes, J.B. Taylor (Eds.), Comprehensive Medicinal

Chemistry, vol. 6, Pergamon Press, Oxford, 1990.

[26] H.P. Deppeler, in: K. Florey (Ed.), Hydrochlorothiazide, Analytical Profiles ofDrug Substances, vol. 10, Academic Press Inc., London, 1981, p. 405.

[27] E. Batrakova, S. Lee, S. Li, A. Venne, V. Alakhov, A. Kabanov, Pharm. Res. 16(1999) 1373.

[28] Y. Kadam, K. Singh, D.G. Marangoni, J.H. Ma, V.K. Aswal, P. Bahadur, J. ColloidInterface Sci. 351 (2010) 449.

[29] M. Almgren, W. Brown, S. Hvidt, Colloid Polym. Sci. 273 (1995) 2.[30] P. Alexandridis, T.A. Hatton, Colloids Surf. A: Physicochem. Eng. Aspects 96

(1995) 1.[31] I. Goldmints, F.K. von Gottberg, K.A. Smith, T.A. Hatton, Langmuir 13 (1997)

3659.[32] G. Wanka, H. Hoffmann, W. Ulbricht, Macromolecules 27 (1994) 4145.[33] M. Almgren, P. Bahadur, M. Jansson, P. Li, W. Brown, A. Bahadur, J. Colloid

Interface Sci. 151 (1992) 157.[34] G. Wanka, H. Hoffmann, W. Ulbricht, Colloid Polym. Sci. 268 (1990) 101.[35] P. Alexandridis, T.A. Hatton, J.F. Holzwarth, Langmuir 15 (1999) 322.[36] Y. Kadam, R. Ganguly, M. Kumbhakar, V.K. Aswal, P.A. Hassan, P. Bahadur, J.

Phys. Chem. B 113 (2009) 16296.[37] Y. Liu, S. Chen, J.S. Huang, Macromolecules 31 (1998) 6226.[38] Y. Liu, S. Chen, J.S. Huang, Macromolecules 31 (1998) 2236.[39] P. Alexandridis, J. Holzwarth, T.A. Hatton, Macromolecules 27 (1994) 2414.[40] B. Foster, T. Cosgrove, B. Hammouda, Langmuir 25 (2009) 6760.[41] W. Batsberg, S. Ndoni, C. Trandum, S. Hvidt, Macromolecules 37 (2004) 2965.[42] S. Hvidt, W. Batsberg, Int. J. Polym. Anal. Charact. 12 (2007) 13.[43] K. Mortensen, W. Batsberg, S. Hvidt, Macromolecules 41 (2008) 1720.[44] H. Tsui, Y. Hsu, J. Wang, L. Chen, Langmuir 24 (2008) 13858.[45] P. Schmidt, J. Dybal, A. Sturcova, Vib. Spectrosc. 50 (2009) 218.[46] Y.L. Su, H.Z. Liu, J. Wang, J.Y. Chen, Langmuir 18 (2002) 865.[47] Y.L. Su, J. Wang, H.Z. Liu, Macromolecules 35 (2002) 6426.[48] L. Zheng, C. Guo, J. Wang, X. Liang, P. Bahadur, S. Chem, Vib. Spectrosc. 39 (2005)

157.[49] B. Bharatiya, C. Guo, J.H. Ma, P.A. Hassan, P. Bahadur, Eur. Polym. J. 43 (2007)

1883.[50] M.F. Saettone, B. Giannaccini, G. Delmonte, V. Campigli, G. Tota, F. Lamarca, Int.

J. Pharm. 43 (1988) 67.[51] A.V. Kabanov, V.P. Chekhonin, V.Y. Alakhov, E.V. Batrakova, A.S. Lebedev, N.S.

Meliknubarov, S.A. Arzhakov, A.V. Levashov, G.V. Morozov, E.S. Severin, V.A.Kabanov, FEBS Lett. 258 (1989) 343.

[52] D. Tsurumi, K. Sakai, T. Yoshimura, K. Esumi, J. Colloid Interface Sci. 302 (2006)82.

[53] A.A. Al-Saden, T.L. Whateley, A.T. Florence, J. Colloid Interface Sci. 90 (1982)303.

[54] Y. Saito, Y. Kondo, M. Abe, T. Sato, Chem. Pharm. Bull. 42 (1994) 1348.[55] A.F. Fioritto, S.N. Bhattachar, J.A. Wesley, Int. J. Pharm. 330 (2007) 105.[56] J. Causse, S. Lagergea, L.C. de Menorval, S. Faure, J. Colloid Interface Sci. 300

(2006) 724.[57] P. Alexdandridis, U. Olsson, B. Lindman, Langmuir 14 (1998) 2627.[58] H. Suh, H.W. Jun, Int. J. Pharm. 129 (1996) 13.[59] P. Alexdandridis, D. Zhou, A. Khan, Langmuir 12 (1996) 2690.[60] Y. Kadam, J. Disper. Sci. Technol. 31 (2010) 870.[61] K. Patel, B. Bharatiya, Y. Kadam, P. Bahadur, J. Surfact. Deterg. 13 (2010) 89.[62] N. Pandit, T. Trygstad, S. Croy, M. Bohorquez, C. Koch, J. Colloid Interface Sci.

222 (2000) 213.[63] K. Ohashi, K. Hashizaki, H. Taguchi, Y. Saito, J. Disper. Sci. Technol. 30 (2009)

720.[64] Y. Saito, T. Sato, Drug Dev. Ind. Pharm. 24 (1998) 385.[65] Y.L. Su, X.F. Wei, H.Z. Liu, J. Colloid Interface Sci. 264 (2003) 526.[66] J.E.A. Comer, in: H. van de Waterbeemd (Ed.), Drug Bioavailability, vol. 1, Wiley-

VCH, New York, 2003, p. 21, Chapter 2.[67] C.A.S. Bergstrom, K. Luthman, P. Artursson, Eur. J. Pharm. Sci. 22 (2004) 387.[68] S. Chakraborty, D. Shukla, A. Jain, B. Mishraand, S. Singh, J. Colloid Interface Sci.

335 (2009) 242.[69] S. Yang, X. Zhang, S. Yuan, J. Mol. Model. 14 (2008) 607.

Colloids and Surfaces B: Biointerfaces 72 (2009) 141–147

Contents lists available at ScienceDirect

Colloids and Surfaces B: Biointerfaces

journa l homepage: www.e lsev ier .com/ locate /co lsur fb

Solubilization of poorly water-soluble drug carbamezapine in Pluronic® micelles:Effect of molecular characteristics, temperature and added salt on thesolubilizing capacity

Yogesh Kadama,∗, Usha Yerramilli a, Anita Bahadurb

a Department of Chemistry, V.N. South Gujarat University, Surat 395 007, Gujarat, Indiab Department of Zoology, P.T. Sarvajanik College of Science, Surat 395 001, India

a r t i c l e i n f o

Article history:Received 14 February 2009Received in revised form 24 March 2009Accepted 26 March 2009Available online 5 April 2009

Keywords:SolubilizationMicelleBlock copolymerMicelle–water partition coefficient (P)

a b s t r a c t

The solubilization of a poorly water-soluble antiepileptic drug, carbamazepine (CBZ), in a series of micelle-forming PEO–PPO–PEO block copolymers with combinations of blocks having different molecular weightwas studied. The drug solubility and micelle–water partition coefficient (P) were determined using UV–visspectroscopy. Dynamic light scattering on copolymer solutions was used to measure size and polydis-persity of nanoaggregates. Solubilization of carbamezapine increased with the rise in temperature andconcentration of block copolymers, but no significant increase was observed with added salt (NaCl).The solubilization is also discussed from a thermodynamics viewpoint, by considering the standard freeenergy of solubilization (�G◦).

© 2009 Elsevier B.V. All rights reserved.

1. Introduction

Several drugs of good clinical value have low water solubility,making the delivery of these drugs by conventional means dif-ficult. Various techniques such as using suitable solvents [1–4],hydrophobically modified polysaccharides [5–7], dendrimers [8],hydrotropes [9], nanostructured fluids such as vesicles [10] and sur-factant micelles [11–23] have been used in the literature to enhancethe aqueous solubility of such sparingly water-soluble drugs.

Block copolymers can be used to solubilize these sparinglysoluble drugs and serve as biocompatible drug delivery systems.Block copolymers are made of two often incompatible blocks thatshow micro-domain formation in solid state and aggregation inselective solvents [11–13]. Amphiphilic block copolymers assem-ble into nanoscopic supramolecular core–shell structures, termedpolymeric micelles, which are under extensive study for drug sol-ubilization, delivery systems [14–23]. These polymer micelles arenanosized particles that can solubilize hydrophobic drugs and altertheir kinetics in vitro and in vivo.

Poly(ethylene oxide)n–poly(propylene oxide)m–poly(ethyleneoxide)n (PEO–PPO–PEO), are amphiphilic substances often calledPluronic® (BASF) or Poloxamers, and have numerous industrialapplications as detergents, dispersants, stabilizers, foaming agents,

∗ Corresponding author. Tel.: +91 999 8481106; fax: +91 261 2256012.E-mail address: yogeshkadam2010@yahoo.com (Y. Kadam).

emulsifiers, etc. Pluronics® behave as non-ionic surfactants andform core–shell micelle [a hydrophobic core of (PPO) and ahydrophilic shell of heavily hydrated (PEO)], above a certain tem-perature, called the critical micellization temperature, CMT, whichdepends on the concentration/molecular characteristics of thecopolymer. These micelles can be spherical or rod-like (evenaggregates of different morphologies including vesicles) in dilutesolution but organize to exhibit rich phase behavior in concen-trated solutions often forming viscoelastic gels under experimentalconditions. The micelle formation and phase behavior of Pluronic®

surfactants have been investigated by several workers and is exten-sively reviewed [24–28].

There have been a few studies on the solubilization of hydropho-bic drugs having different pharmacological activity in Pluronic®

micelles. Increased solubility and longer half-life of naproxen androfecoxib was shown by Suh et al. [29,30] and Ahuja et al. [31].Barreiro-Iglesias et al. [32] showed that solubility of camptothecin,an anticancer drug was 3–4-fold higher with modified PAA blocksin comparison to single Pluronic® block copolymer F127 and L92,whereas Sugin et al. [33] showed improved oral absorption invitro with F127, F68, and P85. Solubility of tropicamide a mydri-atic/cycloplegic drug was studied [34] with a series of Pluronic®

with different molecular characteristics and found that ocular sol-ubility increased linearly with increasing surfactant concentrationand enhanced solubility for higher EO content. Neuroleptic drughaloperidol showed a 5-fold increase in solubility in Pluronic®

P85 [35]. The solubility of estriol an HRT drug increased with

0927-7765/$ – see front matter © 2009 Elsevier B.V. All rights reserved.doi:10.1016/j.colsurfb.2009.03.027

142 Y. Kadam et al. / Colloids and Surfaces B: Biointerfaces 72 (2009) 141–147

Pluronic® L64 concentration and temperature/salt [36,37] as well aswith PAA modified Pluronic® F127 above CMT [38]. Thermal analy-sis of solubilization process with Pluronic® F68 for Cyclosporine,an immune-depressant drug was studied by Molpeceres et al.[39]. Some other studies showed that, the solubility of pilocarpineincreased significantly, when the drug was solubilized in F127 withother additives [40,41]. In addition to Pluronic® [42], it was shownthat the solubility of griseofulvin improved with Tetronic® blockcopolymer also, when higher pH was used [43]. Other studies haveshown that the propofol drug solubility was improved in pure [44]as well as mixed micelles of F68 and F127 [45]. Solubility of nystatinwas studied with several Pluronic® F68, F98, P105, F127 and it wasfound that, with increased polarity of the polymer the solubility ofthe drug decreases [46].

Carbamazepine (CBZ) is a widely used antiepileptic drug [47,48]and reports have focused on improving the dissolution characteris-tics of CBZ [49–53]. However, we did not find any systematic studyon the solubilization of CBZ in micelles of different copolymerswith varying structure and molecular characteristics, particularlyat different temperature and added salt concentration. In fact allthese variables would exert a remarkable effect on solubiliza-tion. Although carbamazepine has high intestinal permeability, thebioavailability is limited by its low water solubility and hence it wasselected as the model drug in this work.

We present results on the solubilization of CBZ and its effecton the micellar structure of various Pluronic® solutions. Pluronic®

(P103, P123, P84 and F127) were selected for monitoring their sol-ubilization capacity for carbamazepine (CBZ). At the experimentaltemperature and concentration, the aqueous solutions of thesefour Pluronic® block copolymers show different micellar behav-ior. The solutions of Pluronic® P103 and P123 (high% PPO) aremicelle rich phase whereas Pluronic® F127 (high% PEO) remains asunimers at experimental temperature. Pluronic® P84 with moder-ate PEO/PPO ratio was selected for the comparison of solubilizationcapacity against the highly hydrophobic and hydrophilic Pluronic®

copolymers. Dynamic light scattering was used to characterize thedimension of micellar aggregates which are changed dramaticallydue to interaction with hydrophobic additives. The drug solubil-ity and the micelle–water partition coefficient (P) were measuredusing ultraviolet spectroscopy. Thermodynamic point of view of thesolubilization is also discussed by considering the standard freeenergy of solubilization (�G◦).

The objective of the present work is to investigate the solubi-lization of a hydrophobic drug with a focus has been on molecularcharacteristics of the copolymer. Effect of temperature and salt onthe solubilization is also studied.

2. Materials and methods

2.1. Materials

All the Pluronics® (Scheme 1) were received as gifts from BASFCorp. Parsippany, NJ, USA and used without further purification.The molecular characteristics are described in Table 1. The drug car-

Scheme 1. Pluronic®.

Scheme 2. Carbamazepine (CBZ). MW = 236.27 g/mol, the aqueous solubility of CBZat 37 ◦C = 5.5 × 10−4 M [5.1 × 10−4 M [55], 8.4 × 10−4 M [56]].

bamazepine (5H-dibenz [b,f]-azepine-5-carboxamide) (Scheme 2)was obtained from Sigma–Aldrich, Co. (St. Louis, MO) and used asreceived.

2.2. Ultraviolet spectroscopy (UV)

Drug solubilization measurements were carried out on Shi-madzu (UV-2450) UV–vis double beam spectrophotometers withmatched pair of stoppered fused silica cells of 1 cm optical pathlength.

Saturated drug-loaded solutions were prepared in glass vesselsby mixing excess powdered drug with copolymer solution and stir-ring at constant temperature (30 or 37 ◦C) at 200 rpm for 2 days.The solutions were filtered (Millipore, 0.45 �m) to remove unsolu-bilized drug. Blank experiments, without copolymer, were done todetermine the solubility of the drug in water. The amount of drugsolubilized was determined by measuring absorbance at 286 nm.Calibration with dilute solutions of the drugs dissolved in methanolgave satisfactory Beer–Lambert plots. In a solubilization experi-ment, the filtered solution was diluted thirty times with methanol,the amount of water after dilution being low enough to allow directuse of the calibration plot.

2.3. Dynamic light scattering (DLS)

Dynamic light scattering (DLS) was used to determine micellesize and polydispersity. DLS measurements were carried out at 130◦

scattering angle on solutions using Autosizer 4800 (Malvern Instru-ments, UK) equipped with 192 channel digital correlator (7132)and coherent (Innova) Ar-ion laser in vacuum at a wavelength of514.5 nm. The average diffusion coefficients and hence the hydro-dynamic diameter was obtained by the method of cumulants.

Table 1Physicochemical characteristics of Pluronic® block copolymers.

Pluronic® MWa Structure Total wt. of EO Total wt. of PO HLBb CP of 1% (◦C)b CMCc (M) at 30 ◦C

P103 4,950 EO17PO60EO17 1485 3465 9 86 6.1 × 10−6

P123 5,750 EO19PO69EO19 1725 4025 8 90 4.4 × 10−6

P84 4,200 EO19PO43EO19 1680 2520 14 74 7.1 × 10−5

F127 12,600 EO100PO65EO100 8820 3780 22 >100 2.8 × 10−6

a The average molecular weights provided by the manufacturer (BASF, Wyandotte, MI).b HLB values of the copolymers; the cloud points were determined by the manufacturer.c CMC values were determined using pyrene probe (Ref. [54]).

Y. Kadam et al. / Colloids and Surfaces B: Biointerfaces 72 (2009) 141–147 143

Fig. 1. UV spectra of solubilized drug CBZ (�max = 286 nm) in P103 at 37 ◦C. Concen-tration of P103 for the systems is varied as: (1) 0% (CBZ in water), (2) 0.004%, (3)0.008%, (4) 0.01%, (5) 0.1%, (6) 1%, (7) 2%, (8) 3%, (9) 4% and (10) 5%.

3. Results and discussion

3.1. Effect of molecular characteristics

The solubilization of CBZ in aqueous solutions of Pluronics® ofdifferent molecular characteristics (Table 1) was monitored usingUV-spectroscopy. Fig. 1 shows the representative plot of drug CBZsolubilized in Pluronic® P103 in terms of intensity in UV-spectrum,which clearly shows strong interaction between the drug andP103 (without shift in �max = 286 nm) with corresponding increasein concentration. The solubilization enhances with increase inPluronic® concentration (1–5%).

Fig. 2 shows the comparisons of solubilization of CBZ inPluronics® (P103 and P84). In the entire concentration range, theamount of solubilized CBZ was more for P103; which can beattributed to the fact that P103 is more hydrophobic than P84. Thisresults in an increased hydrophobic–hydrophobic interaction, forCBZ and P103.

Fig. 2. Amount of solubilized CBZ vs. Pluronic® concentration at 37 ◦C. (�) % w/vP103 and (�) % w/v P84.

Fig. 3. Hydrodynamic size of CBZ solubilized Pluronic® micelle at 37 ◦C. (�) % w/vP103, (�) % w/v F127, (�) % w/v P123 and (�) % w/v P84.

Fig. 3 shows the hydrodynamic size for various copolymers atdifferent concentrations with solubilized CBZ. The consistency insize is an indication that there is no increment in aggregationnumber. The enhancement in solubilization is due to increase innumbers of micelles as shown in Fig. 2 for P103 and P84.

Hydrodynamic size and amount of CBZ solubilized in micelle ofcopolymers measured using DLS and UV-spectroscopy respectivelyare shown in Table 2. It was observed that in all copolymers, solubi-lization is significantly increased with concentration (5% � 1 wt%),with almost no change in micellar size but more number ofmicelles available for solubilization. The solubilization for 1% solu-tions was found in order P103 > P123 > F127 > P84 and for 5%, wasF127 > P103 > P123 > P84. This observation can be explained on thebasis of solubilization of drug partly in the polyoxyethylene outermantle, and partly in the polyoxypropylene inner core of the micel-lar aggregates as shown by several authors [34,35]. The differencein solubilization of drug at lower and higher concentration of blockcopolymers could be attributed to the phase behavior of P103 andP123. Pluronic® copolymers with high % of PPO, show decreasein core radius at higher concentrations; this has been reported byYang et al. [57]. They studied the phase behavior of P103 micelles inwater, which shows a decrease in the average core radius at 5 wt%,when compared to that at lower concentrations. This also can beexplained by the experimental data shown in Table 2, which sug-gests that the hydrodynamic size of P103 and P123 micelles withsolubilized drug are slightly lower at higher concentration (5%)and the micelles are smaller. On the other hand, more hydrophilicPluronic® copolymers show opposite trend as the size of F127micelles increases with the concentration. Apart from this fact, thehigher numbers of micelles at 5% copolymer concentration con-tributes to increased hydrophobic interaction, which is primarilyresponsible for the micellar solubilization of this sparingly water

Table 2Hydrodynamic size and amount of CBZ solubilized in micelle of copolymers (1% and5%) at 37 ◦C.

Pluronic® Hydrodynamic diameter Dh [nm] Amount of solubilized CBZ [mM]

1% w/v 5% w/v 1% w/v 5% w/v

P103 35.4 34.9 1.659 4.257P123 21.3 21.1 1.611 3.750P84 15.5 16.4 1.113 3.612F127 29.2 30.0 1.425 4.560

144 Y. Kadam et al. / Colloids and Surfaces B: Biointerfaces 72 (2009) 141–147

Fig. 4. Amount of solubilized CBZ vs. Pluronic® P103 concentration at differenttemperature. (�) 37 ◦C and (�) 30 ◦C.

soluble drug. Similar results were obtained by Tsurumi et al. [58]for the solubilization of 2-naphthol with four different Pluronics®

(P103, P105, P123, and F108), where they tried to understand therelationship between the solubilization behavior and the copoly-mer’s hydrophobicity.

3.2. Effect of temperature

In general, the amount of drug solubilized in a micellar systemincreases with the increase in temperature due to micellar growth.Saito et al. [36] have shown the increase in the solubilization ofthe drug estriol with temperature. In another study Fioritto et al.[59] got similar results for furosemide from NMR and UV meth-ods. The apparent concentrations of CBZ in aqueous P103 (selectedas a representative) solutions as a function of temperature areshown in Fig. 4. The apparent solubility of CBZ in water is slightlyincreased with an increase in temperature (i.e. 4.2 × 10−4 M at 30 ◦Cand 5.5 × 10−4 M at 37 ◦C), but dramatically increases in aqueous

Fig. 5. UV–vis spectra of solubilized drug CBZ (�max = 286 nm) in P103 at 37 ◦C inpresence of NaCl: (1) 1% P103, (2) 1% P103 + 1 M NaCl, (3) 1% P103 + 2 M NaCl and (4)0% (CBZ in water).

Fig. 6. Amount of solubilized CBZ in 1% Pluronic® micelle with added salt (NaCl) at37 ◦C. (�) % w/v P103, (�) % w/v F127, (�) % w/v P123 and (�) % w/v P84.

block copolymer solutions. This can be attributed to the increase inthermal vibrations of the Pluronic® monomers in the micelle whichresults in an increase in the space available for solubilization of thedrug in the micelle, in addition to the increased solubility of CBZ inwater at higher temperatures.

3.3. Effect of salt

Solubilization of CBZ in Pluronic® (at 1% wt) was also studiedin the presence of salt (NaCl). Fig. 5 shows the representative plotfor P103 + CBZ with salt. The decline in intensity peak indicatesdecrease in the amount of solubilized drugs.

Fig. 6 shows that for all the Pluronic® copolymers at 1% concen-tration, the amount of the solubilized drug was either same (in caseof P84, F127) or decreased (in case of P103, P123) in the presenceof salt. Table 3 and Fig. 6 depict the effect of salt on hydrodynamicsize of different Pluronics® with and without drug loaded micelle at37 ◦C. Intensity vs. size plots (Fig. 7) are in good agreement with theshifts in intensity peaks. Though aggregate size increases on addi-tion of salt, the solubilization capacity was found to decrease. Theseresults are discussed later in detail from the micelle-water partitioncoefficient (P) and standard free energy change (�G◦) viewpoint.

3.4. Partition coefficient and thermodynamics of solubilization

The micelle–water partition coefficient is the ratio of the drugconcentration in the micelle to that in water for a particular surfac-tant concentration, as shown below:

P = Stot − SW

SW(1)

Table 3Hydrodynamic size of 1% Pluronic® micelle with and without solubilized CBZ inaqueous and salt solutions at 37 ◦C.

Pluronic® Hydrodynamic diameter Dh [nm]

H2O 1 M NaCl

Empty micelle Drug loadedmicelle

Empty micelle Drug loadedmicelle

P103 13.8 35.4 41.5 73.2P123 17.0 21.3 22.6 59.2P84 15.0 15.5 14.0 15.3F127 20.5 29.2 20.0 21.1

Y. Kadam et al. / Colloids and Surfaces B: Biointerfaces 72 (2009) 141–147 145

Fig. 7. Intensity vs. size plot for 1% Pluronic® with NaCl, where (—) dash line is for empty micelles and (−) solid line is for drug (CBZ) loaded micelle at 37 ◦C.

Fig. 8. (a) The micelle/water partition coefficient (P) and (b) the standard free energy change (�G◦) for CBZ solubilized in aqueous block copolymers. (�) P103 at 37 ◦C, (�)P103 at 30 ◦C and (�) P84 at 37 ◦C.

146 Y. Kadam et al. / Colloids and Surfaces B: Biointerfaces 72 (2009) 141–147

Fig. 9. Effect of salt on (a) the micelle/water partition coefficient (P) and (b) the standard free energy change (�G◦) for CBZ solubilized in 1% block copolymers at 37 ◦C. (�)F127, (�) P123, (�) P103 and (�) P84.

where Stot and SW are the concentrations of drugs in the micelles(based upon total polymer mass) and in the water, respectively.

From the thermodynamic point of view, the solubilization canbe considered as a normal partitioning of the drug between micelleand aqueous phases and the standard free energy of solubilization(�G◦) can be represented by the following expression:

�G= − RT ln P (2)

where R is the universal constant of the gases, T is the absolutetemperature, and P is the partition coefficient between the micelleand the aqueous phase.

There are several excellent reports [56,60] based uponmicelle/water partition coefficient (P) to determine partitioningof drugs like small low molecular mass solutes between aqueousand micellar phase. The micelle/water partition coefficient (P) andstandard free energy change (�G◦) for solubilization of CBZ in aque-ous block copolymer solutions as a function of concentration areshown in Fig. 8. The partition coefficient begins to show markedincrease with increase in concentration and temperature. Higherthe partition coefficient, better hydrophobic microenvironmentwould be formed by PEO–PPO–PEO block copolymer. Spontaneoussolubilization of CBZ in aqueous block copolymer solutions ismanifested by the negative �G◦ values. Increasing copolymer con-centration/temperature makes values more negative �G◦, whichsuggests appreciable increase in the aggregation number of micelle.The results of solubilization are in agreement with that of smallangle neutron scattering studies [61]. The presence of CBZ in themicelles also has a significant effect on the structure of micelles.Gadelle et al. [62] has suggested that solubilization initially takesplace through a replacement process in which water is displacedfrom the micellar cores.

Fig. 9 shows effect of salt on (a) the micelle/water partition coef-ficient (P) and (b) the standard free energy change (�G◦) for CBZsolubilized in 1% Pluronic® block copolymers at 37 ◦C. No significantincrease in the partition coefficients (P) could be seen in case of P84and F127, rather considerable decrease was observed in case of P103and P123 in presence of NaCl. The values of free energy changes(�G◦) are also in agreement with results obtained. Nonspontaneoussolubilization of CBZ in P103 and P123 Pluronic® solutions is mani-fested by the less negative values of �G◦, which is attributing to thesolubilization of CBZ in palisade layer of micelle. This solubilizationdecreases with the added NaCl due to quenching of water molecule

from PEO (salting out effect) and consequent shrinking of coronaregion.

4. Conclusions

Increase in the apparent solubility of a drug (carbamezapine)in aqueous polyethylene oxide–polypropylene oxide–polyethyleneoxide blocks copolymer solutions can be achieved by varying con-centration and temperature. The solubilization capacity of the drugin copolymer also depends on its molecular characteristics. Themicelle/water partition coefficient values support the findings. Thenegative values of the solubilization free energy for CBZ indicatespontaneous solubilization process. The solubilization of CBZ inPluronic® micelle is not favored in the presence of NaCl. Theseresults developed from the comparison studies of the solubilizationcapacity of Pluronic® copolymer provide important information forselecting a specific Pluronic® copolymer for a desired applicationpurpose. Also, this information can be useful to understand the sol-ubilization behavior of Pluronic® copolymers available in varietiesof molecular weights and can be used to identify possible newerapplications of Pluronic® copolymers in pharmaceutical field.

Acknowledgements

Financial assistance from UGC, India is gratefully acknowledged(AB). Y.K. thanks Dr. P.A. Hassan (Chemistry Division, BARC, Mum-bai, India), for providing facilities for dynamic light scattering (DLS)measurements.

References

[1] Y. Miyako, H. Tai, K. Ikeda, R. Kume, R. Pinal, Drug Dev. Ind. Pharm. 34 (2008)499.

[2] R. Sanghvi, R. Narazaki, S.G. Machatha, S.H. Yalkowsky, Aaps Pharmscitech. 9(2008) 366.

[3] A.S. Uch, U. Hesse, J.B. Dressman, Pharm. Res. 16 (1999) 968.[4] P. Jain, S.H. Yalkowsky, Int. J. Pharm. 342 (2007) 1.[5] W. Henni-Silhadi, M. Deyme, M.M. Boissonnade, M. Appel, D. Le Cerf, L. Picton,

V. Rosilio, Pharm. Res. 24 (2007) 2317.[6] M.F. Francis, M. Piredda, F.M. Winnik, J. Control. Release 93 (2003) 59.[7] Y.P. Wei, F. Cheng, G. Hou, S.F. Sun, React. Funct. Polym. 68 (2008) 981.[8] S. Svenson, A.S. Chauhan, Nanomedicine 3 (2008) 679.[9] T.K. Hodgdon, E.W. Kaler, Curr. Opin. Colloid Interface 12 (2007)

121.[10] A.R. Mohammed, N. Weston, A.G.A. Coombes, M. Fitzgerald, Y. Perrie, Int. J.

Pharm. 285 (2004) 23.

Y. Kadam et al. / Colloids and Surfaces B: Biointerfaces 72 (2009) 141–147 147

[11] G. Riess, G. Hurtrez, P. Bahadur, Block Copolymers, Encyclopaedia of PolymerScience and Engineering, 2nd ed., Wiley, New York, 1985.

[12] G. Riess, Prog. Polym. Sci. 28 (2003) 1107.[13] P. Bahadur, Curr. Sci. 80 (2001) 1002.[14] A. Mahmud, X.B. Xiong, H.M. Aliabadi, A. Lavasanifar, J. Drug Target. 15 (2007)

553.[15] G.S. Kwon, Criti. Rev. Ther. Drug 20 (2003) 357.[16] H.M. Aliabadi, M. Shahin, D.R. Brocks, A. Lavasanifiar, Clin. Pharmacokinet. 47

(2008) 619.[17] E.V. Batrakova, A.V. Kabanov, J. Control. Release 130 (2008) 98.[18] D.A. Chiappetta, A. Sosnik, Eur. J. Pharm. Biopharm. 66 (2007) 303.[19] R. Savic, A. Eisenberg, D. Maysinger, J. Drug Target. 14 (2006) 343.[20] G. Gaucher, M.H. Dufresne, V.P. Sant, N. Kang, D. Maysinger, J.C. Leroux, J. Control.

Release 109 (2005) 169.[21] K. Mondon, R. Gurny, M. Moller, Chimia 62 (2008) 832.[22] A.V. Kabanov, E.V. Batrakova, V.Y. Alakhov, J. Control. Release 82 (2002)

189.[23] A.V. Kabanov, P. Lemieux, S. Vinogradov, V. Alakhov, Adv. Drug Deliver. Rev. 54

(2002) 223.[24] P. Bahadur, G. Riess, Tenside Surfact. Det. 28 (1991) 173.[25] K. Nakashima, P. Bahadur, Adv. Colloid Interface Sci. 123 (2006) 7.[26] B. Chu, Z. Zhou, in: V. Nace (Ed.), Physical Chemistry of Polyoxyalkylene Block

Copolymer Surfactants, Nonionic Surfactants:Polyoxyalkylene Block Copoly-mer Studies, vol. 60, Marcel-Dekker, Inc., NY, 1996.

[27] M. Almgren, BBA-Biomembranes 1508 (2000) 146.[28] P. Alexandridis, Curr. Opin. Colloid Interface Sci. 1 (1996) 490.[29] H. Suh, H.W. Jun, Int. J. Pharm. 129 (1996) 13.[30] H. Suh, H.W. Jun, M.T. Dzimianski, G.W. Lu, Biopharm. Drug Dispos. 18 (1997)

623.[31] N. Ahuja, O.P. Katare, B. Singh, Eur. J. Pharm. Biopharm. 65 (2007) 26.[32] R. Barreiro-Iglesias, L. Bromberg, M. Temchenko, T.A. Hatton, A. Concheiro, C.

Alvarez-Lorenzo, J. Control. Release 97 (2004) 537.[33] Z. Sugin, N. Yuksel, T. Baykara, Eur. J. Pharm. Biopharm. 64 (2006) 261.[34] M.F. Saettone, B. Giannaccini, G. Delmonte, V. Campigli, G. Tota, F. Lamarca, Int.

J. Pharm. 43 (1988) 67.[35] A.V. Kabanov, V.P. Chekhonin, V.Y. Alakhov, E.V. Batrakova, A.S. Lebedev, N.S.

Meliknubarov, S.A. Arzhakov, A.V. Levashov, G.V. Morozov, E.S. Severin, V.A.Kabanov, Febs Lett. 258 (1989) 343.

[36] Y. Saito, Y. Kondo, M. Abe, T. Sato, Chem. Pharm. Bull. 42 (1994) 1348.[37] Y. Saito, T. Sato, Drug Dev. Ind. Pharm. 24 (1998) 385.[38] L. Bromberg, M. Temchenko, Langmuir 15 (1999) 8627.[39] J. Molpeceres, M. Guzman, P. Bustamante, M.D. Aberturas, Int. J. Pharm. 130

(1996) 75.[40] S.D. Desai, J. Blanchard, J. Pharm. Sci. 87 (1998) 226.[41] S.D. Desai, J. Blanchard, J. Pharm. Sci. 87 (1998) 1190.[42] C.J. Rekatas, S.M. Mai, M. Crothers, M. Quinn, J.H. Collett, D. Attwood, F. Heatley,

L. Martini, C. Booth, Phys. Chem. Chem. Phys. 3 (2001) 4769.[43] C. Alvarez-Lorenzo, J. Gonzalez-Lopez, M. Fernandez-Tarrio, I. Sandez-Macho,

A. Concheiro, Eur. J. Pharm. Biopharm. 66 (2007) 244.[44] K.I. Momot, P.W. Kuchel, B.E. Chapman, P. Deo, D. Whittaker, Langmuir 19 (2003)

2088.[45] M.T. Baker, M. Naguib, Anesthesiology 103 (2005) 860.[46] S.R. Croy, G.S. Kwon, J. Control. Release 95 (2004) 161.[47] M. Sitges, L.M. Chiu, V. Nekrassov, Neurochem. Int. 49 (2006) 55.[48] K.A. Voudris, A. Attilakos, E. Katsarou, A. Drakatos, S. Dimou, S. Mastroyianni,

A. Skardoutsou, A. Prassouli, A. Garoufi, Epilepsy Res. 70 (2006) 211.[49] H. El-Zein, L. Riad, A.A. El-Bary, Int. J. Pharm. 168 (1998) 209.[50] E. Chan, H.S. Lee, S.S. Hue, Br. J. Clin. Pharmacol. 51 (2001) 567.[51] J.H. Hu, K.P. Johnston, R.O. Williams, Eur. J. Pharm. Sci. 20 (2003) 295.[52] D. Douroumis, A. Fahr, Eur. J. Pharm. Biopharm. 63 (2006) 173.[53] H. Friedrich, B. Fussnegger, K. Kolter, R. Bodmeier, Eur. J. Pharm. Biopharm. 62

(2006) 171.[54] E. Batrakova, S. Lee, S. Li, A. Venne, V. Alakhov, A. Kabanov, Pharm. Res. 16 (1999)

1373.[55] X.Q. Chen, S.J. Cho, Y. Li, S. Venkatesh, J. Pharm. Sci. 91 (2002) 1838.[56] Z. Zhou, C. Chaibundit, A. D’Emanuele, K. Lennon, D. Attwood, C. Booth, Int. J.

Pharm. 354 (2008) 82.[57] S. Yang, X. Zhang, S. Yuan, J. Mol. Model 14 (2008) 607.[58] D. Tsurumi, K. Sakai, T. Yoshimura, K. Esumi, J. Colloid Interface Sci 302 (2006)

82.[59] A.F. Fioritto, S.N. Bhattachar, J.A. Wesley, Int. J. Pharm. 330 (2007) 105.[60] M.Y. Kozlov, N.S. Melik-Nubarov, E.V. Batrakova, A.V. Kabanov, Macromolecules

33 (2000) 3305.[61] I. Goldmints, G.E. Yu, C. Booth, K.A. Smith, T.A. Hatton, Langmuir 15 (1999)

1651.[62] F. Gadelle, W.J. Koros, R.S. Schechter, Macromolecules 28 (1995) 4883.

Arch Pharm Res Vol 29, No 10, 911-920, 2006

~r~ibes of harmata! i~e~eard3

http://apr.psk.or.kr

In vivo Pharmacokinetics, Activation of MAPK Signaling and Induction of Phase II/111 Drug Metabolizing Enzymes/Transporters by Cancer Chemopreventive Compound BHA in the Mice

Rong Hu ~, Guoxiang Shen ~, Usha Rao Yerramilli ~, Wen Lin ~, Changjiang Xu z, Sujit Nair ~, and Ah-Ng Tony Kong ~2 1Graduate Program in Pharmaceutical Science, Department of Pharmaceutics, Ernest Mario School of Pharmacy, Rutgers, The State University of New Jersey, Piscataway, N J, U.S.A. and 2Department of Pharmaceutics, Ernest Mario School of Pharmacy, Rutgers, The State University of New Jersey, Piscataway, N J, U.S.A.

(Received September 18, 2005)

Phenolic antioxidant butylated hydroxyanisole (BHA) is a commonly used food preservative with broad biological activities, including protection against chemical-induced carcinogenesis, acute toxicity of chemicals, modulation of macromolecule synthesis and immune response, induction of phase II detoxifying enzymes, as well as its undesirable potential tumor-promot- ing activities. Understanding the molecular basis underlying these diverse biological actions of BHA is thus of great importance. Here we studied the pharmacokinetics, activation of sig- naling kinases and induction of phase II/lll drug metabolizing enzymes/transporter gene expression by BHA in the mice. The peak plasma concentration of BHA achieved in our cur- rent study after oral administration of 200 mg/kg BHA was around 10 #M. This in vivo concen- tration might offer some insights for the many in vitro cell culture studies on signal transduction and induction of phase II genes using similar concentrations. The oral bioavail- ability (F) of BHA was about 43% in the mice. In the mouse liver, BHA induced the expres- sion of phase II genes including NQO-1, HO-1, ~,-GCS, GST-pi and UGT 1A6, as well as some of the phase III transporter genes, such as MRP1 and Slcolb2. In addition, BHA acti- vated distinct mitogen-activated protein kinases (MAPKs), c-Jun N-terminal kinase (JNK), extracellular signal-regulated protein kinase (ERK), as well as p38, suggesting that the MAPK pathways may play an important role in early signaling events leading to the regulation of gene expression including phase II drug metabolizing and some phase III drug transporter genes. This is the first study to demonstrate the in vivo pharmacokinetics of BHA, the in vivo activation of MAPK signaling proteins, as well as the in vivo induction of Phase II/1tl drug metabolizing enzymes/transporters in the mouse livers.

Key words: Butylated hydroxyanisole, Pharmacokinetics, MAPKs, Phase II gene, Transporter

INTRODUCTION

Butylated hydroxyanisole (BHA), a synthetic phenolic antioxidant due to its chain-breaking action during the autooxidation of lipid, is widely used as a food preservative (Rehwoldt, 1986). In addition to the inhibition of lipid peroxidation, numerous studies in animals reveal that this compound exhibits a wide range of biological activities.

Correspondence to: Ah-Ng Tony Kong, Department of Pharma- ceutics, Ernest Mario School of Pharmacy, Rutgers, The State University of New Jersey, 160 Frelinghuysen Road, Piscataway, NJ 08854 U.S.A. Tel: 732-445-3831 x 228, Fax: 732-445-3134 E-mail: KongT@rci.rutgers.edu

BHA protects animals against radiation and the acute toxicity of various xenobiotics and mutagens (Kahl, 1984; Brekke et aL, t992; Vercammen et aL, 1998). Wattenberg and coworkers were among the first to report that BHA and its metabolite tert-butylhydroquinone (tBHQ) to protect rodents against formation of tumors (Wattenberg, 1973, 1983, 1985). Subsequently, a large number of studies have established that phenolic compounds/antioxidants including BHA are effective cancer preventive (chemopreventive) agents for carcinogenesis/tumorigenesis induced by a variety of carcinogens at numerous organ sites (Talalay et aL, 1978; King and McCay, 1983). Dietary administration of BHA also leads to the protection against various carcinogens, presumably through the induction of many

911

912 R. Hu et al.

phase II detoxifying enzymes such as epoxide hydrolases (Cha et al., 1978; Monroe and Eaton, 1987), glutathione S-transferases (GSTs) (Benson et al., 1978), and UDP- glucuronosyltransferases (UGT) (Moldeus et aL, 1982), as well as through the inhibition of cytochrome P-450 mono- oxygenase (Cummings and Prough, 1983). In contrast to its beneficial effects, BHA is also found to be toxic and even carcinogenic in some animal models, especially after higher doses. For example, BHA induced papilloma and carcinoma formation in the forestomachs of rats, mice, and hamsters when fed continuously at high doses (Ito et aL, 1983a; Clayson et aL, 1990). Chronic dietary administration of BHA also enhances the development of preneoplastic and neoplastic lesions in the rat kidney and urinary bladder (Nera et al., 1988; Peters et aL, 1996). Furthermore, BHA appears to have initiating activity in two-stage mouse skin carcinogenesis assay and in two- stage transformation of BALB/3T3 cells (Sakai et al., 1990). Most notably, BHA induced proliferative effects not only in rodent forestomachs but also in the esophagus of pigs and primates (Iverson et aL, 1985; Wurtzen and OIsen, 1986). Consistent with these results, we have previously shown that BHA and its metabolite, tBHQ, exerted a dose-dependent toxic effect (especially at high doses) in human hepatoma HepG2 cells, human cervical squamous carcinoma HeLa cells, as well as in primary cultured of rat hepatocutes (Yu et aL, 1997, 2000). Thus, this well known antioxidant can exert opposing biological effects, beneficial as well as toxic effects. Although both anti-carcinogenic and carcinogenic effects of BHA are well described, the precise mechanisms as to how these effects are derived remain obscure but probably are dose- and/or tissue-dependent.

Phase II detoxifying enzymes include NAD(P)H:quinone oxidoreductase (NQO), GSTs, ,(-glutamylcysteine synthetase (~,-GCS), heine oxygenase-1 (HO-1), UGTs, and epoxide hydrolases. These enzymes are capable of converting the reactive electrophiles to less toxic and more readily excretable products, thus protecting cells against various chemical stresses and mutagenesis and carcinogenesis induced by carcinogens (Benson et al., 1978; Prochaska et al., 1985; Wattenberg, 1985). Biochemical and genetic studies revealed that the induction of phase ~ detoxifying enzymes by various chemicals occurs at the transcriptional level and is regulated by a cis-acting regulatory element, defined as the antioxidant responsive element (ARE) or electrophile-responsive element (EpRE). This regulatory element was first detected in the 5'-flanking region of the rat and mouse GST-Ya subunit gene (Friling et aL, 1990; Rushmore and Pickett, 1990; Rushmore et aL, 1991) and human NQO-1 genes (Favreau and Pickett, 1991; Li and Jaiswal, 1992) and is also expected to be present in the promoters of epoxide hydrolase and UGT genes. Recent

studies from several laboratories showed that the basic leucine zipper (bZIP) transcription factors, including nuclear factor-E2-related factor 1 (Nrfl) (Venugopal and Jaiswal, 1996), Nrf2 (Venugopal and Jaiswal, 1996; Itoh et aL, 1997) and small Mafs (Itoh et al., 1997) were implicated in the binding to and transcriptional activation of the ARE sequences. In knock-out studies, the induction of QR and GST by BHA was largely eliminated in the liver and intestine of Nrf2-/- mice (Itoh et al., 1997), suggesting the critical role of Nrf2 in the regulation of ARE-mediated phase II genes induction by BHA. Furthermore, the transcriptional activation of the Nrf2/ARE signaling pathway by phase II enzyme inducers can also be modulated by several cellular signaling molecules such as protein kinase C (PKC), phophainositol-3-kinase (PI3K), RNA-dependant protein kinase-like endoplasmic reticulum kinase (PERK) and mitogen-activated protein kinase (MAPK) (Bloom and Jaiswal, 2003; Chen et aL, 2004; Cullinan et aL, 2004; Kraft et al., 2004).

MAPKs, which belong to the superfamily of serine/ threonine kinases, are evolutionadly conserved in all eukaryotes and play a central role in transducing various extracellular signals into the nuclei (Cobb and Goldsmith, 1995). A typical MAPK cascade consists of three kinases: an MAPK kinase kinase, which phosphorylates and activates an MAPK kinase, which, in turn, phosphorylates and activates MAPK (Marshall, 1994). Extracellular signal- regulated protein kinase (ERK) and c-Jun N-terminal kinase (JNK) are often responsive to different extracellular signals (Wu et aL, 1991; Kyriakis et al., 1994). In contrast, the p38 pathways are activated primarily by a diverse array of ceTlular stresses (Ichijo, 1999). However, they can also be activated by the same stimuli such as mitogenic signals, growth factors, oncogenic Ras (Logan et al., 1997; Vojtek and Der, 1998), stress signals, UV radiation, and oxidative stress (Guyton et al., 1996; Liu et al., 1996). We have previously shown that BHA and its metabolite t- BHQ activated MAPK in human hepatoma HepG2 and cervical squamous carcinoma HeLa cells, as well as in rat hepatocytes (Yu et al., 1997, 2000), and demonstrated a positive role of MAPK in the regulation of phase II genes by tBHQ. However, the in vivo activation of these kinases has not been examined, tn this study, we investigated the in vivo pharmacokinetics of BHA in mice, the in vivo MAPK activation as well as the induction of phase II drug enzymes and phase III drug transporters in mouse liver by BHA.

MATERIALS AND METHODS

Animals and drug treatments Swiss Webster mice were obtained from Hilltop

Laboratories (Wilmington, DE) and kept ad libitum with

Pharmacokinetics and Induction of Phase II/111 Genes by BHA 913

food (AIN 76A) and water and housed in the Rutgers University Animal Facilities. BHA and the internal standard 4-methoxyphenol were purchased from Sigma (St. Louis, MO). Methanol was HPLC grade from Fisher (Fair Lawn, N J). After acclimatization for 1 week, they were dosed by oral gavage with 200 mg/kg of BHA suspended in corn oil, or by intravenous (i.v.) bolus injection with 10 mg/kg BHA in 50% ethanol (Pharmaco Products, Brookfield, CT) and 50% sterile saline solution (Braun Medical, lrvine, CA). Four mice were randomly assigned to each group. At 0.5, 1, 2, 3, 4, 6, and 12 h after oral administration and at 5, 15, 30, 45 min, and 1, 1.5, 2, 3, 4, 6, and 12 h following i.v. dose, mice were sacrificed; plasma (both p.o. and i.v.) and liver (p.o. dose only) samples were obtained. The blood samples were placed in 0.5 ml heparinized micro-centrifuge tubes and the plasma were immediately separated from blood via centrifugation at 1,000 g (Eppendorf Centrifuge 5417R, Brinkmann Instruments Inc., Westbury, NY) for 5 min at 4~ and stored at -80~ until HPLC analyses. Liver samples were frozen in liquid nitrogen immediately and then stored in -80~ until further analyses.

HPLC assay BHA concentrations in plasma samples were deter-

mined using a validated reversed-phase HPLC method with UV detection. The Shimadzu HPLC system (SCL- 10A vp) consisted of a model FCV-10AL vp binary pump, a model SIL-10AD vp autosampler (a 250 ~L injector and a 100 ~LL loop) configured with a heater/cooler, and a model SPD-10AV vp UV-vis detector. The column and autosampler temperatures were kept at room temperature (21 + 1~ and 4~ respectively. The reversed phase chromatography was performed with a Shimadzu C-18 5 m column (4.6 mm i.d.) (Shimadzu, Columbia, MA), and the mobile phase was a gradient of methanol (solvent A) and 5% acetate in H20 (solvent B). The initial mobile phase was 40% solvent A. Between 0 and 10 min, the percentage of solvent B was increased linearly from 60% to 100%. Between 10 to 20 min, the composition was maintained at 100% solvent B. Between 20 to 22 min, the percentage of solvent B was decreased from 100% to 60%. Bwtween 22 to 30 min, the composition was maintained at 60% solvent B. The flow rate was 1.0 mL/ min and the injection volume was 50 ~.L. The UV detector was set at a single wavelength of 280 rim. The Class-VP software version 7.1.1 (Shimadzu) was used for instrument control and data analysis. Stock solutions of BHA and the internal standard (i.s.) 4-methoxyphenol were freshly prepared by dissolving a weighted amount of each compound in acetonitrile. The 0.5 mg/mL working solution of i.s. was prepared by diluting the stock solution with acetonitrile. Each blank plasma sample (60 ~.L) was

spiked with 3 pL of the i.s. solution, 3 pL of varying con- centrations of BHA, extracted with 200 ~.L ethyl acetate three times, the organic phase was then pooled and dried under nitrogen gas and dissolved in 60 p.L methanol, to prepare a series of standards (final concentrations of 50, 100, 250, 500, 1000, 2000, and 5000 ng/mL) for the calibration curve. Each plasma sample (60 t~L) from the pharmacokinetic studies was spiked with 3 p.L i.s. solution, followed by the same extraction method used for preparing the standards. The detection limit for BHA is 50 ng/mL. The active metabolite, tBHQ, was not detected in any of the plasma samples collected in this study.

Pharmacokinetic analysis BHA plasma concentration-versus-time data were

analyzed by noncompartmental method, performed by WinNonlin (v 2.1) (Pharsight, Mountain View, CA). The peak plasma concentration (Cmax) and the time to reach peak concentration (tmax) were determined directly from experimental observations. The area under the plasma concentration-time curve (AUC) was calculated by the log-linear trapezoidal method. The slope (k) of the terminal phase of concentration-time profile was determined by the log-linear regression of at least three data points. The value of k, determined from the terminal slope, was used to estimate the terminal half-life (tl~) by t~2 = 0.693/k. Following intravenous dosing, total body clearance (CL) was estimated by dividing the administered dose by the calculated AUC. The area under the first moment curve (AUMC) was used to calculate the apparent volume of distribution as follows: Vss = CL* (AUMC/AUC). The absolute oral bioavailability (F) of BHA was estimated from the ratios of dose-normalized AUC values (AUC/ dose) following oral administration over that obtained following intravenous administration.

MAPK Assay The mouse liver samples were crushed into powder

with a mortar and pestle. Following evaporation of most of the nitrogen, powdered tissues were lysed with lysis buffer (10 mM Tris-HCI, pH 7.4, 50 mM sodium chloride, 30 mM sodium pyrophosphate, 50 mM sodium fluoride, 100 mM sodium orthovanadate, 2 mM iodoacetic acid, 5 mM ZnCI2, 1 mM phenylmethylsulfonyl fluoride, and 0.5% Triton-X 100). The lysate was homogenized by passing through a 23 G needle three time, sonicating t0 sec, and kept in ice for 30 min. The homogenate was centrifuged at 13,000 rpm for 15 min at 4~ The supernatant was transferred into a clean tube and stored in -80~ The protein concentration of the whole lysates was determined by Bio-Rad protein assay kit. Equal amount of protein was mixed with 4 • loading buffer, and pre-heated at 95~ for 3 min. The samples were then loaded on a 10% mini

914 R. Hu et aL

SDS-polyacrylamide gel, and ran at 200 V. The proteins were then transferred onto a PVDF membrane for 1.5 h using semi-dry transfer system (Fisher). The membrane was blocked in 5% bovine serum albumin (BSA) solution for 1 h at room temperature, then incubated overnight at 4~ with each of the three anti-phospho-MAPK primary antibodies (1:1,000 dilution, New England Biolabs, Inc., Beverly, MA), which specifically recognized phosphorylated ERKI/2 (Thr202fl'yr204), JNK 1/2 (Thr183Fryr185), or p38 (Thr180Fryr182). After hybridization with primary antibody, membrane was washed with TBST (Tris buffered-saline Tween-20) for three times, then incubated with HRP (Horseradish Peroxidase)-conjugated secondary antibody (1:10,000 dilution, Santa Cruz Biotechnology, Inc., Santa Cruz, CA) for 45 min at room temperature and washed with TBST three times. Final detection was performed with ECL (Enhanced Chemiluminescence) Western blotting reagents (Amersham Pharmacia Biotech., Piscataway, N J).

Quantitative real time PCR (Q-RT-PCR) A total number of 9 genes were examined, including 5

phase II genes and 4 phase III genes (Table I). Total RNA was purified from mouse liver with the RNeasy Mini kit (Qiagen, Valencia, CA) after isolation with TRIzol reagent (Life Technologies, Inc., Grand Island, NY) according to the manufacturer's instructions. Total RNA was quantitated and checked for integrity on a 1% formaldehyde-agarose gel. First-strand cDNA was synthesized from total RNA using the Superscript II reverse transcriptase (Invitrogen, Carlsbad, CA) with oligo-dT primers. The PCR reactions were carded out using 10 ng of cDNA, 50 nM of each primer, and SYBR Green master mix (Applied Biosystems, Foster City CA) in 10 pL reactions. Levels of Q-RT-PCR product were measured using SYBR Green fluorescence collected during real-time PCR on an Applied Biosystems PRISM 7900HT Sequence Detection System. A control

Table I. 01igonucleotide primers used for real-time PCR. The nucleotide sequences of the respective up- and downstream primers are indicated

Genes 5' Primers 3' Primers

NQ01 AGCCCAGATATTGTGGCCG GSTpi TGGGCATCTGAAGCCTTTTG HO-1 TGCCCCACTCTACTTCCCTG UGT1A6 GGCGCTACACCGGAACTAGA ~/-GCS TCCAGGTGACATTCCAAGCC MRP1 AGACAGCATTGAGCGGAGGT MRP2 CGTGGCTGTTGAGCGAATAA Slco2bl GCCCACCATAGCAACTCACC Slcolb2 ACCATCTTCCA1TICCGGTTT GAPDH CACCAACTGCTTAGCCCCC

CCTTTCAGAATGGCTGGCAC CCAGCAAGFIGTAATCGGCAA

TGCAAGGGATGA'rTI'CCTGC TGCCCGAGTCTTTGGATGAC AGATGCAGCACTCAAAGCCA TCAGTGTGGGAGGTTCACCC TCTCACCTTTTTTGGGCCAAT AGGCGTAGCATGAGGCTACC TTGGTCGGTGTAGCTTGGATC TCTTCTGGGTGGCAGTGATG

cDNA dilution series was created for each gene to establish a standard curve. Each reaction was subjected to melting point analysis to confirm single amplified product. The data generated from each PCR were analyzed using SDS 2.0 software (Applied Biosystems).

RESULTS

Pharmacokinetic analysis In the mice the averaged plasma concentration versus

time profiles for BHA following the i.v. (10 mglkg) and oral (200 mg/kg) administrations are shown in Fig. 1. Following the oral administration, BHA concentrations could be determined over the 12 h period. However, after i.v. admi- nistration, BHA concentrations were below the limit of detection after 4 h. Noncompartmental analysis estimated a tin of 0.8 h, an AUC of 580 ngfmL*h, CL of 17.2 L/h/kg, and Vss of 43.3 L/kg (Table II). After oral administration, the plasma concentration peaked at 2,095 ng/mL at 1 h. Noncompartmental analysis estimated a t1~2 of 2 h, and calculated an AUC of 4,968 ngtmL*h (Table tl). To estimate the oral availability (F) after oral dosing, the normalized

2 5 0 0

~ 2000 = 1 5 0 0 O

1 0 0 0

U o 5 0 0

[-:p~ i v

0 ~ ' - ~ J ~ q -L ~ ~ - - - , - ~ - - �9 . . . . .

0 2 4 6 8 10 12 14

Time (h)

Fig. 1. Plasma concentration versus time profile of BHA following intravenous administration of 10 mg/kg and oral administration of 200 mg/kg to mice. Each point represents the mean + S.D. of 4 mice.

Table II. Pharmacokinetic variables. Results of noncompartmental modeling of plasma BHA concentration versus time data in the mice given i.v. or p,o, doses of BHA

Species Mouse

Route i.v. Dose (mg/kg) 10 Cmax (ng/mL) 1040 Tmax (h) tl/2 (h) 0.8 AUC (h*ng/mL) 580 CL (L/h/kg) 17.2 Vss (L/kg) 43.3 F(%)

p,o,

200 2095

1 2

4968

42.6

Pharmacokinetics and induction of Phase II/lll Genes by BHA 915

AUC (AUC/dose) value after the oral dose was divided by the normalized AUC (AUC/dose) value after the i.v. doses. The F value for BHA was 42% in the mice.

Gene express ion induced by B H A To examine the gene expression induced by BHA in the

mouse liver, real-time PCR experiments utilizing specific primer pairs for the genes of interest were carried out. As shown in Fig. 2A, phase II drug metabolizing genes such as NQO-1, HO-1, y-GCS, GST-pi and UGT-1A6 were induced time dependently after treatments with 200 mg/kg BHA in the mouse liver. The gene expression patterns

were somehow different with different kinetics of induction (Fig. 2A). With respect to the three genes shown on the left panel of Fig. 2A (NQO-1, HO-1 and y-GCS), they were up-regulated at relatively late time points (6-12 h), whereas the two genes on the right panel of Fig. 2A (GST-pi and UGT-1A6), they were up-regulated at earlier time points (1-3 h). This suggests that their potential different modes of regulation.

We next examined the effects of BHA on some of the phase III drug transporter genes. As shown in Fig. 2B, multidrug resistance protein 1 (MRP1) or ABCC1 (ATP- binding cassette, sub-family C, member 1) was induced

A 12 NQOI ,oi i ! 6 A GST PI

~me (h) ~s 1 ..T--

10 I HO-I 0 - , =: i

i ~ ~ i ctd 0.5 1 2 3 4 6 12

, ! ~ u~ 2

o - - - 4 I U G T I . ~

ctd 0.5 1 2 3 4 6 12 /

Time (hr) " I

5 ~ ganana_GCS 2

3 0 ~ - ,-

i ' i l l " _ = "" 0 -- -+ r F I T --1 ctd 0.5 1 2 3 4 6 12

Time (h)

B MRP1 2.5 S l c o l b 2 5

,dh 2 ctd 0.5 1 2 3 4 6 12 ctd 0.5 1 2 3 4 6 12

Time (h) Time (h)

Fig. 2. Activation of some phase II and transporter genes by BHA in mouse liver. Gene expression levels were measured by real-time PCR and normalized against control as fold induction. (A) time-dependent activation of phase II genes; (B) time-dependent activation of transporter genes. Bars, SD of triplicate data points.

916 R. Hu et al.

by BHA in the liver starting at 3 h and peaked at 4 h. For the solute carrier organic anion transporter family-lb2 (Slcolb2) gene, it was induced by BHA at 3 h. The induction patterns of both MRP1 and SIcolb2 appear to be similar kinetically as GST-pl and UGT1A6 (Fig. 2A- right panel). We had also examined the transcript levels of MRP2 and Slco2bl and found that their transcript levels were not changed by BHA treatments in the duration of this study (data not shown).

M A P K a c t i v a t i o n

To investigate the potential signal transduction events induced by BHA that could contribute to its induction of various genes including phase II enzymes, we studied the activation of MAPK pathway with pooled mouse liver samples. We found that the oral treatments of BHA resulted in a time-dependent phosphorylation and activation of all three major MAPKs, JNK, ERK and p38 in the mouse livers. Activation of JNK was evident as early as 30 min after 200 mg/kg BHA treatment and persisted for the duration of the experiment (Fig. 3). Phosphorylation of ERK was detected at only 3 h after the BHA treatment, while p38 activation was observed between 2 to 4 h and peaked at 3 h. These results showed for the first time in the mouse liver that BHA activated all three MAPKs and activation of JNK by BHA was rapid and persistent, whereas activations of ERK and p38 were relatively delayed and transient. This result suggests that in the in vivo mouse liver, the MAPK pathway may play an important role in the early signal transduction event leading to the transcriptional activation of many genes including ARE- mediated phase II genes expression, analogous to the in vitro cell lines situation (Yu et al., 1999).

ctrl 0.5h lh 2h 3h 4h 6h 12h

: p-JNK

| ].~J J! Ill!Jill ] - , _ _'~ii ~ ' J N K

p-ERK

" ERK

. p-p38

4 1 1 1 D i l m ~ ~ JIO I ~ ~ . p38

Fig. 3. Activation of MAPKs (ERK, JNK and p38) in mouse liver after BHA treatment. The data shown are representative blots of four mouse liver samples per time point.

D I S C U S S I O N

BHA and its metabolite tBHQ were first reported to reduce the incidence of tumors in rodents (Wattenberg, 1973, 1983, 1985). Subsequently, many other studies have also found that phenolic compounds/antioxidants including BHA are effective cancer preventive (chemopreventive) agents against for carcinogenesis/tumorigenesis induced by a variety of carcinogens at many organ sites (Talalay et aL, 1978; King and McCay, 1983)including colon cancer model induced by methylazoxymethanol acetate in female CF1 mice (Reddy and Maeura, 1984). BHA significantly reduced the genotoxic effects, such as the frequency of 6- thioguanidine resistant mutations and micronuclei, induced by N-methyI-N9-nitro-N-nitrosoguanidine (MNNG) in Chinese hamster V79 cells (Horvathova et aL, 1999). BHA also induced apoptosis by oxidative stress in neurons (Ratan et al., 1994) and human monocytes and macro- phages (Hayashi et al., 1997). In contrast to the beneficial effects of BHA in animals or cultured cells, adverse effects have also been reported. At the dose of 0.5 or 2% (w/w) in the diet, BHA induced papillomas and squamous cell carcinoma in the forestomach of rodents (Ito et aL, 1983a; Ito et aL, 1983b). At doses that induce phase II detoxifying enzymes, 15-60 I~M, it induced apoptosis in human colon carcinoma cells (Kirlin et al., 1999). Cytotoxic effects have been observed in human dermal fibroblasts, keratinocytes, melanocytes, and melanoma tumor cells (Babich and Borenfreund, 1990). Its cytotoxicity in rat hepatocytes was attributed to the induction of apoptosis through a molecular mechanism of direct release of cytochrome C and sub- sequent activation of caspases (Yu et al., 2000). These beneficial effects versus adverse effects of BHA might be dependent on its concentrations and or on the nature of cells or tissues.

Detailed pharmacokinetics analysis of BHA in mice is not our primary objective, since some of these findings had been previously reported by other investigators (Taylor et al., 1984; Verhagen et aL, 1989; Vora et aL, 1999). Our goal here is to selectively quantify the plasma concentrations profiles after different routes of administra- tion, so that we can compare the in vivo plasma concen- trations to that of in vitro cell culture concentrations. The peak plasma concentration of BHA achieved in our current study after oral administration was around 2 ~g/mL, which can be converted to approximately 10 pM. The peak in vivo concentrations of BHA offers some insights for the numerous in vitro cell culture studies, where between 10 to 500 ~M BHA were used for various signal transduction studies as well as phase II gene induction studies. In addition, it has been previously reported that the AUC in the rat liver was 49 times higher than that observed in plasma (Della Corte et aL, 1989). The oral bioavailability

Pharmacokinetics and Induction of Phase II/111 Genes by BHA 917

of BHA was 42.8% in the mice. The relatively low bio- availability could be potential due to poor oral absorption. In addition, the calculation of oral bioavailability was based on the concentrations of the parent compound, without including its potential metabolites such as tBHQ.

Since BHA was introduced as a food preservative in the 1960s, it has attracted a lot of attention and debate because of its potential beneficial as well as adverse effects on the potential health of humans. Although extensive studies have been conducted to define the biological activities of BHA in many animal model systems and in humans, the mechanisms of action of BHA are not fully understood. It has been shown to be potent cancer chemopreventive agent (Wattenberg, 1973, 1983; Benson et aL, 1978; King and McCay, 1983) and it is a potent inducer of phase II detoxifying enzymes in animals (Benson et al., 1978; Lam et al., 1980; Sparnins et aL, 1982a, 1982b). In addition, we have previously shown that BHA and its metabolite tBHQ strongly stimulated MAPK cascades (ERK and JNK) in human HepG2, and HeLa cells (Yu et aL, 1997), and demonstrated the possible involvement of MAPK pathway in the induction of phase II enzymes by tBHQ (Yu et al., 1999). The potential role of ERK and JNK in the expression of MRP1 gene were suggested by previously studies (Cripe et aL, 2002; Guan et aL, 2004).

In our current study, we showed that certain phase I1 genes were induced by the treatment of BHA in the mouse liver, and they followed two kinetic expression patterns. GST-pi and UGT-1A6 were up-regulated shortly after BHA administration and peaked around 2-3 h, whereas NQO-1, HO-1 and 7-GCS were up-regulated at relatively later time points between 6 to 12 h. This may be due to the differences in the requirement of transcription factors such as Fos, Jun, Nrf2 and others (Kong et al., 2001). We showed that the phase III drug transporter genes including MRP-1 and Slcolb2 were induced by the treatment of BHA in the mouse liver with earlier kinetics similar to that of GST-pl and UGT1A6. We have also demonstrated for the first time that BHA activates the important signaling kinases, ERK, JNK and p38 in vivo mouse liver. The activation of ERK was a little delayed and transient, similar to that reported previously for some growth factors (Wood et al., 1992; Ohmichi et al., 1994). In contrast, JNK activation was relatively early and sustained, following a pattern similar to that shown by many stress stimuli, such as UV C (Chen et al., 1996), protein synthesis inhibitors (Cano et al., 1994), and arsenite (Liu et aL, 1996). The phase II and phase III tranporter mRNA levels somewhat correlated with and followed the changes of the MAPK activities, which might suggest a potential role of MAPK pathway in the activa- tion of these genes in vivo obviously working in concert

with the pivotal Nrf2 transcription factor (Shen et al., 2004). To acertain the role of MAPK in the induction of phase II and phase III transporter genes and explore the involvement of additional and/or alternative signaling pathways in vivo, further studies involving knockout mice would be needed.

In summary, our current study shows that BHA has relatively poor oral bioavailability in the mice (~43%), with a terminal t~/2 of 0.8 and 2 h for i.v. and oral administration in the mice. The CL values after the i.v. administration of BHA was 17.2 L/h/kg; and the Vss of 43.3 L/kg for mice. Despite its relatively low bioavailability, the peak plasma concentration after oral dosing reached about 2 pg/mL (10 pM)in the mice. Additionally, in the target tissue (such as the liver, although not measured in our current study), the concentrations of BHA could be higher than that of the plasma, and therefore would explain some of the pharma- cological effects such as activation of MAPK and induc- tion of phase II drug metabolizing and phase III drug transporter genes expression between the in vitro cell line studies and in vivo animal models. To our knowledge, this is the first study to demonstrate this in vivo pharmacokine- tics of BHA, in vivo activation of MAPK signaling proteins, as well as the in vivo induction of Phase II/111 drug metabolizing enzymes/transporters in the mouse livers.

ACKNOWLEDGEMENTS

Supported in part by grant R01-CA094828 from the National Institutes of Health (NIH).

REFERENCES

Babich, H. and Borenfreund, E., Cytotoxic effects of food additives and pharmaceuticals on cells in culture as determined with the neutral red assay. J. Pharm. Sci., 79, 592-594 (1990).

Benson, A. M., Batzinger, R. P., Ou, S. Y., Bueding, E., Cha, Y. N., and Talalay, P., Elevation of hepatic glutathione S- transferase activities and protection against mutagenic metabolites of benzo(a)pyrene by dietary antioxidants. Cancer Res., 38, 4486-4495 (1978).

Bloom, D. A. and Jaiswal, A. K., Phosphorylation of Nrf2 at Ser40 by protein kinase C in response to antioxidants leads to the release of Nrf2 from INrf2, but is not required for Nrf2 stabilization/accumulation in the nucleus and transcriptional activation of antioxidant response element-mediated NAD (P)H:quinone oxidoreductase-1 gene expression. J. Biol. Chem., 278, 4467544682 (2003).

Brekke, O. L., Shalaby, M. R., Sundan, A., Espevik, T., and Bjerve, K. S., Butylated hydroxyanisole specifically inhibits tumor necrosis factor-induced cytotoxicity and growth enhancement. Cytokine, 4, 269-280 (1992).

918 R. Hu et al.

Cano, E., Hazz.alin, C. A., and Mahadevan, L. C., Anisomycin- activated protein kinases p45 and p55 but not mitogen- activated protein kinases ERK-1 and -2 are implicated in the induction of c-fos and c-jun. Mol. Cell. Biol., 14, 7352-7362 (1994).

Cha, Y. N., Martz, F., and Bueding, E., Enhancement of liver microsome epoxide hydratase activity in rodents by treatment with 2(3)-tert-butyl-4-hydroxyanisole. Cancer Res., 38, 4496-4498 (1978).

Chen, C., Pung, D., Leong, V., Hebbar, V., Shen, G, Nair, S, Li, W., and Kong, A. N., Induction of detoxifying enzymes by garlic organosulfur compounds through transcription factor Nrf2: effect of chemical structure and stress signals. Free Radic. Biol. Med., 37, 1578-1590 (2004).

Chert, Y. R., Wang, X., Templeton, D., Davis, R. J., and Tan, T. H., The role of c-Jun N-terminal kinase (JNK) in apoptosis induced by ultraviolet C and gamma radiation. Duration of JNK activation may determine cell death and proliferation. J. Biol. Chem., 271,31929-31936 (1996).

Clayson, D. B., Iverson, E, Nera, E. A., and Lok, E., The significance of induced forestomach tumors. Annu. Rev. Pharmacol. Toxicol., 30,441.463 (1990).

Cobb, M. H. and Goldsmith, E. J., How MAP kinases are regulated. J. Biol. Chem., 270, 14843-14846 (1995).

Cripe, L. D., Gelfanov, V. M., Smith, E. A., Spigel, D. R., Phillips, C. A., Gabig, T. G, Jung, S. H., Fyffe, J., Hartman, A. D., Kneebone, P., Mercola, D., Burgess, G S., and Boswell, H. S., Role for c-jun N-terminal kinase in treatment-refractory acute myeloid leukemia (AML): signaling to multidrug-efflux and hyperproliferation. Leukemia, 16, 799-812 (2002).

Cullinan, S. B., Gordan, J. D., Jin, J., Harper, J. W., and Diehl, J. A., The Keapl-BTB protein is an adaptor that bridges Nff2 to a Cul3-based E3 ligase: oxidative stress sensing by a Cul3- Keapl Iigase. Mot. Celt Biol., 24, 8477-8486 (2004).

Cummings, S. W. and Prough, R. A., Butylated hydroxyanisole- stimulated NADPH oxidase activity in rat liver microsomal fractions. J. Biol. Chem., 258, 12315-12319 (1983).

Della Corte, L., Bianchi, L., Valoti, M., and Sgaragli, G, Distribu- tion and peroxidative oxidation of 2-t-butyl-4-methoxyphenol in rat tissues after a single intraperitoneal dose. J. Biochem. Toxicol., 4, 147-150 (1989).

Favreau, L. V. and Pickett, C. B., Transcriptional regulation of the rat NAD(P)H:quinone reductase gene. Identification of regulatory elements controlling basal level expression and inducible expression by planar aromatic compounds and phenolic antioxidants. J. Biol. Chem., 266, 4556.4561 (1991).

Friling, R. S., Bensimon, A., Tichauer, Y., and Daniel, V., Xenobiotic-inducible expression of murine glutathione S- transferase Ya subunit gene is controlled by an electrophile- responsive element. Proc. Natl. Acad. ScL U.S.A., 87, 6258- 6262 (1990).

Guan, J., Chen, X. P., Zhu, H., Luo, S. F., Cao, B., and Ding, L., Involvement of extracellular signal-regulated kinase/mitogen-

activated protein kinase pathway in multidrug resistance induced by HBx in hepatoma cell line. WorldJ. Gastroenterol., 10, 3522-3527 (2004).

Guyton, K. Z., Liu, Y., Gorospe, M., Xu, Q., and Holbrook, N. J., Activation of mitogen-activated protein kinase by H202. Rote in cell survival following oxidant injury. J. Biol. Chem., 271, 4138.4142 (1996).

Hayashi, T., Catanzaro, A., and Rao, S. P., Apoptosis of human monocytes and macrophages by Mycobacterium avium sonicate. Infect. Immun., 65, 5262-5271 (1997).

Horvathova, E., Slamenova, D., Bonatti, S., and Abbondandolo, A., Reduction of genotoxic effects of MNNG by butylated hydroxyanisole. Neoplasma, 46, 356-362 (1999).

Ichijo, H., From receptors to stress-activated MAP kinases. Oncogene, 18, 6087-6093 (1999).

Ito, N., Fukushima, S., Hagiwara, A., Shibata, M., and Ogiso, T., Carcinogenicity of butylated hydroxyanisole in F344 rats. J. Natl. Cancer. Inst., 70, 343-352 (1983a).

Ito, N., Fukushima, S., Imaida, K., Sakata, T., and Masui, T., Induction of papilloma in the forestomach of hamsters by butylated hydroxyanisole. Gann., 74,459.461 (1983b).

Itoh, K., Chiba, T., Takahashi, S., Ishii, T., Igarashi, K., Katoh, Y., Oyake, T., Hayashi, N., Satoh, K., Hatayama, I., Yamamoto, M., and Nabeshima, Y., An Nrf2/small Maf heterodimer mediates the induction of phase II detoxifying enzyme genes through antioxidant response elements. Biochem. Biophys. Res. Commun., 236, 313-322 (1997).

Iverson, E, Truelove, J., Nera, E., Wong, J., Lok, E., and Clayson, D. B., An 85-day study of butylated hydroxyanisole in the cynomolgus monkey. Cancer. Lett., 26, 43-50 (1985).

Kahl, R., Synthetic antioxidants: biochemical actions and interference with radiation, toxic compounds, chemical mutagens and chemical carcinogens. Toxicology, 33, 185- 228 (1984).

King, M. M. and McCay, P. B., Modulation of tumor incidence and possible mechanisms of inhibition of mammary carcinogenesis by dietary antioxidants. Cancer. Res., 43, 2485s-2490s (1983).

Kirlin, W. G, Cai, J., DeLong, M. J., Patten, E. J., and Jones, D. P., Dietary compounds that induce cancer preventive phase 2 enzymes activate apoptosis at comparable doses in HT29 colon carcinoma cells. J. Nutr., 129, 1827-1835 (1999).

Kong, A. N., Owuor, E., Yu, R., Hebbar, V., Chert, C., Hu, R., and Mandlekar, S., Induction of xenobiotic enzymes by the MAP kinase pathway and the antioxidant or electrophile response element (ARE/EpRE). Drug. Metab. Rev., 33, 255- 271 (2001).

Kraft, A. D., Johnson, D. A., and Johnson, J. A., Nuclear factor E2-related factor 2-dependent antioxidant response element activation by tert-butylhydroquinone and sulforaphane occurring preferentially in astrocytes conditions neurons against oxidative insult. J. Neurosci., 24, 1101-1112 (2004).

Kyriakis, J. M., Banerjee, P., Nikolakaki, E, Dai, T., Ruble, E. A.,

Pharmacokinetics and Induction of Phase II/111 Genes by BHA 919

Ahmad, M. E, Avruch, J., and Woodgett, J. R., The stress- activated protein kinase subfamily of c-Jun kinases. Nature, 369, 156-160 (1994).

Lam, L. K., Fladmoe, A. V., Hochalter, J. B., and Wattenberg, L. W., Short time interval effects of butylated hydroxyanisole on the metabolism of benzo(a)pyrene. Cancer. Res., 40, 2824- 2828 (1980).

Li, Y. and Jaiswal, A. K., Regulation of human NAD(P)H:quinone oxidoreductase gene. Role of AP1 binding site contained within human antioxidant response element. J. BioL Chem., 267, 15097-15104 (1992).

Liu, Y., Guyton, K. Z., Gorospe, M, Xu, Q., Lee, J. C., and Holbrook, N. J., Differential activation of ERK, JNK/SAPK and P38/CSBP/RK map kinase family members during the cellular response to arsenite. Free Radic. Biol. Med., 21,771- 781 (1996).

Logan, S. K., Falasca, M., Hu, P., and Schlessinger, J., Phosphatidylinositol 3-kinase mediates epidermal growth factor-induced activation of the c-Jun N-terminal kinase signaling pathway. Mol. Cell BioL, 17, 5784-5790 (1997).

Marshall, C. J., MAP kinase kinase kinase, MAP kinase kinase and MAP kinase. Curr. Opin. Genet Dev., 4, 82-89 (1994).

Moldeus, P., Dock, L., Cha, Y. N., Berggren, M., and Jernstrom, B., Elevation of conjugation capacity in isolated hepatocytes from BHA-treated mice. Biochem. Pharmacol., 31, 1907- 1910 (1982).

Monroe, D. H. and Eaton, D. L., Comparative effects of butylated hydroxyanisole on hepatic in vivo DNA binding and in vitro biotransformation of afiatoxin B1 in the rat and mouse. Toxicol Appl Pharmacol, 90, 401-409 (1987 ).

Nera, E. A., Iverson, E, Lok, E., Armstrong, C. L., Karpinski, K., and Clayson, D. B., A carcinogenesis reversibility study of the effects of butylated hydroxyanisole on the forestomach and urinary bladder in male Fischer 344 rats. Toxicology, 53, 251-268 (1988).

Ohmichi, M., Sawada, T., Kanda, Y., Koike, K., Hirota, K., Miyake, A., and Saltiel, A. R., Thyrotropin-releasing hormone stimulates MAP kinase activity in GH3 cells by divergent pathways. Evidence of a role for early tyrosine phosphorylation. J. BioL Chem., 269, 3783-3788 (1994).

Peters, M. M., Rivera, M. I., Jones, T. W., Monks, T. J., and Lau, S. S., Glutathione conjugates of tert-butyl-hydroquinone, a metabotite of the urinary tract tumor promoter 3-tert-butyl- hydroxyanisole, are toxic to kidney and bladder. Cancer, Res., 56, 1006-1011 (1996).

Prochaska, H. J., De Long, M. J., and Talalay, P., On the mechanisms of induction of cancer-protective enzymes: a unifying proposal. Proc. Natl. Acad. Sci U.S.A., 82, 8232- 8236 (1985).

Ratan, R. R., Murphy, T. H., and Baraban, J. M., Oxidative stress induces apoptosis in embryonic cortical neurons. J. Neurochem., 62,376-379 (1994).

Reddy, B. S. and Maeura, Y., Dose-response studies of the

effect of dietary butylated hydroxyanisole on colon carcinogenesis induced by methylazoxymethanol acetate in female CF1 mice. J. Natl. Cancer. Inst., 72, 1181-1187 (1984).

Rehwoldt, R., Tracking the use of antioxidants through industry surveys. Food Chem. Toxicol., 24, 1039-1041 (1986).

Rushmore, T. H. and Pickett, C. B., Transcriptional regulation of the rat glutathione S-transferase Ya subunit gene. Character- ization of a xenobiotic-responsive element controlling inducible expression by phenolic antioxidants. J. Biol. Chem., 265, 14648-14653 (1990).

Rushmore, T. H., Morton, M. R., and Pickett, C. B., The antioxidant responsive element. Activation by oxidative stress and identification of the DNA consensus sequence required for functional activity. J. Biol. Chem., 266, 11632- 11639 (1991).

Sakai, A., Miyata, N., and Takahashi, A., Initiating activity of 3- tert-butyl-4-hydroxyanisole (3-BHA) and its metabolites in two-stage transformation of BALB/3T3 cells. Carcinogenesis, 11, 1985-1988 (1990).

Shen, G, Hebbar, V., Nair, S., Xu, C., Li, W., Lin, W., Keum, Y. S., Han, J., Gallo, M. A., and Kong, A. N., Regulation of Nrf2 transactivation domain activity. The differential effects of mitogen-activated protein kinase cascades and synergistic stimulatory effect of Raf and CREB-binding protein. J. BioL Chem., 279, 23052-23060 (2004).

Sparnins, V. L., Chuan, J., and Wattenberg, L. W., Enhance- ment of glutathione S-transferase activity of the esophagus by phenols, lactones, and benzyl isothiocyanate. Cancer. Res., 42, 1205-1207 (1982a).

Spamins, V. L., Venegas, P. L., and Wattenberg, L W., Glutathione S-transferase activity: enhancement by compounds inhibiting chemical carcinogenesis and by dietary constituents. J. Natl. Cancer. Inst., 68, 493-496 (1982b).

Talalay, P., Batzinger, R. P., Benson, A. M., Bueding, E., and Cha, Y. N., Biochemical studies on the mechanisms by which dietary antioxidants suppress mutagenic activity. Adv. Enzyme. Regul., 17, 23-36 (1978).

Taylor, M. J., Sharma, R. P., and Bourcier, D. R., Tissue distribu- tion and pharmacokinetics of 3H-butylated hydroxyanisole in female mice. Agents Actions, 15, 454-458 (1984).

Venugopal, R. and Jaiswal, A. K., Nrfl and Nrf2 positively and c-Fos and Fral negatively regulate the human antioxidant response element-mediated expression of NAD(P)H:quinone oxidoreductasel gene. Proc. Natl. Acad. Sci. U.S.A., 93, 14960-14965 (1996).

Vercammen, D., Beyaert, R., Denecker, G, Goossens, V., Van Loo, G, Declercq, W., Grooten, J., Fiers, W., and Vandenabeele, P., Inhibition of caspases increases the sensitivity of L929 cells to necrosis mediated by tumor necrosis factor. J. Exp. Med., 187, 1477-1485 (1998).

Verhagen, H., Beckers, H. H., Comuth, P. A., Maas, L. M., ten Hoor, E, Henderson, P. T., and Kleinjans, J. C., Disposition of

920 R. Hu et aL

single oral doses of butylated hydroxytoluene in man and rat. Food Chem. Toxicol., 27, 765-772 (1989).

Vojtek, A. B. and Der, C. J., Increasing complexity of the Ras signaling pathway. J. Biol. Chem., 273, 19925-19928 (1998).

Vora, J., Wu, Z., Montague, M., Penn, M., and Erow, K., Influence of dosing vehicles on the preclinical pharmacokinetics of phenolic antioxidants. Res. Commun. Mol. Pathol. Pharmacol., 104, 93-106 (1999).

Wattenberg, L. W., Inhibition of chemical carcinogen-induced pulmonary neoplasia by butylated hydroxyanisole. J. Natl. Cancer. Inst., 50, 1541-1544 (1973).

Wattenberg, L. W., Inhibition of neoplasia by minor dietary constituents. Cancer. Res., 43, 2448s-2453s (1983).

Wattenberg, L. W., Chemoprevention of cancer. Cancer. Res., 45, 1-8 (1985).

Wood, K. W., Sarnecki, C., Roberts, T. M., and Blenis, J., ras mediates nerve growth factor receptor modulation of three signal-transducing protein kinases: MAP kinase, Raf-1, and RSK. Cell, 68, 1041-1050 (1992).

Wu, J., Rossomando, A. J., Her, J. H., Del Vecchio, R., Weber,

M. J., and Sturgill, T. W., Autophosphorylation in vitro of recombinant 42-kilodalton mitogen-activated protein kinase on tyrosine. Proc. Natl. Acad. ScL U.S.A., 88, 9508-9512 (1991).

Wurtzen, G and Olsen, P., BHA study in pigs. Food Chem. Toxicol., 24, 1229-1233 (1986).

Yu, R., Tan, T. H., and Kong, A. T., Butylated hydroxyanisole and its metabolite tert-butylhydroquinone differentially regulate mitogen-activated protein kinases. The role of oxidative stress in the activation of mitogen-activated protein kinases by phenolic antioxidants. J. BioL Chem., 272, 28962- 28970 (1997).

Yu, R., Mandlekar, S., and Kong, A. T., Molecular mechanisms of butylated hydroxylanisole-induced toxicity: induction of apoptosis through direct release of cytochrome c. Mol. Pharmacol., 58,431-437 (2000).

Yu, R., Lei, W., Mandlekar, S., Weber, M J., Der, C. J., Wu, J., and Kong, A. T., Role of a mitogen-activated protein kinase pathway in the induction of phase II detoxifying enzymes by chemicals. J. Biol. Chem., 274, 27545-27552 (1999).