Regulation of DNA Replication Initiation in a Baculovirus, AcMNPV

Yuntao Wu

A thesis submitted to the Depamnent of Microbiology and Immunology in conformity with the requirements for the degree of

Doctor of Philosophy

Queen ' s University Kingston, Ontario, Canada

February, 1998

copyright@ Yuntao Wu, 1998

National Library I*! of Canada Bibliothèque nationale du Canada

Acquisitions and Acquisitions et Bibliographie Services services bibliographiques

395 Wellington Street 395. nie Wellington OttawaON K1AON4 Ottawa ON K1A ON4 Canada Canada

The author has granted a aon- exclusive licence allowing the National Library of Canada to reproduce, loan, distribute or sell copies of this thesis in microform, paper or electronic formats.

The author retains ownership of the copyright in this thesis. Neither the thesis nor substantial extracts fiom it may be printed or otherwise reproduced without the author's permission.

L'auteur a accordé une licence non exclusive permettant à la Bibliothèque nationale du Canada de reproduire, prêter, distribuer ou vendre des copies de cette thèse sous la forme de microfichelfih, de reproduction sur papier ou sur format électronique.

L'auteur conserve la propriété du droit d'auteur qui protège cette thèse. Ni la thèse ni des extraits substantiels de celle-ci ne doivent être imprimés ou autrement reproduits sans son autorisation.

QUEEN'S UNIVERSITY AT KINGSTON

SCHOOL OF GRADUATE STUDIES AND RESEARCH

PERMISSION OF CO-AUTHOR(S)

I/we, the undersigned, hereby grant permission to microfilm any materiai designated as being co-authored by melus in the thesis copyrighted to the person named below:

Name of Copyrighted Author Signature of copyrighted author

ABSTRACT

Homologous regions (hrs) of Aitrographa californica multicapsid nuclearpolyhe-

drovims (AcMNPV) may funcrion as ongins of viral DNA replication. To determine the

role of hrs in the replication process, plasrnids containing specific deletions of various hrs

were generated and tested in a standardized, plasmid-based replication assay. Deletion of

hr2 and hr5 abolished the ability of plasmids to replicate in the infected cells, while

deletion of h r l . hr3 and hr4a did not, suggesting that hrs were not unique sequences

possessing the ability to support plasmid DNA replication in the infected cells. Plasmids

carrying the complete ie-2 and pe38 genes. the ie-l gene upsueam region or a variety of

baculovirus early genes were also able to replicate in vims infected cells. Thus, certain

sequences within viral early genes could also function as putative origins of replication.

The iti vivo effects of hr deletions were firther invesagated to detect whether any h r was

essential or important for the replication of baculovinis. Six groups of recombinant vinises

carrying deletions in either hr 1. hrla, hR, hr3, hr4a. hr4b were consmicted. Each of these

recombinant viruses replicated normally in cultured cells, as judged by the production of

progeny vinons, even though levels of products of viral early genes such as ie-1, p M 3 ,

lef-3 orp47 were changed. These data indicated that individually none of the hrs was

essential for the viral replication.

In contrast to DNA replication in the vims infected cells, plasmids in the absence of

v i n l inserts replicated in cells cotransfected with virai DNA. Replication of plasmid DNA

was not due to acquisition of hrs or other viral sequences following cotransfection; nther.

it depended on the presence of viral genes including ie-1, p I 4 3 . dnapol, lefil, lef-2. ief-3

and p35, iti rmrs. The data suggested that the replication machinery of baculovinis could

potentially initiate DNA replication from multiple sequences, including non-viral

sequences in cenain circurnsmces. A mode1 was proposed suggesting that the selection of

replication initiation sites may be imposed directly by a chromatin structure and indirectly

by specific sequences and that the process of viral DNA replication may be linked with

viral transcription. The conformation of plasrnid DNA replicating in the coa-ansfected cells

was analyzed and found to be high moiecular weight concatemers. Ten to 25% of the

replicated plasmid DNA was integrated into multiple locations on the viral genome and

was present in progeny virions following serial passage. No homologous or conserved

sequences were identified at the proximiry of the integration sites. indicating possible

involvement of non-homologous recombination in the process of viral DNA replication.

These data also suggested that while roLling-circle mechanism could be used for the viral

DNA replication, recombination rnay be highly involved.

Specific roles of viral factors in the process of DNA replication in the cotransfected

cells were investigated, based on possible interactions of viral factors with the putative

helicase, P143. P l 4 3 was localized in the nuclei of infected cells or cells cotransfected

with viral DNA but retained in the cytoplasm in the absence of other viral proteins. The

viral single-smded DNA binding protein, LEF-3, was essential and sufficient to mediate

the localization of Pl43 into the nucleus. LEF-3 and P l 4 3 colocalized in the nucleus,

suggesting that these two proteins rnay exist as a complex in the infected cells. In contrast,

other viral proteins such as IE- 1, LEF- 1. LEF-2. DNA polymerase and P35 failed to

mediate the nuclear localization of P143, suggesting that a direct interaction between Pl43

and these viral factors rnay not exist. Together. it was implicated that regulation in the

initiation of DNA replication in baculovirus rnay be closely related to possible function of

the putative helicase P l 4 3 in the nucleus. Interactions between DNA and Pl43 or the

complex of Pl43 and LEF-3 rnay promote the replication of multiple sequences in the

infected or cotransfected celis. Resaictions on possible interactions between Pl43 and the

viral genorne rnay determine specific sites to be used as ongins during the replication of

the baculovinis genome.

ACKNOWLEDGMENTS

1 would like to thank my supervisor Dr. Eric B. Cantens, for introducing me to this great country, and for his guidance and help throughout the period when 1 was in culture shock, financial crisis, and while standing in the darkness of an unknown world, both academically and cuiturally. His unique way of training has helped to make me what 1 am today. My growth is evident when cornpared with what 1 was like when 1 fust arrived here - barely able to speak a complete sentence of English but confident with a Chinese-English dictionary in rny hand. which unfortunately was later confmed to have taught me many unusual expressions. I am proud of not only what 1 have achieved today, but also what 1 will be able to do tornorrow.

1 also would like to thank my supervisory cornmittee. Dn. Peter Faulkner, Andrew fiopinski, and Chris Mueller for their invaluable suggestions at many critical points of my research and for their sound jud&ment of my progress.

Special thanks to my lab mates: Renée Lapointe who tolerated my invasion of her bench space many times until 1 was kicked out of the main lab; Ge Liu who shared with me his extensive experiences in DNA replication assays and Qiagen columns; Kent Arrell who was my batting coach in my first softball garne; and Jian J. Liu and Wei Qiu who gave me many valuable suggestions during lab meeting. Special thanks to Richard Casselman, our technicianship. whose lab slang 1 used unsuccessfully as necessary jargon in my academic writing and as key words for Medline literature searches.

1 gratefully acknowledge the help of Drs. Albert Lu and Ge Liu for providing plasmids pAcHE4.3, pAcHE4.5, pAchr2, pAcp 143. pAclefl, pAcIE 1 hrP 143 and pAcIEl LEF-3; Dr. Lois Miller for pAcdnap and pAclef3; and Dr. Paul Friesen for p E l- IacZ.

1 wouid also like to thank members of my family: my wife Tao Liu, who adjusted her personal life to help rny personal growth and endured many lonely days and nights; my daughter Anqi Wu, to whorn 1 promise to devote more time: and my brothers and sisters, who were al1 in China providing me with encouragement through their letters.

1 would like to thank to my parents who are laying peacefully undemeath. but on the other side of the earth. 1 am sure they would be proud of me if they were still alive. 1 do not intend to disturb them tliis time but just want to say that I appreciate very much what they have done for me during their life tirnes. My mother's philosophy of life, do your best but do not expect anything, influenced me for so many years and helped me to deai with al1 kinds of hardship in life.

I dedicate this thesis to three extraordinary women: my mother, my wife and my daughter.

Finally , 1 grate full y acknowledge the financial support of the Medical Research Council of Canada, the National Science and Engineering Research Council of Canada, the Canada Student Loan Program, the Ontario Student Loan Program, Queen's University and the University of Konstam in Germany.

Yuntao Wu

TABLE OF CONTENTS ABSTRACT ....................................................................................... ii ACKNOWLEDGMENTS ........................................................................ iv TABLE OF CONTENTS ......................................................................... v

LIST OF FIGURES .............................................................................. vii ...

LIST OF TABLES ................................................................................ v u LIST OF ABBREVIATIONS .................................................................... ix

1 . DNA Replication Initiation and its Regulation ................................... 1 A . Origins of Replication ........................................................... 1 B . Replication Initiaton ............................................................ 4 C . Helicases for Unwinding at Origins ........................................... 5 D . Priming DNA Synthesis ....................................................... - 7 E . Assembly of DNA Polymerases ont0 Ongins by Accessoiy

Factors .............. ... .......................................................... - 8 F . DNA Polymerases ............................................................... 10 G . Other Factors Involved in DNA Replication ................................. 12 H . DNA Replication Initiation in Cells of Multicellular

....................................................................... Eukaryotes 12 II . DNA Replication Initiation in DNA Viruses ...................................... 16 III . DNA Replication Initiation in Baculovirus ........... .... .................. 20

A . AcMNPV and its Genome ...................................................... 21 B . Baculovirus Putative Replication Origins ................................. 2 2 C . Genes Involved in DNA Replication .......................................... 24

1 . ie-l gene ................................................................... 24 . ............................................................... 2 dnopoi gene 25

3 . p l 4 3 gene .................................................................. 25 4 . lef.1, 2, 3 genes .......................................................... 26 5 . p3.5. ie-2 and pe38 genes ............................................... 26

................................... 6 . pcia and putative exonuclease genes 27 D . Baculovirus DNA Replication and Gene Transcription ..................... 28

............................................. E . Possible Replication Mechanisms 29

............................................................................. III . Rationale -30

MATERIALS AND METHODS ................................................................ 35 A . Cells and Viruses ................................................................... -35

.................................. B . Cloning and Subcloning Viral DNA Fragments 36 ............................................. C . Construction of Recombinant Viruses 41

.......................... D . DNA Purification, Elecaophoresis and Hybridization 41 .................... E . Rotein Exmction, Electrophoresis and Immuno Detection 43

F . Transfection and Replication Assays in Sf21 Cells .............................. 44 G . Immunofluorescence Microscopy .................................................. 45 H . Cornputer Assisted Data Analysis .................................................. 47

RESULTS .......................................................................................... 48

A . Replication of Plasrnids and Recombinant Viruses Canying hr Deletions ............................................................................. -48

B . Identification of Alternative Origins of Replication ............................. - 5 5 1 . initiation of DNA Replication by Viral Early Gene Regions ............... 55

................ 2 . Initiation of DNA Replication by the ie-I Promoter Region 60

........................ C . Replication of Plasmid DNA in Cotransfected Cells ..... 62 1 . Plasmid RepLication is Independent of Specifc Viral

Sequences ....................................................................... -62 2 . Plasmid Replication Depends Upon Viral Genes ........................... -64

D . Conformation of the Replicated Plasrnid DNA in Cotransfected CeUs .................................................................................. -66 1 . High Molecular Weight, Concatemeric Structure of the

Replicated Plasmid DNA ....................................................... 68 2 . Inte_ption of the Replicated plasrnid DNA into Viral

Genome ........................................................................... 68 E . Possible Interaction of Viral proteins in Initiation of DNA

Replication ........................................................................... - 8 5 1 . Different ïntncelluiar Localization of Pl43 and IE-l in CeUs

Co-producing P 143 and IE- 1 .................................................. 85 2 . The Abiiiry of the Viral Replication Factors to Facilitate the

Nuclear Localization of Pl43 .................................................. 87 ............................... 3 . Pl43 and LEF-3 colocalize in the nucleus ... 90

DISCUSSION .................................................................................... -94

A . Roles of hrs in DNA Replication ................................................... 94

B . DNA Repiication Initiation and Early Gene Transcription ..................... -97 .................. C . Possible Mechanisms of Initiation of Viral DNA Replication 100

D . Recombination and V i n l DNA Replication ....................................... 107 . E Conclusions .......................................................................... 111

REFERENCES .................................................................................... 113

CURRICULUM VITAE ......................................................................... 142

LIST OF TABLES

Table 1. Production of progeny budded vimses at 24 hours post infection with hr deletion viruses. ......................................................... .52

Table 2. Roduction of progeny budded viruses at 48 houn post infection with hr deletion viruses. .......................................................... 52

Table 3. Determination of replication initiation efficiency following standard replication assay. ................................................................. .59

LIST OF ABBREVIATIONS

AcMNPV ARS ATP bp BV DAH 0 dCTP DNA m7-P DOPE dpm rn DUE EBV EBNAl E. coli EDTA FSC h hl- IE kb kD LEF rnA

min MCM MNPV

Autographa cafvornica MNPV autonornously replicating sequences Adenosine triphosphate base pair budded virus 4',6-diamidino-2-phenylindole diameter deoxycytidine triphosphate deox yribonucleic acid deoxynucleotide triphosphate 1 2-dioleoyl-sn-glycero-phosphatidylethanol-amine disin tegrations per minute Di thiothreitol DNA unwinding element Epstein-Bar vims Epstein-Bar nuclear antigen 1 Eschericia cofi ethylenediamineteaaacetic acid fatal caIf serum hour hornologous region immediate-earl y kilo base kilodal ton late expression factor rnilliampere microCurie microfaraday microlitre microgram micromolar miiiigrarn millili ue millime ter minutes minichromosome maintenance multicapsid nucleopolyhedrovirus multiplicity of infection nanometre nucleopolyhedrovirus nucleotide occluded virus omega op tical density

on ORE OBR RP- A PAGE PBS PCNA PCR pol-a p l - 6 PI RFC rPm RNA SV40 SSB ts Tris TEMED v

ongin origin recognition element origin of bidirectional repiication replication protein A po lyacry larnide gel electrop horesis p hosphate-buffered saline proliferation ceil nuclear antigen polyrnerase chah reaction polyrnerase a polymerase S propidium iodide replication factor C revolutions per minute ribonucleic acid S imian virus 40 singe-stranded DNA binding protein temperature-sensi tive ~s(hydroxymethyl)aminomethane N,N,N',N' -Te tramethylethylenediarnine volts

INTRODUCTION

1. DNA Replication Initiation and its Regulation

Self-multiplication is the ultimate goal for the existence of a biologicai species;

genorne replication is the center of the matter. Organisrns. cornpeting for existence, have

evolved well diversified replication strategies. However, while remaining unique and

cornpetitive, they do share some basic mechanisms for the genome replication. Below is a

review about aspects of these basic mechanisms, with a focus on the replication of DNA

genomes.

Watson and Crick fxst predicted a geeneeral mechanism for DNA replication based

on the DNA helix s m c m . The duplication of a DNA molecule could simply be a process

of melting apart two DNA strands followed by polymerization of new complementary

strands on the melted DNA templates. But problems such as how to denature double-

stranded DNA at the physiological condition, or where to initiate the first polymenzation

reaction impiied the complexity of this process.

A. Origins of Replication

Jacob and Brenner f i s t proposed a replicon mode1 more than 30 years ago. in

which the proposed major control step of DNA synthesis is at initiation (Jacob et al..

1964). Initiation would depend on the specific interaction of a cis-acting DNA sequence

(replicator) and a cognate tram-ac ting protein (initiator). For simple genomes such as

those of bacteria. plasrnids. many vinises, yeast and rnitochondria of higher eukaryotes.

this prediction proved to be fairly accurate. Replication of these genomes starts from

specific sites caiied origins (Kelly, 1988; Fangman and Brewer, 1991; Marians, 1992). In

general. an origin of replication for simple genomes usudly includes a core component

and one or more auxiliary components. The core consists of a cenual origin recognition

element (ORE), a DNA-unwinding element (DUE). and an A+T-rich element

(DePamphilis, 1993). The ORE is usually the binding site for the origin recognition

protein, which initiates DNA replication by its binding to ORE and exerting double

smnded DNA unwinding activity directly (Borowiec et al., 1990; Gutierrez et al., 1990;

Seki et al.. 1990: Lorimer et al., 1991) or indirectly through recruiting an unwinding

enzyme (helicase) (Middleton and Sugden, 1992; Bell and Scilhan, 1992) ont0 the origin.

The DUE is an easily unwound region and appears to be the site where DNA unwinding

b e m s and the transition from discontinuous to continuous DNA synthesis occurs (Hay

and DePamphilis, 1982; Kowalski and Eddy, 1989; Marahrens and Stillman, 1992).

Ongin auxiliary components consist of transcription factor-binding sites that facilitate

ongin core activity by multiple rnechanisms such as facilitating the binding of ongin

recognition proteins to the core element, or p r e v e n ~ g chromatin structure fiom i n t e r f e ~ g

with the binding of replication factors to origins (Heintz. 1992). The best characterized

simple ongins include those for E. coli (Messer et al.. 1988). SV40 (Kelly. 1988) and

yeast Saccharomyces cerevisiae (Fangman and Brewer, 199 1). As examples. the structure

of the ongins for E. coli and yeast is described below.

Initiation of chromosomal replication in E. coli uses well defmed sequences. the E.

coli onC, which consists of three elements: a cenual sequence of 245 bp flanked on one

side by an A+T-rich region and on the other by three repeats of 13-mers (Komberg and

Baker. 1992; Yasuda and Hirota, 1977: Zyskind and Smith, 1986). The central sequence

is an origin recognition elemenr which contains four 9-mer specific recognition sites for an

initiator protein. DnaA (Fuller et al., 1984), and the 13-mer repeats are easily unwinding

sequences possessing a high propensity for melting. The 13-mer repeats and are also the

sites for loading another replication factor, the DnaB helicase. Binding of DnaA to the core

sequences is the first step in the initiation of DNA replication (Chiang et al., 199 1:

Marszalek and Kaguni. 1994). This binding induces localized unwinding of the 13-mer

repeats which may facilitate the assembly of the DnaB heiicase ont0 the ongin for initiation

of replication (Kubota et al.. 1997; Samin et al., 1989; Gille and Messer. 199 1).

Chromosomal ongins of replication in budding yeast Saccharomyces cerevisiae

coincide with autonomously replicating sequences (ARSs) in plasmids (S tinchcomb et al.,

1979; Campbell, 1993; Rowley et al., 1994). ARSs were identifiai by their ability to

promote the extrachromosomd maintenance of plasmids in S. cerevisiae. It has been

demonstrated using 2D gel electrophoresis that ARS elements function as replication

origins both on plasmids and on chromosomes (Stinchcomb et al.. 1979; Campbell. 1993;

Rowley et al., 1994). Moreover, when chromosome III was systematicall y searched for

origins other than ARS, no additional origins were found (Greenfeder and Newlon, 1992;

Collins and Newlon. 1994), suggesting that ARSs function specificdly as origins for

chromosomal replication. All ARSs contain a 11 bp consensus sequence

(AmmA(T/C)(A/G)TTT(A/T), known as the ARS consensus sequence. Mutational

analyses have revealed that the ARS consensus sequence functions as an origin

recognition element. The six-subunit origin recognition complex (ORC) specifically

recognizes the ARS consensus sequence, both in vivo and in vitro (Bell and Stillman,

1992; Diffley and Cocker, 1992). In addition, three other regions (BI, B2 and B3)

flanking the ARS consensus sequence increase the efficiency of origin function of ARS

(Marahrens and Stillman, 1992; Rao and Stillman, 1995; Rowley et al., 1995). Extensive

analysis of these regions by linker-scan substitutions and point mutations suggested that

the presence of any 2 of these 3 elements was sufficient for ARS activity (Theis and

Newlon, 1994; Rao et al., 1994). The B2 element may function as a DNA-unwinding

element (Marahrens and Stillman. 1992), whereas the B 1 and B3 elements are functionally

involved in binding of proteins. The B 1 element is also a binding site for ORC (Rao and

Stillman, 1995; Rowley et al., 1995). Point mutations within B 1 of ARS 1 caused a

dramatic decrease in the plasmid stability and ORC binding (Diffley et al., 1994),

suggesting the stimulatory effect of B 1 may be related to its interaction with ORC. The B3

element of ARS1 is the binding site of a rnultifunctional transcription and replication

protein, ARS-binding factor 1. Interestingly, the B3 element of ARS 1 can be replaced by

binding sites for other aanscription factors such as Gal4p and Raplp (Marahrens and

Stillman, 1992). suggesting that the B3 element might play a general role in stimulation of

replication initiation. This stimulation may be relared to a general effect of transcription

factors on the origin activity, such as û-anscription factors influencing the local chromatin

srxucture or facilitating the interaction between multiprotein cornplex and the origh.

Although the cis-acting elements required for chromosomal replication in E. coli

and yeast have little sirnilarity in sequence, as demonstrated above. common structures

such as the core elements or the DNA-unwinding elements in these origins are obvious.

The core sequences in both types of origins contain multiple binding sites for replication

initiator proteins. which initiate DNA replication by specific interaction with the core

sequences.

B. Replication Initiators

Replication initiators are proteins that bind to replication ongins in a sequence

specific manner, and function as a landing pad for the assembly of other replication

proteins such as helicases for the initiation of DNA replication. Initiator proteins often

oligomerize upon binding to the origin. The oligomerization probably acts to stabilize the

protein-DNA interaction and allows efficient interaction with other proteins. In some

cases. i t may cause local unwinding of a region at the origin. The E. coli replication

initiator, the DnaA protein, specifically recognizes its four 9-mer recognition sites at the

onC (Fuller et al., 1984). The specific DNA-protein interaction results in the cooperative

binding of about 30 monomers of DnaA protein to its four 9-mer binding sites at the oriC

(Fuller et al.. 1984; Messer et al., 1988). The binding of DnaA to onC promotes localized

melting of the DNA within the 13-mer repeats at the left edge of oriC, and helps the

loading of DnaB helicase to oriC (Kubora et al., 1997; Samitt et al.. 1989; Gille and

Messer, 1991). Once the helicase DnaB protein is associated with onC, the first step in the

assembly of other replication factors for the DNA synthesis begins (Chiang et al.. 1991;

Manzalek and Kaguni, 1994).

Similarly, the SV40 DNA replication initiator. large T antigen, interacts with its

four recognition sites in the SV40 origin, resulting in the binding of two hexamers of T

antigen to the SV40 ongin in an ATP-dependent manner (Goetz et al., 1988; Parsons et

al., 1990; San Martin et al.. 1997). This binding leads to unwinding of 8 bp within the

origin through the helicase activity of T antigen (Borowiec and Hunvitz, 1988; Borowiec

et al., 1990). Thus, the 8 bp DNA-unwinding element appears to be the enuy site for the

assembly of replication machinery (Collins and Kelly. 199 1; Erdile et al., 199 1). The

SV40 large T antigen is a special case since it functions as both the initiator protein and the

helicase for DNA unwinding. However, in most cases. extensive unwinding of DNA at

the ongin requires a separate protein, the helicase. and helicases need to be assembled onto

the origin.

C. Helicases for Unwinding at Origins

Following the binding of initiator proteins to an origin, replication factors are

sequentiaily assembled ont0 the origin. DNA helicases or single-stranded DNA-binding

proteins are usually the fiist factors assembled ont0 DNA. Helicases unwind the DNA

duplex, whereas the single-stranded DNA-binding proteins srabilize the unwound region.

For unwinding double-stranded DNA, DNA helicases utilize the energy of the binding

and/or hydrolyzing NTP to translocate in either the Y+3* or 3'-t5' direction.

Both prokaryotic and eukaryotic helicases have six distinctive conserved protein

motifs (1-VI) (Hodgman, 1988; Gorbalenya and Koonin, 1993; Gorbalenya et al., 1989).

A loosely defined seventh motif. Ia. also exists within a subgroup of the helicase

superfarnily (Gorbalenya and Koonin. 1989). The results of mutation analyses of these

motifs tend to support their cmcial roles for DNA helicase function (Zhu and WeIler,

1992; Martinez et al., 1992). Motifs Ia, I and II are required for recognition and

hydrolysis of nucleotide triphosphates since numerous proteins hydrolyzing purine

nucleotide triphosphates contain these motifs(Saraste et al.. 1990; Koonin, 1993). Motifs

III-VI have less clearly assigned function although they are essential (Zhu and Weller,

1992; Martinez et al.. 1992). Motif V has been implicated in single-srranded DNA binding

(Graves-Woodward and Welier, 1996), whereas motif III may function in coordination of

ATP and single-stranded DNA binding (Brosh and Maüon, 1996). Motif IV has also k e n

implicated in nucleotide binding (Hall and Matson, 1997).

In prokaryotic celts. the E. coli DnaB protein, a hexamer of a 50 k D subunit, is

likely the principal helicase for the chromosomal replication. The protein binds to the

single-stranded region of a partially duplex DNA molecule and translocates along the

single strand with a 5'-3' polarity, requiring energy derhed from the hydrolysis of either

ATP. GTP or CTP (Jezewska er al., 1996; Jezewska and Bujalowski, 1996; LeBowitz

and McMacken, 1986). Eukaryouc cells contain a group of DNA helicases (Borowiec,

1996; Thornmes and Hübscher, 1992; Passarge, 1995). However, the roles of these

identified helicases in the chromosomal replication remain unknown although they likely

function in the process of DNA repair, recornbination or transcription (Matson er al.,

1994; Tuteja and Tuteja, 1996; Prakash et al., 1993).

Helicases usually interact with other replication factors such as primases, single-

sûanded DNA binding proteins (SSB) or DNA polymerases. For example, the E. coli

DnaB and DnaC protein form a 6 : 6 complex which serves a critical role in the assembly

of the prepnming factors (Wahle et al., 1989b; Wahle et al.. 1989a; Allen and Komberg.

1991; Arai et al.. 1981). The 63 kD product of the bactenophage 77 gene 4 Qp4) has both

helicase and primase activities (Bernstein and Richardson, 1989; Matson et al., 1983;

Mendelman et al., 1993; Egelman et al., 1995); it also can interact with the T7 DNA

polymerase and T7 SSB (gp2.5), forming a discrete interactive complex (Notamicola et

al., 1997; Kim and Richardson, 1993). By analogy, some of the isolated helicases from

eukaryotic cells might interact with either DNA polymerase-a (Thornrnes and Hubscher,

1990; 'T'hommes et al., 1992; Biswas et al., 1993), polymerase-6 (Li et ai., l992a),

polymerase-e (Siegal es al., 1992). replication factor C (RF-C) (Li et al., 1992b), or

replication protein A (RP-A) (Georgaki et al., 1994). However, a role of these helicases in

the chromosomal replication remains undefie..

D. Priming DNA Synthesis

Following DNA unwinding by helicases at the origin, the next step requires

assembly of primases on the origin. Initiation of DNA synthesis by DNA polymerases

requues pnmers; in most cases primases function specifically in the synthesis of these

primers. Rimases can be loaded onto ongins by their direct association or interaction with

the assembled helicases or, altemauvely. by recognition of a DNA smicture created by

helicases. For example, the primase assembly involves direct interaction between large T

antigen and pol-a:primase in SV40 origin (Melendy and Stillman, 1993; Collins and

Kelly, 1991; Dormeiter et al., 1993). The E. coli primase DnaG is loaded ont0 the

replication fork by interaction with the helicase DnaB protein (Komberg and Baker,

1992). Once assembled ont0 the origin, primases synthesize short RNA pnmers that are

utilized by DNA polymerases.

In E. coli . the primase DnaG protein, a polypeptide of 60 kD, can synthesize

RNA pnmers on a stem-loop structure of a single-stranded DNA template (Kombeq and

Baker, 1992). This synthesis does not depend on other cellular or viral factors. However,

primases often form a rnultiprotein complex and act in concert with other factors in

prirning most of the templates. For the replication of 0x174 DNA, the DnaG protein

interacts with DnaB, DnaT, M A , W B , and PriC proteins, and forms a multiprotein

complex, the primosome (Arai et al., 1981). The pnmosome tracks along the 0x174

template and synthesizes primers at numerous places. In the replication of bacterial

plasmid DNA. DnaG teams up with DnaB and Pri A proteins to form functional

primosome to synthesize primers (Lu et al., 1996; Steger et al., 1996). In eukaryotic

cells, primase activity is a component of the DNA pol-a:pnmase (Plevani er al.. 1988;

Santocanale et al., 1992). The primase activity of the 48 kD and 58 kD subunits of human

pol-a:pnmase is evident both in the polymerase complex and in the separated forms

(Santocanale et al., 1992; Podust et al.. 1992). However, these two subunits appear to be

a functional unit to maintain the primase activity. Pol-a:pnmase likely synthesizes primers

for both the leading and lagging saands during DNA synthesis (Copeland and Wang.

1993; Foiani et al., 1994).

E. Assembly of DNA Polymerases onto Origins by Accessory Factors

Once the pnmers are synthesized, assembly of the DNA polymerase onto the origin

is the last critical step in initiation of DNA synthesis. DNA polymerases are loaded ont0

the template DNA at the primer sites. This process involves the recognition of the

synthesized primers by a complex of the DNA polymerase ar.d accessory factors,

including single-stranded DNA binding proteins (SSB), polymerase clamp proteins. and

DNA-dependent ATPases that load the polymerase clamps ont0 the DNA. In both

prokaryotic and eukaryotic ceus, the ATP-dependent clamp-Ioading proteins recopize the

primer-template junctions and assemble the polyrnerase clamps ont0 the junction sites

(Tsurimoto and Stillman, 1990; Tsurimoto et al., 1990). DNA polyrnerases are then

assembled onto the primers ready for DNA synthesis (Nethanel and Kaufmann. 1990).

For example, in the SV40 ongin, the clamp loading protein RF-C binds to the 3' terminus

of the synthesized RNA primes in the presence of ATP. then loads the polymerase clamp

protein PCNA (proliferating ce11 nuclear antigen) onto the DNA. This complex is

recognized by DNA polymerase-8 or E, which initiates DNA synthesis from the primers

(Tsunmoto et al., 1989; Tsurhoto and Stillman, 199 1 b; Tsurimoto and StilIrnan, 199 1 a;

Fien and Stillman, 1992).

Replication accessory factors such as RF-C and PCNA play a variety of roles such

as recruiting of DNA polymerases, facilitating the binding of DNA polymerases to the

pnmer temiinus, increasing processivity of DNA polyrnerases as well as preventing non-

productive binding of DNA polymerases to single-strandcd DNA. The E. coli SSB is an

exnemely stable tetramer of 18.9 kD, which binds to DNA single strands cooperatively

(Mitas et al.. 1997). Its function in DNA replication is to stabilize DNA single strands and

to protect unwinding regions from being used as the nonspecific sites for priming (Chase

and Williams, 1986). The SSB (RP-A) in eukaryotic cells is a heteroaimer with subunits

of 70 kD, 32-34 kD and 11-14 kD (Gomes et al., 1996; Bochkarev et ai., 1997; Wold,

1997; Ozawa et al., 1993; Wold and Kelly, 1988). RP-A aIso assists the SV40 large T

antigen in unwinding the viral replication origin, interacts with pol-a:prirnase and

suppresses nonspecific priming events (Kenny et al., 1989).

The polymerase clamp protein or the polymerase processivity factor in E. coli is

the 40.6 kD dimenc P subunit of pol III holoenzyme (Kuriyan and OIDonnell, 1993;

Komberg and Baker, 1992). The B subunit does not directly bind to DNA. but it c m

become tightly attached to the region of the template-primer duplex. The assembly of P subunit ont0 DNA depends on the ATP-driven action of the y complex of pol III

holoenzyme. The ycomplex is a functional homology of RF-C in eukaryotic cells.

The eukaryotic polymerase clamp protein, PCNA, is a 29-40 kD ring-shaped

homotrimer (Kelman, 1997; Krishna et al., 1994; Kelman and OIDonnell, 1995), which

interacn with pol-6, p o k and RF-C (Tsurimoto and Stillman, 1990; Mossi er al.. 1997;

Lee and Hurwitz, 1990; Burgers, 1991). PCNA functions as a sliding clamp to increase

the pnmer binding and processivity of pol-6 and pol-e (Bauer and Burgers, 1988b; Bauer

and Burgers, 1988a: Prelich and Stillman. 1988). PCNA does not bind to DNA but can

forrn a primer recognition complex with ATP and RF-C (Podust et al., 1995; Lee and

Hurwitz. 1990; Podust et ai.. 1992).

RF-C is a multiprotein complex composed of one large subunit and four small

subunits (Tsurimoto and Stillman. 1989; Uhlmann er al., 1996). The large subunit,

hRFC140 can bind to DNA (Pan et al., 1993), whereas one of the small subunits,

hRFC40, interacts with PCNA (Mossi et al.. 1997; Pan et al.. 1993). hRFC40 and

another subunit, hRFC37, interact respectively with pol-6 and pol-E, and with each other

(Chen et al.. 1992). RF-C enzymatically loads PCNA ont0 DNA in the presence of ATP

(Podust et al., 1995; Lee and Hunvitz, 1990; Podust et al.. 1992; Burgen. 199 1).

F. DNA Polymerases

At the replication origin, the assembled DNA polymerases use one strand of a

DNA duplex as the template and elongate the prirners by catalyzing the polymenzation of

dNTPs into the complementary DNA strand. Some DNA polyrnerases also carry a 3 ' 4 5 '

exonuclease activity to proof-read the process of DNA synthesis. DNA polymerases often

form multisubunit complexes. For example. the holoenzyme of E. coli D N A polymerase

I I I (pol III) is a complex of about 20 subunits (Kornberg and Baker, 1992): a, the

polymerase; E , the 3'45' exonuclease; r, the ssDNA-dependent ATPase; P. the

processivity factor, the ycomplex and the 0 subunit The pol III holoenzyme reconstituted

in vitro is an asyrnrnetric dimer of multiple subunits, which possesses a high processivity

and polymenzation rate close to the iti iiivo rate of fork movernent (Kornberg and Baker,

1992). Pol III is the principal polymerase in the E. coli chromosomal replication (Funnell

et al., 1986).

Eukaryotic cells have at least five DNA polymerases: a, P, y, 6 and e (Wang.

1991; Wang 1996). Four of these are nuclear polymerases, whereas polymerase y is

likely associated with mitochondna DNA replication. Polymerase a (or pol-a:primase) in

human cells is a heterotetrarner which contains four subunits (Plevani et al., 1988;

Copeland and Wang, 1993; Murakami et al., 1986). The largest subunit is the catalytic

180 kD polypeptide. It forms a tight complex with the 48 k D and 58 kD subunits which

carry the pnmase activity (Copeland and Wang, 1991; Melov et al., 1992; Stadlbauer et

al., 1994; Podust et al., 1992). The remaining 70 kD subunit has no identified function.

but it may be necessary for recniiting subunits of pol-a:primase to the replication fork

(Collins et al., 1993; Foiani et al., 1994). Pol-a:pnmase lacks a 3'+5' exonuclease

activity and high processivity. Thus. this enzyme is unlikely the major polymerase during

elongation. Rather. it appears to play a role in initiation, possibly serving as a pnming

enzyme at the replication fork (Waga et al., 1994; Waga and Stillman, 1994).

In contrast, polymerase 6 @oI-6) contains two subunits and a processivity factor,

PCNA, which enhances the processivity of pol-6 (Zhang et al., 1995; Wang. 1996;

Prelich and Stillman. 1988). The larger 124 kD catalytic subunit of pol-6 has an intrinsic

3'+5' exonuclease activity (Simon et al., 199 1; Monison and Sugino, 1994; Zhou et al.,

1996), whereas the srnall 48 kD subunit appears to be necessary for the stimulation by

PCNA (Lee and Hunvitz. 1990; Bravo et al., 1987). POI-6 may function as one of the

major enzymes to elongate both the leading and lagéng strands pnmed by pol-a:pnmase

('surimoto et al., 1990).

Similarly, polymerase E (pol-E) is a heterodimer. which has an intrinsic 3*+5'

exonuclease activity associated with its 225 kD catalytic subunit (Syvaoja, 1990; Kesti et

al., 1993). Pol-& can form a stable complex with replication factor C (RF-C), ATP and

PCNA at the primer terminus (Chen et al., 1992). However, compared with pol-6, pol-E

is insensitive to PCNA stimulation (Syvaoja and Linn, 1989; Lee er al., 199 1). The

function of pol-E dunng replication is not clear; it may play a role in elongation. In

budding yeast, the gene (POL?) coding for the catalytic subunit of pol-E is essential.

Mutations in POL2 caused deficiency in the S-phase checkpoint (Navas et al., 1995),

suggesting that pol-e rnay play a role in monitoring the status of DNA replication (Lee et

al., 199 1 ; Navas et of., 1995).

Polymerase P is a single polypeptide of 40 kD and has no 3'+5' exonuclease

activity (Prasad et al., 1993). Genetic analysis of polymerase gene suggests it does not

play a significant role in chromosomal replication (Zmudzka et al., 1988). but may be

involved in DNA repair ( L e m et al., 1994).

G . Other Factors Involved in DNA Replication

As the DNA polymerase synthesizes new complementary DNA and the replication

fork moves, the RNA primers at the 5' end of DNA fragments (Okazaki fragments) on the

lagging strand need to be removed, and the resulting gaps must be filled and ligated. As

weli, the tonional strain accumulated ahead of the replication fork requires relaxation. The

E. coli DNA polymerase 1 with an intrinsic 5 ' 4 ' exonuclease activity can fulfill the

requirement of Okazaki fragment processing. However, none of the eukaryotic

polymerases has the 5*+3' exonuclease activity (Kunkel and Bebenek 1988; Komberg

and Baker, 1992); instead. a 44 kD exonuclease, FE3Ll. may functionally substitute for

the S+3* exonuclease activity of the E. d i DNA polyrnerase 1 enzyme (Li et al., 1995;

Parks and Graham, 1997). FEN- 1 and RNaseHl rnay act together to process Okazaki

fragments (Turchi et al., 1994; Waga et ai., 1994; Waga and S tillman, 1994). In addition.

DNA ligase 1 is most likely the enzyme used to join Okazaki fragments after processing

(Waga et al., 1994; Waga and Stillman, 1994). Two of the eukaryotic toposornerases,

type 1 and type II, may functionally be involved in the resolution of topological problems

dunng DNA replication (Anderson et ai., 1996; Wang, 1996).

H. DNA Replication Initiation in Cells of Multicellular Eukaryotes

While Jacob and Brenner's replicon model fils nicely to most simple genomes with

bi-directional ongins, mechanistic variations exist. Not surprisingly, when this mode1 was

further applied to complex genomes, especially mammalian chromosomes. results were

controversial at the beginning (Hamlin et al., 1994).

The first problem facing higher eukaryotes is whether they use defined discrete

nucleotide sequences as origins. Evidence in favor of specific initiation came directly from

the identification of a few chromosomal replication origins. For example, a replication

origin was located in a 135 kb region between the 6-globin and P-globin genes of the P- globin gene cluster on human genome (Kitsberg et al., 1993a; Kitsberg et al., 1993b).

Under normal conditions. DNA replication within the 135 kb region was initiated only

from this origin of bidirectional replication (OBR). However, cells from patients with

haemoglobin Lepore syndrome had an 8 kb deletion within this 135 kb region that

includes the OBR. This deletion elirrünated bidirectional replication from this site,

rendering the 135 kb region to be passively replicated from an unidentified distant ongin

(Kitsberg et al., 1993b). This demonstrated directly that there may be cis-regulatory

elements in higher eukaryotic genomes that are responsible for controlling initiation. In

another example, the dihydrofolate reductase (DHFR) locus in Chinese hamster ovary

cells was by far the most intensively studied ongin (Harnlin et al., 1994). The DHFR

domain has been scrutinized by a variety of techniques to define the origin function.

Although the identified initiation zones varied from severai thousand to a few hundred

base pairs depending on individual approaches. results frorn techniques such as in vivo

labelling, leading strand template bias assay, lagging strand assay and a PCR-based assay

indicated the preferential use of two specific sites to initiate DNA replication (He and

Huang, 1997). These two origins were located precisely within the intergenic spacer

region of the DHFR and ZBEZ121 genes (Harnlin et al.. 1994).

However, evidence from two dimensional gel electrophoretic studies did not

always indicate specific initiations (Hamlin er al., 1994). This technique consistently

revealed the existence of multiple sites within a broad range of initiation zones for higher

eukaryotic genomes (Shinomiya and Ina. 1993). For example, the DHFR dornain was

found to contain multiple initiation sites throughout the approximate 55 kb intergenic

region (Hamlin et al., 1994). In addition, when the standard experimental approach that

identified ARS in yeast was used to identify ARS activity in marnmalian cells, it failed to

identify any consensus sequences (Coverley and Laskey, 1994). The problem was not that

too few sequences could replicate; rather, too many replicated. Most DNA fragments

larger than 10 kb from marnmalian chromosomes can provide some ARS activity in

mammalian cells (Coverley and Laskey, 1994), suggesting that D N A length is more

cxitical than specific sequences. The picture became further complicated by an o n f i assay

using a vector with a crippled latent origin of replication (O*) from Epstein-Barr v h s .

Although this cnppled orif c m not replicate autornaticaiiy, it still can be retained within

cells for a period of time. A number of regions from the human genome have been cloned

into this vector to isolate regions that can functionally compensate the cnppled oriP .

However, virtually every fragment tested restored the replication of the crippled oriP to

some extent (Yates et al.. 1985; Heinzel er of., 1991). Subcloning did not identify shorter

specific. functional origins (Heinzel et ai.. 1991). In agreement with these observations. it

has been demonstrateci that when DNA was injected into eggs of Xenopus or added to

exmcts of Xetiop~cs eggs, DNA replication was initiated at a single randornly selected site

within virtually any DNA molecule (Gilbert et al., 1995b; Lee and Leone. 1994),

suggesting that specific sequences may not be necessary for initiation of DNA replication.

Many models have been proposed to resolve the contradictory conclusions in

defining eukaryotic replicons (DeParnphilis, 1993). One commonly accepted explanation

is that DNA replication in eukaryotic cells is initiated at specific sites but, while rnany

sequences can potentially function as origins, selection of an actual initiation site appean

to depend on the chromosome context rather than on specific sequences (Coverley and

Laskey, 1994). For example, a recent experiment demonstrateci that in the nbosomal RNA

gene locus of early Xewpru embryos replication initiated at regular 9 -12 kb interval with

no apparent dependence on specific sequences. However, later in development, when

these rRNA genes were k ing transcribed, initiation sites were restricted to the intergenic

regions. In other words. the specificity in initiation may be imposed by the chromatin

structure (Hyrien et of., 1995). Chromosomal loops may correspond to one replication

unit (replicon) in eukaryotic cells because of their similar sizes (30-100 kb) (Marx, 1995).

Accumulated evidence indicates that attachment to the nuclear scaffold rnay be functionally

essential during replication (Brun et al., 1993). A number of isolated matrix-attachment

sequences are early replicating, and containing A+T-rich sequences, direct repeats and

topoisornerase II consensus elements (Maruniak et al., 1984; Razin et al., 1991)

suggesting that these sites may be easily unwound elements and could be used as sites of

replication initiation.

Another major characteristic of DNA replication in eukaryotes is that initiation of

DNA replication is tightly regulated and coupled with the ceU cycle and ceil differentiation

(Muzi-Falconi et al.. 1996). The replication is time restricted within a window of the S

phase, and regulated to prevent re-initiation within a single ceil cycle (Baker, 1995).

Although the control mechanism is still not clear, it has been hypothesized that initiation of

DNA replication could be replated by a licensing mechanism in which a licensing factor

plays a cenaal role (Blow and Laskey, 1988). This putative licensing factor was proposed

to bind replication origins, serving as a prerequisite for initiation of DNA replication. To

prevent re-initiation, licensing factor must be resuicted from entering the nucleus. Only in

the M phase of a ce11 cycle. when the nuclear envelopes are disassembled, can the

licensing factor enter the nuclei and bind to DNA. DNA replication is initiated from ongins

in the following S phase in the presence of the licensing factor as well as a pre-replicative

complex. On the other hand, the process of DNA replication inactivates al1 Iicensing

factors, preventing it from reinitiating replication within the sarne ceII cycle. Certain factors

such as the products of the minichromosome maintenance (MCM) genes in yeast and the

homologous genes in a wide range of eukaryotes (MCM/Pl gene family) have some

similarity with the putative licensing factor (Chong et al., 1996). They are necessary for

the initiation of DNA replication, and only enter nuclei as cells undego anaphase,

s u g g e s ~ g that these factors rnay play some role in licensing initiation.

Analyses of factors interacting with the chromosomal ongins in S. cerevisiae

identified an origin recognition complex (initiator). This 250 k D complex bound to

sequence A and B1 of ARSs (Bell and Stillman, 1992; Diffley and Cocker, 1992) and

interacted with a cell-cycle-regulated factor. Cdc6 protein in vitro (Liang et al., 1995).

The Cdc6 protein is required for the initiation of DNA replication and is necessary for the

formation and maintenance of a chromatin configuration at origins (Bueno and Russell,

1992). sugesting that Cdc6p may play some role in replating origin function. The mini-

chromosome maintenance proteins. Cdc6p and the ongin recognition complex may f o m a

yeasr pre-replicative complex, which is directly associated with the chromatin and plays a

crucial role in licensing the replication initiation and re-initiation events (Botchan. 1996;

Blow and Laskey. 1988; Yan er al.. 1993; Madine er al.. 1995; Chong et al.. 1995;

Kubota et al.. 1995). The function of the pre-replicative complex rnay be regulated by

cyclin-dependent kinases (CDKs) to couple the initiation of DNA replication wirh the cell

cycle (Su ef al.. 1995; Dahrnann et ai., 1995).

II. DNA Replication Initiation in DNA Viruses

In general. genomic replication of DNA vimses is initiated from well defined cis-

acting elements by specific interaction with viral encoded initiator pro teins. The simpiicity

of this process in terms of Limited factors involved has k e n very helpful in understanding

rnechanisms of DNA replication in both the virai and the host cellular systems; vimses

such as SV40 have been subjects of extensive studies in the past and present. However, as

a group. DNA viruses Vary greatly in the way their genomes are replicated. Some viruses

such as SV40 depend heavily on the host replication system, and have only one or a few

replication factors encoded by the vimses. Other viruses such as herpes simplex viruses

have an almost complete set of v i n l replication factors. and use suategies totally diffcrenr

from the chromosomal replication of their host cells. The genomic replication of some

DNA viruses such as baculoviruses appears to be relatively independent of phases of the

host ce11 cycle, while that of others such as Epstein-Bar virus during latency is very well

coordinated with the proliferation of host cells. Different sirategies in genome replication

may require discrete regulatory rnechanisms for replication initiation. Below are a few

exarnples of different initiation mechanisms used by different DNA vimses.

SV40 The replication of the circular, double-stranded DNA genome of SV40 relies

largely on the host cellular replication system. and requires only one single viral protein,

large T antigen, which interacts with the SV40 ongin to initiate the DNA replication. The

64 bp SV40 ongin core consists of three domains: a 27 bp palindrome that contains

binding sites for viral large T antigen, a 8 bp DNA-unwinding element, and a 17 bp A+T-

rich region with one T-rich and one A-nch srrand (DePamphilis, 1993). Two auxiliary

elements, A u x 4 and Aux-2, contain binding sites for both T antigen and another

nanscription factor. Spl (Kelly. 1988). The auxiliary sequences stimulate the T antigen-

dependent DNA unwinding possibly by the interaction between proteins bound to these

sequences and T antigen (Guo et al.. 1989; Guo et al., 1991; Guo and DePamphiIis.

19%).

Large T antigen is a multiple function protein with DNA helicase and ATPase

activities. Large T antigen cm fonn a cornplex with multiple cellular factors, including pol-

a:primase, PR-A. transcription regulator protein Rb and p53 (Thukral et al.. 1994; Ray et

al.. 1996; Collins and Kelly. 1991). Two hexamers of T antigen specifically interacted

with and bind to the SV40 origin in an ATP-dependent manner (Goetz et ul.. 1988:

Parsons et al.. 1990; San Manin et al.. 1997). This binding leads to DNA unwindins

through T antigen helicase activity (Borowiec et al.. 1990). T antigen hexamers cover the

8 bp DNA-unwinding elernent i n i t i a ~ g DNA melting at nucleotides 5210-5217 (Borowiec

and Hunvitz. 1988). where the transition from discontinuous to continuous synthesis is

located (nucleotide 52 10-52 1 1) (Hay and DePamphilis. 1982). Specific interaction

between T antigen and PR-A recmits RP-A to stabilize the unwound region, whereas the

interaction between T antigen and pol-a:prirnase assembles pol-a:primase onto the

unwound region for the primer synthesis. Once the primers are available. RF-C recognizes

the primer and loads PCNA ont0 the site. Subsequentiy pol-6 was assembled ont0 the

primer site for DNA synthesis (Collins and Kelly, 199 1: Erdile et al.. 199 1 ) .

ADENOVIRUS Adenovirus has a double-stranded, linear genome that is covalently

associated with a terminal protein (TP) at the 5' end of each DNA saand (Stillman, 198 1;

Tamanoi and Stillman, 1982). The replication of the genome starts from its two ends.

Each origin of replication consists of four regions that are located within the inverted

terminal repeat (ITR) of the DNA ends (Challberg and Kelly, 1979). The origin core

sequence contains 18 bp binding sites for two viral proteins. the preterminal protein @TP)

and adenovims DNA polymerase (Ad pol). The core sequence is responsible for the

minimal level of initiation of DNA replication but higher levels of initiation require the

presence of auxiliary sequences. The auxiliary region flanking the core sequence contains

the binding sites for two cellular proteins, nuclear factor I (NFI) and octamer-binding

protein (Oct- 1) or nuclear factor III (NFIII) (Armentero et al., 1994; Coenjaerts et al.,

1994). The binding of the pTP/Ad pol to the origin core sequence and its interaction with

these cellular factors play an important role in the assembly of the adenovhs replication

complex (Challberg and Kelly. 1979).

Catalyzed by adenovirus polymerase, the pTP and the terminal residue form a

covalent linkage, the 3'-OH group of which is used as a primer for the synthesis of the

nascent saand (King and Van der Vliet, 1994). Two cellular transcription factors can

stimulate replication initiation (Hatfield and Hearing. 1993). NFI appears to interact with

Ad pol to stabilize the binding of the pTP/Ad pol heterodirner to the replication ongins

(Amentero et ai., 1994; Coenjaerts and Van der Vliet. 1994). NFIIVOct-1 may stimulate

replication initiation by inducing bending of the DNA at the ongin of DNA replication.

promoring interactions between the various components in the preinitiation complex

(Hagmeyer et al., 1993; Coenjaens et al., 1994). Altematively, direct interaction with the

pTP/Ad pol heterodimer may be responsible for the stimulation.

HERPES VIRUSES During the viral lytic infection, herpes viruses rely largely on their

own replication enzymes. The lytic ongins of herpes simplex virus type 1 (HSV-1) are a

combination of three different origins located within the L (o r i~ ) and the S components

(orisl. oris2) of the genome (Stow, 1982; Kung and Medveczky. 1996; Graham et al.,

1978; Challberg, 1996). The linear double-stranded DNA genome of HSV-1 circularized

upon entry into the host cells, and has been proposed to replicate by a rolling-circle

mechanism (Garber et al., 1993; Skaliter et al., 1996). Interestingly. none of the identifie-

origins seems to be uniquely required for viral DNA replication. Deletion of o r i ~ or both

oris from the viral genorne has little effect on either the viral yield or viral DNA

accumulation in infected cells (Igarashi et al., 1993: Polvino-Bodnar et al., 1987).

suggesting that these origins are functionally redundant.

The sequences of o r i ~ and ons are closely related. Both contain binding sites for a

viral initiator protein, UL9, and an extensive inverted repeat sequence. o r i ~ consists of

two high- and two low-affinity UL9 binding sites adjacent to an A+T-rich sequence of

144 bp that can f o m a perfect palindrome (Lockshon and Galloway, 1988). whereas ons

is a 67-90 bp sequence containing three binding sites for UL9 and a central 18 bp A+T-

rich region. This A+T-nch region may function as a DNA-unwinding element (Challbeg

and Kelly, 1989; Wong and Schaffer. 1991; Harnmarsten et al., 1996; Elias and Lehman,

1988). The core sequence of onS also contains a binding site for a cellular factor, OF-1.

Binding of OF-1 to the origin appears to be -1portant for ongin function in a transient

replication assay (Dabrowski et al., 1994). Mutations that elirninate OF- l binding also

diminish the replication efficiency of origin-containhg plasmids (Dabrowski et al., 1994).

Auxiliary sequences flanking the core sequence contain a number of binding sites for the

cellular transcription factors such as SPI or NF1 (Lockshon and Galloway. 1988;

Dabrowski et al., 1994) and can stimulate the replication eficiency up to at least 50 folds

(Wong and Schaffer. 199 1 ; Dabrowski and Schaffer, 199 1).

Another member of the herpes virus family, human cytomegalovinis (HCMV), has

a more cornplex origin consisting of multiple elements. A 2 kb viral origin was identified

by Li vivo labelling of newly synthesized DNA in the presence of an elongation inhibitor,

gancyclovir (Hamzeh et al., 1990; Anders et al., 1992). The identified origin, which bevs

no homology to any previously identified herpes virus origin contains a core element

consisting of a number of repeats, regions of dyad symmeay and cellular manscription

factor binding motifs (Anders and Punturieri, 1991; Masse et al., 1992). The most

distinguishing feature of the HCMV origin core is the existence of an oligopyrirnidine

stretch (Y block) that is essential for the origin function (Chaltberg, 1996). No HCMV

encoded protein has yet been shown to bind specificaily to this origin sequence.

Herpes simplex virus c m establish a latent infection in postmitotic neurons during

which no viral DNA replication can be detected (Challberg, 1996). However, Epstein-Bm

virus (EBV) replicates during latency in dividing B cells. During latency, EBV replication

relies alrnost entûeiy on the host replication system. Only a single EBV encoded protein.

EBNA 1. functions during replication initiation by its interaction with the latency-specific

replication origin. oriP (Hsieh et al., 1993; Yates er ai.. 1985; Yates and Guan. 199 1;

Yates et al., 1984). oriP consists of two groups of multiple EBNA1 binding sites (Gahn

and Schildkraut, 1989; Harrison et al., 1994). One goup contains four EBNA 1 binding

sites. arranged in a dyad symmehy (DS), while the other goup has an array of twenty 30

bp repeats which are sites for the high-affinity EBNA 1 binding. The 30 bp repeats may be

responsible for the maintenance of the EBV genome in mammalian cells dunng latency

(Krysan et of.. 1989). DNA replication usually stans from the DS region and moves

bidirectionally (Gahn and Schildkraut, 1989; Wysokenski and Yates, 1989; Harrison et

al., 1994). However. replication can aiso initiate from other locations on the viral genome

(Little and Schildkraut, 1995). In Raji cells, an irregular initiation zone covers an expansr

of at least 50 kb (Little and Schildkraut, 1995; Gussander and Adams, l984), suggesting

that EBV might have a sirnilar initiation mechanism as mammalian chromosomes.

III. DN A Replication Initiation in Baculovirus

A. AcMNPV and its Genome

Autographa caiifornicn rnulticapsid nucleopolyhedrovirus (AcMNPV), the most

well-characterized baculovims, belongs to the DNA virus family Boculoviridae, which

consist of a diverse group of viruses pathogenic for anhropods, particularly insects of the

orders Lepidoptera, Hymenoptera. Diptera. Coleoptera, Thysanura and Trichoptera.

(Blissard and Rohrmann, 1990). By far the majonty of baculovims isolates are from the

Lepidoptera. Baculoviruses usually have very resaicted host ranges; each virus member

infects one or few numbers of host species. Productive viral infections occur only in

invertebrates; no member of this family is known to infect vertebrates or plants although

occasionaily virus particles do penetrate cells of these organisms (Ignoffo, 1975; Groner,

1986). However, viral DNA replication or gene aanscnption does not appear to take place

in a non-host ce11 (Ignoffo and Rafajko. 1973; Heimpel. 1966; Bmsca et al.. 1986).

Unlike most baculovinises, AcMNPV has a very unusual host range that includes

at least 32 species in 12 families of insects (Granados and Williams. 1986). Some species,

e.g., Spodoptera jhcgiperda. are highly susceptible to AcMNPV infection. The infected

insect larvae usually die with typical symptorns of the nuclear polyhedrosis disease (Vail

and Jay. 1973). AcMNPV replicates in the infected ce11 nuclei. The viral early gene

expression occurs immediately after entry of the virus into the cells, and is followed by

initiation of viral DNA replication at approximately 6 h post infection u j i a et al., 1979).

The late and very late gene expression follows DNA replication and involves the

production of two phenotypes of progeny vhses . One, responsible for the secondary

infection of the host cells. is the budded virus (BV), which is also the infectious form for

cultured insect cells. The second is the occluded virus (OV) that is occluded in large

crystals of viral polyhedrin protein and is the infectious f o m for host insects (Blissard and

Rohrmann. 1990). The budding of progeny viruses from the nuclear envelope begins at

12 hours post infection. Mature progeny virions appear as early as 12- 18 hours post

infection (Granados and Lawler, 198 1 ; Granados and Williams, 1986).

Mature BVs contain individudy enveloped r d shaped nucleocapsids, within each

of which is packaged the viral genome. Packaged viral DNA is associated with a highly

basic protein, p6.9. The DNA and p6.9 appear to exist in the form of a ughtly wound

helicoid smicture (Revet and Guelpa, 1979; Wilson and Miller. 1986; Wilson er al., 1987:

Wilson, 1988; Wilson and Pnce, 1988), enabling the large supercoiled DNA genome to be

condensed and packaged. The p6.9 protein. however, appears to be not essential for

infectivity since the purified viral DNA is infectious when transfected into insect cells

(Carstens et al., 1980).

The purified viral DNA is a closed circular, double-stranded DNA of 134 kb

(Sumrners and Anderson, 1973; Tjia et al., 1979; Ayres et al., 1994). The complete

nucleotide sequence analysis of AcMNPV DNA reveals an overall A+T content of 59%

and potential capacity for encoding over 150 polypeptides (Ayres et al., 1994). A

distinctive structure of AcMNPV genome is the presence of eight A+T-rich homologous

repeats ( h m ) (hrl, hrla. hr2. hr3. hr4a, hr4b, hr4c and hr5) interspersed around the

genome (Fig. la) (Cochnn and Faulkner. 1983: Guarino and Sumrners. 1986a: Guarino

et al., 1986; Ayres er al., 1994). Each hr contains two to eight highly conserved repeated

sequences of about 72 bp with a 30 bp imperfect palindromes situated at its center. The 30

bp imperfect palindrome has an E c o N site (except h r l c ) ar the rniddle (Guarino et al.,

1986). Because of the syrnrnetric location. the high A+T content and the palindromic

structure. hrs were originally suggested to be viral DNA replication origins (Cochran and

Faulkner. 1983).

B. Baculovirus Putative Replication Origins

Evidence to support the speculation about the ongin function of hrs has corne frorn

studying the replication of bacterial plasmids carrying hrs in baculovirus infected cells

(Pearson et al.. 1992; Kool et al., 1993a; Kool et al., 1993b; Leisy and Rohmann. 1993).

A single palindrome with an essential EcoRI-core site (except hr4c) is sufficient for

supporting plasrnid replication although the number of palindromes seems to affect the

relative replication efficiency (Pearson et al., 1992; Leisy et al .. 1995). In addition, after

40 undiluted serial passages of AcMNPV, sequences flanking hrl , hr3 and hrS were

retained as supennolar fragments in EcoRI digests of defective viral DNA genomes,

suggesting the retention of hrs and flanking sequences in defective viral genomes (Kool et

al., 1993a; Kool et al., 199 1).

In contrast to this observation, after 81 passages of AcMNPV, short non-hr

sequences were retained as multiple repeats in defective genomes. These sequences are

derived mostly from the HiiidIII-K regions of the AcMNPV genome (Lee and Krell.

1992). As well. plasrnids carrying the HindIII-K fragment or regions of the HindIII-K

fragment replicated in the virus infected cells (Kool et al.. 1994b). suggesting that regions

within the HindIII-K fragment rnight also function as the putative orighs. Although there

is no sequence homology with hrs, the HitidIII-K fragment does contain two imperfect

palindromes. an A+T-rich region and several repeated motifs. However. unlike the

palindromes and repeats in hrs, these essential elements in the HindIII-K region do not

initiate DNA replication without auxiliary sequences (Lee and Krell. 1992; Kool et al..

1993b; Kool et al.. 1994b). The identification of the putative origins, both hies and the

HiridIII-K region, suggests that baculovirus may use multiple sites for replication ongins.

In this way. the vins may increase the opponunity for the formation of a preinitiation

cornplex.

In addition to the specific replication of plasrnid DNA containing hrs or the

HiridIII-K fragment in the infected cells, it has also been demonstrated that plasmids

without baculovhs inserts replicated when they were cotransfec ted with viral DNA into

insect cells (Guarino and Sumrners, 1988; Yu, 2990; Kool et al., 1994a; Lu and Miller,

1995). The mechanism of this replication has not k e n investigated and the basis for this

plasmid DNA replication is unknown although it was speculated that this replication rnight

result from the acquisition of hrs by recombination dunng the co~ansfection process

(Kool et al., 1995).

C . Genes Involved in DNA Replication

Genetic studies of temperature sensitive mutants have identified two genes (ie-I

and p143) which are essential or important for the viral DNA replication. A point mutation

within pl43 abolished viral DNA replication at the non-permissive temperature (Gordon

and Carstens, 1984), while a point mutation within ie-I delayed the initiation of viral

DNA replication (Miller et al., 1983). Using a transient replication assay, several other

viral genes that are essential for minimal levels of replication of a hr2-containing plasrnid

have also been identified (Kool et al.. 1995; Kool et al., 1994a). These genes include

dmpol, lef-1. lef--2 , 16-3 and p35. Two genes, i e - and pe38, dthough not essential, are

stimulatory for this replication process (Kool et al.. 1994). The vims also encodes apcna

(proliferating cell nuclear antigen) p n e (O'Reilly et al., 1989; Crawford and Miller,

1988). homoIogous to the rat pcna gene, and a putative alkaline exonuclease gene whose

putative product contains four short conserved domains present in the alkaline exonuclease

of herpes sirnplex vinise-1 (Ayres et al., 1994). However, these genes do not appear to be

necessary or even stimulatory for the replication of hr-containing plasmid in the

cotransfected cells (Kool et al., 1994a).

1. ie- 1 gene

The product IE- 1, of the immediate early ie-l gene. is a multi-functional protein. It

both transactivates the expression of most viral early genes (Guarino and Summers,

1986b), and suppresses the expression of ie-0 and ie-2 (Carson et al., 1991; Kovacs et

al., 1991). When cotransfected with plasmids containing a variety of baculovinis early

gene promoters. ie-l gene activates transcription from these promoters, and this activation

is greatly enhanced in the presence of hrs. IE-1 binds to hrs and it appears that the

dimeriration of IE-1 occurs before its binding to hr palindromes (Rodems and Friesen,

1995). E- 1 is essential for virai DNA replication (Miller et al., 1983; Ribeiro et al., 1994)

and late gene expression (Passarelli and Miller, 1993b). However. it is not clear whether

IE-1 is direcrly involved in the replication initiation process, or simply is required for the

expression of other viral early genes. IE-1 may function as a replication initiator by its

interaction with hrs. Functional dissection of E l identified a transactivation domain in the

N-terminal portion (Guarino and Sumrners, 1986b; Kovacs et al., 1992; Lu and Carstens,

1993) and a DNA binding domain in the C-terminal portion of IE-1 (Guarino and Dong.

199 1; Leisy et al., 1995; Choi and Guarino, 1995a; Choi and Guarino, 1995b).

2. dnopol gene

The product of the baculovinis DNA polymerase gene contains motifs that are

conserved arnong a number of DNA polymerases (Wang. 199 1). This gene is essential for

the replication of the hr-containing plasmid in plasmid cotransfected cells (Kool et al.,

1994a). However, in another slightly different condition, dnupol appears to be

dispensable. This may suggest that under certain conditions host DNA polyrnerases can

functionally complement the viral DNA polymerase (Lu and Miller, 1995). AcMNPV

DNA polymerase could be a glike polymerase since a 3'+ 5' exonuclease activity of

DNA polymerase 6 is tightly associated with the DNA polymerase of B. mori NPV, a

close relative of AcMNPV (Kelly. 198 1; Wang and Kelly, 1983; Mikhailov et al., 1986).

This concept seems to be supponed by the identification of a viral pcna g n e (Crawford

and Miller, 1988; O'Reilly et al.. 1989). whose product may be a processivity factor

associating with viral DNA polymerase.

3. pl43 gene

The viral pl43 gene is the only gene in addition to ie-I demonstrated to be

essential for viral DNA replication both in vivo and in the transient replication assay (Lu

and Carstens, 1991; Kool et ai., 1994). A point mutation within the open reading frarne of

Pl43 (Methionine to Valine 934) in a temperature sensitive mutant eliminates viral DNA

replication and late gene expression at the non-permissive temperature (Lu and Carstens.

1991). Like IE- 1, Pl43 is a multi-functional protein which also plays a role in the

determination of baculovirus host range (Maeda et al., 1993; Croizier et al., 1994). Pl43

was speculated to be a DNA helicase. The C-terminal region of Pl43 consists of seven

motifs which are conserved among proteins with nucleic acid unwinding activity. while its

amino teminus includes a modifieci leucine zipper motif. P143 also contains a consensus

purine hphosphate binding sequence, a helix-tm-helix structure and a putative nuclear

localization signal. Consistent with its putative role during replication. Pl43 is localized to

the nucleus of infected cells, binds to double-saanded DNA in a sequence non-specific

fashion and is detected in infected cells by 3 hours post infection. well before the time of

initiation of viral DNA replication (Laufs et al., 1997).

4. lef- 1 . 2 . 3 genes

The lef-1, Iej2 and le-3 genes. originally identified as essential for the expression

of viral late genes, are also required for DNA replication in transient replication assays

(Passarelli and Miller, 1993a; Passarelli and Miller, 1993b; Li et al., 1993; Kool et al.,

1994a). The specific functions of lef-I and ief-2 genes in the process of DNA replication

are unknown but LEF-1 interacts with LEF-2 in biochemical assay conditions. suggesting

that they may form functional heteroligomers in the infected cells. LEF-1 contains a

pnmase motif (WVVDAD) which appears to be essential for its function to support DNA

replication. LEF-1 may be a pnmase with LEF-2 as one of its cofactors (Evans et al.,

1997). The product of the lef-3 gene , LEF-3. a single stranded DNA binding protein

(Hang et al., 1995). foms a homotrimer under biochemical assay conditions (Evans and

Rohrmann, 1997).

5. p35, ie-2 and pe38 genes

The p35 gene. shown to be only stimulatory for plasmid DNA replication in one

case, appears to be essential in another (Kool et al., 1994a; Lu and Miller, 1995). These

conflicting observations could be due to variations in experimentai conditions such as

different times in harvesting the infected cells. P35 could be essential since infected cells

may go through a high degree of apoptosis at late stages of infection (3 days post

infection). P35 is an inhibitor of AcMNPV-induced apoptosis in insect cells. The

requirement of P35 for plasrnid DNA replication suggests that the cellular apoptosis may

be induced either by the viral repiication factors or by the replication of the plasmid DNA

itself. The ie-I gene product seems to be one of the factors that can induce the apoptosis

(Pnkhod'ko and Miller, 1996). Other possible roles that P35 may play during DNA

replication are not clear although it also functions as an early gene transcriptional activator

(Gong and Guarino, 1994).

The ie-2 and pe38 gene are functionally involved in the process of stimulating

early gene transcription. The products of both genes uansactivate early gene transcription;

pc38 stimulates the expression of p l43 and ie-2 stimulates the expression of both ie-l

and pe38 gene (Lu and Carstens, 1993; Yoo and Guarino, 1994b; Yoo and Guarino,

1994a). Consistent with their transactivation function, ie-2 and pe38 also stimulate the

DNA replication process in nansient replication assays. Presumably the enhancement in

DNA replication is due to the stimulatory effect of i e - and pe38 on the expression of

replication genes.

6. pctla and putative exonuclease genes

Sequence analysis of baculovims genome revealed the existence of a homologue of

the eukaryotic PCNA gene. The predicted product of the baculovinis pcno gene shares

42% amino acid sequence identity to rat PCNA. However, this gene does not appear to be

essential for DNA replication both in the transient replication assay (Kool et al., 1994a)

and the virus infected cells (Crawford and Miller, 1988). Deletion of this gene from the

viral genorne does not delay the viral DNA replication itt vivo although the viral late gene

expression seems to be delayed (Crawford and Miller. 1988). suggesting that either a host

homologue of potu gene can substitute for its function or the virus DNA polymerase does

not require such a cofactor during DNA replication.

Sequence analysis of the viral genome also revealed the existence of a putative

alkaiine exonuclease gene, whose predicted product contains four short conserved

domains that are present in the alkaline exonuclease of herpes simplex virus (Maninez et

al., 1996). This gene is also not essential for plasmid DNA replication in cotransfected

ceils. No host factor that may be involved in the process of viral DNA replication has yet

k e n identifid

D. Baculovirus DNA Replication and Gene Transcription

Baculovinis gene transcription is categorized into early, late and very late phases.

The process of viral transcription is largely sequential: expression of early genes occun

before virai DNA replication and does not depend on the replication of the viral genome,

while the expression of late and very late genes follows viral DNA replication and requires

complete replication of the viral pnome (Carstens er al., 1979; Rohel and Fauher, 1981;

Huh and Weaver, 1990a).

The virai immediate early genes such as ie-1, i e - orpe38 are the frst genes to be

expressed upon virus infection, and can be expressed in the absence of any vin1 factors

(Guarino and Summers, 1986b; Chisholm and Henner. 1988; Krappa et al., 1991: Yoo

and Guarino. 1994a; Krappa et al., 1995). The products of these immediate early genes

are transcnptional regulators of other viral early genes (Carson er al.. 1988; Yoo and

Guarino. 1994b; Lu and Carstens, 1993). IE-1 appears to be essential for both the gene

transcription and DNA replication (Ribeiro et al., 1994) and these functions are closely

associated with the virai hrs. IE-1 interacts with hrs and this interaction was demonstrated

using gel retardation assays, in which the mobility decrease of the Iir fragments depends

on the expression of the ie- I gene, either from a msfected plasmid carrying the ie-1 gene

or from an N i vitro t~anslation product of the ie-I gene (Choi and Guarino. 199%; Choi

and Guarino, 1995b).

The minimal sequence for IE-1 binding is half of a 30-mer h r palindrome;

however, this minimal binding does not seem ro be functional in both DNA replication and

transcription enhancement (Leisy et al.. 1995; Rodems and Friesen. 1995). A functional

interaction benveen IE-1 and hrs , in both cases, requires the binding of the pre-dimerized

IE-1 to a complete 30-mer h r palindrome (Rodems and Friesen, 1995). As well, the

spacing benveen the dimerized IE- 1 seerns to be important. Small insertions or deletions at

the center of the palindrome result in the loss of activities in both the replication and the ie-

I dependent transactivation (Rodems and Fnesen. 1995).

In contrast to viral early gene expression, viral late p n e expression does not occur

if viral DNA replication is inhibited (Rice and Miller, 1987; Huh and Weaver. 1990b). A

point mutation in the viral pl43 gene of ts8 mutant abolishes both DNA replication and late

gene transcription, while early gene transcription rernains unaffected (Lu and Carstens,

1991; Lu and Carstens, 1992). The mechanism for the switches from viral DNA

replication to late geene expression is not clear.

E. Possible Replication Mechanisms

Analyses of the structure of defective viral genomes carrying the viral HindIII-K

region suggests that baculovims may use a rolling circle mechanism to replicate its

genome. After 81 undiluted serial passages of the virus. the viral genome was analyzed by

pulse field gel electrophoresis and it reveaied that multiple copies of a srnall viral sequence

of less than 2.8 kb were hybndized to the HindIII-K region (Lee and Krell, 1992).

indicating a possible concatemenc DNA structure in the defective genomes. Consistent

with this observation, plasmid DNA canyùig hrs and coreplicating with the viml DNA in

infected cells was in the f o m of a head-to-tail concatemer, a typical product of rolling

circle replication (Leisy and Rohmiann, 1993).

Another aspect related to mechanisms of baculovims DNA replication is the

spontaneous incorporation of host DNA fragments into the viral genome during

replication. Host DNA sequences have been identified by phenotype changes due to

insertions into viral structural genes. For example, when screened for the phenotype of

polyhedra number. baculovirus appears to have a high potential to be converted into few

polyhedra per infected ce11 phenotype (FP). The FP phenotype usuaily arises rapidly and

accounts for 65% of the total virus by the 5th passage, 90% by the 10th serial passage,

and 100% by the 20th passage (Potter et al., 1976; MacKinnon et al., 1974). Even using a

plaque-punfied virus isolate as the original inoculum or using a lower multiplicity of

infection (0.01) to passage vinises, the FP phenotype still steadily rises to 90% by the

20th serial passage (Potter et al., 1976: Wood, 1980).

B iochemical characterization revealed that in most cases, the FP p henotype was

due to the insertion of host cellular sequences into distinct loci on the viral genome. the

HiridIII-1 or the 25k gene region (Fraser and Hink. 1982; Fraser et al., 1983). Eight out of

the nine FP mutants analyzed had the host DNA insertion in this region (Fraser er al..

1983). The inserted host sequences appear to be highly repeated sequences of different

origins. In another case, two FP mutants carried insertions of host DNA in the viral

HimiIII-K region. The host insert in this case was a copia-like transposon element (Potter

and Milier, 1980; Milier and Miller, 1982).

Analyses of baculovirus polyhedra morphology mutants identified M5, a mutant

with one large cuboidal occlusion body per infected ce11 nucleus (Carstens, 1982;

Carstens, 1987). M5 has two 290 bp insens at 2.6 and 46 map units on the viral genome

(Carstens, 1987). These inserts are likely denved from the host genome as well. The

primary sequence of the inserts revealed characteristics similar to the termini of

transposons (Carstens, 1987). The frequent integration of foreign DNAs into the viral

genome may reflect aspects of the viral DNA replication process.

III. Rationale

Research interests in the genorne replication of baculovinises grow with increasing

interests in the application aspects of baculoviruses. As potential biopesticides, naturally

occumng baculoviruses pose no foreseeable hazards to human health or the environment

The virus replication is generally species specific so the nsk to non-target insects is low

(Groner. 1986). However, the relatively slow action of baculovinises as an insecticide (5

to 15 days post infection to kill insects) is one of the major weaknesses. One solution to

this problem is to insen insecticidal genes such as toxins into the viral genome so that the

v ins would kill insects quicker or at least stop insect feeding (Carbone11 et al., 1988;

Chejanovsky et al., 1995; Tomalski and Miller, 1991 ; Stewart et al., 199 1). However, the

release of engineered baculovinises expressing toxins raises concems of potential hazard

to the environment since possible evolvement of the virus host range may bring toxin

genes to other insect species (Coghlan, 1994). Although curren tly no scien tific evidence

backs these womes. future development of new generations of baculovirus pesticides may

need to focus on the viruses themselves and find a way to enhance the virus replication

cycle. Factors involved in the viral genome replication could be one of the targets for

engineering.

Baculovinises have relatively narrow host ranges, but an efficient biopesticide

would infect a broad range of pests, while remaining safe to beneficial insects. Viral

proteins regulating the replication of the viral genome are likely one of the factors that

restrict the productive infection of baculoviruses to certain host cells. For example, the

viral replication factor Pl43 is also a host range determinant (Karnita and Maeda, 1997;

Kondo and Maeda, 1991; Croizier et al., 1994). A single amino acid substitution within

Pl43 (from Ser564 to Asn) extended the host range of AcMNPV to non-permissive B.

mori cells (Kamita and Maeda, 1997). Engineering of baculovinis for a broader host range

would require background information about the viral replication machinery. In addition,

as a safety precaution, interactions of baculoviruses with their hosts, CO-infectants or non-

hosts need to be closely monitored. Knowing the replication strategies of baculovinises

such as under what conditions the unexpected viral DNA replication may occur would add

to our confidence in the safe use of baculovirus pesticides.

Baculovimses have k e n widely used as expression systems particularly due to the

availability of the strong late polyhedrin p n e promoter (Miller et ai., 1982; Smith et ai..

1983). Although not directly involved in the process of late gene expression. genome

replication is a prerequisite for the efficient transcription of late genes. Understanding the

DNA replication mechanism would help to understand replations of the expression of late

genes. The genome replication of bacu!ovirus, albeit crucial to the v h s replication cycle.

is poorly understood. Little is known about how baculovinis replicates or maintains its

genome although large numbers of recombinant baculoviruses have ken. or are being

constructed and propagated in many laboratories.

An essential step in studying baculovinis DNA replication is to identify the ongin

of replication. Interactions between the origin and viral factors would help to identify and

characterize components of the viral replication machinery. As with other DNA vimses,

baculovinis may have a replication machinery with a helicase as its core (Borowiec. 1996;

Hassel1 and Bnnton, 1996; Boehmer and Lehman, 1997). Assembly of the helicase ont0

the origin could be the central issue in the initiation of the viral DNA replication.

Evidence from the infection-dependent replication assays indicates that baculovirus

may use hrs or the HindIII-K region as origins of replication (Pearson et al., 1992; Lee

and Krell. 1992; Washburn and Kushner. 1993). The question remains what feature

determines viral origins; is it a consensus DNA sequence, a common DNA structure such

as a palindrome or something else? Since hrs and HindIII-K region do not share any

sequence homology; the primary DNA sequence is unlikely a comrnon feature specifically

recognized by the replication initiator. Both hrs and HindIII-K region contain

palindromes. but these two types of palindromes function differently in the process of

initiation. A single palindrome within hrs is sufficient for the initiation of DNA replication.

whereas the palindrome within HidII -K is not (Pearson et al., 1992; Lee and Krell,

1992; Washburn and Kushner, 1993). Therefore, selection of initiation site in baculovinis

appears to be a complicated issue. Baculovims has a large genome, and only a small

portion has been scrutinized by the standard replication assay for potentid origin function.

If systematically tested, regions in addition to hrs and HindIII-K might replicate in this

assay. It is necessary to test multiple regions to search for any pcssible common feature

that wouid lead to the DNA replication.

Two of the identified virai replication factors, IE-l and P143, rnay potentially serve

as replication initiaton. Both proteins possess DNA binding activity; IE-1 binds to hrs,

while Pl43 binds to DNA in a sequence non-specific fashion (Rodems and Friesen, 1995;

Laufs et al., 1997). If IE-1 functions as the initiator, hrs would rnost likely be the

replication origins. The initiation of replication by IE-1 may involve the assembly of the

helicase, possibly P143. ont0 hrs. A direct interacaon benveen Pl43 and IE- I might exist.

On the other hand, if Pl43 functions as the initiator, its non-specific binding to DNA

rnight lead to the replication of multiple sequences. Pl43 rnight initiate replication from

specific sites. but the initiation would require the interaction of P l 4 3 with other factors

such as a DNA binding protein with sequence specificity or a structural protein organizing

the conformation of the viral genome. Possible roles of Pl43 and its interaction with other

viral replication factors might hold the key to understanding baculovirus replication

mechanisms.

The overall aim of this study was to investigate aspects of the initiation process of

baculovirus genome replication. Four different objectives were established. First. the

present study was to test whether his and HimiIII-K region were unique sequences

possessing the ability to initiate plasmid DNA replication in the standard replication assoy.

If they were not, multiple viral genomic regions would be scrutinized for additional ongin

function. The identification of alternative putative origins on the viral genome is necessary

before common feature among hrs, HitidIII-K or any other putative origin c m be defined.

This cornmon feature may reflect mechanisms of initiation, and would help to predict an

interaction between die origins and the initiator of the replication. The second objective

was to study the process of plasmid DNA replication in cells coaansfected with the viral

DNA. This process would also be compared with plasmid DNA replication in the infected

ceus. Possible differences in the regdation of initiation in the infected versus cotransfected

cells may reflect regulatory mechanisms involved in the viral DNA replication.

Understanding these mechanisms may eventually help to elucidate the viral replication

machinery. The third objective was to investigate possible interactions between viral

replication factors in the process of initiation. The viral putative helicase protein, P143,

was the focus of this study. Pl43 likely plays a cenaal role in the process of initiation.

The assembly of Pl43 ont0 replication origins may involve direct interaction of Pl43 with

other factors. Detection of this interaction in cells expressing viral replication factors

would help to reveal the organization of the viral replication machinery.

Finally, the fourth objective of this study was to examine the possible mechanism

used by the virus to replicate its DNA. The process of initiation is also closely associated

with the process of DNA replication. For example, T4 uses recombination dunng

replication and includes the use of free 3' ends of the replication intermediates as prirners

for the initiation of DNA synthesis (Mosig and Colowick, 1995; Mosig, 1987).

Examinarion of the mode of the DNA replication of baculovirus could help to elucidate

possible roles of the replication intemediates in the process of initiation. The mode of the

DNA replication would also provide the basis for designing il1 vivo approaches to identify

genuine origins in the future.

In general, results from this study would help to understand how the replication of

the baculovirus genorne is initiated by specific interaction between the virai cis-ac ting

replicators (oripins) and tl-ans-ac~g initiator or initiators.

MATERIALS AND METHODS

A. Cells and Viruses

The Spodopterafrugiperda continuous ce11 line, IPLB-SF-21 (SfX), established

from pupal ovaries of the Fa11 Army Worm (Vaughn et al.. 1977; Knudson and Tinsley,

1974). was maintained at 28'C by passage in TC-100 medium (Gibco-BRL)

supplemented with 10% heat-inactivated (56'C. 30 min) fetal calf serum (FCS) (Gibco-

BRL). Cells with a passage number between 100 to 200 were used in this study.

The Autogropha californico multicapsid nucleopolyhedrovixus (AcMNPV) strain

HR3, a plaque-purified isolate (Brown et al., 1979). was propagated by infection of SC1

ceIl monolayen with the budded virus (BV) (Erlandson er al., 1984) (m.0.i. of 0.01). The

infection was carried out in six-well tissue culture plates (0 35 mm, Coming) or flasks

(75 mm* or 150 mm?. Coming) in a minimal volume covering the ce11 surface area. After

being rocked gently for 1.5 h, the infected monolayers were washed three tirnes with TC-

100 medium. covered with fresh TC-100 supplemented with 10% FCS. and incubated at

28'C und harvesting.

Progeny virus was harvested from the infection supernatant by centrifugation at

380 x g (~orval l@ Econospin, Dupont) for 10 min to remove the ce11 debris. The

supernatant containine virus particles was collected, stored at 4 'C or, further purified by

centrifugation through a 5 ml 20% sucrose cushion (in 10 miM Tris-HC1. 1rnM EDTA. pH

7.5; TE) at 26.000 rpm (SW28, Beckman) for 45 min. The virus pellet was resuspended

in a minimal volume of TE buffer, then loaded onto a 25%-56% sucrose (in TE buffer)

gradient and centrifuged at 30,000 rpm for 90 min (SW60 Ti, Beckrnan). The visible virus

band was collected. diluted with TE buffer and recentrifuged at 30,000 rpm for 30 min

(SW60 Ti). The purified virus pellet was resuspended in TE buffer (Summers and Smith.

1987).

To titrate the progeny viruses, one million cells were seeded in each well of a six-

well plate, then infected with 500 pl of appropriately diluted virus suspension. The

infected cells were washed twice with TC-100 following the 1.5 h adsorption. covered

with 1.5 ml of mixture of TC-100. 10% FCS, 50 pg/ml of gentarnicin (Sigma) and 1.5 %

of melted (cooled to 37'C) low geiling temperature agarose (SEAPLAQUE", FMC Co.).

The plates were incubated at 28'C for 7 to 10 days until the formation of countable plaques

occurred (Brown and Faulkner. 1978). When recombinant viruses ca-g the bacterial

lac2 gene were tiaated, X-gal (5-bromo-4-chloro-3-indolyl-~D-galactosie) (Gibco-

BRL) was added to the agarose overlay in a final concentration of 100 p@d.

B. Cloning and Subcloning Viral DNA Fragments

The EcoRI site was deleted from pUC18 by digestion with EcoRI followed by

incubation with DNA polymerase (Klenow fragment) and reEgation to produce pUC18AE.

DNA fragments of AcMNPV carrying the h r l (HindIII-F), hrla (HindIII-O), hr2 (Psd-

J), hr3 (a 6.2 kb SsrI-HitzdIII fragment of SstI-D), hr4a (KpnI-D), hr4b (a 7.5 kb PsrI-

XbaI fragment of PstI-C) and hr5 (HindIII-Q) regions were directly cloned into

pUC18AE to produce pAchrl, pAchrla, pAcPstJ. pAchr3, pAchr4b and pAchr5. The

KpriI-D clone was further digested with Hi1rdII1. partially digested with EcoRI to retain

the right end 3.5 kb viral kagrnent containing EcoRI-Q and the hr4a region, then blunt

ended with Klenow DNA polymerase and religated to produce pAchr4a. The resulting

plasmids were digested with EcoRI to delete the hr sequences, then incubated with 0.5-1

units of S 1 nuclease (Pharmacia) at room temperature for 30 min in 26.7 mM Tris-HCl,

pH8.0, 30 mM CH3COOK, pH4.6,250 mM NaCl, 267 PM MgCl2, 1rnM ZnSOq, 5%

glycerol. The reaction was stopped by incubation at 65'C for 10 min. The S1 treated

plasmid DNAs were self-ligated to generate pAcAhr2 pAcAhr3, pAcAhr4a and pAcAhr5.

The AcMNPV HindIII-F fragment was cloned into pUC18, then this plasmid was

digested with Cl01 and religated to generate pAcAhrl.

Subclones (pAcHE4.3 and pAcie2pe38) of the left end flanking hrl and a 1.7 kb

EcoRI-ScaI fragment of pAcHE4.3 [pAcHE4.3(ES)] have been previously descnbed (Lu

and Carstens, 1993). The 2.6 kb PstI-N fragment of AcMNPV was cloned into pUC18

to generate pAcPstN (Lu and Cantens, 1993). PstI digestion of pAcHE4.3 released a 1.5

kb PsrI fragment containing the pe38 gene, which was recovered and ligated into PstI

digested pUC18 to generate pAcPE38. A 2.5 kb HindIII-ScaI fragment of pAcHE4.3 was

cloned into pUC18 to produce pAcIE-2. The 1.5 kb HindIII-San fragment frorn pAcPstJ

was cloned into the HitidIII-Soli site of pBSK- to generate pAchr2. The 1.9 kb EcoRI-Q

and 1.4 kb EcoRI-S fragments of AcMNPV were cloned into pBR322 to generate

pAcHE65 and pAcp35. respectively. The 1.8 kb HbidIII-R fragment was cloned into

pUC19 to pnerate pAc39K. A 2.3 kb ScaI-XhoI fragment from pSTCHX-3 (Thiem and

Miller, 1989) was cloned into the SmaI-Safi sites of pUC18 to generate pAclef4. A 3 kb

HiridITI-XbaI fragment from Hindm-E was cloned into the HindITI-XbaI site of pUC18

to generate pAcp47. A 4.7 kb EcoRI-SspI fragment from EcoRI-D was cloned into the

EcoRI-SmaI site of pUC19 to generate pAcp143. A 1.4 kb EcoRI-Nrid fragment from

EcoRl-O was cloned into the EcoRI-SmaI site of pUC19 to generate pAclef1. pAclef2

was constructed by subcloning a 0.9 kb Mid fragment from the EcoRI-I region. The 0.9

kb Mird fragment was blunt-ended with the Klenow fragment of DNA polyrnerase. then

inserted into the SmaI site of pUC19. Plasmids carrying the ie-1 (pAciel). driapol

(pAcdnap) and lef-3 (pAcleD) genes were previously described (Guarino and Summers,

1986b; Tornalski et al., 1988; Li et ai., 1993). A plasmid containing the ie- I gene

promoter linked to the E. coli lac2 pene @IEl-lad) was a gift from Dr. P. Friesen. The

ie-l promoter was deleted from pIE1-IacZ by digestion with Smal and EcoRV and

religation of the 6.8 kb SmoI-EcoRV fragment to produce placZ(0RF). pIE1-P(CH) was

subcloned from pIEl-lac2 by inserting the 558 bp CloI-HincII fragment of the ie-l

promoter region into the ACCI-HindIII site of pBS (Stratagene) by blunt end ligation.

Plasmids pAchrl, pAchrla, pAchr2, pAchr3, pAchr4a and pAchr4b were digested

with EcoRI to elirninate palindromes within each individual hr, then ligated to a 4.0 kb

EcoRI fragment carrying the ie-i promoter driving E. coli lac2 gene (isolated by partial

digestion of pIE l -lac2 with EcoRI) to generate pAcAhrl -1acZ. p AcAhr l a-lac2 pAcAhr2-

IacZ. pAcAhr3-lacZ. pAcAhr4a-lac2 or pAcAhr4b-lacZ. A 4.5 kb HindIII-BamHI

fragment frum plEl-lac2 was cloned into the Bgm-HindIII site of the EcoRI-P fragment

contained in pAcEcoFü-P (vector pUC8 ) to generate pAcEcoRI-P-lacZ.

Various regions of the ie-I promoter were subcloned h m pIE1-P(CH) (3.3 kb).

The 1.1 kb SspI fragment of pIE1-P(CH) was ligated to a 1.8 kb SspI-PvuII fragment of

pIEI-P(CH) to generate plEl-P(CS) (3.0 kb). Digestion of pIEI-P(CH) with AflIII and

religation of the 2.7 kb fragment generated pIE1-P(CA) (2.7 kb). A 0.4 kb PvuII

fragment from plEI-P(CS) was ligated with a 2.4 kb PvuII fragment of pIEI-P(CH) to

generate pIEI-P(CP) (2.8 kb). Digestion of pIEI-P(CH) with NheI and AflII, filling in

with DNA polymerase 1 (Klenow) and ligation generated pIE1-P(CN) (2.5 kb). Digestion

of pIE1-P(CH) with NheI and EcoRI, filling in with DNA polymerase 1 (Klenow) and

ligarion generated pIE1-P(NH) (3.1 kb). Ligation of the 2.4 kb and 0.5 kb PWII

fragments from pIE1 -P(CH) generated PIE 1 -P(PH) (2.8 kb). Digestion of pIE 1 -P(CH)

with Ml141 and EcoRJ followed by filling in with DNA polymerase 1 (Klenow) and ligation

yielded pIE1-P(AH) (2.9 kb). Digestion of pIE1-P(CH) with SspI and religation

generated pIEI-P(SH) (2.2 kb). The 0.3 kb PruII fragment of pIE1-P(NH) was ligated

with a 2.4 kb P\uII fragment of pIE1-P(CH) to generate pIE1-P(NP) (2.6 kb). Digestion

of pIE1-P(PH) with AmII and religation generated pIE1-P(PA) (2.3 kb). Digestion of

pIE1-P(CS) with EcoRI and MluI, filling in with DNA polymerase 1 (Klenow) and

religation generated PEI-P(AS) (2.6 kb).

The expression vector pIElhr/PA, a gift from Dr. P. Fnesen. contains hr5 and the

upstream region of the ie-1 gene (Cartier et al.. 1994). Both p i 4 3 and lef-3 ORFs were

cloned behind the ie-l promoter in this vector. The cloning of PIE 1 hrP143 was descnbed

elsewhere (Liu, 1997). pIElhrLEF3 was cloned by PCR amplification of the lef-3 gene

region in pAclef3 by using two primers: 5' ACGGATCCATGGCGACCAAAAGATCTT

3' and 5' GACAGCCTGATCTGCAATAGGATCCAT 3'. The 1363 bp PCR product

containing the ORF and Poly(A) signal of the Ief-3 gene was digested with BamHI, then

inserted into the B g m site of pIElhr/PA.

The Eschericio coli strain DHSa (Gibioco-BRL) was used as the host strain for

DNA cloning and subcloning. Competent DHSa cells were prepared and mnsformed by

two different methods. In the first method, four to five colonies of bacteria were

inoculated into 30-100 ml of SOB (2% tryptone, 0.5% yeast extract, 8.6 mM NaCl, 2.5

rnM KCI, 10 rnM MgCI2, pH7.0) containing 20 rnM MgS04 and grown at 37 OC for 2.5

to 3 h to an OD6w of 0.7. The cells were pelleted at 4000 rpm (JA-14, Beckman) for 10

min, then washed once in 20 ml of FSB buffer (10 rnM CH3COOK. pH7.5, 45 mM

MgCl2, 10 mM CaC12, 100 mM KCI, 3 mM hexaminecobalt chloride, 10% glycerol) and

resuspended in 4 ml of FSB. The ce11 suspension was mixed with 280 11 of DMSO and

quickly aliquoted and frozen at -70°C (Hanahan, 1983). For transformation, 100 p1 of the

chemically treated ceils, mixed with DNA, was incubated on ice for 30 min, then treated at

45'C for 45 seconds, followed by incubation at 37OC for l h in SOC (SOB plus 20 rnM

glucose). Recombinant colonies were plated on agar plates (0100 mm, Coming) of Luna-

Benani medium (1% tryptone, 0.5% yeast extract, 1% NaCI, pH 7.0; LB) containing 100

j.~/m.i of ampicillin (Sigma). and incubated at 37 OC for 12 to 18 h.

DHSa ceils were aiso transfonned by electroporation. To prepare competent cells,

a single colony of bacteria was inoculated into 10 ml of LB and grown ovemight at 37 OC.

The ovemight culture was inoculated into 1 L of LB medium and incubated at 37 'C for 2

to 3 h to an OD600 of 0.8. Cells were then pelleted by centrifugation at 4000 rpm (JA-14)

for 10 min. The pellet was washed twice with ice cold Hz0 (1 L and 500 ml) and once

with 10% glycerol (in H20) (20 mi), then resuspended in 2 ml of ice cold 10% glycerol (in

H20). The resuspended cells were quickly frozen and stored at -70°C in 50 pI aliquots.

For electroporation. the DNA was first desalted by mixing with 300 pl of 6 M sodium

idodide, 3 pl of glass powder (Vogelstein and Gillespie, 1979) and incubation on ice for

15 min. After cenûifugation at the maximal speed (microcentrifuge. Eppendorf) for 30

seconds, the glass powder was washed twice with 10 mM Tris-HC1,OS mM EDTA. 500

rnM NaCl. 50% ethanol, pH7.4 and the DNA, bound to the glass powder, was eluted

with 20 pl of H 2 0 by incubation at W C for 5 min and centrifugation at the maximal

speed (microcentrifuge, Eppendorf) for 30 seconds. The DNA supernatant was collected

and used for electroporation. Electroporation was perfomed in 0.1 cm cuvettes using an

ElectroPorator (Invitrogen Co.). Cornpeten t cells, mixed with desal ted DNA. were

elecaoporated at 1,50OV, 150 R, 50 pF and 5-8 milliseconds. Transfomed bactena were

resuspended in 1 ml SOC and incubated at 37'C for 1 h, then plated on ampicillin (100

pg/ml) agar LB plates.

To screen for recombinant clones, single colonies of transformants. grown

overnight on ampicillin LB agar plates, were picked and dissolved in single colony

preparation buffer [2% Ficoll. 1% SDS, 0.01% bromphenol blue and 1% sucrose in TBE

buffer (90 m M Tris-borate, 2 rnM EDTA, pH8.3)J. The bacterial lysates were directly

loaded ont0 agarose gels and electrophoresed to detect transfonnants carrying plasmid

DNA.

The alkaline lysis method (Bimboim and Doly, 1979) was used to prepare plasmid

DNA from 1.5 ml (Mini prep) or 100 ml (Maxi prep) of overnight-grown bactenal culture.

Bacteria were pelleted at 4.000 x g for 10 min, then resuspended in 200 p1 (Mini prep) or

10 ml (Maxi prep) of 50 mM Tris-HCI, pH8.0, 10 mM EDTA, 100 p d m l RNase A

(Gibico-BRL) and incubated at room temperature for 5 min. After the addition of 200 pl

(Mini prep) or 10 ml (Maxi prep) of 0.2 N NaOH, 1% SDS, the bactenal suspension was

mixed and irnrnediately precipitated by the addition of 200 pl (Mini prep) or 10 ml (Maxi

prep) of ice cold 3 M CH3COOK, pH 5.5. Following 15 min of incubation on ice. the

precipitated chromosomal DNA complex was removed by centrifugation at 12.000 x g for

30 min. The plasmid DNA contained in the supernatant was directly precipitated by the

addition of 2 volumes of 100% ethanol (Mini prep) or further purifieci by QIAGEN-tip-

500 (Qiagen Inc.) according to the manufacturer's insmiction. The precipitated DNA was

bnefly dried and redissolved in TE buffer.

Al1 clones were confmed by restriction enzyme mapping. Al1 clones carrying hi-

sequence deletions were confmed by DNA sequence analysis

DNA sequencing was performed by the Cortec DNA Service Laboratories, hc. at

Queen's University, Kingston. Ontario. using an AB1 PRISMTM Dye Terminator Cycle

Sequencing Kit (Perkin-Elmer Corporation, California) according to the manufacturer's

instructions.

C. Construction of Recombinant Viruses

For the constmction of recombinant viruses, regions containing hrs or the p l 0

gene region were first cloned into plasmids to produce pAchrl, pAchrla, pAchr2,

pAchr3. pAchr4a. pAchr4b and pAcEcoRi-P-lac2 as described above. The hr-containing

plasrnids were then digested with EcoN to destroy hrs. A 4.0 kb EcoRI fragment carrying

the ie-2 promoter driving E. coli foc2 gene (from pIE1-lad) was inserted into the EcoRI

site of hi-S. The resulting plasmids and pAcEcoR1-P-lac2 were then cotransfected

individually with viral DNA into insect cells to generate recombinant vimses (Pennock et

al., 1984). The E. coli P-galactosidase gene (lacz), inserted at each deleted hi- or the p l 0

gene region was expressed from the viral ie-l promoter and used as the selection marker

(reporter) for the selection of recombinant vhses. Progeny virions were harvested three

days after cotransfection and screened and pwified by 4 to 6 rounds of plaque assays. The

p ~ e d vimses were exarnined with restriction digestion and hybridization with a probe of

plasmid DNA carrying lac2 gene.

D. DNA Purification, Electrophoresis and Hybridization

Viral DNA was purifid ffom up to three 150 cm2 flasks (Coming) of infected ceii

supemarants. The budded virus was purified and concentrated by sucrose gradient

centrifugation. The purified virus was resuspended in 475 p1 of TE buffer. After the

addition of 25 pl of 10% SDS, 2 pi of Proteinase K (20 mghi) (Gibco-BRL), the virus

suspension was incubated at W C for lh. nie viral DNA was purified by Iwo extraction

of the suspension with phenol/chloroform fisoamyl alcohol (25: 24: 1). then dialyzing the

aqueous phase against TE buffer over 12 h with 4 changes of buffer.

For the purifilcation of total intracellular DNA, one million Sf2 1 cells. infected with

viruses or transfected with DNA, were pelleted at 6.000 rpm (Microcentrifuge.

Eppendorf) for 5 min. The ce11 pellet was washed once with PBS buffer (80 mM

Na2HP04, 20 m M NaH2P04. 100 mM NaCI, pH7.5), resuspended in 320 pl of

Proteinase K buffer (10 mM Tris-HCI, 5 rnM EDTA, pH7.8, 150 mM KCI. 0.5% SDS)

and incubated at 6S°C for 30 min. After the addition of 150 pl of 10% SDS and 20 pI of

Proteinase K (5 mg/mi), the sample was incubated at 65'C for 30 min, then extracted with

pheno1/cNorofor~isoarnyl alcohol (2524: 1) twice and chloroform/isoamyl alco hol(24: 1)

once. The total intracellular DNA was precipitated with 2 volumes of 100% ethanol and

redissolved in 100 11 of TE buffer (Gross-Bellard et al., 1973).

Purified DNA was electrophorized in 0.6%-0.7% agarose or 5% polyacrylamide

gel in TBE running buffer (90 rnM Tris-borate, 2 rnM EDTA. pH8.3) at 50 V for 3 to 12

h. Pulse field gel electrophoresis was perfonned in 0.7% agarose gel in TBE, at a constant

160 V with variable pulse times of 90 s for the frst 2 h followed by 15 s for the final 20 h.

The clamped homogeneous electric field apparatus @IO-RAD) were used. Following gel

electrophoresis, DNA samples were transferred to Q I A B R A N E ~ ~ nylon membrane

(Qiagen). DNA in agarose gel was transferred onto the membrane by downward capillary

movement with 0.4 N NaOH. DNA in polyacrylamide gel was transferred to the

membrane by electrophoresis in 0.5 x TBE at 50 V for 2 h.

DNA probes for hybridization were prepared by labeliing 35 ng of heat-denatured

DNA (100 'C. 5 min) with 50 jKi of a - 3 2 p - d m (ICN Biomedicals Inc.) by random

priming of DNA with hexadeoxyribonucleotides of random sequences (Feinberg and

Vogelstein, 1983). T'he reaction was carried out in 10 mM Tris-HC1, pH 7.5, 50 mM

NaCl. 10 mM MgCl2, 5 rnM DTT, 20 PM dNTPs (minus dCTP), 5 unitslml of

hexadeoxyribonucleotides of random sequences. and 10 U of the Kienow fragment of

DNA polymerase at 37'C for 30 min (Oligolabelling Kit, Pharmacia-LKB). The un-

incorporated dNTPs was separated from the labelled DNA by gel filtration using

sephedex@-~50 ~ i c k ~ M colurnn (Pharmacia-LKB). The specific activity of probes was

about 1-2 x 109 dpm/pg DNA.

DNA containing filters were prehybridized in 2 x SSC, 1 8 SDS, 135 pg/ml

denatured hemng spem DNA, 10% dextran sulphate at 68'C for 2 h. then hybridized ar

68'C overnight in 2 x SSC, 1% SDS. 100 pg/ml denatured hemng sperm DNA. 8%

dextran sulphate. The hybridized blots were washed three times in 2 x SSC. 0.5% SDS

and three times. 30 min each. in 0.1 x SSC, 0.5 % SDS, then exposed to

REFLECTION~~ Autoradiography fdm (DuPont) for 10 min to one week.

E. Protein Extraction, Electrophoresis and Imrnuno Detection

Total cellular proteins were extracted by direct resuspension of washed ce11 pellets

in sarnpling buffer (62.5 rnM Tris-HCI. pH6.8 at 25°C. 2% SDS, 10% plycerol. 0.0 1%

bromophenol blue, 42 mM DTT ) and heating the suspension at 100°C for 5 min.

Polypeptides €rom ce11 exrncts were separated by elecuophoresis through 10% resolving

(acry1amide:bis-acrylamide, 30:0.8; in 400 mM Tris-HCI. pH8.8, 0.1% SDS, 0.07%

ammonium persulphate. 0.007% TEMED), 4 8 stacking (acry1amide:bis-acrylamide.

30:0.8; in 125 m M Tris-HCl, pH6.8,0.1% SDS. 0.07% ammonium persulphate. 0.007%

TEMED) polyacrylamide gels. and running buffer (25 mM Tris-HCI. pH8.3, 192 mM

glycine and 0.1 % SDS) at 5- 10 mA with constant curent for 2-4 h (Laemmli. 1970). The

gel was stained with Coomassie brilliant blue (0.2%, dissolved in 50% methanol. 7 8

glacial acetic acid) and destained in 5% glacial acetic acid. 10% butanol. All chernicals

used in polyacrylamide p l electrophoresis were purchased from ICN Biomedicals Inc.

Broad range (2-212 kD) protein markers (New England Biolab) were used as the

molecular weight mobility markers.

For immuno detection of viral proteins, monoclonal antibodies àgainst Pl43 (RC-

2) (Laufs et al., 1997), IE-I (a gift from Dr. L. Guarino), LEF-3 (a gift from Dr. L.

Guarino), and P47 (Carstens et al., 1993) were used.

Proteins. separated on polyacrylarnide gel. were uansferred ont0 OPTITRAflM

membrane (Schleicher and Schuell Inc., New Hampshire) by electrophoresis in ETB

buffer (25 mM Tris-HCI, pH 8.3, 192 mM glycine, 0.1% SDS, 10% methanol) at 200

mA for 1.5 h. The membrane was blocked for 1 h at room temperature or ovemight at 4

OC in 5% skimmed milk powder in PBS, 0.1% Tween-20 (PBS-T), then washed three

times with PBS-T and incubated with appropriately diluted pnmary monoclonal antibody

for 1 h at room temperature. After three washes with PBS-T, the membrane was incubated

wi th goat ami-mouse anti body conjugated with horseradish peroxidase (1 : 20,000 dilution

in PBS-T, Jackson ImmunoReseach Laboratories. Inc. Pennsylvania) for 1 h at room

temperature, then washed three times in PBS-T. Immuno reactive proteins were detected

using the ECLTM western blottîng detection solution (Amersham). The cherniluminescence

due to oxidation of luminol, catalyzed by the peroxidase. was recorded on

REFLECTIONTM Autoradiography film (DuPont). If the membrane was reprobed, the

bound antibodies were stripped by submerging the membrane in 100 m M 2-

mercaptoethanol, 2% SDS, 62.5 mM Tris-HCI, pH6.7, and incubating at 55'C for 30

min.

F. Transfection and Replication Assays in SfZl Cells

Sf21 cells (1061, seeded into each well of a six-well plate for 4 h. were washed

three times with TC-100 before transfection. For transfection with only plasrnids. the

washed Sf21 monolayer was incubated with 0.5-2 pg of plasmid DNA. 10 pl of

LipofectinTM (Gibicol-BRL) (for transfection of one plasmid) in a total volume of 1 ml.

When multiple plasmids were used, the cells were mnsfected with 2-5 pg of each

plasmid. 60 pl of DOPE (1.2-dioleoyl-sn-glycero-phosphatidylethne) (Wang et

al., 1996) and TC-100 in a final volume of 0.7 ml at 28°C for 6 h. For cotransfection of

viral and plasmid DNA, 0.5 pg of viral DNA was mixed with 0.5-1 pg of plasrnid DNA

and 10 pl of LipofectinTM in a total volume of 75 pl. The mixture was added to the

washed ce11 monolayer in 1.5 ml of TC-100 and incubated at 28°C for 6 h. After the

removal of the DNA/Lipofectin mixture. cells were washed twice with TC-100. The

transfected cells were overlaid with fresh media w-100 supplemented with 10% FCS)

and incubated at 28°C for 48-72 h. In some cases, the transfected cells were infected with

virus for 1-1.5 h after various times after transfection at room temperature (rn.0.i. of 1).

The aansfected-infected cells were overlaid with fresh media (TC-100 supplemented with

10% FCS) and incubated at 28°C for 48 h (KooI et al., 1993b).

The replication of plasmid DNA in Sf21 cells was monitored by D p d digestion.

Plasmid DNA replicated in Sf2l cells is not methylated at GATC, and therefore is resistant

to DprlI digestion. Total intracellular DNA was digested with Dpn 1 (20 units) for 2-4 h,

the reaction was heat-inactivated at 85°C for 20 min (Pearson et al., 1992; KooI et d.,

1993b).

G . Immunofluorescence Microscopy

Sf21 cells seeded on to a coverslip in a tissue culture peui dish (035 mm,

Coming), were transfected with plasmids or infected with vixus. Eighteen to 24 h post

transfection or infection. the celis were washed with PBS and fixed by oeatment with 10%

paraformaldehyde for 10 min at room temperature, then premeabilized in methanol for 20

min at -20 OC. After washing three times with PBST, the cells were blocked for 1 h in 1%

goat serum (in PBST), then incubated with prirnary antibody for 1 h. Monoclonal

antibodies against Pl43 (RC-2) (1:100 dilution), LEF-3 (1500 dilution) and IE-l

(150,000) were used in this study. Following incubation with prirnary antibody, cells

were washed three tirnes for 5 min with PBST. then incubated for 1 h with 75 pl of goat

anti-mouse IgG conjugated with Oregon Green 488 (Jackson ImmunoResearch

Laboratories. Inc. Pennsylvania) (2 pg/d diluted in 1% goat serum). Following the

incubation, the coverslip was washed three times with PBST. Cell nuclei were stained

before mounting ont0 the slide with DAPI (4*,6-diamidino-2-phenylindole) (Molecular

Probes, Inc. Oregon) or propidium iodide. Both reagents were diluted with Slow Fade

bufferTM (Molecular Probes, Inc. Oregon) to a final concentration of 1 PM, and incubated

for 2 min with cells at room temperature. One drop of Slow ~ a d e m (Molecular Probes,

Inc. Oregon) was placed on the cells and the coverslip was placed face down on a

microscope slide for examination. In double-labelling experiments. the cells were

incubated with the monoclonal antibodies againsi LEF-3 (1500 dilution) for 1 h foilowed

by the goat anti-mouse IgG conjugated with Oregon Green 488 (2pgIrnl diluted in 1 % goat

serum). Then the polyclonal rabbit antiserum against P143, M78.28.2. 1:1000 dilution)

(Laufs et al., 1997) was added, followed by goat-anti rabbit IgG conjugated with

Rhodamine (Jackson ImrnunoReseach Laboratories, Inc. Pennsylvania) (2pg/ml diluted in

1 % goat serum). The stained cells were exarnined by a Leitz Aristoplan microscope (Leitz.

Toronto. ON) using an 13 k i t z band pass filter for Oregon Green 488 detection or an A

Leitz filter for DAPI stain. The confocal imaging of some of the stained cells was

performed on a Meridian confocal microscope using a 530 nm band pass filter for Oregon

Green 488 detection, a 590 nm band pass filter for Rhodamine detection and a 620 nm

band pass filter for propidium iodide stain. Photogaphs were taken on Kodak TMY 5053

film with 25-40 x objective lem. Color images were generated and analyzed with MCID

M4 software (Imaging Research. Brock University. St. Catharines. ON) with 100 x

objective lens.

H. Computer Assisted Data Analysis

The computer program Gene Consiruction Kitm (Textco Inc. New Hampshire)

was used to imitate and predict the actual DNA manipulation and cloning procedure based

on DNA sequences. The program MacvectorTM (Oxford Molecular Ltd.) was employed

for DNA sequence alignment and homology cornparison. X-ray films were scanned using

the Apple Color Onescanner and 0foto@ image program (Light Sources Computer Images

Inc.). The relative intensity of signals on X-ray films was determined using the public

domain computer program NIH Image (version 1.54). For graphic presentation of the

research data, the programs MacDraft version 3.01 (Innovative Data Design Inc.) and

Adobe Photoshop" 4 (Adobe System Inc.) were used.

RESULTS

A. Replication of Plasmids and Recombinant Viruses Carrying hr Deletions

Plasrnids canying baculovims hrs replicate in infected insect cells (Pearson et 01..

1992; Kool et al.. 1993a; Kool et ai., 1993b; Leisy and Rohmann, 1993). These results

suggest that hrs c m function as origins of replication on the viral genome. However. it is

not clear whether the replication of plasrnid DNA in the infected cells is dependent

exclusively on the presence of hrs, because the majority of the viral genorne has not k e n

tested by the transient replication assays. It is possible that regions other than h n may also

possess the ability to support the replication of plasrnid DNA in the infected cells. Indeed,

when a viral genomic region, the HindIII-K region, was tested in the replication assay.

efficient replication was detected (Kool et al., 1994b). These results suggs t that regions

in addition to hrs may serve as sites for replication initiation. To test this hypothesis,

sequences flanking hrs were examined for their replication ability.

A series of viral genornic regions carrying h r deletions were consmicted (Fig. Ib)

and tested in a transient replication assay (Kool et al.. 1993a; Kool et al., 1993b). Plasrnid

pAcAhr?. pAcAhr3 or pAcAhr4a contained sequences flanking hrs plus a single hr

palindrome deleted in the central EcoRI site. whereas pAcAhr5 contained hr j flanking

sequences plus only one half of a single palindrome. The plasmid pAcAhr1 had a complete

dektion of the hrl region from its flanking sequences by CIaI digestion. The replication

ability of these hr deletion plasmids was tested by rransfection of these plasmids into insect

cells and infection of the ceils with virus (m.0.i. of 1) at 6 h post transfection. The infected

cells were harvested 2 days post infection. and total intncellular DNA was punfied and

digested with DptlI to detect the replication of plasmid DNA. No replication of plasmids

pAcAhr3 and pAcAhr5 was detected, while the connol hi-Lcontaining plasmid pAcPstl

showed a strong replication signal (Fig. 2. lanes 1, 4. 7). This demonstrated that

sequences flanking ht-2 and hi5 were not able to compensate for the essentiai role of these

Figure 1. Location of hrs and their flanking sequences on the AcMNPV genome.

(a) AcMNPV EcoRI resmction rnap is s h o w as the linear map on the top. hrs are indicated

by downward arrows. To demonstrate the smicture of hrs. the continuous DNA sequence

(from nucleotide number 26292 to 26454) of hr2 contained within the PstI-J region is

shown. The repeated sequences and 30 bp palindromes (underlined sequences) within hr2

are aiigned and indicated at the bottom. The central EcoRI sites within palindromes are shown as bold undedine letters. (b) AcMNPV HitidIIi, PsrI, SstI and KpA restriction

maps are shown on the top of each panel, with the downward arrows to indicate hrs. The

viral DNA fragments cloned in pAchrl, pAchr2, pAchr3, pAchr4a and pAchr5 are shown

by expansion maps beneath the AcMNPV restriction maps. The cloning sites and the

EcoRI sites on these fragments are indicated by vertical bars. hrs were deleted from these

fragments and the resulting fragments carrying hr deletions and contained in pAcAhr 1.

pAcAhr2. pAcAhr3, pAcAhr4a and pAcAh~-5 are shown by the shoner linear maps below

the expansion maps.

hrl I v LM N I

H i n d i l l

Pst l

Sstl

Kpnl

hr.5 I v

K Q P I IHI I A l I A 2 I I I I (

Ahrl Ahr5

l Sstl y "*Ill

Figure 2. Infection-dependent replication of plasmids containing hr dele- tions.

Sf2 1 cells ( 106) were transfected with 1 pg of hr-deletion plasmid pAcAhrl (lane 3),

pAcAhr2 (lane 4), pAcAhr3 (lane 5) , pAcAhr4a (lane 6), pAchhr5 (lane 7). The same

arnount of pAcPstJ (lane 1 ) or pUC 19 (lane 2) were used in control transfections. Plasrnid

transfected cells were infected with AcMNPV (m.o.i. of 1) at 6 h post uansfection. then total intracellular DNA was purified at 48 h post infection and digested with DpnI plus

SmaI (lanes 1.2, 3,4. 5, 7) or plus KpnI (lane 6) to linearize the replicated plasmid DNA.

After electrophoresis, DNA sarnples were transferred to Qiagen nylon membranes and

hybridized with 32~-labeled pUC 18 DNA. The DpnI resistant fragments are indicated by

arrows.

two hrs in supporting DNA replication. However, deletions of the hrs in pAcAhrl,

pAcAhr3 and pAcAhrla decreased but did not elirninate their ability to replicate (Fig. 2,

lanes 3. 5, 6) , indicating that these h n were not specifically required for plasmid DNA

replication; other sequences in the flanking regions of hrl. hr3 and hr4a could function as

additional initiation sites. These results also indicated that a disrupted palindrome with a

deletion of EcoEU core site (in pAchr2) or half a palindrome (in pAcAh-5) disabled the

ability of hr palindromes to Function as DNA replication origins, consistent with published

data (Leisy et al.. 1995).

Since hr2 and hr5 were essential for the replication of the plasmid DNA in the

infected cells, they rnight be necessary for the replication of the virus in vivo. To test

whether any hr wiis specifically required in vivo, recombinant vimses carrying different hr

deletions were constructed and tested for the ability to replicate in insect cells. Six groups

of recombinant viruses expressing the ZacZ gene were confmed to carry individual

deIetion in either hrl (AclacZAhrl), hrla (AclacZAhrla), hr2 (AclacZAhr2), hr3

(AciacZAhr3). hr4a (AclacZAhr4a) or hr4b (AclacZAhr4b) (data not shown). As an

expenment control to normalize possible effects of the expressed lac2 gene on the virus

growth, a seventh recombinant virus carrying al1 the hrs plus the lac2 reporter gene

inserted into the virai p l 0 gene region was also constructed (AclacZ4PlO).

Sf2 1 cells were infected with these recombinant viruses (m.0.i. of 0.01) ,and titers

of progeny viruses harvested at either 24 or 48 hours post infection were determined

(Table 1, 2). Each viius titer represents the average results of three infections of each virus

and three plaque assays for each infection. The titer of the budded virus carrying specific

hr deletion was compared with that of Ac1acZA.P 10. The results indicated that deletion of

hrl. hrla. hr4a or hr4b from the viral genome had little or no effect on the production of

budded viruses. while deletion of hr2 or hr3 resulted in a marginal increase in the virus

titer (Table 1, 2). These results demonstrated that none of the hrs was essentid for the

Table 1. Production of progeny budded vituses at 24 hour post infection with hr deletion vimses

hr deletion Assay 1 Assay 2 Assay 3 Mean virus (PFUI~I) x t $ ( PFU~I ) x 1 o3 (PFUI~I) x 103 (PFU~I)XIO~ & ç ~ *

AclacZAhrl 3 7 43.6 35.8 34.2 38.6 40.2 36.2 35.2 36.6 36.5 1.92

AclacZAhrla 40.2 36.8 35.8 29.6 34.8 33.8 41 40.2 34.4 36.3 3 . 7

AclacïAhr2 42.8 41 56 32.4 29.8 35.2 44 42 50 41 -5 8.3

AclacZAhr-3 42 42 54 37 45.4 33 42 39.6 41.8 41 -9 5.8

AclacZAhr4a 37.8 31.6 35.2 46.2 32.6 36.8 27.8 28.4 24 33 -4 6 - 6

AclacïAhr4b 35.8 39 33.8 29.6 34.4 35.8 37 34.4 40.2 35 -6 3.1

AclaZAP10 30.2 35.8 33.6 37.4 29 36.2 38.4 40.2 37.8 35.5 3.6

' SD: standard deviation

Table 2. Production of progeny budded vhses at 48 hour post infection with h r deletion vlluses

hr deletion Assay 1 Assay 2 Assay 3 Mean virus (PFUI~I) x 1 o5 (PFUI~I) x 105 [ P F U ~ I ) x 105 ( P F u i m l ) X r ~ ~ ~ S D *

- - - -

AclacZAhrl 34.2 35 32.6 34.2 24.6 33.6 36.2 22.8 34.2 33 3.9

AclacïAhrla 19.8 22 19.6 3 4 23 27.8 56 44 40 31 -8 12.7

AclacZAhR 38 48.6 37.4 38.4 46.8 37.2 44 26.6 42 39.9 6.52

ActacZAhr3 50 36.2 40.6 40.2 40.6 46.8 46 38.2 33.6 41.4 5.3

AclacïAhr4a 30.6 38 33 30.4 39 37.4 50 34.2 37.4 36.7 5 -9

AclacZAhr4b 28.2 21.8 32.6 29.6 31.4 33.2 36.4 38 40.6 32.4 5.6

AclaZAP10 26.2 29.6 27.8 27 31.6 29.4 38.6 44 44 33.1 7.1

' SD: standard deviation

virus replication in vivo, suggesting that the cis-acting function of hrs in the process of

viral DNA replication is redundant.

hrs can also function as aanscription enhancers of the viral early genes in transient

expression assays (Guarino and Summers, 1986a; Guarino and Summers, 1986b). To

determine whether the deletion of specific hrs affected viral early gene expression,

products of viral early genes were compared arnong recombinant vimses. Cells were

infected with individual recombinant virus, then the infected cells were harvested at 24 h

post infection and totd intracellular protein extracts were prepared. The cell extracts were

analyzed by Western immunoblots probed with the IE-1 monoclonal antibody. The

amount of IE- 1 was used to normalize each sample so that an equivalent arnount of IE- 1

contained in each extract was loaded ont0 each lane (Fig. 3, A. lanes 2 to 8).

Subsequently, blots were snipped and reprobed with monoclonal antibodies against P143,

LEF-3 and P47. The amount of each of these proteins was detected by cherniluminescence

and the intensity of each band was compared with the corresponding band present in the

extract of cells infected with AclacZAP10. The extracts of ce1Is infected with AclacZAhr3,

AclaZAhr4a contained a decreased amount of P 143 (Fig. 3, B. lanes 4, 5). the cells

infected with AclacZAhr2, AclacZAhr3 or AclacZAhr4a had a Iower amount of LEF-3

(Fig. 3. C. lanes 4, 5.6) and cells infected with AclacZAhr? or AclacZAhr3 produced Iess

P47 (Fig. 3. D, lanes 5, 6). In conuast, cells infected with AclacZAhrl, AclacZAhrla.

AclacZAhr4b had no apparent reduction in the production of any of these three early

proteins (Fig. 3. lanes 2, 3,7, 8). Since IE-1 was the nomaiized standard, a change in the

amount of IE-1 would also affect the ratio between IE-1 and P143, LEF-3 or P47.

Nevertheless, the data indicated that even a single deletion of hrs such as the deletion of

hl-2. hl-3 or hr4a had a detectable effect on the viral early gene expression il1 i*iito. and

different hrs appeared to affect early gene expression differently.

Figure 3. Effects of individual hr deletions on products of viral early genes.

Sf21 cells were infected with each recombinant virus (m.0.i. of 1) deleted in a specific h r

or the p l 0 gene: AclacZAhrla (lane 8), AclacZAhrl (lane 7), AclacZAhr2 (lane 6),

A c l a c ~ 3 (lane 5), AclacZlyu4a (lane 4), AclacZAhr4b (lane 3), or AclacZAp 1 O (lane 2).

infected cells were harvested at 24 h post infection and whole ce11 extracts were analyzed

by 10% polyacrylamide gel electrophoresis. After electrophoresis, proteins were electrophoreticaily trans ferred onto the nitrocellulose membranes and pro bed with a

monoclonal antibody against IE- 1 (1 :5,000,000 dilution) followed by anti-mouse antibody

conjugated with horseradish peroxidase (1: 20,000 dilution). The reaction was detected by

chemilurninescence. The same detection procedure was performed after the blot being

stripped and reprobed with monoclonal antibody specific for P 143 ( 1 : 1,000), LEF-3

(1:5,000) or P47 (1: 1000). Results of immunoblotting ce11 extracts frorn mock infected

cells is shown in lane 1 (M).

Antibody

IE-1

P l 43

LEF-3

P47

B. Identification of Alternative Origins of Replication

1. Initiation of DNA Replication by Viral Early Gene Regions

The above results indicated that some hi- flanking sequences could substitute for

hrs as putative ongins (Fig. 2). For example, even though hrl was deleted in pAcAhrl:

replication of this plasrnid was stiil detected (Fig. 2. lane 3). To determine the sequences

responsible for the replication activity, specific regions of pAcAhrl were subcloned and

each individual clone was tested in the standard infection-dependenr replication assay.

Both the left and nght hrl flanking regions contained within the HindIII-F fragment

possessed the ability to stimulate DNA replication (data not shown). A detailed dissection

of the plasmid pAcHE4.3 (the hrl left flanking region) identified two regions that

correlated with the non-hr sequence replication. One contained the complete open reading

frame of the p d 8 gene plus 94 bp of upstream sequence (Fig. 4a. lane 3). while the other

contained the complete open reading frame for the ie-2 gene plus 91 bp of upstream

sequence (Fig. 4a. lane 5). Dunng normal virus infection, both of these genes are

expressed immediately after infection, but are also regulated by ie-l (Guarino and

Summers, 1987; Pullen and Friesen, 1995a; Pullen and Friesen, 1995b). Thus, these

experiments demonstrated that regions other than hrs could stimulate plasmid replication in

virus-infected cells and suggested that the presence of early genes may be responsible for

this property.

Therefore. a number of plasmids canying regions of viral early genes were

constructed or chosen and tested for their ability to stimulate plasmid replication.

Surprisingly. almost al1 plasmids canying viral DNA insens expected to be expressed

early after infection were capable of supporting plasrnid replication (Fig. 5 ) - These

plasmids carried a variety of genes (open reading frames plus their upstream regions)

including the E. coli lac2 gene (dnven by the ie-1 promoter), the early 3%. the apoptosis

repressing gene (p35). the immediate early he65, d~iapol, p143. lef-1. lef-3, lef-4. ~ 4 7 .

Figure 4. Infection-dependent replication of plasmids containing DNA sequences flanking the hrl region.

(a) Sf21 cells were transfected with individual plasmid containing DNA fragments h-om

AcMNPV HindlII-F region flanes 1 to 5). Transfected cells were infected with AcMNPV

(rn.0.i. of 1) at 6 h post transfection, then total cellular DNA was purified at 48 h post

infection and digested with DpriI plus HindlII (lanes 1 and 4) or plus Pst1 (lanes 2. 3. 5).

The hybridization were carried out using the sarne condition as outlined in Figure 2. The

position of the DpnI sensitive bands is indicated on the right side of the figure and the DprzI

resistant, replicated bands are indicated by arrows. (b) The physical location of viral DNA

inserts denved from the HindIII-F fragment is schematically presented. Samples in Figure 4 originated from the same gel as in Figure 2. The conaol samples are presented in lanes 1

and 2 of Figure 2

Hindlll Pstl hrl

Scal Pstl EcoRl

Figure 5. Regions containing viral early genes can serve as origins of plasmid DNA replication.

Sf21 cells were transfected with pAchr2 (lane 1). pBSK' (lane 2). pBR322 (lane 3).

pUC19 (lane 4), pIE1-lac2 (lane 5). pAc39K (lane 6). pAcp35 (lane 7), pAcHE65 (lane 8), pAcdnap (lane 9). pAcp143 (lane IO), pAclefl (lane 1 1). pAclef3 (lane 12). pAclef4

(lane 13). or pAcp47 (lane 14) and infected with AcMNPV as described in Figure 2. Total

intracellular DNA was purified and digested with SmaI (lanes 1, 2. 4, 5, 6, 9). PstI (lanes

3. 7. 8, 10, 1 1. 13) or HirldIII (lanes 12, 14) to linearize the total intracellular plasmid

DNA (except pAcp143, lane 10, which has two PstI sites. only the 6.3 kb hybridized) (-

DpnI) or with the same restriction enzymes plus DpnI (+DpnI) to identify replicated

plasrnid DNA. Blotting and hybridization conditions were the same as outlined in Figure 2.

+ Dpnl

- Dpnl

p43 and gta AcMNPV genes (Fig. 5, lanes 5 to 14). The plasrnids used as vectors in the

cloning experiments and which did not carry any viral sequence (PBSK-, pBR322 and

pUC19) were completely negative in the replication assay (Fig. 5, lanes 2 to 4). These

data strongly implicated viral sequences other than hrs which could serve as origins of

replication. The arnount of DpnI-resistant plasrnid DNA varied considerably among the

panel of plasmids used but so did the size of these plasmids. Because larger plasmids

rnight be expected to replicate fewer copies than smaller plasrnids within the same time

period. it was important to determine the initiation eficiency of replication regardless of

plasmid size. Assuming that once DNA replication had initiated. it would continue to

replicate the entire plasmid at a constant rate. Thus, the efficiency of initiation was the

cntical parameter that needed to be exarnined. The replication process was therefore

separated into two steps: initiation and elongation (Table 3). The initiation efficiency (KI)

was expressed as the ratio of initiated (Ro) to uninitiated DNA (U), K1 = [ROI / [U]. The

rate of elongation (KZ) was expressed as the ratio of fully replicated DNA (R) to initiated

DNA (Ro), K2 = [RI / [ROI. Because the rate of replication. once begun. would be

independent of initiation and simply be a function of the length of the DNA to be replicated

(kb) and the supply of essential protein factors necessary for replication (0. K2 would

equal " f " divided by the length of the replicating template (K2 = f / kb). The total

intracellular concentration of each plasmid DNA after replication [Tl would equal [U] plus

[RI. Therefore, K1 = (R kb) / [f (T - R)]. The values for [RI (linearized DprI resistant.

replicated plasrnid) and [Tl (linearized total inh-acellular plasmid DNA including rep licated

and unreplicated plasmids) were determined by densitometer analysis of a variety of

different exposures of three separate replication assay films including those shown in

Figure 5. K1 for each plasmid was calculated for each experiment and averaged assuming

(0 to be 1.0 for a rn.0.i. of 1. The replication efficiency (Kl) of the reporter plasmid

pAchr2 was standardized as 100% and al1 other plasmid KI values were compared with

this value (Table 3). The results of this analysis show that plasmids canying sequences

Table 3. Determination of replication initiation efficiency following standard replication assay

Viral Eady Assay 1 Assay 2 Assay 3

Plasmid ORF* ?romotert kb [R] [q [RI [Tl [RI m K I ave Oh hR

(ha p43. p47, gta

pl43

dnapol

35k

lef-3

lef-4

ie- 1

he65

ie-2

P338

39k

lef- 1

pBR322 4.4 0.00 >IO0 0.00 >IO0 0.00 >IO0 0.00 0.00%

open reading frarnes contained within the viral DNA insert and designated by nurnbers (Ayres el al., 1994).

t promoten located within the viral DNA insert

K 1 ave: average K 1 value calculated from three different replication assays

including Zef-1, pe38.39K and ie-2 replicated at low but detectable Ievels ( l e s than 5% of

the reporter), and plasrnids carrying the he65 gene or the ie-1 promoter replicated at about

1520% of the reporter. Plasmids carrying the lef-3,lef-4, p35 or dnapol genes replicated

with efficiencies between 33-788 of the reporter. Plasmids carrying the pl43 p n e or a

region containing the p47, p43 and gta gene promoter regions replicated as efficiently or

better than the reporter plasrnid. These results clearly indicated that sequences including

viral early genes can efficiently function as DNA replication initiation sites.

2. Initiation of DNA Replication by the ie-I Promoter Region

To identiQ functional domains associated with the ability of early genes to

stimulate DNA replication, one of the replicated plasmids, pIE 1-lac2 was analyzed in

detail. pIEl-lac2 was subcloned into two plasrnids. pIE1-P(CH) and placZ(0RF).

pIE1-P(CH) contained only the 558 bp upstream region of the ie-1 gene, from -546 to +

12 including the transcriptional starting site at + l . while placZ(0RF) lacking the ie-1

promoter region contained the rest part of plEl-lacZ, including the ORF of lac2 gene.

Both plasmids were transfccted into insect cells and tested for the ability to support

plasrnid DNA replication in the presence of virus infection. pIE 1-P(CH) clearly replicated

(Fig. 6a. lane 3), while placZ(0W) did not (Fig. 6a. lane 7). demonstrating that DNA

sequences found within the ie-l promoter region could act as replication initiation sites. To

identify functional motifs within the ie-1 promoter region. a series of plasrnids containing

deletions of the ie- l upstream sequence were constructed (Fig. 6b) and tesred in the

replication assay. Replication of subclones individually containing only one of the five

regions demonstrated that any of these individual regions could suppon DNA replication

but did so weakly (Fig. 6a. lanes 7, 1 1- 14). In contrast, subclones pIE1-P(CS) and

p E 1 -P(NH) replicated almost as efficiently as the whole promoter plasrnid PIE 1 -P(CH),

suggesting replication efficiency increased with increasing size of the promoter region.

Figure 6. The ie-I promoter region can serve as an origin of plasmid DNA replication.

(a) Infection-dependent replication of plasmids carrying AcMNPV ie-l gene promoter

region and its subdomains. Sf2 1 cells were transfected with PIE 1-(CH) (lane 3).

p[E 1 -P(CS) (lane 4), PIE 1-P(CA) (lane 3, pIE 1-P(CP) (lane 6), pIE 1-P(CN) (lane 7).

p E 1-P(NH) (lane 8), pIE 1-P(PH) (lane 9). PEI-P(AH) (lane IO), pIE1-P(SH) (lane 1 l),

pIE1-P(NP) (lane 1 3 , PIE 1-P(PA) (lane 13). plEl-P(AS) (Iane 14), pBSK- (lane 1). or

placZ(0RF) (Iane 2) and infected with AcMNPV as described in Figure 2. Total

intracellular DNA was purified and doubly digested with DpnI plus SmaI (lanes 1, 2) or

XmnI (lanes 3 to 14). Blotting and hybridization conditions are outlined in Figure 2. The

DpnI resistant fragments are indicated on by arrows. (b) Restriction map of the 558 bp ClaI

- HincII fragment containing the ie-l promoter region and the location of the five domains

(1-V) tested in the replication assay are shown. The relative intensity of each DNA band on

X-ray films was measured using the public domain computer program NM Image (version

1.54). Numbers of "cg' represents differences in folds.

b.

Nhel Puvll Afllll S s ~ l Hincll

Size (kW

3.3

3.0

2.7

2.8

2.5

3.1

2.8

2.9

2.2

2.6

2.3

2.6

Replication eff iciency

tl-t

* u

t t

+ +ft

u

* * t t

+ 4

These data indicated that viral early promoter regions could be one of the sequences

responsible for the initiation of plasmid DNA rep lication.

C. Replication of Plasrnid DNA in Cotransfected Cells

One of the earliest attempts to identify origins of DNA replication in baculovims

was to comnsfect insect cells with viral DNA and plasmids carrying different viral DNA

fragments (Guarino and Surnmers, 1988; Yu, 1990; Kool er ni., 1994a; Lu and Miller,

1995). It has been observed that plasmids even in the absence of any insened virai

sequence can be replicated when cotransfected with the viral DNA into Sf21 cells (Yu.

1990; Kool er al., 1994a; Kool et al., 1995). The basis of this plasmid DNA replication is

unknown although it has been speculated that replication may result from the acquisition of

h r sequences following cotransfection (Kool et al., 1995). Another major question derived

from this observation is related to ciifferences in the specificity of plasrnid replication in

conansfected versus infected cells. It is paradoxical that in vims infected cells, plasmid

replication is dependent upon the presence of hrs. regions within HidIII-K or early gene

regions as demonstrated above, whereas in the cotransfected cells, replication of plasmid

DNA appeared to be independent of any specific viral sequences.

1. Plasmid Replication is Independent of Specific Viral Sequences

To investigate the possible reasons that lead to the replication of plasmids in the

cotransfected cells, pUC18, pBSK- or pBR322 was cotransfected with viral DNA into

insect cells. DpriI assays were conducted on samples harvested at 48 h post

cotransfection. The relative replication efficiency of each plasmid was estimated from the

intensity of the hybridization bands on the Southem blot usine the method descnbed

above. For cornparison, the replication of a hr-5-containing plasmid, pAchr5. in the

cotransfected cells was included in the assays. The results demonstrated that pUC19.

pBSK- and pBR322 replicated as efficiently as pAchr5 (Fig. 7, lanes 5 to 12). Since these

vectors did not carrying viral DNA sequences, the fact that they replicated suggested that

Figure 7. Relative replication efficiency of plasmid DIVA in cotransfected insect cells.

Sf21 cells (106) were cotransfected with 0.5 pg of AcMNPV DNA plus 0.5 pg pUC19 (lane 7, 8) or plus equai molar amounts (as pUC19) of pAchr5 ( lane 5. 6). pBSK- ( lane

9. 10 ), pBR322 (lane 11, 12). As experiment controls, the cells were transfected with 0.5 pg AcMNPV DNA (lane 1, 2) or 0.5 pg pUC19 (lane 3, 4), respectiveIy. Total

intracellular DNA was purified after 48 h post cotransfection or transfection and digested

with EcoRI (lanes 2, 4. 6, 8. 10, 12) or EcoRJ plus DprzI (lanes 1, 3, 5, 7, 9, 11). After

electrophoresis, DNA samples were aansferred to Qiagen nylon membrane and hybridized

with 32~-labelled pUC18 DNA. Lambda DNA HirtdIII fragments were used as the

molecular weight markers (kb).

1 Cotransfection with AcNPV DNA

AcNPV PUC pAchr5 PUC pBSK pBR322

+ - + - + + + - + - kb

Dpnl

initiation of plasmid DNA replication in cells cotransfected with viral DNA is different than

in cells infected with virus.

To exclude the possible involvement of hrs in the replication of plasrnid DNA

following cotransfection, a plasmid, denved from pUCl8 where the EcoRI site was

deleted, was constructed (pUCl8AE) and used in cotransfection experiments. If the

replication of pUCl8AE involved the acquisition of his. an essentid EcoRI core site from

h r would be regenerated in pUCl8AE, and possibly accompanied by a size change of the

plasmid DNA. The results reveded that t!!e replicated pUC18AE DNA was resistant to

EcoRI digestion, while linearization of plasmid DNA by PstI resulted in a 2.7 kb band.

indicating that no acquisition of a hr sequence had occurred (Fig. 8). The possible

involvement of other viral sequences in the replication of pUC18AE was also exarnined.

The total intracellular DNA from pUC18AE and viral DNA cotransfected cells was

digested with HLidIII. PstI. SmaI or BamHI. These enzymes were chosen because they

al1 can linearize pUCl8AE into a unit length 2.7 kb fragment. When digested with DpiI

plus these enzymes. the replicated plasrnid DNA did not have detectable change either in

the restriction fragment pattern or DNA size (data not shown). Taken together, the above

results indicared that specific viral sequences were not involved in the initiation of the

plasmid DNA replication in conansfected cells. However. viral genomic DNA was

required for replication. In the absence of viral DNA. plasmid DNA replication was

abolished (Fig. 7, lanes 3, 4). Presumably the viral genomic DNA expressed viral factors

that were essentid. il, tram, for plasmid DNA replication.

2. Plasmid Replication Depends Upon Viral Genes

The above presumption about the role of the viral DNA in providing replication factors

was tested. It would be possible to use cloned viral DNA fragments that express

replication factors to substitute viral genomic DNA in the cotransfection expenment. The

transient expression of the essential viral replication genes from cloned viral fra, =men ts

Figure 8. Replication of plasmid DNA was not due to acquisition of hrs.

SE1 cells (106) were cotransfected with 0.5 pg of AcMNPV DNA plus 0.5 pg pUC18AE

(lanes 1, 2). Total cellular DNA was purified after 48 h post cotransfection and digested

with DpnI plus Pst1 (lane 1) or EcoRI (lane 2). After electrophoresis, DNA sarnples were

transferred to Qiagen nylon membrane and hybridized with 32~-~abe11ed pUC 18 DNA. The

membrane was stripped and reprobed with 32~-labelled AcMNPV DNA. Lambda DNA

HiirdIIl fragments were used as the moiecular weight markers (kb).

Pstl EcoRl Pstl EcoRI

probe: pUC18

would mimic viral genomic DNA in supporting plasmid DNA replication in the

cotransfected cells. Therefore, eight clones containing viral sequences coding for

baculovirus replication genes, including the ie-I. p143. dtlopol. Ief-1. lef-2, lef-3, p35

genes as well as two stimulatory ie-2 and pe38 genes, were used to substitute for viral

pnornic DNA in cotransfection experiments. Because ai i these viral replication genes were

cloned behind their native early promoters, these genes would be transiently expressed

when cotransfected together into insect cells (Kool et al., 1995). Cells cotransfected with

these plasmids plus pUC19 were harvested three days post cotransfection. Total

intracellular DNA was punfied and digested with DpnI. Ir revealed pUC19 replication in

the presence of al1 these genes (Fig. 9, lane 3). Subtracting the stimulatory ie-2 and pc38

genes from the cotransfection mixture did not abolish pUC19 replication although it was

decreased (Fig. 9, lane 11). Removing any one of the essential genes (the rnissing DNA

bands in Fig. 9, lanes 4 to 10, -DpnI) from the cotransfection mixture eliminated plasmid

DNA replication (Fig. 9, lanes 4 to IO), indicating that the replication was not dependent

on any specific viral factor. Rather, replication was supponed by and dependent upon the

presence of a11 seven viral replication factors. In addition, along with the replication of

pUC19, the cotransfected plasmids carrying viral replication genes also replicated (Fig 9.

lanes 2. 3, 11 ), consistent with the replication of multiple sequences in the cotransfected

cells (Fig. 7). In control sarnples. when the cells were transfected with only pUC19 (Fig

9, lane 1) or cotransfected with eight clones in the absence of pUC19 (Fig 9. lane 2). no

DpnI resistant band with the size of pUC19 DNA was detected. These results sitggested

that the DpnI resistant pUC19 band detected in the presence of viral replication essential

genes was not a byproduct from the recombination of the cotransfected plasmids.

D. Conformation of the Replicated Plasrnid DNA in Cotransfected Cells

It has been suggested that baculovirus may use a rolling-circle mechanism to

replicate its genome because plasrnids containing hrs were replicated into high molecular

Figure 9. Replication of plasmid DNA was dependent on products of viral replication genes.

Sf2 1 cells (106) were cotransfected with 1 pg pUC19 plus eight plasmids each expressing

a different viral replication gene (0.5 pg pAcIef3 plus equal molar amounts of pAcie1,

pAcdnap, pAcp 143. pAclef1, pAclef2, pAcp35, pAcie2pe38) (lane 3). The assays were

also carried out in the absence of one of the plasrnids expressing an essentiai viral product.

The subtracted plasmid was pAcie 1 (lane 4), pAcdnap (lane 5). pAcp 143 (lane 6). pAclef 1

(lane 71, pAclef2 (lane 8). pAclef3 (lane 9). pAcp35 (lane 10). or pAcie2pe38 (lane 1 1). As

a conaol, Sf21 cells were also uansfected with 1 pg of pUC19 (lane l), or cotransfected

with only the eight plasrnids expressing replication genes (using the same amounts of DNA

as in lane 3. minus pUC19) (lane 2). The total cellular DNA was purified after 72 h post

transfection or cotransfection and digested with DpnI plus EheI (+ DpnI, lanes 1 to 11) to

Iinearize the replicated plasmid DNA (except pAcIef3) or only digested with EheI (-DpnI,

lanes 1 to 1 1). After electrophoresis. DIVA sarnples were transferred to Qiapn nylon

membrane and hybridized with 3*~-labeled pUC18 DNA. Lambda DNA HirrdnI fragments

were used as the molecular weight markers (kb).

dl i- pUC al1 + pUC

minus

laf3 ie&:.eJ8

minus

al1

+ Dpnl - Dpnl

weight concatemers in virus infected cells (Leisy and Rohrmann, 1993). The concatemenc

structure of the replicated DNA has been used as an indicator for the baculovirus

replication machinery (Martin and Weber, 1997b). To c o n f m that in the cotransfected

cells. plasmid DNA was indeed replicated by the viral replication machinery, the structure

of the replicated pUC19 DNA was examined.

1. High Molecular Weight, Concatemeric Structure of the Replicated Plasmid D N A

Total intracellular DNA from pUC19 and viral DNA cotransfected cells was

digested with DpnI plus different restriction enzymes. HiridIII or Pst1 digested the

replicated plasmid DNA (DpnI resistant) into a 3.7 kb fragment, cornigrating with the

EcoRI digested input pUC19 (Fig. 10. lanes 3.4.5). When digested with only DpA, the

replicated plasrnid DNA rnigrating near the position of the undigested virai genomic DNA

(Fig. 10, lane 6). In cornparison, the undigested input pUC19 DNA (Fig. 10. lane 2)

mignted in the supemoiled ( III ) and relaxed ( 1 ) forms. These results suggested that the

replicated plasrnid DNA might be replicated into high molecular concatemers. To test this,

the total intracellular DNA were digested with DptrI. panially digested with SmuI and

hybridized by southern blotting using a plasmid probe. The hybridization detecred

fragments with sizes around 2.7.5.4, 8.1 and 10.7 kb, suggesting that replicated pUC19

DNA contained multimers including dirners, trimers or temmers (Fip. 1 1).

2. Integration of the Replicated plasmid DNA into Viral Genome

Given that the DpA resistant pUC19 DNA. when undigested with other enzymes,

always comigrated with undigested viral genomic DNA (Fig. 10, lane 6). it was possible

that some pUC19 DNA molecules might integrated into the viral genome. To test this

possibility, total intracellular DNA from pUC19 cotransfected cells was digested with

N d , EagI or M i d . These enzymes were chosen because they digest only the viral

genomic DNA but not the pUC19 DNA. If pUC19 DNA was integrcired into the viral

Figure 10. Conformation of the replicated plasmid DNA following cot ransfection of Sf21 cells.

Sf21 cells were coûansfected with 0.5 pg of AcMNPV DNA plus 0.5 pg of pUC19 (lanes

4 to 9). The total intraceliular DNA was purified after 48 h post cotransfection and digested

with Dpji I (D, lane 6) or DpnI plus HindIII (D+H, lane 4), PsrI (D+P, lane S) , Nor1

(D+N, lane 7), EagI (D+Ea, lane 8), M h I @+M. lane 9). As a control, 1 pg of puRfied.

undigested input AcMNPV DNA (U, lane 1). and 200 pg of undigested (U, lane 2) or

EcoRI digested (E, lane 3 ) input pUC19 were included. After electrophoresis, DNA

samples were transferred to Qiagen nylon membrane and hybridized with 32~-labeled

pUC18 DNA. After the exposure shown on the left, the membrane was stripped and

reprobed with 32~-labeled AcMNeV DNA. Lambda DNA HhdIII fragments were used as the molecular weight markers Rb).

I t $ / 2.! 1 total cellular DNA total cellular DNA

(AcNPV + pUC19)

1 2 3 4 5 6 7 8 9

Probe: pUC18

1 2 3 4 5 6 7 8 9

Probe: AcNPV-DNA

Figure 11. Structure of the replicated plasmid DNA in cotransfected S R I cells.

Sf2 1 cells were cotransfected with 0.5 pg of AcMNPV DNA plus 0.5 yg pUC19. The total

inmacellular DNA was purified after 48 h post cotransfection and completely digested with

DpnI. then partidly digested with SmaI for 15 min, using increasing arnounts of SmuI as

labelled (lanes 1 to 9). After electrophoresis, DNA samples were transferred to Qiagen

nylon membrane and hybndized with 32~-labeled pUCI8. AcMNPV DNA Pst1 fragments

were used as the molecular weight markers (kb).

(Units)

Smal

+ Tetramer (10.7kb)

a+-- Trimer (8.1 kb)

Dimer (5.4kb)

a+ Monomer (2.7kb)

genome. digestion of viral DNA would release pUC 19 DNA from the viral genome. The

released pUC19 DNA would have a different size than its integrated form. This size

change could be detected by gel electrophoresis. On the other hand, if the replicated

pUC19 DNA was isolated from the viral DNA, digestion of viral DNA would not affect

pUC19 DNA. The results revealed that the replicated pUC 19 DNA rnigrated as a smear

ranging from around 4 kb to above 20 kb after digestion (Fig. 10, lanes 7, 8, 9),

suggesting that significant amounts of replicated plasrnid DNA molecules could be

integrated into the virai genomic DNA. Since no particular band of plasmid DNA formed

after digestion, the integration rnay occur at multiple sites around the viral genome or the

integrated pUC 19 DNA may have different sizes or, both.

If integrated, the replicated pUC 19 DNA could be packaged with the viral genomic

DNA into progeny virions. Therefore, the budded viruses produced from the cells

cotransfected with virai DNA plus pUC 19 were harvested and serially passaged undilutely

or by using different multiplicity of infections (from m.0.i. of 0.01 to 10). The viral DNA

from each virus passage was purified. digested with SrnaI and anaiyzed by southern blot

hybridization for the presence of the pUC 19 DNA. A 2.7 kb fragment was detected in al1

viral DNA samples (Fig. 12. lanes 3 to I l), indicating the presence and retention of the

integrated pUC19 DNA within the progeny vinons. In addition. a weak smear of high

molecular weight DNA appeared in each lane of the digested viral DNA. These smears

were likely caused by shon fragments of pUC 19 DNA that was still remained on the viral

DNA after SmaI digestion.

The integration of pUC19 DNA into viral DNA was further confirmed by

restriction digestion and southem blotting anaiysis of the passage 3 (P3) virion DNA (Fig.

13). Restriction enzymes NotI, EagI and MlrcI were used to specifically digest the viral

DNA as mentioned above. After digestion, the replicated pUC19 DNA formed smears on

the gel (Fig. 13, lanes 9, IO), indicating possible integration of the pUC 19 DNA with the

viral DNA. Funhermore. when digested with Sse8387I, a restriction enzyme that

Figure 12. Detection of replicated plasmid DNA in progeny budded virus

particles.

Sf2l cells (106) were cotransfected with 0.5 pg of AcMNPV DNA plus 1 pg of pUC19.

Progeny vinises (lane 3) were harvested at 72 h post cotransfection. then serially passaged

four times (lanes 4, 5, 6, 7) or passaged by using different arnounts of v h s e s (rn.0.i. of

10, lane 8; m.0.i. of 1, lane 9; m.0.i. of O. 1, Iane 10; m.0.i. of 0.0 1, lane 1 1). Budded

virions from each passage supernatant were purified by sucrose gradient centrifugation, the

virion DNA was punfied and doubly digested with SmaI plus DpriI (Ianes 3 to 1 1).

Following agarose gel electrophoresis, the fragments were blotted ont0 Qiagen nylon

membrane and hybndized with 32~4abeled pUC18 probe. SmaI digested plasrnid pUC18 (lanes 1) and SrnaI digested pAchr5 (lane 2) were included as the molecular weight markers

and hybridization controls. The bottom arrow indicates the S m d linearized pUC19 DNA

contained in viral DNA (2.7 kb), whereas the top arrow indicates that short fragments of

the digested pUC19 DNA possibly linked with the viral DNA.

AcNPV + pUC19

height moleculat weight DNA hybridized

+- pUCI9 DNA

Figure 13. Conformation of plasmid DNA packaged into virions.

The passage level three virion DNA, prepared from AcMNPV DNA plus pUC19

cotransfection, was purified and digested with EcoM (E, lane 4). HindIII (H, lane 5) , P sr1

( P . lane 6) . Nor I ( N , lane 8)- EagI (Ea, lane 9), MluI (M. lane 10). Sse8387I (Se, lane

1 l), Sse8387I plus MhiI (M+Se, lane 12), or undigested (U, lane 7). As controls, 1 pg of purified input AcMNPV DNA (lane 1) and 20 pg of undigested (lane 2) or EcoRI digested

(lane 3 ) pUC19 were included. After electrophoresis, DNA sarnples were transferred to

Qiagen nylon membrane and hybridized with 32~4abeled pUC 18 DNA (the left figure).

The membrane was smpped and reprobed with 32~-labeled AcMNPV DNA (the right

figure). Lambda DNA HiridIII fragments were used as the molecular weight markers (kb).

1 2 3 4 5 6 7 8 9 1 0 1 1 1 2

Probe: pUC18

> 01

O a

AcNPV+pUC19 > puci9 L (P3 virion DNA) 5 1 1 M+

1 2 3 4 5 6 7 8 9 1 0 1 1 1 2

Probe: AcNPV-DNA

pUC19

U

AcNPV+pUC19 (P3 virion DNA)

E E H P U N E a M S e S e M+

specificdy cuts only pUC19 DNA but not the viral DNA, the replicated pUCI9 DNA was

resolved into a 2.7 kb fragment plus a high molecular weight DNA band (Fig. 13. lane

1 1). If isolated from the viral DNA. the replicated pUC19 DNA would be resolved into

only one 2.7 kb fragment. Therefore, the appearance of the extra hgh molecuIar weight

DNA band indicated high molecular weight DNA fragments carrying virai and short

plasmid sequences. To confirm the extra high molecular weight DNA band contained viral

DNA, the Sse8387I digested viral DNA was hrther digested with M i d , an enzyme that

digests viral DNA but not pUC19 DNA. The results showed that MluI digestion resolved

the high molecular weight DNA band into a much weaker srnear of DNA bands (Fig. 13.

lane 12), demonstrating that this high molecular weight DNA band consisted of viral DNA

c a q i n g fragments of integrated pUCL9 DNA. This smear also suggested that the

integration sites of pUC19 DNA were possibly dispersed around the viral genome since

no particular DNA band fonned after MlrtI digestion.

The structure of the integrated pUC19 DNA was further examined. Because

digestion of P3 viral DNA with a single enzyme such as EcoRI. HNtmTI or Pst1 released

an intact 2.7 kb p K 1 9 DNA fragment (Fig. 13, lanes 4 to 6). it was possible that some

of the integrated pUC 19 DNA might be in a concatemeric form. Thus. the P3 virion DNA

was panially digested with SmaI using the sarne condition as descnbed in Fig. I 1. pUC 19

DNA fragments of around 2.7. 5.4 and 8.1 kb were detected. suggesting that the p K 1 9

sequences were integrated as concatemers (.Fige 14).

In an attempt to locate the integration sites of pUC19 DNA on the viral genomr,

passage 3 viral DNA was digested with M M to release fragments carrying the integrated

p K 1 9 DNA. The MluI digested viral DNA was then religated. transformed into E. coli

DHSa to selectively ampli@ viral sequences carrying pUC 19 DNA. Recombinant colonies

were selected in the presence of ampicillin (Fig. 15). Each clone should contain viral insert

and a copy of the integrated pUC19 DNA. Thus. the junction sites between the viral DNA

and pUC19 could be mapped by digestion of the cloned DNA with a restriction enzyme

Figure 14. Structure of plasmid DNA integrated into virion DNA.

The passage level three virion DNA, packaged fiom AcMNPV DNA plus puCl9 cotransfection. was purified and partially digested with SmaI for 15 min, using different

amounts of SmaI as Iabelled (lanes 1 to 8). After elecuophoresis, DNA samples were

transferred to Qiagen nylon membrane and hybndized with 32~-labeled pUC18 DNA.

AcMNPV DNA Pst1 fragments were used as the molecular weight markers (kb).

0.0 2.4 (Units) Smal

* Trimer (8.1 kb)

* Dimer (5.4kb)

Monorner (2.7kb)

Figure 15. Strategy for mapping junction sites of pUCl9 to viral DNA.

The HpaII restriction map of pUC19 is shown on the top. pUC19 is presented as a

concatemer. The rnap between two vertical, dashed lines represents one unit of the pUC19

concatemer. The starting nucleotide (number 1) is defined as the first T in

TCGCGCGTITC of pUC19 sequence. The approximate locations of primers used for

DNA sequencing are indicated by black (F22 and Ml 3R) and white (M 13F and R 10 15)

triangles. The left- or right-ward direction of these hiangles indicates the direction of DNA

sequencing h m these primers. The replication origin (on), multiple cloning site (white

box) and the arnpicillin resistant gene (Apr, leftward arrow bar) are indicated. Beneath the

pUC19 map is an exarnple of integration of pUC19 DNA into the viral genome. The

presumed recombination may occur in the HpaiI-D region of pUC19 DNA. To map the

integration sites. the viral DNA (the fine and dashed linesj canying intepted pUC19 DNA

(the bold line) was digested with M M (M), religated and introduced into E. coli. Bacterial

colonies were selected in the presence of arnpicillin. From these colonies plasmid DNA was

punfied, digested with HpoII and separated on polyacrylamide gel. The junction sites

between pUC19 and the viral DNA were identified by analyzing the pattern of the HpoII fragments on the gel. A missing HpaII fragment such as a missing "D" fragment in this

example would indicate possible insertion of viral sequences. The junction sites were then

mapped by sequencing from adjacent primers such as M13R or F22 in this case.

1 integration

Mlul digestion

I re-ligation

transformation

digestion with Hpal l

1. pUC19: Hpal l digestion

2. pUC19 carrying viral insert: Hpall digestion

such as HpaII. which cuts the plasrnid at many sites. Insertion of viral DNA into any

HpaII fragment of the pUC19 DNA would likely cause a DNA size change and this

change could be detected by gel electrophoresis (Fig. 15). Fifty vansformants were

selected and the plasmid DNA was purified, and digested with HpaII. Twenty out of the

50 clones revealed a missing (possibly shifted) Hpan A, B. C or D fragment, and other

three (pM5, pM7 and pM25) showed two missing bands, either the HpaII D and A, B and

H or D and H fragments (Fig. 16), indicating that the junction sites between pUC19 DNA

and AcMNPV DNA were likely located within these HpaII fragments. In addition, two

plasmids (pM33 and pM40) rnay lack the HpaII-H fragment because of a decreased

intensity of the corresponding DNA band on the gel. The HpaII-H and -1 fragments have a

sirnilar molecular weight and formed only one supermolar band on the gel. Thus, a

decrease in the intensity may suggest that one of these two fragments was missing.

Because the H p d - I fragment is located in the ampicillin resistant gene region, which was

unlikely disrupted by insertion (the clones were selected in the presence of ampicillin), the

viral insens were likely in the HpaII-H region. For the rest of the 50 clones. the junction

sites could not be determined by this approach because every HpaII fragment was present

on the gel. If the integrated pUC19 DNA contained in these clones was multimers. these

plasmids would carry repeated copies of HpaII fragments. Therefore, the insertion of viral

DNA into a HpaII fragment would not eliminate any phcular HpuU fiagrnent on the gel.

The junction sites between pUC19 DNA and viral DNA on eight (pM2, pM3,

pM7, pM8, pM12, pM20, pM27, pM46) of these clones were further mapped by

sequencing plasmid DNA using four different primers corresponding to the pUC19

sequence (Fig. 17). The primer M13F (M13/pUC forward primer, from nucleotide

number 364 to 386) and RI015 (from nucleotide number 1035 to 1015) were used to

sequence the region between nucleotides 387 and 1014, whereas the primer M13R

(Ml 3/pUC reverse primer. from nucleotide number 500 to 478) and F22 (frorn nucleotide

number 2 to 22) were used to sequence the region between nucleotides 23 to 477.

Figure 16. HpaII restriction mapping of viral insects on recombinant plasmids.

Recombinant plasmids punfied from 50 selected colonies were digested with HpaII. then

separated on 5% polyacrylarnide gel at 50 V for 3 to 5 h. After electrophoresis, each gel

was stained with ethidium bromide for DNA detection. The migration positions of pUC19 HpaIl fragments and the relative sizes of these fragments are indicated at the left and npht

of each figure. The missing HpaII fragment or fragments detected in each lane are indicated (upward amows) at the bottom of each figure.

t t t t t t t ? A D D A C B B C D

t f t t t t t ? A H C B A D B D

Figure 17. DNA Sequence analysis of the junction sites of pUCl9 to viral DNA.

(a) Strategy for sequence analysis. The HpaIl resmction map of pUC19 is shown on the

top. Below the pUC19 map is shown maps of recombinant plasmids that were detected by

HpaII digestion to carry viral inserts. The possible locations of viral insens on these

plasmids are indicated by downward arrows. The dashed lines indicate regions being

sequenced for the junction sites of pUC19 to viral DNA. The short lines with mowheads

indicate pnmers and directions of sequencing. (b) Nucleotide sequences identified at the

proximity of the junction sites. Each nucleotide sequence is presented as a continuous

sequence in the direction of 5' to 3' Oeft to right direction). The name of each plasmid and

the corresponding primers used for sequencing are indicated at the beginning of the

sequence. Starting from the pUC19 sequence, each identified viral DNA sequence is shown as undertined letters. Positions of the junction nucleotides are indicated by the

numbers above each sequence. These numbers represent the positions of the junction

nucieotides on pUC19 or the AcMNPV genome (Ayres et al., 1994). The bold letters

represent insertion elements which are not aligned with either pUC19 or the viral DNA

sequence. The numbers between slash lines represent numbers of continuous sequences

(nt. nucleotides) which are not presented due to space tirnit.

K L J 1 i b - - -7- - - - - I G I I F I C I l I I I E 1 A

€03 622 CATCGTTGCCAACAA TTTCCAGTCGGGAAACCTGT

The results of the sequencing analysis are summarized in Fig. 17b. Sequencing by these

prirners identified two junction sites on each plasmid. In most junction sites. the pUC19

sequences were followed immediately by AcMNPV genomic DNA sequences frorn either

the (+) or (-) strand. Locations and orientations of these junction viral sequences were

precisely mapped on the viral genome. The predicated integration sites of pUC19 on the

viral genome are illusuated in Fig. 18. In pM12, pM2 and pM20, the two ends of the

pUC19 DNA were linked with different regions of viral DNA which were separated by

around 15 to 50 kb. If integrated into the viral genorne. pUC19 DNA may replace viral

genomic regions between the two integration sites; therefore, the integration may cause

deletions of large genomic regions. In pM8, pM3 and pM27, the pUC19 DNA were

linked with relatively small viral genomic fragments, ranging from 10 kb to 30 kb,

suggesting that pUC19 DNA may form chimencal molecules with these viral sequences.

In pM7, sequencing from the Ml 3F primer identified a viral sequence of 407 bp (frorn

nucleotide 46861 to 47267 of AcMNPV genome) inserted at the position between 478 and

603 of pUC19 DIVA and there was no MIuI site within this 407 bp region. However.

judged from the size of 7 to 8 kb and the fact that there was a Mhd site on pM7 plasmid

(data not shown), pM7 likely carried another unidentified viral insert. In pM46, the two

junction sites were located at the nucleotide 128746 and 74046 on the viral genome, and

the junction viral sequences in both regions were in the direction of the (+) strand of the

viral genome. Because the DNA was sequenced from two different directions using the

primer M13F and R1015, it suggested that sequences within pM46 may have gone

through inversion during recornbination. The actual regions of inversion on the viral

genome can not be predicated from the sequence data.

Cornparison of the sequences around the integration sites did not revenl any

consensus sequences, and no obvious homology was found between the pUC19 and

AcMNPV DNA at the vicinity of the junction sites. In some cases (pM7, pM8, pM12,

pM20, pM27). short sequences were inserted between the pUC19 and viral DNA

Figure 18. Prediction of sites of integration of pUCl9 DNA into the viral genome.

The complete linear. EcoRI restriction map of AcMNPV genome is shown on the top.

Below are predicted defective gnomes due to possible integration of pUC19 DNA into the

viral genome. The predicated genomes are labelleci with the narne of the corresponding

plasmids on which the junction sites from p K 1 9 to viral RNA were determined. The

junction sites between pUC19 and the viral DNA are indicated by the numbers attached to

the junction sites. These numbers represent positions of the junction nucleotides on the

standard AcMNPV genome (Ayres et al., 1994) or pUC19 DNA. In pM7, the dashed lines

represent that some unidentified viral sequences may also present on this plasmid (see tex1

for detail).

AcNPV genome

I l ' a ' k b

O 0.5 10 1 .S 20 2 5 2.7

(Fig. 17b). These sequences did not align with pUC19 or the viral DNA; the ongin of

these sequences was unknown.

To search for any possible conserved feature at the junction sites, eight more

plasmids (pM5, pM9. pM22. pM25, pM33, pM38, pM38. pM45 and pM48) were

sequenced usine the primer M 13F or M 13R (Fig. 19). The sequence data are presented in

Fig. 19b. No consensus or homologous sequences were identified at the junction sites.

consistent with previous observations (Fig. 17). As well. short DNA sequences of

unknown ongin were inserted at the junction between pUC19 DNA and the v d DNA on

sorne plasmids (pM9. pM22, pM25, pM38) (Fig. 19b). Sizes of these inserts vary from 2

bp to 116 bp. Most of these sequences are A+T-rich sequences. The insertion elements

contained in pM9, pM22. pM25 as well as pM7 were aligned with sequences from

different organisms such as human (Aoki et al., 1997). C . elegatis (Wilson et al., 1994).

Drosophiia mekmiogaster (Themen et ai., 1995). yeast (de Zarnaroczy and Bemardi.

1986) etc.. Some of these aligned sequences were repeated sequences such as telomenc-

repeat-like intemal eliminated sequence (TelIESs) (Klobutcher. 1995). or sequences fiom

mitochondrial DNA (de Zarnaroczy and Bemardi. 1986) (Fig. 20). suggesting that these

insertion sequences were likely derived from the host insect cells. Insertion of unknown

sequences has also k e n observed on the genome of defective viruses (Carstens. 1987:

Kool et al.. 199 1). Similady, insertions were found at the junction sites between two

different regions of the viral genomic DNA (Cÿrstens. 1987; Kool et d, 1991; Carstens.

1982), suggesting that a common mechanism may be involved in acquisition of these

sequences.

Mechanisms of plasmid DNA replication observed in the above replication assays

could be closely related to biochernical properties of the viral replication machinery.

Further understanding these mechanisms would require a thorough biochemical

characterization of the viral replication proteins such as their ability to interact or react with

DNA, as well as to interact with other cellular or viral replication proteins.

Figure 19. Sequence analysis of the junction sites of pUC19 to viral DNA.

(a) Smtegy for sequence analysis. The HpaII restriction map of pUC19 is shown on the

top. Below the pUC19 map is shown maps of recombinant plasmids that were detected by

HpaII digestion to cany viral inserts. The possible locations of viral inserts on these

plasmids are indicated by downward arrows. The dashed lines indicate regions being

sequenced for the junction sites of pUC19 to viral DNA. The short lines with arrowheads

indicate primers and directions of sequencing. (b) Nucleotide sequences identified at the

proximity of the junction sites. Each nucleotide sequence is presented as a continuous

sequence in the direction of 5' to 3' (Ieft to nght direction). The name of each plasmid and

the corresponding primers used for sequencing are indicated at the beginning of the

sequence. Starting from the pUC19 sequence, each identified viral DNA sequence is

shown as underlined letters. Positions of the junction nucleotides are indicated by the

numbers above each sequence. These numbers represent the positions of the junction

nucleotides on pUC19 or the AcMNPV gnome (Ayres et al., 1994). The bold letters

represent insertion elements which are not aligned with either pUC19 or the viral DNA

sequence. The numbers between slash lines represent numbers of continuous sequences

(nt, nucleotides) which are not presented due to space Limit.

K H L J

pM45 Y - i B 1 G I I F i C ! ! 1 I I € 1 A + on Ml* -

Am

K H L J

pM48 L - E ~ 1 B I G I I F I C I l I I I E I A f-- on < t

Ml* &f

5 ' 464 164 pM9: Mï3R- CATGA/ /276 nt//GGTGCACTCTCAGTACAATC GTATTATTTATPATATATTATTATTATTTCG

TATTCAMCMTATATTAAACTATTATMTATACATATATTTATACACCTATCTWTTM 58631 58640

MCACAMTCACTGCATATATATACCT TAGCACTTGCCTTCTTCCAT

5 ' 398 814 pMZ2: M13F- ATTCG// 392 n t //CGCACGAUGAACATGTGAG GTGTTGGMCTGGTTATACA-TATTTGT

ATTTATGTCMTATATACMGATATTACCTCATMTCTTGTTTATMCMGATTATGAGCA 67287 67306

TGCTGTAMTTGTGTMTTTATATATlLA TMTCACATGAATGTTGTGA

464 451 9896Z CATGATTACGCCAA ATCAllAAGCCGTTTGATTTAAMCTATCAGTMC GTCGTTTATGCTGGA

Figure 20. Nucleotide sequence alignment between the insertion elements and multiple cellular sequences

The insertion elements idenw~ed at the junction sites on recombinant plasmids are presented

on the top of each panel. Each aligned cellular sequence is indicated by the locus name of

the sequence in the Entrez database provided by NCBI (National Center for Biotechnolow

Information). The aligned nucleotides are indicated by uppercase letters. whereas the

mismatched nucleotides are indicated by lowercase letters.

P M ~ 5 : ATCAAAAGCC GTTTGATTTA AAACTATCAG TAAC

HSTRILPROM : AAAAGCC G T T T a T T T A AAAaTA HSAC002064 : ATgAAAAcCa GTGTGtcTTA AAACTATCtG TA MO02 6 54 : TaAtAAGaC GTTTGATTTA AAAaTATaAa aAA

F m R m : Eumdn mRNA f o r translin prornoter (Aoki et al., 1 9 9 7 ) . HSAC002064: Human BAC clone RG016304 from chromosome 7q21- MO02654 : Carassius auratus alpha 1 tubulin gene.

: AGAAAGGTAG AATAAAAATA TCCCTTTTAT ATTCCGCAAC CTAATAACGC

CELC39D10 : A-TA TCCCTTaTAa ATTCCGgAAC aTtAaA EUPMIC3 : TAG A A T W T A TCC t tcTTAT HSU91321 : AGGgAG AAgAAAAATA TCCCTTT

CELt39D10 : CaenorWicis e1egm.s cosmid C39D10 (Wilson et al., 1994) . EUPMïC3 : -Fuplotes c r a s s u s G f micronucfearsequence (Klobutcher, 1 9 9 5 ) . HSU91321 : Human chromosome 16p13 BAC clone CIT987SK-363E6.

pH9 : GTATTATTTA TTATXTATTA TTATTATTTC GTATTCAAAC MTATATTPA

YSCMTCGO3 : TATTATTaA TTATATATTA TTATaAaTcC a T YSCMTATPSA : TATTtTTTA TT tTATATTA TTATTATT YSCMTCG13 : TATa tTTTA T a tATTATTA TTATT

YSCWi'CG03 : Yeast mitochondrion =ans fec genes (de Zamaroczy and B e r n a = & , 1986 . YSmATPSÀ: Y e a s t mitochondrial o x i 3 gene (de Zamaroczy and B a r d i , 1986 1 . YSCMKG13 : Sacchdrromyces cerev=siae m i tochondrion oxi3 g-e .

pM2 2 : GTGTTGGM-CT GGTTATACAT GTATTTGTAT TTATGTCMT ATATAC-:AGA TATTA

HSL184D6 : Euman DNA sequence f r c m cosmid L184d6, tiuntington's Disease Region, c-komosome 4pl6.3 .

DR020DClOZ: grosophila melanoçaszer ENA sequ-ce. CMU43582 : Drosophila rnelanoçzsr=er !&nase suppressor of ras (Thez r i e? ec al., 1995)

E. Possible Interaction of Viral proteins in Initiation of DNA Replication

The following sections presents an attempt to analyze possible interactions of the

viral replication proteins in the process of DNA replication. Results from the plasmid DNA

replication studies demonstrated that seven viral replication proteins (IE- 1. P143, DNA

polymerase, LEF- 1, LEF-2, LEF-3, P35) were essential and sufficient to initiate plasrnid

DNA replication in comsfected cells. These viral factors are iikely involved in formin$ a

replicaiion complex. Interactions between some of these proteins may regulate the process

of replication initiation. Because Pl43 appears to be very important for virai DNA

replication but little is known about its biochernical function. P 143 was used to identify

possible interactions with other proteins. Pl43 was predicted to function as a helicase (Lu

and Carstens. 1991) and may fom complexes with other viral replication factors,

especially a replication initiator. Identification of this possible complex would be an

important step towards understanding regulation of replication initiation.

1. Different Intracellular Localization of Pl43 and XE-L in Cells Co- producing Pl43 and IE-l

Since baculovirus replicates in the nucleus and Pl43 is essential for viral DNA

replication, Pl43 was expected to be localized in the nuclei of infected cells. To determine

the intracellular Iocalization of P143, AcMNPV infected cells ( m.0.i. of IO), harvested at

18 to 24 hours post infection, were stained with monoclonal antibody against Pl43 (RC-

2) followed by goat anti-mouse antibody coupled with Oregon Green. Pl43 was found

predominately in the nuclei of the infected celis (Fig. 21, A l , A2). confirrning the

specuiation of nuclear Iocalization of P 143. Since the viral DNA is infectious (Carstens et

al., 1980). Sf21 cells were also transfected with purified AcMNPV DNA. Again Pl43

was localized in the nuclei of the transfected cells (Fig. 21, BI , B2), demonstrating that

the process of transfection mimics the process of infection in Iocalizing functional Pl43 to

the nucleus. In the control cells transfected with only herring sperm DNA, no fluorescence

Figure 21. Intracellular localization of Pl43 o r IE-1 in infected or transfected Sf2 1 cells.

SC1 cells were infected with virus (rn.0.i. of 10) (A), nansfected with viral DNA (B), or

cotransfected with plasmids pAciel plus pAcp143 (C. D). Eighteen to 24 h post infection

or transfection the cells were fixed, labelled with monoclonal antibody against Pl43 or IE-

1. The conventionai epifluorescence images of the cells labelled with anti-Pl43 (A l . B1 C 1) or ami-IE- 1 @ 1) are shown. The same ceIls were stained for DNA (chromosomes)

with DAPI (A2, B2. C2, D2). Bar. 10 pm.

was observeci in any part of the cells (data not shown), indicating that the monoclonal

antibody RC-2 reacted specifically to Pl43 under the assay conditions

The nuclear localization of Pl43 could be mediated by Pl43 itself or it may be the

result of a interaction between Pl43 and some other proteins. To test this, two different

plasmids, one expressing the p l 4 3 and another expressing the ie-l gene were

cotransfected into cells. Both PI43 and E- 1 were expressed from their native promoters.

These two genes were expected to be expressed in the cotransfected cells. When the

cotransfected cells were stained with RC-2, Pl43 was found exclusively in the cytoplasm

(Fig. 21, Cl. C2 ), demonsnating that Pl43 itself did not have the ability to self-locaiize

into the nucleus and that IE-1 could not facilitate the nuclear localization of P143.

However, IE- 1 was localized in the nucleus (Fig. 2 1, D 1, D2). Although the cotransfected

cells were not double-labelled with two antibodies against P 143 and IE- 1. two facts

strongly suggested that Pl43 and IE-1 localized differently in the sarne cell. First, when

the cotransfected cells were stained with RC-2 or monoclonal antibody against 1E-1

respectively, there was always a roughly equal percentage (10-20%) of cells k ing stained.

suggsting that the positively stained cells in both cases were likely the same popularions

of cells. Because staining of Pl43 in the cotransfected cells was dependent on the presence

of the cotransfected ie-I gene (see results below). the cells positively stained by RC-2

must contain IE-1. Second. the cytoplasmic localization of Pl43 and the nuclear

localization of IE- 1 were predominant in stained cells. Therefore, different intracellular

localization of Pl43 and I L 1 suggested that a direct interaction between Pl43 and IE- 1

was unlikely in the cotransfected cells.

2. The Ability of the Viral Replication Factors to Facilitate the Nuclear Localization of Pl43

Previous data have shown that cotransfection of the appropriate plasmids expressing seven

viral replication genes result in transient replication of plasrnid DNA (Fig. 9). It was

possible that plasmid DNA replication would occur in the nucleus in the presence of these

seven viral proteins. P143, as one of these viral proteins, would be localized in the

nucleus. The localization of Pl43 was examined in cells cotransfected with eight plasrnids

expressing the pnes encoding IE- 1, DNA polymerase, P 143, LEF- 1. LEF-2, LEF-3,

P35, IE-2 and PE38. In these plasmids, al1 viral genes were cloned behind their

indigenous promoters. When coaansfected together into insect cells, these genes are

expressed and function to support DNA replication (Fig. 9). The cotransfected cells were

immuno-stained for P143. In the cells, Pl43 was found predorninately in the nuclei (Fig.

22, A 1, A2). This suggested that in the presence of these viral replication proteins, Pl43

was transported to the nucleus. These results also confmed that in the presence of al1 the

products of the viral replication genes, DNA replication likely occurred in the nucleus,

mimicking the DNA replication process occuning in the infected cells.

The ability of each individual replication protein to facilitate the nuclear localization

of Pl43 was further investigated by sequentially subtracting each plasrnid from the

cotransfection mixture. When pAcdnap, pAclefl, pAclef2, pAcp35 or pAcie2pe38 was

individually removed from the cotransfection mixture, Pl43 was found in the nucleus

(Fig. 22, B. C. D. E, F), suggesting that these factors were not essential for Pl43 nuclear

localization. In conuast, when pAclef3 was removed, Pl43 was predominately localized

in the cytoplasm (Fig. 22, G1, G2). Thus LEF-3 may be one of the factors essential for

the nuclear localization of P143. When pAciel was not included, no fluorescence was

detected (data not shown), suggesting that in the absence of IE- 1 , the expression of P 143

€rom its indigenous promoter was eliminated or greatly reduced confirming previous

results (Lu and Carstens, 199 1).

Since only one plasrnid was subtracted from the cotransfection mixture each time,

it was possible that the nuclear localization of Pl43 depended on the presence of LEF-3

plus any one or a few of the other viral proteins. LEF-3 alone may not have the ability to

promote the nuclear localization of P143. Therefore, only three plasrnids, pAcp143,

pAclef3 and pAcie1, were cotransfected into insect cells. Nuclear localization of Pl43 was

Figure 22. Intracellular localization of Pl43 in SC21 cells transiently

expressing viral replication genes.

Sf2 1 cells were cotransfected with plasmids pAcie 1. pAcp 143, pAcdnap, pAclef 1,

pAclef2, pAclef3, pAcp35, pAcie2pe38 minus one of the foliowing plasmids: A. none; B,

pAcdnap; C, pAclefl; D. pAclef2; E, pAcp35; F, pAcie2pe38; G, pAclef3. To demonstrate

that LEF-3 might be sufficient to mediate the nuclear localization of P143, the ceils were

also comsfected with only three plasmids pAcie1. pAcp 143 and pAclef3 (H). Eighteen to

24 h post cotransfection the cells were fixed and labelled with a monoclonal antibody to

P143. The conventional epifluorescence images of Sf21 cells labelled with antibody to

P 143 are shown (A 1. B 1 to Hl) dong with the same cells stained for DNA (chromosomes)

with DAPI (A2. B2 to HZ). Bar, 10 Pm.

observed in every ce11 expressing Pl43 (Fig. 22, Hl, H2). As expected, when pAclef3

was subtracted, P 143 remained cytoplasmic, whereas when pAcie 1 was subtracted. no

fluorescence from the RC-2 staining of coûansfected cells was detected (data not shown).

These results indicated that LEF-3 was the viral replication factor essential and likely

sufficient for the aanspon of Pl43 into the nucleus.

3. Pl43 and LEF-3 coIocalize in the nucleus

Since IE-1 alone can not mediate the transport of Pl43 (Fig. 21. C. D), but it may

assist LEF-3 in localizing Pl43 to the nucleus. The presence of the necessary IE- 1 in the

cotransfection mixtures clouded the possible role of IE-1 in mediating nuclear localization

of P143. Thus. both the p 14.3 and lef-3 genes were cloned behind the ie- I gene promoter

so that the expression of these genes from the ie-I promoter would depend solely on host

cellular factors. Cells transfected with pAcIElhrP143 produced a novel protein that reacted

specifically with RC-2 and had a similar size with Pl43 from the infected cells, whereas

cells transfected with pAcIE lhrLEF-3 produced a protein reacting with the monoclonal

antibody against LEF-3 (Fig. 23). This protein had also a molecular weight corresponding

to LEF-3 in the infected cells. As expected. cells cotransfected with both pAcIE l hrP143

and pAcIE 1 hrLEF-3 produced two novel proteins corresponding to Pl43 and LEF-3

respectively in the infected cells. As a contrast, no signal was seen in cells transfected with

the cloning vector pIE 1 hr/PA.

The intracellular localization of Pl43 was examined in cells transfected with

pAcIE 1 hrP143 or cotransfected with pAcIE 1 hrP 143 and PACE 1 hrLEF-3 (Fig. 24). In the

ce11 transfected with pAcIE 1 hrP143 alone, Pl43 was exclusively localized in the

cytoplasm (Fig. 23. A 1 to A4). whereas in the ce11 cotransfected with pAcIE 1 hrP143 plus

pAcIEl hrLEF-3. Pl43 was detected in the nucleus (Fig. 24, B 1 to B4). LEF-3 alone is

sufficient to mediate the nuclear localization of P143.

Figure 23. Detection of Pl43 and LEF-3 in Sf21 cells transfected with pIElhrP143 andlor pIElhrLEF-3.

Sf21 cells were transfected with plasmid pIElhrP143 (lane 2), pIElhrLEF-3 (lane 3)

individually, or cotransfected with pIEl hrPlQ plus p E l hrLEF-3 (lane 4). As controls,

the cells were transfected with the cloning vector pIEl hr/PA (lane 1) or cotransfected with

pIElhr/PA plus pIElhrP143 (lane 5). To detect the expression of Pl43 and LEF-3, the

cells were harvested at 24 h post transfection or comsfection and whole cell extracts were

analyzed by 10% polyacrylamide gel electrophoresis. After electrophoresis, proteins were

electrophoretically transferred ont0 the nitrocellulose membranes and probed with a monoclonal antibody against LEF-3 (1 5,000 dilution) followed by anti-mouse antibody (1 :

20.000 dilution) conjugated with horseradish peroxidase. The reaction was detected by

cherniluminescence. The same detection procedure was performed after the blot being

stripped and reprobed with monoclonal antibody specific for Pl43 (1: 1,000). Results of

immunoblotting ce11 extracts from infected cells (rn.0.i. of 10. 12 h post infection) are

shown in lane 6. The position of Pl43 and LEF-3 and the relative mobility of protein

standard are indicated on the right and left of the figure respectively.

Figure 24. LEF-3 rnediated nuclear colocalization of Pl43 and LEF-3 in Sf21 cells,

Sf2l cells were transfected or cotransfected with plasmids, harvested at 24 h post

transfection or cotransfection, and labelled with antibodies against Pl43 or LEF-3. The confocal laser scanning images from the same ce11 or cells are presented in eacn panel. In

panel A, the ce11 transfected with pIEl hrP143 was labelled with monoclonal antibody to

Pl43 (A3) and stained for chromosomes (A2) with propidum idode. The whole ce11 image

is shown in A l , while a merged image of A2 and A3 is shown in A4. Panel B shows the

image of whole cells (B 1) conansfected with pIEl hrP143 and PIE 1 hrLEF-3. stained for

chromosomes (B2), and labelled with monoclonal antibody to Pl43 (B3), along with a

rnerged image (B4) of B2 and B3. in panel C, the cells were transfected with pIE lhrLEF-

3, labelled with a monoclonal antibody to LEF-3 (C3) and stained for chromosomes (C2). The whole ce11 and the merged image are shown in C 1 and C4 respectively. Panel D shows

a ce11 (Dl) cotransfected with pIElhrP143 and pIElhrLEF-3. double-labelled with a

polyclonal antibody against Pl43 (D2) and a monoclonal antibody against LEF-3 (D3). dong with a merged image (D4) of D2 and D3. Bar, 10 Pm.

The LEF-3 mediated nuclear localization of Pl43 rnay involve a direct interaction

between LEF-3 and P143. which would lead to the colocalization of these two proteins in

the nucleus. Therefore, the intracellular localization of LEF-3 was also exarnined. In the

cells transfected with only pAcIElhrLEF-3, staining with monoclonal antibody against

LEF-3 revealed that LEF-3 was in the nucleus (Fig. 24, C l to C4), suggesting that LEF-3

alone was capable of localizing itself to the nucleus. Cells cotransfected with

p AcIE 1 hrLEF-3 and pAcIE 1 hrP143 were double-labelled with a monoclonai antibody

against LEF-3 and a rabbit polyclonal antibody against Pl43 (Laufs et al.. 1997). The

staining of cells with monoclonal antibody against LEF-3 was foilowed by goat anti-

mouse antibody conjugated with Oregon Green, whereas the rabbit polyclonal antibody

against PI43 was followed by goat anti-rabbit antibody conjugated with Rhodamine. The

labelled cells were then analyzed by a confocal laser scanning microscope using two

different filters to visualize the fluorescence due to Rhodamine and Oregon Green.

Representative cells are shown in Fig. 23, Dl-D4. In the same cell, staining with Pl43

polyclonal antibody revealed a diffuse nuclear labelling of Pl43 (red fluorescence due to

Rhodamine) and sraining with LEF-3 monoclonal antibody revealed a similar labelling

pattern (green fluorescence due to Oregon Green). The rnerging of the two images in D4

of Fig. 23 gave an image (orange) showing an overlapping of the red and green colors.

These results indicated that Pl43 and LEF-3 colocalized in the nucleus. In the control

samples. when the cells were transfected with only the cloning vector pIEl hr/PA. staining

of the cells with monoclonal antibody against LEF-3 did not produce any background

stain, whereas staining with polyclonal antibody against Pl43 produced only a very low

cytoplasmic background. These results strong suggest that LEF-3 interacts with Pl43 to

form a complex which is transported into the nucleus.

DISCUSSION

The current literature suggests that baculovirus homologous regions are very

important, as transcription enhancers of viral early genes and ongins of replication. The

replication of plasmid DNA in the presence of hn suggested that baculovirus may have

multiple initiation sites for genomic replication. Multiple initiation is a mechanism used in

the replication of chromosomal DNA in eukaryotic cells and the genome replication of

some DNA vimses such as herpes vimses. One of the advantaps of using multiple sites

may be to increase the chances for the formation of a preinitiation complex and thus

increase the speed of replication cycle. Initiation of DNA replication from multiple sites

usually involves the interaction of one common initiator protein with multiple ongins

rather than the use of multiple initiators to interact with multiple ongins. In baculovirus.

because hrs have highly homologous and repeated sequences, different hrs would be

recognized by the sarne initiator protein, likely IE-1. However, it was puzzling that

regions within the HimiIII-K fragment also replicated efficiently in the replication assays

although this region does not share sequence homology with hrs (Kool et al., 1994b). The

differences between hrs and HimiIII-K in terms of requirement for minimal sequences for

supporting DNA replication sugpsted that these two regions could be recognized by

different initiator proteins. Baculovinis may have more than one replication initiator or,

unidentified mechanisms may be involved in the initiation of baculovirus DNA replication.

To clarify the confusion. it became imponant to identify other viral sequences that might

possess the ability to support DNA replication. Then, a possible comrnon ground for these

sequences to function as origins of replication could be deducted. As a first step, it was

necessary to test whether or nor there were other sequences on the viral genome that could

functionally substitute hrs in the transient replication assay.

A. Roles of hrs in DNA Replication

The results shown in Fig. 2 demonstrated that in addition to hrs, sequences

flanking hr l , hr3 and hr4a dso possessed the ability to initiate DNA replication in the

infected cells. These data suggest that hrs do not specifically function as the replication

origins and other sequences can functiondy substitute h n in supporthg DNA replication.

Regions flanking hrl were selected and analyzed in detail. At least two regions were

identifid to carry the ability to support plasrnid DNA replication. One contains the viral

pe38 gene, while the other region carries viral ie-2 gene. Although these two regions do

not share sequence homology with hrs or the Hindm-K fragment, both pe38 and ie-2 are

viral early genes. The ability of these two early genes to support plasrnid DNA replication

could be simply due to the fact that they are early genes. Therefore, a wide variety of

regions canying viral early genes were tested in the replication assay. The results indicated

that almost al1 plasrnids carrying early viral genes replicated and some (pAcp143 and

pAcp47) replicated to higher levels than the h R reporter plasrnid (Table 3), indicating that

baculovims replication origins might be more complex and widespread on the genome

than originally suggested (Kool et al., 1995).

The hr deletions were further introduced into the viral genomes individually to test

whether any of hrs was essential or important for the replication of the virus itt vivo.

Recombinant viruses carrying h r deletions in either hrla, hrl, hr2, hr3, hr4a, hr4b were

consmcted and tested for the ability to replicate in Sf21 cells. CeIls were infected with

each h r deletion virus, then the production of the progeny virions was measure after virus

replication. Consistent with a previous result involving deletion of hrS from the viral

genome (Rodems and Fnesen, 1993), deletions of al1 hrs (except hr4c) individually

appeared to have Iittle or no effect on the production of the progeny viruses. Therefore,

none of the hrs is used by baculovims as a unique site for replication initiation.

The function of hrs in replication initiation appears to be correlated with their

function as the transcriptional enhancer in the transient expression assay. pAcAhr2 has one

palindrome with a disrupted EcoRI core site, whereas pAcAhr5 has only half of the 28-

mer palindrome. Both plasmids failed to replicate in the replication assay (Fig. 2).

suggesting that the complete sequence of the hr palindrome is important for its function as

the replication origin. In cornparison, the minimal sequence requirernent for the enhancer

function of hr.5 is also the 28-mer palindrome (Rodems and Friesen, 1995). Half a

palindrome or a palindrome with a deleted central EcoRI site disabled the function of hn

as the transcription enhancer (Rodems and Friesen, 1995; Leisy et al., 1995). The

minimal functional sequence of h n for the processes of replicaaon and transcription is

sirnilar, suggesting these two processes may be intimateiy connecteci.

The involvement of hrs in the transcription of viral early genes has been

demonstrated in vivo by deleting hr5 from the viral genome, which decreased the

transcription of the viral p35 gene around one fold (Rodems and Friesen, 1993). Effects

of hr deletions (except hr4c) on products of viral early genes such as IE- 1, P143, LEF-3

or P47 were examined in this study. The results suggest that each individual h r affects

specific sets of early genes, and different hrs affect early genes differently. For exarnple,

the deletion of hr-2 affected the relative amount of P47, LEF-3 but not P143. On the other

hand, the deletion of hr4a affected P 143 and LEF-3, but not P47. The deletion of hr3

decreased the ratio between IE-1 and al1 these three proteins, while the deletion of hrla,

hrl, hr4b had no apparent effect. The correlation between an individual hi- and its action

on particular early genes appears to be cornplex, reflecting multiple factors such as the

relative location of the h r and the early genes, and the overall genetic organization of the

genome.

While deletions of a single hi- affected early gene aanscription, the effect on virus

replication was minimal. This could be due to the insignificance of each individual h r

deletion on overail gene transcription, or the virus may have some balancine mechanisms.

When the expression of some genes is negatively affected by h r deletions, the expression

of other genes may be enhanced. It would be important to introduce more than one h r

deletions hto the viral genome. These multiple hr deletions rnay have a strongeer effect on

the process of viral gene transcription or DNA replication. which may be easily

distinguishable and would help to define specific functions of krs in the process of viral

DNA replication and gene uanscnption. However, it is not clear whether deletion of more

than one hr at the same tirne would abolish or gready affect baculovirus replication. The

situation will be more complex when multiple hrs are deleted since the same sequences

within hrs serve as both the putative ongins and the early gene transcription enhancers.

Impaîring either function may affect both. Nevertheless, the deletion of each individual hr

from the viral genome and the replication of these deletion mutants in vivo demonstrate.

for the first time. that hn are redundant in their function as the putative replication origins.

Funher functional analysis of hrs by multiple deletions will use the data and techniques

established in the study of single k deletions.

B. DNA Replication Initiation and Early Gene Transcription

The results shown in Fig. 5 demonsmted that plasmids carrying a senes of viral early

genes replicated in the infected cells. One of the replicated plasmids. pIEl- lad. was

analyzed in detail for possible reasons leading to the replication. Only the ie-l promoter

region could initiate DNA replication. A detailed deletion analysis of the ie-l promoter

region did not identify any specific sequence that was responsible for the DNA replication.

Maximal replication was observeci only in the presence of al1 the sub-regions of the ie-l

promoter (Fig. 6).

The ie-1 promo ter region shares no sequence homology with previou sly described

origins. It contains one 24 base pair imperfect palindrome within region N. but deletion of

this region did not abolish replication (Fig. 6a. lanes 7 and 9 to 11). Region 1, II and V

contain three A+T-rich domains (55 to 67% A+T over 70 to 119 nucleotides), but the

replication of the lower A+T content region IV (46% A+T over 169 nucleotides). as well as

the fact that one A+T-rich domain between I and II is disrupted. did not support a specific

role for these A+T-nch domains in replication.

Analysis of the replication negative plasmids pAcAhr2 and pAcAhr5 reveaied that they

also contain regions of approximately 140 nucleotides which are about 80% A+T. All of

the control plasmids lacking viral inserts also contain regions with high A+T content (74%

A+T over 100 nucleotides), but they were completely negative in the replication assays.

Therefore, high A+T content regions are not sufficient to impart replication ability, while

retaining an early promoter region intact appeared to be important in determinhg maximal

replication abili ty. The replication of different su b-regions within the ie- 2 promo ter

suggested that the replication ability does not directly correlate with transcriptional

activation but rather appears to indicate the potential role that these regions play in binding

transcription factors pnor to early transcription.

The ie-l promoter region 1, which contains the TATA and CAAT box sequences.

known to be essential for accurate initiation of transcription (Blissard et al., 1992; Guarino

and Smith, 1992; Pullen and Friesen, 1995a). is not essential for replication. In addition,

dthough the upstream regions of the ie-I promoter, including regions II to V in this study,

may be non-essential for transcnption irz vivo, they can enhance ie-l expression when

transfected into cells (Pullen and Fnesen. 1995b). suggesting that other transcription factor

binding sites likely exist within these regions. Evidence suggesting that these regions carry

regdatory elements responsive to host ce11 factors (Pullen and Friesen, 1995b) has also

k e n reponed. Therefore, these data in baculovirus are in agreement with other studies in

which the presence of binding sites for a range of cellular transcription factors near the

SV40 ongin of replication stimulates viral DNA replication but does not correlate with their

ability to stimulate transcription (Hoang et al.. 1992).

A comelation between manscription and DNA replication has been demonstrated in

several other eukaryotic systems (for a review, see Heintz, 1992). The uanscnption

activator NF1 , which specifically prevents repression of SV40 DNA replication by

chrornatin assembly, stimulates DNA replication 20-fold in vivo (Cheng and Kelly.

1989). The transcription factors VP16, GALA and P53 c m bind to the large subunit of

replication protein A. s t i m u l a ~ g polyornavinis DNA replication by exening an influence

on a very early stage of the initiation process such as initiation complex assembly (He et

al., 1993; Li and Botchan. 1993). The fact that a single je-1 promoter or its subdomain. as

well as a number of other early gene regions of AcMNPV, when present in plasmids, can

lead to DNA replication suggests that the processes of baculovirus gene transcription and

replication rnay be intimately connected: (1) the binding of transcription factors pnor to

transcription initiation, especially transcription of early genes. rnay expose the DNA to the

replication machinery. allowing for initiation of DNA replication following transcription.

(2) the interaction between transcription factors and the virus replication machinest rnay

facilitate the assembly of replication factors necessary for DNA replication. (3) facton that

recognize early viral promoters rnay inhibit or dislodge nucleosomes, allowing access to

DNA domains that then function as replication ongins.

The conformation of a plasmid can affect its transcriptional activity during a

transient expression assay. Supercoiling of plasmids is crucial for maximum transcription

activity (Parvin and S harp, 1993). Coincidentally, linearization of a supercoiled h r

containing plasmid completely abolished the replication ability of the plasmid in the

infection-dependent replication assay (Kool er al., 1993b). Because prolonged storage of

plasmids or repeated extraction of the plasmid DNA with phenol c m greatly reduce the

DNA's replication efficiency (unpublished data), DNA conformation rnay be an important

cnterion for both transcriptional and replication activation.

Using the standard plasmid based replication assay, a number of other regions of

the genome which c m also function as putative DNA replication ongins were identified.

However. the possibility that more DNA elements rnay also be involved in this process

can not be excluded. The situation is rerniniscent of the widely used yeast ARS high-

frequency transformation assay which successfully identified the first eukaryotic

chrornosomal ongin of replication, ARSI, and later, many other yeast ARS elements

(Stinchcomb et al., 1979; Smhl et al., 1979; Newlon, 1988). However, subsequently,

using a variety of approaches, it was revealed that while all yeast chromosornal origins are

ARS elements, not al1 ARS elements function as ongins in the yeast chromosome

(Fanpan and Brewer, 1991). Furthermore, not al1 yeast ongins can initiate replication at

the same time (Fangman and Brewer, 1991). The selection of each individual ongin

appears to also be controlled by the context of the chromosome structure. The data in this

thesis demonstrate that many different regions of the baculovirus genome can initiate

plasmid DNA replication in v h s infected cells. It remains to be determineci which of these

sequences function as genuine origins of replication during the vins replication cycle.

Future studies may need to use in vi~ro approaches to identify the genuine origins of

replication. Approaches such as in r~iipo labelling of viral DNA synthesis in the presence

of an inhibitor of eiongation or using a temperature sensitive mutant defective in elongation

at non-permissive temperature would be invaluable.

C. Possible Mechanisms of Initiation of Viral DNA Replication

One major paradox in defining baculovirus DNA replication origins is the

observation that al1 plasrnids, even those not canying viral sequences, replicate when

co~ansfected with viral DNA into insect cells (Guarino and Summers, 1988; Yu, 1990;

Kool et al., 1994a; Lu and Miller, 1995). However, it was not known whether this non-

specific replication is initiated by the viral replication machinery or by cellular replication

proteins. The possible reason that led to the replication of multiple sequences in the

cotransfected cells were investigated. The results indicate that plasmids lacking viral

sequences are capable of replication and this replication is independent of the presence of

baculovirus DNA sequences such as hrs in cis, but is dependent on the presence of viral

replication genes in tram (Fig. 7, 8, 9). Seven genes are necessary and sufficient to

initiate plasmid DNA replication. Therefore, baculovinis replication machinery can

potentially initiate DNA replication from multiple sequences, including non-viral

sequences under certain circurnstances.

The replication of the plasmid DNA in cotransfected ceiis could be due to

integration. Indeed. some of the replicated plasmid DNA was integrated into the virai

genome (Fig. 10). However, the smicniral difference between the replicated plasmid DNA

(Fig. 1 1) and the input plasrnids (Fig. 10, lane 2) did not support the hypothesis that the

replication was passively iniaated from the plasrnid DNA because of its integration into the

viral genome. The majority of the replicated plasrnid DNA was concatemeric, while rnost

of the input plasmid DNA was monomeric (fom 1 and III), suggesting that the replicated

plasmid DNA must have gone through at least one round of self-replication. In addition.

an estimation of the integration rate (see below) shows that only 1&25 % of the replicated

plasmid DNA in the cotransfected cells was intepiteci into progeny virion DNA. The rest

of the replicated plasmid DNA was not covalently Iinked to viral DNA. Therefore, the

replication of plasmid DNA in cownsfected cells appears to be an autonomous process

independent of the initiation events of the viral genome. The integration of plasrnid DNA

into the viral genome likely results from CO-replication and non-homologous

recombination of plasrnid DNA and the viral genome.

The replication of plasmid DNA in cells cotransfected with baculovirus DNA is

reminiscent of results showing that all exogenous naked DNA molecules including a wide

range of bacterial plasmids and bacteriophage genorne, when injected into intact Xempus

eggs or incubated in egg exwcts, replicated efficiently (Harland and Laskey, 1980;

Mechali and Kearsey, 1984). When intact nuclei fiom Chinese hamster ovary cells were

added to the same egg extract, replication initiated specifically at or near authentic ongins

of replication (Gilbert et al., 1993; Gilbert et al., 1995a). These experiments indicate that

some feature of nuclear structure. for example matrix attachment regions, can impose

selective initiation sites on DNA that would otherwise initiate randomly. Therefore,

patterns of replication in eukaryotes might be imposed by chromosome suucture coupled

with DNA sequence (Coverley and Laskey, 1994).

The results of plasmid DNA replication in cotransfected versus infected cells

appear to support this point of view. In baculovirus infected cells, plasmid DNA

replication requires specific putative origin sequences such as hrs. HindIiI-K or viral early

gene regions, while in cotransfected cells it does not. suggesting that a structural factor

rather than primary sequences rnay regulate the specificity of the initiation process.

As a working hypothesis to resolve the paradox observed in different transient

replication assays. a mode1 (Fig. 25) is proposed, suggesting that the specificity of

baculovinis replication initiation is determined by features of chromatin stnicniie. It has

been dernonstrated that plasmids transfected into eukaryotic cells are assembled into

chromatin structure constituting cellular histones, and this assembly process can occur in

the absence of DNA replication (Gruss et al., 1990). Therefore, it is possible that

plasmids are also assembled into chromatin structure following their transfection into

insect cells. The transfected cells are further infected with vimses and specific viral

transcription factors such as IE- 1 and replication proteins such as Pl43 are expressed. If

the plasmid contains binding sites (such as viral promoter regions or h r sequences)

recognized by the early viral proteins, binding of these factors could disrupt the chromatin

structure and expose the DNA to replication proteins. If no viral factor binding sequences

are present, the chromatin structure could prevent replication proteins from interacting with

the plasmid DNA, effectively repressinp replication. The assembly of the replication

proteins ont0 DNA may simply require binding factors to open the chromatin smcture. In

this case, the specificity of replication initiation would be based directiy on the presence of

recognizable binding sequences. On the other hand. following cotransfection of the

purified, naked plasmid DNA and viral DNA. the replication proteins rnay directiy

assemble ont0 the naked plasmid DNA pnor to formation of the chromatin structure.

initiating nonspecific DNA replication.

Figure 25. Mode1 of plasmid DNA replication in insect cells.

When nansfected into cells, plasmid DNA forms a chromatin smcture which affects the

way the plasmid is recognized as a template for virus-induced replication. In this model. plasrnids canying a viral DNA insen would be recognized by viral transcription factors,

whose binding would open up the chmat in structure, senting as a platfonn for assembly

of the replisome and initiation of replication (i). Otherwise, a complete chroma.tin smicture

could preclude the assembly of the replisome (ii). If the plasmid DNA was introduced into

cells followed shortly by virus infection, there would not be enough tirne to form a

complete chromatin smicnire so the virus replisome could assemble on any naked region of

plasmids and initiate replication (iii). This conclusion is supported by data in Figure 26, lanes 2-4. where pUC18 (without any viral insert ) replicated when vims infection occurred

within four hours after transfection. If plasmid and viral DNA were cotransfected into ceus,

the immediately synthesized proteins of the viral replisome could assemble on any naked

plasmid DNA and initiate replication (iv). These concIusions are supponed by data in

Figure 26, lane 1.

transfection infection

1. + 1, 6

6h

Plasmid replication

No plasmid - replication 6h

iii.

6 8

iv. cotransfection Plasmid

replication

O-I- : a - Nucleosome

/--1 1 -

0 \

I \ 1 Plasmrd I

AcNPV ; I - ! ~ replicat ion \

V I I U 3 L C p 1 1 3 u l l l e

\ I

0 '---/' 1 - 1

AcMNPV virions l

i 7 - I

-. . . DNA binding protein(s) 1

Figure 26. Replication potential of piasmid DNA changes with tirne after transfection.

Sf21 cells were cotransfected for 2 h with 1 pg AcMNPV DNA plus 2 pg pAchr2 (a. lane 1) or 1 pg AcMNPV DNA plus 2 pg pUC18 @, lane 1). For infection-dependent transient

replication assays, 2 pg pAchr2 (a, lanes 2-6) or 2 pg pUC18 (b. lanes 2-6) was incubated for 2 h with cells, then monolayen were washed irnmediately, infected with virus (m.0.i of 1) at 2,3,4,5 or 6 h (lane 2 to 6 , respectively) after aansfection (adding DNA to cells was

time zero). Total cellular DNAs were purified at 72 h post cotransfection or 48 h post virus

infection and digested with D p d and SmaI. Blotting and hybridization conditions were as outlined in Figure 2.

& I1 c transfection t infection

a. &' 8 2h 3h 4h 5h 6h

c 8 @

b. c transfection + infection g

This mode1 was tested by infecting cells at several time points early after

transfection of plasrnid into cells with the aim of detecting some plasrnids with immature

chromatin structures (replication competenr). Replication of pUC18 DNA was detected

following infection with AcMNPV at 2. 3 or 4 h after transfection. However. no

replication of pUC18 DNA was detecrable after 5 h post transfection (Fig. 26b). Plasrnid

containing the ht-2 region was recognized as a template and replicated at al1 urnes after

transfection (Fig. 26a). Although there is no direct evidence yet, it is likely that after 5 h.

the aansfected pUC 18 DNA is smicturally altered and is no longer recognizable by viral

replication proteins. This concept will be testable once i ~ i i7itr-O replication assays for

baculovirus are available.

The replication of plasmid DNA in cotransfected cells depends on seven viral genes

whose products include two double-stranded DNA binding proteins LE- 1 and P143. It is

not clear how the DNA binding function of these two proteins is related to the initiation of

DNA replication in the cotransfected cells. Apparently IE-1 is a sequence specific DNX

binding protein. recognizing multiple E l binding sites in hrs (Choi and Guarino. 1995b).

If IE-1 functions as the initiator in the ongin recognition cornplex. hi-s would function as

the origins and Se expected ro repticate specifically. or at least more strongly thm non-viral

sequences. However. the data presented in this study indicate that hrs do not replicate

specifically. nor do they enhance replication in the cotransfected cells. In addition. IE- 1

rnay not cany the ability to directly interact with the purative Iielicase Pl13 and mediate the

assembly of Pl43 ont0 the origins to iniriate DY4 replication. When Pl43 and IE-1 were

CO-produced in insect celis. they localized differently within the cells (Fig. I l 1. Pl43

localized in the cytoplasrn. while IE-1 localized in the nucleus. suggesting that thsse two

proteins may not interact directly in the comnsfected cells. Therefore. assembly of Pl 43

ont0 origins may be accomplished by recognition of a DNA smicture created by the bindins

of IE- 1 to the origins. rather than by a direction interaction between Pl33 and IE- 1.

On the other hand, the putative helicase Pl43 has been shown to be a sequence non-

specific double-saanded DNA binding protein (Laufs et of., 1997). Ir is tempting to

speculate that without the repression of a chromatin structure. Pl43 may bind to any DNA

sequence in the nucleus. From this sense, assembly of Pl43 onto DNA would rely less on

the ability of an initiator protein to specifically interact with Pl43 and more on the ability of

a viral or cellular factor to dislodge a chromatin-smicture possibly formed onto ongin

sequence. As long as the viml or cellular factors cany the ability to dislodge the chromatin-

structure and present naked DNA to P143, they may have the ability to initiate DNA

replication in the presence of the viral replication machinery. Accordingly, sequences

carrying the binding sites for these viral or cellular factors rnight function as ongins in the

infected ceUs.

A recent report describing the replication of the SV40 ongin in insect cells supports this

hypothesis (Martin and Weber, 1997b). When a plasrnid canying the SV40 origin was

transfected into insect cells and then the celis were infected with a recombinant baculovirus

expressing SV40 large T antigen, the plasmid replicated. The replication of the plasmid

depended on the presence of the SV40 origin, infection of baculovinis and the expression

of T antigen. The replicated plasmid consisted of high molecular weight concatemers which

undenvent significant levels of homologous recombination during replication. These data

are consistent with an AcMNPV rather than a SV40 directed mode of DNA synrhesis. It is

very likely that the replication of the SV40 origin in insect cells was completed by the

baculovinis replication machinery with T antigen only playing a role dunng initiation.

Although T antigen is the initiator in the replication of the SV40 genome in human cells, it

was unlikely that specific interaction between T antigen and baculoviral factors supported

the replication of the SV40 origin in insect cells. Rather, T antigen in this case may sirnply

disrupt the chromatin structure on the plasmid by its binding to the SV40 ongin, which in

tum could expose plasmid DNA to P143. The non-specific binding of Pl43 to the SV40

ongin may eventually lead to its repiication by the baculovirus replication machinery.

If P l43 has helicase activity, binding of Pl43 to an origin could lead to DNA

unwinding, which would facilitate the assembly of other replication factors such as the

single-srranded DNA binding protein ont0 the origin. Indeed, evidence presented in this

study demonstrated that Pl43 likely interacted with the viral single-stranded DNA binding

protein, LEF-3 (Fig. 23, 24). Pl43 and LEF-3 probably existed as a complex in the

nucleus since Pl43 alone was excluded from entering the nucleus. If Pl43 binds to DNA

directly in the nucleus, it would bnng LEF-3 to the binding site. Once the DNA duplex was

opened by P143. LEF-3 would stabilize the opened region by its binding to the single-

stranded region. which. in mm, would facilitate the assembly of other replication factors

such as the pnrnase complex or the DNA polymerase for DNA synthesis.

D. Recombination and Viral DNA Replication

Analysis of the products of DNA replication in the cotransfected cells indicated that

baculovinis incorporated a significant arnount of replicated plasmid DNA into its genome,

which was then packaged into progeny virions (Fig. 12). Cornparison of the percentage of

the replicated plasmid DNA contained in the vinons versus that in the couansfected ceils

would roughly reflect the incorporation rate. Presumably, once integrated, the replicated

plasmid DNA in the cotransfected cells would have the equal possibility of k ing packaged

into virions as the viral genomic DNA. Any unintegated plasmid DNA may be excluded

from packaging due to lack of a packaging signal sequence. Every microgram of purified

virion D N A contained 50-100 pg of replicated plasmid DNA (Fig. 13. lanes 3, 7),

whereas intracellularly for every microgram of viral DNA, there was 400-500 pg of

replicated plasmid DNA (Fig. 10). Therefore. at least 10-25 % of the replicated plasrnid

DNA in the cotransfected cells appeared in the progeny vinons, and was likely in the

integated fom. Accounting for possible exclusion of sorne integrated plasmid DNA from

packaging, the integration rate would be higher. The DNA packaging system could

exclude some defective viral genomes carrying plasmids, or some virai genomes with

excessive sizes due to plasmid integration. Nevertheless. the integration of plasmid DNA

was so prominent that it was easily detectable by resaiction digestion and hybndization of

the total invacellular DNA. The MIuI digestion of the total innacellular DNA greatly

aitered the pattern of the replicated plasrnid DNA on the gel due to the covalent attachent

of plasmid DNA to the viral DNA (Fig. 10). The efficient recombination of the replicated

plasmid DNA into the viral genorne suggests a high degree of involvement of illegitimate

recombination in the process of baculovhs DNA replication. These data are consistent

with other observations that the bacterial transposon Tn5, when inserted into the

baculovirus genome as an indicator for recombination, exhibits high levels of Tn5

inversion, a stmng indication for recornbination (Martin and Weber, 1997a).

The results presented here also demonstrate the presence of concatemers of

replicated plasmid DNA. in agreement with a previous observation suggesting that the

baculovims may use rolling-circle mode to replicate its DNA. However. the efficient

inteption of the replicated, concatemeric plasmid DNA into the viral genome suggests a

more complex mode of replication that may involve recombination. In the HSV-1 DNA

replication, while the concatemenc f o m of replicated viral DNA was easily detectable,

newly replicated virai DNA was composed of highly branched. complex networks. The

HSV-1 DNA replication process is more complex than a simple rolling-circle mode1 of

replication (Bataille and Epstein, 1995; Bataille and Epstein. 1994; Zhang et al.. 1994;

Severini et al., 1996; Severini sr al., 1994). Therefore, cautions must be taken in

interpreting data related to the structure of plasrnid DNA replicated in baculovirus infected

cells.

It is not clear how the process of baculoviral DNA replication promotes

incorporation of plasrnid DNA into the virai genome or whether the recombination process

and the replication initiation processes are directly linked. Such a mechanism has been

demonstrated in the bacteria phage T4 where the free 3' DNA ends of recombination

intermediates invade neighbouring genomes and serve as the primers for the initiation of

DNA replication (Mosig and Colowick, 1995; Mosig, 1987). Baculovirus DNA may use

such a mechanism to replicate its DNA at a late stage of replication when multiple genomes

are replicating in one single ceU. Some of the replication i n t e d i a t e s may have fkee DNA

ends that invade regions of neighbouring genomes.

Analysis of the integration sites of plasmid DNA revealed that plasmid DNA was

linked with different regions of the viral DNA, some of which were separated by as much

as 50 kb. These data suggest that non-homologous recombination between plasrnid DNA

and viral DNA could lead to deletion of large portions of the viral genome. It has also been

demonstrated that genomes of defective baculovinises carried large deletions of the viral

genome (Carstens. 1987; Carstens, 1982; Kool er al., 1993a; Kool et al., 199 1 ) . A

similar mechanism of non-homologous recombination could be responsible for the

pneration of defective genomes in both cases.

The plasmid replication. recornbination and integration in coaansfected cells may

suggest a way by which baculoviruses have acquired non-homologous DNA sequences

from host cells dunng evolution. For instance. the viral genes encoding PCNA and

ubiquitin may derive from the cellular homologues by such a mechanism. The few

polyhedra (FP) high frequency mutants certainly have cellular repeated sequences inserted

into the viral 25k gene region (Fraser et al., 1983: Bauser et of., 1996; Wang et al., 1989;

Miller and Miller. 1982). As suggested by the results in Fig. 17, the cellular sequences

may integrate into multiple sites around the viral genome. The viral 2% gene mutation has

a detectable selection marker, related to the polyhedra morphology. If more selection

markers were available, more integration sites would Iikely be revealed. For example. in

the polyhedra morphology mutant M5, two identical host cellular repetitive sequences of

290 bp were found inserted at the 2.6 and 46 map unit regions (Carstens, 1987),

supgesting that cellular sequences can be inserted at multiple locations on the viral

genome.

Cellular inserts in baculovirus usually consist of repeated or transposon like

elements, which suggest that the high integration efficiency may simply be due to their

repeated nature. For exarnple, the TE-D transposable element that inserted in the HinàIII-

K region of AcMNPV genome has approximately 50 copies dispersed throughout the host

T. ni genome (Miller and Miller, 1982). These elements have higher chances of integration

than unique cellular sequences. An alternative explanation is that these repeated or

transposon-like elements c m somehow isolate thernselves fiorn the cellular genome during

virus infection, and are replicated by the virus replication machinery and inegrated.

The observation of random integration of the plasmid DNA could lead to the

development of a new tool for the identification of functional viral genes or sequences

such as the viral packaging signal sequences. For example, cotransfection of viral DNA

with plasmids containing the E. coli mini-F origin would promote the integration of rnini-

F into numerous locations on the viral genomes. This integration may disrupt or delete

some functional p n e s or sequences. On the other hand, viral genomes containing the

mini-F insens would replicate in bacteria cells when aansfecteed into E. coli. The E. coli

amplified defective viral genomes could be re-transfected into insect cells for

charactenzation. Any disruption or modification of the normal functions of the virus could

be correlated with a rnini-F insertion in a particular location on the viral genome.

The observation of the efficient integration of plasrnid DNA into the viral genome

raises concems regarding the safety of using baculovirus as a biopesticide. Some of the

cellular homologues of oncogenes or retrovirus-like repeated sequences, as well as

genomes of baculovirus CO-infectants, may integrate into the baculovinis genome during

virus replication. These elements would be persisrently maintained in the population of

vimses as implicated in the studies of the plasmid DNA replication. integration and

packaging. The consequences of the integration of these foreign elements would cenallily

deserve close attention.

E. Conclusions

Replication of plasrnids carrying hr deletions indicated that h n did not function

specifically as the putative origins. Consistent with these data, recombinant viruses

carrying individual hr deletions replicated nomally even though these vimses contained

altered levels of products of viral early genes. In addition, plasmids carrying a series of

viral early p n e s replicated in the infected cells, suggesting that the cis-acting elements

required for the replication of the viral genome may be more widely dispersed on the viral

genome than onginally suggested (Pearson et ai., 1992). These data also implicated a

possible connection between replication initiation and gene transcription in baculovinis.

Replication of plasmid DNA in cells cotransfected with viral DNA was a contrast to

that in the infected cells. Multiple sequences replicated in the cotransfected cells and the

replication did not depend on the presence of specific viral sequences in cis. Rather, the

presence, in tram, of seven viral genes was essential and sufficient to initiate DNA

replication. These data suggest that the selecrion of a particular site of initiation rnay not be

determined directly by the primary DNA sequences. Other factors such as a chromatin-like

smicture on the viral genome may replate the process of initiation.

Analysis of DNA conformation revealed the existence of high molecular weight

concatemers of the replicated plasmid DNA, suggesting that a rolling-circle mode of DNA

replication may be involved. Ten to 25% of the replicated plasmid DNA was integrated

into the viral genome at multiple locations and this integntion may generate large deletions

on the viral genome. No particular sites or sequences were preferentially used for

integration, suggesting that a rnechanism of non-homoIogous recombination could be

involved. Therefore. the process of DNA replication in baculovinis must be prone to

generation of defective genomes, which have also been abundantly demonswted by others

(Carstens, 1987; Kool et al., 1993a; Kool et al., 1991).

Two viral proteins, E l and P143, rnay function as replication initiators by direct

interaction with the viral DNA during initiation. Due to an essential role of Pl43 during

replication, localization of Pl43 into the nucleus and assernbly of it ont0 viral DNA rnay

be vital for the initiation of DNA replication. Among the seven viral proteins required for

DNA replication, the single-stranded DNA binding protein LEF-3 was essential and

sufficient to mediate the nuclear localization of P143. LEF-3 and Pl43 colocdized in the

nucleus. suggesting that these two proteins rnay exist as a complex in the infacted celis. In

contrast, other vual proteins such as IE-1. LEF-1, LEF-2, DNA polymerase and P35 did

not cary the ability to mediate the nuclear localization of P143, suggesting that a direct

interaction between Pl43 and these viral factors may not exist. Pl43 has been

demonstrated to bind double-stranded DNA in a sequence non-specific fashion (Laufs et

al., 1997). which was implicated in this study to be responsible for the replication of

multiple sequences in the cotransfected cells. Direct interaction between the complex of

Pl43 and LEF-3 and the viral DNA rnay play a central role in the initiation of viral DNA

replication.

Together. regulation of the initiation of DNA replication in baculovinis appears to

be a complicated issue. The cis-acting elements that rnay be involved in the initiation of

DNA replication consist of a variety of different viral sequences including hrs (Pearson et

nl.. 1992). HhdIII-K (Lee and Krell. 1992) and regions containing viral early genes.

Although the replication initiator has not k e n identified, the putative helicase Pl43 was

implicated to play an important role in the initiation of DNA replication. Possible

replations such as restriction of specific viral sequences to be approachable by Pl43 rnay

determine certain specific sites to be used as genuine origins of replication. Understanding

the mechanism of initiation rnay have a broad implication in engineering and safe use of

baculovinis as an eficient biopesticide.

REFERENCES

Allen. G. C.Jr. and Komberg, A.(1991). Fine balance in the regulation of DnaB helicase by DnaC protein in replication in Escherichia coli. J . Ëiol. Chem. 266, 22096- 22 10 1 .

Anders, D. G.. Kacica, M. A., Pari, G., and Puntuneri, S. M.(1992). Boundaries and structure of human cytomegalovinis oriLyt, a cornplex origin for lytic-phase DNA replication. J . Virol. 66, 3373-3384.

Anders, D. G. and Punturien, S. M.(1991). Multicomponent ongin of cytomegalovinis lytic-phase DNA replication. J. Virol. 65,931-937.

Anderson, A. H., Bendixen. C., and Westergaard, 0.(1996). DNA replication in e~tkaryotic cells (DeParnphilis, M . L., Ed.) Cold Spring Harbor Laboratory Press, New York- 587-618.

Aoki, K., Ishida, R., and Kasai, M.(1997). Isolation and characterization of a cDNA encoding a translin-like protein, TRAX. FEBS Lett. 401, 109- 1 12.

Arai, K. -1.. Low, R.. Kobori, J.. Shlomai, J., and Kornberg, A.(l98 1). Mechanism of dnaB protein action V. Association of dnaB protein. protein nt, and other prepnming proteins in the pnmosome of DNA replication. J . Biol. Chem. 256.5273-5280.

Armentero, M. -T., Horwitz, M.. and Mermod. N.(1994). Targeting of DNA polymerase to the adenovirus origin of DNA replication by interaction with nuclear factor 1. Proc. Narf. Acad. Sci. USA 91, 11537-11541.

Ayres, M. D.. Howard. S. C.. Kuzio. J.. Lopez-Ferber, M., and Possee. R. D.(1994). The complete DNA sequence of Autographa califoniica nuclear polyhedrosis virus. Virology 202, 586-605.

Baker, T. A.(1995). Replication arrest. Celf 80. 52 1-524.

Bataille, D. and Epstein, A.(1994). Herpes simplex virus replicative concatemers contain L components in inverted orientation. Virology 203.384-388.

Bataille, D. and Epstein, A. L.(1995). Herpes simplex v h s type 1 replication and recombination. Biochimie 77, 787-795.

Bauer, G. A. and Burgers, P. M. J.(1988a). Protein-protein interactions of yeast DNA polymerase III with marnmalian and yeast proliferating ce11 nuclear antigen (PCNA)/cyclin. Biochim. Biophys. Acta 951, 274-279.

Bauer. G. A. and Burgers, P. M. J.(1988b). The yeast analog of mammalian cyclin/proliferating-ce11 nuclear antigen interacts with marnmalian DNA polymerase 6. Proc. Natl. Acad. Sci. USA 85, 7506-75 10.

Bauser, C. A-, Elick, T. A., and Fraser, M. J.(1996). Characterization of hitchhiker, a transposon insertion frequently associated with baculovinis FP mutants derived upon passage in the TN-368 ce11 line. Virology 216,235-237.

Bell, S. P. and Stillman, B.(1992). ATP-dependent recognition of eukaryotic origins of DNA replication by a multiprotein cornplex. Nature 357, 128- 134.

Bernstein, J. A. and Richardson, C. C.(1989). Characterization of the helicase and primase activities of the 63-Da component of the bacteriophage TI p n e 4 protein. J . Biol. Chem. 264, 13066- 13073.

Bimboim, H. C. and Doly, J.(1979). A rapid aikaiine extraction procedure for screening recombinant plasmid DNA. Nucleic Acids Res. 7, 15 13- 15 10.

Biswas, E. E., Chen, P. -H., and Biswas, S. B.(1993). DNA helicase associated with DNA polymerase a: Isolation by a modified immunoaffinity chromatography. Biochemistry 32, 13393- 13398.

Btissard, G. W.. Kogan, P. H., Wei, R., and Rohrmann, G. F.(1992). A synthetic early promoter fiom a baculovirus: Roles of the TATA box and conserved start site CAGT sequence in basal levels of transcription. Virology 190, 783-793.

Blissard, G . W. and Rohrmann, G. F.(1990). Baculovinis diversity and rnolecular biology. Ami. Rev. Entornol. 35, 127- 155.

Blow. J. J. and Laskey, R. A.(1988). A role for the nuclear envelope in connolling DNA replication within the ce11 cycle. Norwe 332, 546-548.

Bochkarev, A.. Pfuetzner, R. A., Edwards, A. M., and Frappier, L.(1997). Structure of the single-stranded-DNA-binding domain of replication protein A bound to DNA. Narrtre 385, 176-181.

Boehmer, P. E. and Lehman, 1. R.(1997). Herpes simplex virus DNA replication. Ami. Rev. Biochent. 66, 347-384.

Borowiec, J. A.(1996). DNA replicotiori in eukaryoric cells (DePamphilis, M. L.. Ed.) Cold Spring Harbor Laboratory Press, New York. 545-574.

Borowiec, J. A., Dean, F. B., Bullock, P. A., and Hurwitz, J.(1990). Binding and unwinding--How T antigen engages the SV40 origin of DNA replication. C e l l 6 0 , 181-184.

Borowiec, J. A. and Hurwitz, J.(1988). Localized melting and structural changes in the SV40 origin of replication induced by T-antigen. EMBO J . 7,3 149-3 158.

Botchan, M.(1996). Coordinating DNA replication with ce11 division: Current status of the licensing concept. Proc. Natl. Acad. Sei. USA 93, 9997-10000.

Bravo, R., Frank, R.. Blundell, P. A., and Macdonald-Bravo. H.(1987). Cyclin/PCNA is the auxillary protein of DNA polymerase-delta. Nufure 326, 5 15-5 17.

Brosh, R. M.,Jr. and Matson, S. W.(1996). A partiaily fûnctional DNA helicase II mutant defective in forming stable binary complexes with ATP and DNA - A role for helicase motif III. J. Biol. Chem. 271, 25360-25368.

Brown, M., Crawford, A. M., and Faulkner, P.(1979). Genetic analysis of a baculovhs Autographa californica nuclear polyhedrosis virus. 1. Isolation of temperature- sensitive mutants and assonment into complementation groups. J . Virol. 31, 190-1 98.

Brown, M. and Fauikner, P.(1978). Plaque assay of nuclear polyhedrosis vimses in cell culture. Appl. Environ. Microbiol. 36, 31-35.

Brun, C., Surdej, P., and Miassod, R.(1993). Relationship between scaffold-anached regions, sequences replicating auronomousIy in yeast, and a chromosomal replication origin in the Drosophila rDNA. Exp. Ce11 Res. 208, 104-1 14.

Brusca, J., Summers, M.. Couch, I., and Courtney, L.(1986). Aurographa californico nuclear polyhedrosis v h s efficiently eneters but does not replicate in poikilothermic vertebrate cells. Intervirol. 26, 207-222.

Bueno, A. and Russell, P.(1992). DuaI functions of CDC6: A yeast protein required for DNA replication also inhibits nuclear division. EMBO J. 11, 2 167-2 176.

Burgers, P. M. J . ( W 1). Saccharomyces cer-evisiue replication factor C. II. Formation and activity of complexes with the proliferating ce11 nuclear antigen and with DNA polymerases 6 and CE. J. Biol. Chem. 266, 22698-22706.

Campbell, J. L.(1993). Yeast DNA replication. J. Biol. Chem. 268, 2526 1-25264.

Carbonell, L. F., Hodge, M. R., Tomaiski, M. D., and Miller, L. K(1988). Synthesis of a gene coding for an insect-specific scorpion neurotoxin and atternpts to express it using baculovirus vectors. Gene 73, 409-418.

Carson, D. D., Guarino, L. A., and Summers, M. D.(1988). Functional mapping of an AcNPV immediately early gene which augments expression of the IE- 1 tram-activated 39K gene. Virology 162,444-451.

Carson, D. D., Summers, M. D., and Guarino, L. A.(1991). Transient expression of the Alrtographa califortzica nuclear polyhedrosis virus immediate-early gene, IE-N, is regulated by three viral elements. J. Vir-ol. 65,945-95 1.

Carstens. E. B.(1982). Mapping the mutation site of an Autogropha colifonlica nuclear polyhedrosis virus polyhedron morphology mutant J . Virol. 43, 809-8 18.

Carstens, E. B.(1987). Identification and nucleotide sequence of the repions of Autographa colifornica nuclear polyhedrosis virus genome camying insertion elements from Spodoptera frugiperda. Virology 161, 8- 17.

Carstens, E. B., Lu, A. L., and Chan, H. B.(1993). Sequence, transcriptional mapping, and overexpression of p47, a baculovinis gene regulating late gene expression. J . Virol. 67, 25 13-2520.

Carstens, E. B., Tjia, S. T., and Doerfler, W.(1979). Infection of Spodoptera frugiperda cells with Autographa californica nuclear polyhedrosis virus. 1. Synthesis of inmacellular proteins after virus infection. Virology 99,386-398.

Carstens, E. B., Tjia, S. T., and Doerfler, W.(1980). Infectious DNA from Autographa califorwka nuclear poly hedrosis virus. Virology 101, 3 1 1-3 14.

Cartier, J. L., Hershberger, P. A., and Fnesen, P. D.(1994). Suppression of apoptosis in insect cells stably transfected with baculovirus p35: Dominant interference by N- terminal sequences p351-76. J. Virol. 68,7728-7737.

Challberg, M.(1996). DNA replication in eukaryoric cells (DeParnphilis, M . L., Ed.) Cold Spnng Harbor Laboratory Press, Cold Spnng Harbor, NY. 721-750.

Challberg, M. D. and Kelly, T. J.(1979). Adenovims DNA replication in vitro. Proc. Natl. Acad. Sci. USA 76, 655-659.

Challberg. M. D. and Kelly. T. J.(1989). Animal virus DNA replication. Arin. Rev. Biochem. 58, 671-717.

Challberg. M. D. and Kelly, T. J. J.(1979). Adenovinis DNA replication in vitro: origin and direction of daughter swnd synthesis. J. Mol. Biol. 135, 999-1012.

Chase, J. W. and Williams, K. R.(1986). Single-stranded DNA binding proteins required for DNA replication. Anri. Rev. Biochem. 55, 103-136.

Chejanovsky, N., Zilberberg, N., Rivkin, H., Zlotkin, E., and Gurevitz, M.(1995). Functional expression of an alpha anti-insect scorpion neurotoxin in insect cells and lepidopterous larvae. FEBS Lett. 376, 18 1 - 184.

Chen, M., Pan, 2. -Q., and Hurwitz, J.(1992). Studies of the cloned 37-kDa subunit of activator 1 (replication factor C) of HeLa cells. Proc. Natl. Acad. Sci. USA 89, 521 1- 5215.

Cheng, L. and Kelly, T. J.(1989). Transcriptional activator nuclear factor 1 stimulates the replication of SV40 minichromosomes in vivo and in vitro. Ceil 59,541-55 1.

Chiang. C. -S., Xu, Y. -Ce, and Bremer, H.(1991). Role of DnaA protein during replication of plasmid pBR322 in Escherichia coli. MGG 225,435-442.

Chisholm, G. E. and Henner, D. J.(1988). Multiple early aanscripts and splicing of the Aictographa californica nuclear polyhedrosis virus IE-1 gene. J. Viro1.62. 3193- 3200.

Choi, J. and Guarino, L. A.(1995a). A temperature-sensitive IEI protein of Autogropha californica nuclear polyhedrosis virus has altered transactivation and DNA binding activities. Virology 209, 90-98.

Choi, J. and Guarino. L. A.(1995b). The baculovirus transactivator E l binds to viral enhancer elements in the absence of insect ce11 factors. J. Virol. 69,4548-455 1.

Choi, J. and Guarino, L. A.(1995c). Expression of the 1El transactivator of Azltographa coiiforriicu nuclear polyhedrosis virus during viral infection. Viroiogy 209, 99-107.

Chong, J. P. J.. Mahbubani, H. M., Khoo, C. -Y., and Blow, J. J.(1995). Purification of an MCM-containing complex as a component of the DNA replication licensinp system. Nature 375, 41 8-42 1.

Chong, J. P. J., Thomrnes, P., and Blow, J. J.(1996). The role of MCM/Pl proteins in the licensing of DNA replication. Trends Biochem. Sei. 21, 102- 106.

Cochran. M. A. and Faulkner, P.(1983). Location of homologous DNA sequences interspersed at five regions of the baculovims AcMNPV genome. J. Virol. 45. 961- 970.

Coenjaerts, F. E. J. and Van der Vliet, P. C.(1994). Early dissociation of nuclear factor 1 from the origin during initiation of adenovirus DNA replicarion studied by origin immobilization. Nrtcleic Acids Res. 22, 5235-5240.

Coenjaerts, F. E. J., Van Oosterhout, J. A. W. M., and Van der Vliet. P. C(1994). The Oct-1 POU domain stimulates adenovirus DNA replication by a direct interaction between the viral precursor terminal protein-DNA polymerase complex and the POU homeodomain. EMBO J. 13, 540 1-5409.

Coghlan, A.(1994). Will the scorpion gene run wild? New Scientist 142 No. 1931. 14-15.

Collins, 1. and Newlon, C. S.(1994). Chromosomal DNA replication initiates at the same origins in meiosis and mitosis. Mol. Cell. Biol. 14, 3524-3534.

Collins, K. L. and Kelly. T. J.(1991). Effects of T antigen and replication protein A on the initiation of DNA synthesis by DNA polymerase a-primase. Mol. Cell. Biol. I l , 2108-21 15.

Collins. K. L., Russo, A. A. R, Tseng. B. Y.. and Kelly, T. J.(1993). The role of the 70 kDa subunit of human DNA polymerase a in DNA replication. EMBO J. 12. 4555-4566.

Copeland, W. C. and Wang. T. S. -F.(1991). Catalytic subunit of human DNA polymerase a overproduced frorn baculovirus-infected insect cells. Structural and enzymological characterization. J. Biol. Chem. 266.22739-22748.

Copeland, W. C. and Wang. T. S. -F.(1993). Enzymatic characterization of the individual rnamrnalian pnmase subunits reveals a biphasic mechanism for initiation of DNA replication. J. Biol. Chem. 268. 26 179-26 189.

Coverley. D. and Laskey. R. A.(1994). Regulation of eukaryotic DNA replication. A m . Rev. Biochem. 63. 745-776.

Crawford. A. M. and Miller, L. K(1988). Charactenzation of an early gene accelerating expression of late genes of the baculovirus Autographa califorriica nuclear polyhedrosis virus. J. Virol. 62, 2773-2781.

Croizier. G., Croizier. L.. Argaud, O., and Poudevigne, D.(1994). Extension of Autographa califorrzic~ nuclear polyhedrosis virus host range by interspecific replacement of a short DNA sequence in the pl43 helicase gene. Proc. Natl. Acad. Sci. USA 91. 48-52.

Dabrowski, C. E.. Carmillo. P. J., and Schaffer. P. A.(1994). Cellular protein interactions with herpes simplex virus type 1 oriS. Mol. Cell. Biol. 14. 254-2555

Dabrowski. C. E. and Schaffer, P. A.(1991). Herpes simplex virus type 1 origin-specific binding protein: ois-binding properties and effects of cellular proteins. J . Vb-of. 65. 3140-3150.

Dahmann. C., Diffley, J. F. X., and Nasmyth, K. A.(1995). S-phase-promoting cyclin- dependent kinases prevent re-replication by inhibiting the transition of replication origins to a pre-replicative state. Current Biology 5 , 1257- 1269.

de Zarnaroczy, M. and Bemardi, G.(1986). The pnmary structure of the mitochondrial genorne of saccharomyces cerevisiae-a review. Gerie 47, 155- 177.

DePanphilis. M. L.(1993). Eukaryotic DNA replication: Anatomy of an ongin. A m . Rev. Biochem. 62, 29-63.

Diffley. J. F. X. and Cocker. J. H.(1992). hotein-DNA interactions at a yeast replication origin. Natiu-e 357, 169- 172.

Diffley. J. F. X.. Cocker. J. H., Dowell. S. J., and Rowley, A.(1994). Two steps in the assembly of complexes at yeast replication origins in vivo. Cell78,303-3 16.

Domreiter, L, Copeland, W. C., and Wang, T. S. -F.(1993). Initiation of simian virus 40 DNA replication requires the interaction of a specific domain of human DNA polyrnerase a with large T antigen. Mol. Cell. Biol. 13,809-820.

Egelman, E. H., Yu, X., Wild, R., Hingorani, M. M., and Patel, S. S.(1995). Bacteriophage T7 helicaselprimase proteins form rings around single-stranded DNA that suggest a general structure for hexameric helicases. Proc. Natl. Acad. Sci. USA 92, 3869-3873.

Elias, P. and Lehman, 1. R.(1988). Interaction of origin binding protein with an origin of replication of herpes simplex virus 1. Proc. Natl. Acad. Sei. USA 85,2959-2963.

Erdile, L. F., Heyer, W. -D., Kolodner, R., and Keily, T. J.(l99 1). Characterization of a cDNA encoding the 70-kDa single-stranded DNA-binding subunit of human replication protein A and the role of the protein in DNA replication. J . Biol. Chem. 266, 12090-12098.

Erlandson, M. A., Skepasts, P.. Kuzio, J., and Carstens, E. B.(1984). Genornic variants of a temperature-sensitive mutant of Autogropha californica nuclear polyhedrosis virus containing specific reiterations of viral DNA. Vincr Res. 1,565-584.

Evans, J. T., Leisy, D. J., and Rohrmann, G. F.(1997). Characterization of the interaction between the Baculovinis replication factors LEF-l and LEF-2. J . Virol. 71. 31 14-31 19.

Evans, J. T. and Rohrmann, G. F.(1997). The baculovirus single-stranded DNA binding protein, LEF-3. forms a homotrimer in solution. J . Virol. 71, 3574-3579.

Fangman, W. L. and Brewer. B. J.(1991). Activation of replication origins within yeast chromosomes. Atitirr. Rev. Cell Biol. 7 , 375-402.

Feinberg, A. P. and Vogelsiein, B.(1983). A technique for radiolabeling DNA restriction endonuclease fragments to high specific activity. Analytical Biochemistry 132, 6- 13.

Fien, K. and Stillman, B.(1992). Identification of replication factor C from Saccharomyces cerevisiae: A component of the leading-strand DNA replication complex. Mol. Cell. Biol. 12, 155- 163.

Fciani, M., Marini, F., Gamba, D., Lucchini, G., and Plevani, P.(1994). The B subunit of the DNA polymerase a-primase complex in Saccharomyces cerevisiae executes an essential function at the initial stage of DNA replication. Mol. Cell. Biol. 14, 923-933.

Fraser, M. J. and Hink, W. F.(1982). The isolation and characterization of the MP and FP variants of Galleria rnellortella nuclear polyhedrosis virus. Virology 117, 366-378.

Fraser, M. J., Smith. G. E., and Summers, M. D.(1983). Acquisition of host ce11 DNA sequences by baculoviruses: Relationship between host DNA insertions and FP

mutants of Autwra~ha californicg and -a nuclear polyhedrosis vims. J . Virol. 47, 287-300.

Fuller, R. S., Funnell, B. E.. and Komberg, A.(1984). The dnaA protein complex with the E.coli chromosomal replication origin (oriC) and other DNA sites. Cell38, 889- 900.

Funnell, B. E., Baker, T. A., and Komberg, A.(1986). Complete enzymatic replication of plasmids containing the origin of the Exchenchia coli chromosome. J. Biol. Chem. 261, 5616-5624.

Gahn, T. A. and Schildkraut, C. L.(1989). The Epstein-Barr virus origin of plasrnid replication, oriP, contains both the initiation and temllnation sites of DNA replication. Cell 58, 527-535.

Garber, D. A., Beverley, S. M., and Coen, D. M.(1993). Demonstration of circularization of herpes simplex virus DNA following infection using pulsed field gel electrophoresis. Virology 197,459-462.

Georgaki, A.. Tuteja, N., Sturzenegger, B., and Hübscher, U.(1994). Calf thymus DNA helicase F, a replication protein A copurifying enzyme. Nucleic ~ c i d s Res. 22, 1128- 1 134.

Gilbert, D. M., Miyazawa, H., and DePamphilis, M. L.(1995a). Site-specific initiation of DNA replication in Xerzopus egg extract requires nuclear structure. Mol. Cell. Biol. 15, 2942-2954.

Gilbert, D. M., Miyazawa, H., and DePamphilis, M. L.(1995b). Site-specific initiation of DNA replication in xenopus egg extract requires nuclear structure. Mol. Cell. Biol. 15, 2942-2954.

Gilbert, D. M., Miyazawa, H., Nallaseth. F. S., Onega, J. M., Blow. J. J., and DePamphilis, M. L.(1993). Site-specific initiation of DNA replication in metazoan chromosomes and the role of nuclear organization. 58,475-485.

Gille, H. and Messer, W.(I99 1). LocaIized DNA melting and structural pertu bations in the origin of replication. oriC, of Escherichia coli iri vitro and in vivo. EMBO J . 10, 1579-1584.

Goetz, G. S., Dean, F. B., Hurwitz, J., and Matson, S. W.(1988). The unwinding of duplex regions in DNA by the Simian v h s 40 large tumor antigen-associated DNA helicase activity. J . Biol. Chem. 263,383-392.

Gomes, X. V.. Henricksen, L. A., and Wold, M. S.(1996). Proteolytic mapping of human replication protein A: Evidence for multiple structural domains and a conformational change upon interaction with single-stranded DNA. Biochemisrry 35, 5586-5595.

Gong, M. and Guarino, L. A.(1994). Expression of the 39k promoter of Autographa californico nuclear polyhedrosis virus is increased by the apoptotic suppressor P35. Virology 204, 3 8-44.

Gorbalenya, A. E. and Koonin, E. V.(1989). One more conserved sequence motif in helicases. Nucleic Acids Res. 16, 7734.

Gorbalenya, A. E., Koonin, E. V., Donchenko, A. P., and Blinov, V. M.(1989). Two related superfamilies of putative helicases involved in replication, recombination, repair and expression of DNA and RNA genornes. Nucleic Acidr Res. 17, 47 13-4730.

Gorbalenya, A. F. and Koonin, E. V.(1993). Helicases: amino acid sequence cornparisons and structure-function relationships. Current Opinion in Sfructural Biology 3, 419-429.

Gordon, J. D. and Carstens, E. B.(1984). Phenotypic characierization and physical mapping of a temperature-sensitive mutant of Autographa californica nuclear polyhedrosis virus defective in DNA synthesis. Virology 138.69-8 1.

Graham, B. J., Bengali, 2.. and van de Woude, G. F.(1978). Physical map of the origin of defective DNA in herpes simplex virus type 1 DNA. J. Virol. 25,878-887.

Granados, R. R. and Lawler, K. A.(1981). In vivo pathway of Autographa califomica baculovirus invasion and infection. Virology 108. 297-308.

Granados, R. R. and Williams, K. A.(1986). The biology of bacu~ovin~ses (Granados, R. R. and Federici, B. A., Eds.) CRC Press Inc., Boca Raton,Florida. 89-108.

Graves-Woodward, K. L. and Weller, S. K.(1996). Replacement of ~ 1 ~ 8 1 5 in helicase motif V dters the single-stranded DNA-dependent ATPase activity of the herpes simplex virus type 1 helicase-primase. J. Biol. Chem. 271, 13629- 13635.

Greenfeder, S. A. and Newlon, C. S.(1992). A replication map of a 61 kb circular derivative of Saccharomyces cerevisiae chromosome I I I . Mol. Biol. Ce l l3 , 999- 101 3.

Groner, A.(1986). The biology of baculoviruses, Volitrne I (Granados. R . R. and Federici, B. A., Eds.) CRC Press Inc., Boca Raton, Fl.. 177-202.

Gross-Bellard, M., Oudet, P., and Chambon. P.( 1973). Isolation of high-molecular- weight DNA from mamrnalian cells. Ercr. J. Biocheni. 36, 32-38.

GNSS. C., Gutierrez, C., Burhans, W. C., DePanphilis, M. L., Koller. T., and Sogo, J. M.(1990). Nucleosome assernbly in mamrnalian cell extracts before and after DNA replication. EMBO J. 9, 29 1 1-2922.

Guarino, L. A. and Dong, W.(1991). Expression of an enhancer-binding protein in insect cells msfected with the Autographa californica nuclear polyhedrosis virus El gene. J . Virol. 65, 3676-3680.

Guarino, L. A., Gonzalez, M. A., and Sumrners, M. D.(1986). Complete sequence and enhancer function of the homologous DNA regions of Autogrupha caiifornica nuclear polyhedrosis virus. J. Virol. 60, 224-229.

Guarino, L. A. and Smith, M.(1992). Replation of delayed-early gene transcription by dual TATA boxes. J. Virol. 66,3733-3739.

Guarino, L. A. and Sumrners, M. D.(1986a). Interspersed homologous DNA of Autographa californica nuclear polyhedrosis virus enhances delayed-early gene expression. J . Virol. 60, 2 15-223.

Guarino, L. A. and Summers, M. D.(1986b). Functional mapping of a uans-activating gene required for expression of a delayed-early gene. J . Virol. 57. 563-57 1.

Guarino, L. A. and Summers, M. D.(1987). Nucleotide sequence and temporal expression of a baculovims regulatory gene. J. Virol. 61,209 1-2099.

Guarino, L. A. and Sumrners, M. D.(1988). Functional mapping of Aurographa californica nuclear polyhedrosis virus genes required for Iate gene expression. J. Virol. 62, 463-47 1.

Guo, 2. -S. . Gutierrez, C., Heine, U., Sogo, J. M., and DeParnphilis, M. L.(1989j. Origin auxiliary sequences can facilitate initiation of sirnian virus 40 DNA replication in vitro as they do in vivo. Moi. Celi. Biol. 9, 3593-3602.

Guo, 2. -S., Heine. U., and DePamphilis, M. L.(1991). T-antigen binding to site I facilitates initiation of SV40 DNA replication but does not affect bidirectionality. Nrrcieic Acids Res. 19, 708 1-7088.

Guo, 2. S. and DeParnphiIis, M. L.(1992). Specific transcription factors stimulate simian virus 40 and polyomavirus origins of DNA replication. Mol. Cell. Biol. 12, 2514- 2524.

Gussander, E. and Adams, A.(1984). Electron microscopie evidence for replication of circular Epstein-Barr vims genomes in latentiy infeckd Raji cells. J. vil-oi. 53, 549- 556.

Gutierrez, C., Guo, 2. -S., Roberts, J., and DePamphilis, M. L.(1990). Simian virus 40 origin auxiliary sequences weakly facilitate T-antigen binding but strongly facilitate DNA unwinding. Mol. Ceil. Biol. 10, 17 19-1728.

Hagmeyer, B. M., Konig, H., Herr, I., Offringa. R., Zantema, A., Van der Eb, A. J., Herrlich, P., and A n p l , P.(1993). Adenovirus E1A negatively and positively

modulates transcription of AP- 1 dependent genes by dimer-specific regulation of the DNA binding and transactivation activities of Jun. EMBO J. 12,3559-3572.

Hall, M. C. and Matson, S. W.(1997). Mutation of a highly conserved arginine in motif IV of Escherichia coli DNA helicase I I results in an ATP-binding defect. J . Biof. Chem. 272, 18614-18620.

Hamlin, J. L., Mosca, P. J., and Levenson, V. V.(1994). Defining ongins of replication in mammalian cells. Biochimica et Biophysica Acta: Reviews on Cancer 1198, 85- 111.

Harnrnarsten, O., Elias, P., and Stow, N. D.(1996). Charactenzation of a binding site for the herpes simplex virus type 1 UL9 origin-binding protein within the UL9 gene. J. Gen. Virol. 77, 969-976.

Hamzeh, F. M., Lietman, P. S., Gibson, W., and Hayward, G. S.(1990). Identification of the lytic origin of DNA replication in human cytomegalovirus by a novel approach utilizing ganciclovir-induced chah termination. J. Virol. 64.6 184-6 195.

Hanahan, D.(1983). Stuàies on transformation of Escherichia coli with plasrnids. J . Mol. Biof. 166, 557-580.

Hang, X., Dong, W., and Guarino, L. A.(1995). The lef-3 gene of Autogropha califor~lica nuclear polyhedrosis virus encodes a single-stranded DNA-binding protein. J . Virol. 69, 3924-3928.

Harland, R. M. and Laskey, R. A.(1980). Regulated replication of DNA microinjected into eggs of Xenopus laevis. Ce11 2 1. 76 1-77 1.

Harrison, S., Fisenne, K., and Hearing. J.(1994). Sequence requirements of the Epstein- Barr virus latent origin of DNA replication. J. Virol. 68, 191 3- 1925.

Hassell, J. A. and Brinton, B. T.(1996). DNA replication il1 eukoryotic cells (DePamphilis, M . L., Ed.) Cold Spnng Harbor Laboratory Press, New York. 639- 678.

Hatfield, L. and Hearing, P.(1993). The NFIWOCT-1 binding site stimulates adenovhs DNA replication in vivo and is functionally redundant with adjacent sequences. J. Vil-01. 67, 393 1-3939.

Hay. R. T. and DePamphilis, M. L.(1982). Initiation of SV40 DNA replication in vivo: Location and structure of 5' ends of DNA synthesized in the on region. Ce11 28,767- 779.

He, J. K. and Huang, L.(1997). Growth inhibition of human papillomavirus 16 DNA- positive mouse tumor by antisense RNA transcribed from U6 promoter. Cancer Research 57, 3993-3999.

He, 2.. Bnnton, B. T.. Greenblatt, J., Hassell, J. A., and Ingles, C. J.(1993). The transactivator proteins vp16 and gal4 bind replication factor a. Cell 73, 1223- 1232.

Heimpel. A. M.(1966). Exposure of white mice and guinea pigs to the nuclear polyhedrosis of the cabbage looper, Tnch~plusia ni. J . Invertebr. Parhol. 8,98402.

Heintz, N. H.(1992). Transcription factors and the control of DNA replication. Curr. Opin. Ce11 Biol. 4,459-467.

Heinzel, S. S., Krysan, P. J., Tran, C. T., and Calos. M. P.(1991). Autonomous DNA replication in human ceus is affected by the size and the source of the DNA. Mol. Cell. Biol. 11 , 2263-2272.

Hoang, A. T.. Wang. W., and Gralla, J. D.(1992). The replication activation potential of selected RNA polymerase iX promoter elements at the Simian Virus 40 origin. Mol. Cell. Biol. 12, 3087-3093.

Hodgman, T. C(1988). A new superfamily of replicative proteins. Nature (London) 333, 22-23.

Hsieh, D. -J., Camiolo, S. M., and Yates, J. L.(1993). Constitutive binding of EBNAl protein to the Epstein-Barr virus replication origin, oriP, with distonion of DNA structure dunng latent infection. EMBO J. 12,4933-4944.

Huh. N. E. and Weaver, R. F.(1990a). Categorizing some early and late transcripts directed by the Autogropha califonlica nuclear polyhedrosis virus. J. Geri. Vil-01.71. 21 95-2200.

Huh. N. E. and Weaver, R. F.(1990b). Identifying the RNA polymerases that synthesize specific transcnpts of the Autogropha califonzicu nuclear polyhedrosis virus. J. Gen. Virol. 71 , 195-201.

Hyrien, O., Maric, C., and Méchali, M.(1995). Transition in specification of embryonic metazoan DNA replication origins. Scietlce 270, 994-997.

Igarashi. K., Fawl, R.9 Roller, R. J., and Roizman, %.(1993). Construction and propenies of a recombinant herpes simplex virus 1 lacking both S-component origins of DNA synthesis. J . Virol. 67, 2123-2132.

Ignoffo, C. A.(1975). Bac~tZoviruses for insect Pest control: sufery comiderarions (Summers, M . , Engler, R., Falcon, L. A., and Vail, P.. Eds.) Amencan Society for Microbiology, Washington, DC. 52-57.

Ignoffo, C. M. and Rafajko, R. F.(1973). In vitro attempts to infect primate ce11 lines with the nucleopolyhedrosis vins of Heliothis. J. Invertebr. ~a tho l . 20. 32 1- 325.

Jacob, F., Brenner, S., and Cuzin, F.(1964). On the regulation of DNA replication in bacteria Coid Spring Harbor Symp. Quunt. Biol. 28,329-348.

Jezewska, M. J. and Bujalowski, W.(1996). Global conformational transitions in Escherichia coli primary replicative helicase DnaB protein induced by ATP, ADP, and single-stranded DNA binding - Multiple conformational, States of the helicase hexamer. J. Biol. Chem. 271,4261-4265.

Jezewska, M. J., Kim, U. S.. and Bujalowski, W.(1996). Binding of Escherichia coli primary replicative helicase DnaB protein to single-stranded DNA. Long-range allostenc conformational changes within the protein hexamer. Biochernistry 35, 2129-2145.

Kamita, S. G. and Maeda. S.(1997). Sequencing of the putative DNA helicase-encoding p n e of the Bombyx rnori nuclear polyhedrosis vins and fine-mapping of a region involved in host range expansion. Gerie 190, 173-179.

Kelly, D. C.(1981). Baculovhs replication: Stimulation of thymidine kinase and DNA polymerase activities in Spodoptera ffugiperda cells infected with Trichoplusia ni nuclear p;olyhedrosis virus. J. Gen. Virol. 52, 313-319.

Kelly, T. J.(1988). SV40 DNA replication. J . Bioi. Chem. 263, 17889- 17892.

Kelman, Z(1997). PCNA: Smcture, functions and interactions. Oncogetle 14, 629-640.

Kelman, 2. and OtDonnell, M.(1995). Smictural and functional similarities of prokaryotic and eukaryotic DNA polymerase sliding clamps. N~icleic Acids Res. 23, 36 13-3620.

Kenny, M. K., Lee, S. -H., and Hurwitz. J.(1989). Multiple functions of human single- stranded-DNA binding protein in simian vims 40 DNA replication: Single-suand stabilization and stimulation of DNA polymerases a and 6. Proc. Natf. Acad. Sci. USA 86, 9757-9761.

Kesti, T., Frantti, H., and Syvaoja, J. E.(1993). Molecular cloning of the cDNA for the catalytic subunit of human DNA polymerase E. J . BioL Chem. 268, 10238- 10245.

Kim, Y. T. and Richardson, C. C.(1993). Bactenophage T7 gene 2 J protein: An essential protein for DNA replication. Proc. Natl. Acad. Sci. USA 90, 10 173- 10 177.

King, A. J. and Van der Vliet, P. C.(1994). A precursor terminal protein-trinucleotide intermediate during initiation of adenovirus DNA replication: Regeneration of molecular ends i~r vitro by a jumping back mechanism. EMBO J. 13,5786-5792.

Kitsberg, D., Selig, S., Brandeis, M., Simon, I., Keshet, I., Driscoll, D. J., Nicholls, R. D., and Cedar, H.(1993a). Allele-specific replication timing of i m p ~ t e d gene regions. Nartrre 364, 459-463.

Kitsberg, D., Selig, S., Keshet, L, and Cedar, K(1993b). Replication structure of the human beta-globin gene domain. Nature 366,588-590.

Klobutcher, L. A.(1995). Developmentally excised DNA sequences in euplotes crussur capable of fomiing G quartets. Proc. Natl. Acad. Sei. USA 92, 1979- 1983.

Knudson, D. L. and Tinsley, T. W.(1974). Replicating nuclear polyhedrosis virus in a continuous ce11 culture of Spodoptera frugiperda: Purification, assay of infectivity and growth charactenstics of the virus. J. Virol. 14.934444.

Kondo, A. and Maeda, S.(1991). Host range expansion by recombination of the baculovinises Bombyx mori nuclear polyhedrosis virus and Aurographa caiiforrzica nuclear polyhedrosis virus. J. Virol. 65,3625-3632.

Kool, M., Ahrens, C. H., Goldbach, R. W., Rohnnann, G. F., and Vlak, J. M.(1994a). Identification of p n e s involved in DNA replication of the Autogropha califtornica baculovims. Proc. Narl. Acad. Sci. USA 91, 1 12 12- 1 12 16.

Kool, M., Ahrens, C. H., Vlak, J. M.. and Rohrmann, G. F.(1995). Replication of baculovims DNA. J . Getz. Virol. 76, 2103-21 18.

Kool, M., Goldbach, R. W., and Vlak, J. M.(1994b). A putative non-hr ongin of DNA replication in the HirrdIII-K fragment of Autographa califorriico multiple nucleocapsid nuclear polyhedrosis virus. J . Gen. Virol. 75, 3345-3352.

Kool, M.. Van den Berg, P. M. M. M., Tramper, J., Goldbach, R. W., and Vlak, J. M.(1993a). Location of two putative origins of DNA replication of Aitrographa califor-riica nuclear polyhedrosis virus. Viroiogy 192, 94- 10 1.

Kool, M., Voeten, J. T. M., Goldbach, R. W.. Tramper, J., and Vlak, J. M.(1993b). Identification of seven putative origins of A urographo californica multiple nucleocapsid nuclear polyhedrosis vims DNA replication. J. Gen. Virol. 74, 2661- 2668.

Kool, M., Voeten, J. T. M., Goldbach, R. W., and Vlak. J. M.(1994c). Functional mapping of regions of the Aurographa californica nuclear polyhedrosis virai genome required for DNA replication. Virology 198,680-689.

Kool, M., Voncken, J. W., Van Lier, F. L. J., Tramper, J., and Vlak, J. M.(1991). Detection and analysis of Aittographa californica nuclear polyhedrosis virus mutants with defective interfenng properties. Virology 183.739-746.

Koonin, E. V.(1993). A common set of conserved motifs in a vast variety of putative nucleic acid-dependent ATPases including MCM proteins involved in the initiation of eukaryotic DNA replication. Nucfeic Acids Res. 21, 254 1-2547.

Kornberg, A. and Baker, T. A.(1992). DNA replication, W.H.Freeman and Company, New York.

Kovacs, G. R., Choi. J., Guarino, L. A., and Surnmers, M. D.(1992). Functional dissection of the Autographa californica nuclear pol yhedrosis virus immediate-early 1 transcriptional regulatory protein. J. Virof. 66,7429-7437.

Kovacs, G. R.. Guarino, L. A., and Summen. M. D.(1991). Novel regulatory properties of the IEl and IEO transactivators encoded by the baculovinis Autogropha californica mu1 ticapsid nuclear polyhedrosis virus. J. Virof. 65,528 1-528 8.

Kowalski, D. and Eddy, M. J.(1989). The DNA unwinding elernent: A novel, cis-acting component that facilitates opening of the Escherichia coli replication ongin. EMBO J. 8, 4335-4344.

Krappa, R.. Behn-Krappa. A., Jahnel. F., Doerfîer, W., and Knebel-Morsdorf, D.(1992). Differential factor binding at the promoter of early baculovirus gene PE38 during viral infection: GATA motif is recoinized by an insect protein. ~ . - ~ i r o f . 66. 3494-3503.

Krappa, R.. Roncarati, R., and Knebel-Morsdorf, D.(1995). Expression of PE38 and IE2, viral members of the C3HC4 finger family, dunng Baculovhs infection: PE38 and XE2 localize to distinct nuclear regions. J. Virol. 69, 5287-5293.

Krishna, T. S. R., Kong, X. -P., Gary, S., Burgers, P. M., and Kunyan, J.(1994). Crystal structure of the eukaryotic DNA polymerase processivity factor PCNA. Ce11 79, 1233-1243.

Krysan, P. J., Haase, S. B., and Calos, M. P.(1989). Isolation of human sequences that replicate autonomously in human celis. Mol. CelI. Biol. 9. 1026- 1033.

Kubota, T.. Katayama, T., ho, Y., Mizushima, T., and Sekimizu, K.(1997). Conformational transition of DnaA protein by ATP: Sûuctural analysis of DnaA protein. the initiator of Escherichia coli chromosome replication. Biochem. Biophys. Res. Cornrnrr~t. 232, 130- 135.

Kubota, Y., Mimura, S., Nishimoto, S., Takisawa, H., and Nojima, H.(1995). Identification of the yeast MCM3-related protein as a component of Xenopus DNA replication licensing factor. Celf81,601-609.

Kung. S. H. and Medveczky, P. G.(1996). Identification of a herpesvirus Saimin cis- acting DNA fragment that permits stable replication of episomes in transformed T cells. J. Virol. 70, 1738- 1744.

Kunkel, T. A. and Bebenek, K(1988). Recent studies of the fidelity of DNA synthesis. Biochim. Biophys. Acta 951, 1-15.

Kuriyan. J. and OtDonnell. M.(1993). Sliding clamps of DNA polymerases. J. Mol. Biol. 234, 9 15-925.

Laernrnli, U. K.(197O). Cleavage of stmctural proteins during the assembly of the head of bacteriophage T4. Nature (London) 227,680-685.

Laufs, S., Lu, A., ArreII, L. K., and Carstens, E. B.(1997). Autographa californica nuclear polyhedrosis virus pl43 gene product is a DNA-binding protein. Virology 228, 98-106.

LeBowitz, J. H. and McMacken, R.(1986). The Escherichia coli dnaB replication protein is a DNA helicase. J. Biol. Chem. 261,4738-4748.

Lee, H. Y. and Krell, P. J.(1992). Generation and analysis of defective genomes of Autographa californica nuclear polyhedrosis virus. J. Virol. 66,4339-4347.

Lee, P. W. and Leone, G.(1994). Reovinis protein sigma 1: from cell attachment to protein oligomerization and folding mechanisrns. BioEssays 16. 199-206.

Lee, S. -H. and Hurwitz, J.(1990). Mechanism of elongation of primed DNA by DNA polyrnerase 6, proliferating ceIl nuclear antigen, and activator 1. Proc. Nd. Acad. Sci. USA 87, 5672-5676.

Lee, S. H., Pan. 2. Q., Kwong, A. D., Burgers, P. M., and Hunvitz, J.(1991). Synthesis of DNA by DNA polymerase E irr vitro. J . Biol. Chem. 266, 22707-22717.

Leem, S. H., Ropp, P. A., and Sugino, A.(1994). The yeast Saccharomyces cerevisioe DNA polymerase IV: Possible involvernent in double strand break DNA repair. Nucleic Acids Res. 22, 30 1 1-301 7.

Leisy. D. J., Rasmussen, C., Kim, H. -T., and Rohrmann, G. F.(1995). The Ai<rographa califoniica nuclear polyhedrosis virus homologous region la: Identical sequences are essential for DNA replication activity and transcnptional enhancer function. Virology 208. 742-752.

Leisy, D. J. and Rohrrnann. G. F.(1993). Characterization of the replication of plasrnids containhg hr sequences in baculovinis-infected Spodopterajhigiperda cells. Virology 196, 722-730.

Li, R. and Botchan, M. R.(1993). The acidic transcriptional activation domains of VP16 and p53 bind the cellular replication protein A and stimulate in vitro BPV-1 DNA replication. Cell73, 1207- 122 1 .

Li, X., Tan, C. -K., So, A. G., and Downey. K. M.(1992a). Purification and characterization of 6 helicase from fetai calf thymus. Biochemistry 31,3507-3513.

Li, X., Yoder, B. L., and Burgen, P. M. J.(1992b). A Saccharomyces ce)-evisioe DNA helicase associated with replication factor C. J. Biol. Chem. 267, 25321-25327.

Li,

Li,

X. Y.. Li. J., Hamngton, J.. Lieber. M. R.. and Burgers, P. M. J.(1995). Lagging suand DNA synthesis at the eukaryotic replication fork involves binding and stimulation of FEN- 1 by proliferating ce11 nuclear antigen. J . Biol. Chem. 270.22109- 221 12.

Y.. Passarelli, A. L., and Miller. L. K.(1993). Identification. sequence. and transcriptional mapping of lef-3. a baculovirus gene involved in late and very late gene expression. J. Virof .67. 5260-5268.

Liang. C.. Weinreich, M., and Stillman, B.(1995). ORC and Cdc6p interact and d e t e d e die frequency of initiation of DNA replication in the genome. Ce11 81,667- 676.

Little, R. D. and Schildkraut, C. L.(1995). Initiation of latent DNA replication in the Epstein-Barr virus genome can occur at sites other than the pnetically defined ongin. Mol. Cell. Biol. 15, 2893-2903.

Liu, G.(1997). Site-directed mutagenesis of the Autographa californica multicapsid nuclear polyhedrosis virus (AcMNPV) P143: Effects on viral DNA replication. Ph.D. thesis. Queen's University, Kingston. Ontario.

Lockshon, D. and Galloway. D. A.(1988). Sequence and structural requirements of a herpes simplex viral DNA replication origin. Mol. Cell. Biol. 8,401 8-4027.

Lonmer. H. E., Wang, E. H., and Prives, C.(1991). The DNA-binding propenies of polyomavirus large T antigen are altered by ATP and other nucleotides. J. Virol. 65, 687-699.

Lu, A. and Carstens, E. B.(1991). Nucleotide sequence of a gene essential for viral DNA replication in the baculovirus A utogr-opho colifonrica nuclear poly hedrosis virus. Virology 181. 336-347.

Lu, A. and Carstens, E. B.(1992). Transcription analysis of the EcoRI D region of the baculovirus Autographa califonlica nuclear polyhedrosis virus identifies an early 4- kilobase RNA encoding the essential pl43 gene. J. Virol. 66,655-663.

Lu, A. and Carstens, E. B.(1993). Immediate-early baculovirus genes transactivate the p 143 gene prornoter of Autographa califorrrica nuclear polyhedrosis virus. Virology 195, 710-718.

Lu, A. and Miller. L. K(1995). The roles of eighteen baculovirus late expression factor genes in transcription and DNA replication. J. Virol. 69.975-982.

Lu, Y. B., Ratnakar, P. V. A. L., Mohanty, B. K., and Bastia, D.(1996). Direct physical interaction between DnaG primase and DnaB helicase of Escherichio coli is necessary for optimal synthesis of primer RNA. Proc. Nad. Acad. Sci. USA 93. 12902-12907.

MacKinnon. E. A., Henderson, J. F., Stoltz, D. B.. and Faulkner, P.(1974). Morphogenesis of nuclear polyhedrosis virus under conditions of prolonged passage in vitro. J. Ulrrastruct. Res. 49. 419-435.

Madine, M. A., Khoo, C. -Y., Mills. A. D., and Laskey. R. A.(1995). MCM3 cornplex required for ceIl cycle replation of DNA replication in vertebrate cells. Nature 375, 42 1-424.

Maeda, S., Karniîa, S. G., and Kondo, A.(1993). Host range expansion of Autographa californicci nuclear polyhedrosis virus (NPV) following recombination of a 0.6- kilobase-pair DNA fragment originating from Bombyx mon' NPV. J . Virol. 67,6234- 6238.

Marahrens. Y. and Stillman. B.(1992). A yeast chromosomal origin of DNA replication defined by multiple functional elements. Science 255,8 17-823.

Marians. K. J.(1992). Prokaryotic DNA replicaûon. A m . Rev. Biochern. 61, 673-7 19.

Marszalek. J. and Kaguni. J. M.(1994). DnaA protein directs the binding of DnaB protein in initiation of DNA replication in Escherichia coli. J. Biol. Chem. 269.4883-4890.

Manin. D. W. and Weber, P. C.(1997a). DNA replication promotes high-frequency homologous recombination during Autographa californica multiple nuclear polyhedrosis v h s infection. Virol. 232. 300-309.

Martin, D. W. and Weber. P. C.(1997b). Replication of sirnian virus 40 ongin-containing DNA during infection with a recombinant Ailtogr-apha califonlica multiple nuclear polyhedrosis virus expressing large T antigen. J . Virol. 71. 501-506.

Martinez, R., Sarisky, R. T.. Weber. P. C., and Weller, S. K.(1996). Herpes simplex virus type 1 alkaline nuclease is required for efficient processing of viral DNA replication intermediates. J. Virol. 70,2075-2085.

Martinez, R., Shao. L., and Weller, S. K(1992). The conserved helicase motifs of the herpes simplex virus type 1 ongin-binding protein UL9 are important for function. J. Virol. 66, 6735-6746.

Maruniak. J. E., Brown, S. E., and Knudson. D. L.(1984). Physical maps of SfMNPV baculovirus DNA and its genomic variants. Virology 136,221-234.

Marx, J.(1995). Frontiers in biology: Chromosomes How DNA replication originates. Scierzce 270, 1585- 1587.

Masse. M. J. O., Karlin, S., Schachtel, G. A.. and Mocarski. E. S.(1992). Hurnan cytomegalovims ongin of DNA replication (oriLyt) resides within a highly complex repetitive region. Proc. Natl. Acad. Sci. USA 89.5246-5250.

Matson, S. W., Bean, D. W., and George, J. W.(1994). DNA heiicases: enzymes with essential roles in al1 aspects of DNA metabolism. BioEssays 16, 13-22.

Matson, S. W., Tabor, S., and Richardson, C. C.(1983). The gene 4 protein of bacteriophage 77. J. Biol. Chem. 258, 140 17- 14024.

Mechali. M. and Kearsey, S.(1984). Lack of specific sequence requirement for DNA replication in Xenopus eggs compared with high sequence specificity in yeast. Cell 38, 55-64.

Melendy, T. and Stillman, B.(1993). An interaction between replication protein A and SV40 T antigen appears essential for pnmosome assembly during SV40 DNA replication. J. Biol. Chem. 268, 3389-3395.

Melov, S., Vaughan. H., and Coaerill. S.(lW2). Molecular characterisation of the gene for the 180 kDa subunit of the DNA polymerase-pnmase of Drosophila melanogaster. J. Cell Sci. 102, 847-856.

Mendelman, L. V., Notarnicola, S. M., and Richardson, C. C.(1993). Evidence for distinct primase and helicase domains in the 63-kDa gene 4 protein of bacteriophage T7. Characterization of a nucleotide binding site mutant. J. Biol. Chem. 268. 27208- 27213.

Messer, W., Seufert, W., Schaefer, C., Gielow, A., Hartmann, H., and Wende, M.(1988). Functions of the DnaA protein of Escherichia coli in replication and transcription. Biochim. Biophys. Acta 951, 35 1-358.

Middleton. T. and Sugden. B.(1992). EBNAl can link the enhancer element to the initiator element of the Epstein-Barr virus plasrnid origin of DNA replication. J. Virol. 66, 489-495.

Mikhailov, V. S.. Marlyev. K. A.. Ataeva, J. O., Kullyev, P. K.. and Atrazhev. A. M.(1986). Characterization of 3' - 5' exonuclease associated with DNA polymerase of s i k w o m nuclear polyhedrosis virus. Nucleic Acids Res. 14. 384 1-3857.

Miller, D. W. and Miller. L. K(1982). A virus mutant with an insertion of a copia-like transposable element. Nature (London) 299, 562-564.

Miller, L. K., Miller, D. W., and Adang, M. J.(1982). Genetic Engineering in eukaryo~s: NATO advanced study Iristirutes Series A (Lurquin. P . F. and Kleinhofs, A., Eds.) Plenum Press, New York. 89-98.

Miller. L. K., Trimarchi, R. E., Browne, D., and Pennock, G. D.(1983). A iernperature- sensitive mutant of the baculovims Alitogrophu caf~orr~ica nuclear polyhedrosis virus defective in an early function required for further gene expression. Virology 126,376- 380.

Mitas, M., Chock, J. Y., and Chrïsty, M.(1997). The binding-site sizes of Escherichia coli single-stranded-DNA-binding protein and mamrnalian replication protein A are 65 and greater than or equal to54 nucleotides respectively. ~ ~ u c h e m i c d Jounial324, 957-96 1 .

Momson, A. and Sugino, A.(1994). The 3'-->5' exonucleases of both DNA polymerases 6 and CE participate in correcting errors of DNA replication in Saccharomyces cerevisiae. Mofecular and General Genetics 242, 289-296.

Mosig, G.(1987). The essential role of recombination in phage T4 growth. Ann. Rev. Genet. 21, 347-371.

Mosig, G. and Colowick, N.(1995). DNA repLication of bactenophage T4 in vivo. Methods Enzymo f . 262, 587-604.

Mossi, R., Jhsson, 2. O., Ailen, B. L., Hardin, S. H., and Hübscher, U.(1997). Replication factor C interacts with the C-terminal side of proliferating cell nuclear antigen. J. Biof. Chem. 272, 1769-1776.

Muritkami, Y., Wobbe, C. R., Weissbach, L., Dean, F. B., and Hurwitz, 3.(1986). Role of DNA polymerase alpha and DNA pnmase in simian virus 40 DNA replication in vitro. Proc. Nad. Acad. Sci. USA 83, 2869-2873.

Muzi-Falconi, F., Brown, G. W., and Kelly, T. 5.(1996). DNA replication: Controlling initiation during the ceii cycle. Current Biofogy 6,229-233.

Navas, T. A.. Zhou, Z., and Elledge, S. J.(1995). DNA polymerase CE links the DNA replication machinery to the S phase checkpoint. Cell80.29-39.

Nethanel, T. and Kaufmann, G.(1990). Two DNA polymerases may be required for synthesis of the

lagging DNA strand of sirnian v h s 40. J. Virol. 64, 5912-591 8.

Newlon, C. S.(1988). Yeas t chromosome replication and segregation. Micr-obiological Reviews 52, 568-60 1.

Notamicola, S. M., Mulcahy, H. L., Lee, J., and Richardson, C. C.(1997). The acidic carboxyl terminus of the bacteriophage T7 gene 4 heIicase/pnmase interacts with T7 DNA polymerase. J . Biol. Chem. 272, 18425- 18433.

OIReilly, D. R., Crawford, A. M., and Miller, L. K(1989). Viral proliferating ce11 nuclear antigen. Nature (London) 337,606.

Ozawa, K., Dean, F. B., Chen, M., Lee, S. -H., Shiratori, A., Murakami, Y., Sakakura, T., Hurwitz, J., and Eki, T.(1993). Mapping of the 70 kDa, 34 kDa, and 1 1 kDa subunit genes of the human multimeric single-suanded DNA binding protein

(hSSB/RPA) to chromosome bands 1 7 ~ 1 3 . lp35p36.1, and 7p21-p22. Ce21 Structure and Function 18, 22 1-230.

Pan, 2. -Q., Chen, M., and Hunvitz, J.(1993). The subunits of activator 1 (replication factor C) carry out multiple functions essentiai for proliferating-ce11 nuclear antigen- dependent DNA synthesis. Proc. Nat/. Acad. Sci. USA 90,6-10.

Parks, R. J. and Graham. F. L.(1997). A helper-dependent system for adenovinis vector production helps define a lower limit for efficient DNA packaging. J. Virol. 71.3293- 3298.

Parsons, R., Anderson, M. E., and Tegtmeyer, P.(1990). Three domains in the simian virus 40 core ongin orchesnate the binding, melting, and DNA helicase activities of T antigen. J . Virol. 64, 509-518.

Parvin, J. D. and Sharp, P. A.(1993). DNA topology and a minimal set of basal factors for transcription by RNA polyrnerase II. Ce11 73,533-540.

Passarelli, A. L. and Miller, L. K.(1993a). Identification and characterization of lef-1. a baculovinis gene involved in late and very Iate gene expression. J . Virol. 67, 3481- 3488.

Passarelli, A. L. and Miller, L. K(1993b). Three baculovinis genes involved in Iate and very Iate gene expression: ie-1, ie-n, and ief-2. J . Virol. 67, 2 149-2 158.

Passarge, E.(1995). A DNA helicase in full BIoom. Nature Getietics 11, 356-357.

Pearson, M.. Bjornson. R., Pearson, G., and Rohrmann, G.(1992). The Autogropha califor-tiica baculovinis genome: Evidence for multiple replication origins. Science 257, 1382-1384.

Pennock, G. D., Shoemaker, C., and Miller, L. K(1984). Suone and regulated expression of Eschenchia coli beta-gdactosidase in insect cells with a baculovinis vector. Mol. Cell. Biol. 4 , 399-406.

Plevani, P., Foiani, M., Falconi, M. M., Piuagalli, A., Santocanale, C., Francesconi, S., Valsasnini, P., Cornedini, A., Piatti, S., and Lucchini, G.(1988). The yeast DNA polymerase-primase complex: Genes and proteins. Biochim. Biophys. Acra 951. 268-273.

Podust. L. M., Podust, V. N., Sogo, J. M., and Hübscher, U.(1995). Mammalian DNA polymerase auxiliary proteins: Anaiysis of replication factor C-catalyzed proliferating ce11 nuclear antigen Ioading onto circular double-stranded DNA. Mol. Cell. Biol. 15, 3072-3081.

Podust, V. N., Vladimirova, O. V., Manakova, E. N., and Lavnk, 0. L(1992). Eukaryotic DNA primase appears to act as oligomer in DNA-polymerase-a--primase cornplex. Eur-. J. Biochem. 206, 7-13.

Polvino-Bodnar, M., Orberg, P. D.. and Schaffer, P. A.(1987). Herpes simplex virus type 1 oriL is not required for v h s replication or for the establishment and reactivation of latent infection in mice. J* Virol. 61, 3528-3535.

Potter, K. N., Faulkner, P., and MacKinnon, E. A.(1976). Strain selection during senal passage of Trichoplusia ni nuclear polyhedrosis virus. J. Virol. 18. 1040- 1050.

Potter. K. N. and Miller, L. K(1980). Animal Virus Genetics (Field, B. N. and Jaenisch, R., Eds.) Academic Press, New York, 71-80.

Prakash, S., Sung, P.. and Prakash, L.(1993). DNA repair genes and proteins of Saccharomyces cerevisiae. A m . Rev. Genet. 27, 33-70.

Prasad, R., Widen, S. G.. Singhal. R. K., Watkins, J., Prakash. L., and Wilson. S. H.(1993). Yeast open reading frame YCR14C encodes a DNA P-polymerase-like enzyme. Nucfeic Acids Res. 21, 530 1-5307.

Prelich. G. and S tillman, B.(1988). Coordinated leading and lagging snand synthesis dunng SV40 DNA replication in vitro requires PCNA. Ceil 53. 1 17-126.

Prikhod'ko, E. A. and Miller, L. K.(1996). Induction of apoptosis by Baculovirus transactivator IE 1. J. Virol. 70,7 1 16-7 124.

Pullen, S. S. and Friesen. P. D.(1995a). The CAGT motif functions as an initiator element during early transcription of the baculovirus msregulator ie-1. J . Virol. 69, 3575-3583.

Pullen, S. S. and Friesen. P. D.(1995b). Eariy transcription of the ie-l transregulator p n e of Autogi-~pha californica nuclear polyhedrosis virus is regulated by DNA sequences within its 5' noncoding leader region. I. Virol. 69, 156- 165.

Rao, H., Marahrens. Y., and Stillrnan, B.(1994). Functional conservation of multiple elements in yeast chrornosomal replication. Mol. Cell. Biol. 14. 7643-7651.

Rao. H. and Stillman, B.(1995). The origin recognition com~lex interacts with a biuartite DNA binding site within yeast rep1icators.- Proc. ~ o t i . Acad. Sci. USA 92,2224- 2228.

Ray, S., Anderson, M. E., and Tegtrneyer, P.(1996). Differential interaction of temperature-sensitive simian virus 40 T antigens with tumor suppressors pRb and p53. J. Virol. 70, 7224-7227.

Razin, S. V., Vassetzky, Y. S., and Hancock, R.(1991). Nuclear matrix attachment regions and topoisornerase II binding and reaction sites in the vicinity of a chicken DNA replication ongin. Biochem. Biophys. Res. Commun. 177, 265-270.

Revet, B. M. J. and Guelpê B.(1979). The genome of baculovirus infecting Tipula paludosa (Meig.) (Diptera). A high molecular weight closed circular DNA of zero superhelix density. Virology 96, 633-639.

Ribeiro, B. M., Hutchinson, K., and Miller, L. K(1994). A mutant baculovinis with a temperature-sensitive IE- 1 msregulatory protein. J. Virol. 68. 1075- lO84.

Rice, W. C. and Miller, L. K(1987). Baculovinis transcription in the presence of inhibitors and in nonpermissive Drosophila cells. Virus Res. 6, 155-172.

Rodems, S. M. and Friesen, P. D.(1993). The hr5 transcnptional enhancer stimulates early expression from the Aurographa californica nuclear polyhedrosis virus geenoome but is not required for virus replication. J. Virol. 67,5776-5785.

Rodems, S. M. and Friesen, P. D.(1995). Transcnptional enhancer activity of hr5 requires dual-palindrome half sites that mediate binding of a dimenc f o m of the baculovirus transregulator 1 ' 1 . J. Virol. 69, 5368-5375.

Rohel, D. 2. and Faulkner, P.(1984). Time courre analysis and mapping of Aurographo californica NPV transcnpts. J . Virol. 50,739-747.

Rowley. A., Cocker, J. H., Hanvood, J., and Diffley, J. F. X.(1995). Initiation complex assembly at budding yeast replication origins begins with the recognition of a bipartite sequence by limiting amounts of the initiator, ORC. EMBO J. 14,263 1-2641.

Rowley, A., Dowell, S. I., and Diffley, J. F. X.(1994). Recent developrnents in the initiation of chromosomai DNA replication: A complex picture emerges. Biochim. Biopltys. Acta Gerre Srrzict. Expr. 12 1'1, 239-256.

Sarnitt, C. E., Hansen, F. G., Miller, J. F., and Schaechter, M.(1989). In vivo studies of DnaA binding to the origin of replication of Eschcrichia coli. EMBO J . 8,989-993.

San Martin, M. C., Gruss, C., and Carazo, J. M.(1997). Six molecules of SV40 large T antigen assemble in a propeller-shaped particle around a channel. J. Mol. Biol. 268, 15-20.

Santocanale, C., Locati, F., Falconi, M. M., Piseri, A., Tseng, B. Y., Lucchini, G., and Plevani, P.(l992). Overproduction and functional anal ysis of DNA primase subunits from yeast and mouse. Ge~ie 113, 199-205.

Saraste, M., Sibbald, P. R., and Wittinghofer, A.(1990). The P-Ioop-common motif in ATP- and GTP-binding proteins. Trends Biochem. Sci. 15,430-434.

Seki, M., Enomoto, T., Eki, T., Miyajima, A., Murakami, Y., Hanaoka, P., and Ui, M.(1990). DNA helicase and nucleoside-5'-triphosphatase activities of polyoma virus large tumor antigen. Biochemisry 29, 1003- 1009.

Severini, A.. Morgan, A. R., Toveii. D. R., and Tyrreli, D. L. J.(1994). Smdy of the structure of replicative intermediates of HSV-1 DNA by pulsed-field gel electrophoresis. Virology 200.428-435.

Severini, A.. Scraba, D. G., and Tyrrell, D. L. J.(1996). Branched structures in the intracellular DNA of herpes simplex v h s type 1. J . Virol. 70,3 169-3 175.

Shinomiya, T. and Ina, S.(1993). DNA replication of histone gene repeats in Drosophila melanogaster tissue culture cells: Multiple initiation sites and replication pause sites. Mol. C d . Bioi. 13, 4098-4106.

Siegal, G., Turchi, J. J., Jessee, C. B., Myers, T. W.. and Bambara. R. A.(1992). A novel DNA helicase from calf thymus. J. Biol. Chem. 267, 13629-13635.

Simon, M., Giot, L., and Faye, G.(1991). The 3' to 5' exonuclease activity Iocated in the DNA polymerase 6 subunit of Saccharomyces cerevisiae is required for accurate replication. EMBO J . 10, 2 165-2 170.

Skaliter, R., Makhov, A. M., Griffith, J. D., and Lehman. 1. R.(1996). Rolling circle DNA replication by extracts of herpes simplex v h s type 1-infected human cells. J. Virol. 70, 1 132-1 136.

Smith, G. E., Summers, M. D., and Fraser, M. J.(1983). Production of the human beta interferon in insect cells infected with a baculovims expression vector. Mol. Cell. Biol. 3, 2156-2165.

Stadlbauer. F., Brueckner, A.. Rehfuess, C.. Eckerskom, C., Lottspeich. F.. Forster, V., Tseng, B. Y., and Nasheuer, H. -P.(1994). DNA replication irz vitro by recombinant DNA-polymerase-a-pnmase. Ewopean Joiirrzal of Biochemisrry 222, 78 1-793.

S teger, G.. Ham, J., and Yaniv, M. (19%). E2 proteins: Modulators of papillomavirus transcription and replication. Merhods Enzymol. 274, 173- 185.

Stewart, L. M. D., Hirst, M., Ferber, M. L., Merryweather, A. T., Cayley. P. J., and Possee. R. D.(1991). Construction of an improved bacuIovims insecticide containing an insect-specific toxin pne. Narwe 352, 85-88.

Stillman, B. W.(1981). Adenovirus DNA replication ir~ rirro : a protein linked to the 5' end of nascent DNA stmnds. J . Moi. Biol, 40,467-490.

Stinchcomb, D. T., Stnihl, K., and Davis, R. W.(1979). Isolation and characterisation of a yeast chromosomal replicator. Nature 282, 39-43.

Stow. N. D.(1982). Location of an origin of DNA replication within the TRs/IRs repeated region of the herpes simplex vinis type 1 genome. EMBO J. 1, 863-867.

Stnihl. K., Stinchcomb. D. T.. Scherer, S., and Davis, R. W.(1979). High-frequency transformation of yeast: Autonomous replication of hybrid DNA molecules. Proc. Natl. Acad. Sei. USA 76, 1035- 1039.

Su, T. T., Follette, P. J.. and O1Farre1l, P. H.(1995). Qualifying for the license to replicate. Cell 81, 825-828.

Summers. M. D. and Anderson, D. L.(1973). Characterization of nuclear polyhedrosis virus DNAs. J. Virol. 12, 1336-1346.

Summers, M. D. and Smith. G. E.(1987). A manual of methods for baculovirus vectors arzd insect ce[/ culture procediires. Texas A&M University. College Station.

Syvaoja, J. and Linn. S.(1989). Characterization of a large form of DNA polymerase 6 from HeLa cells that is insensitive to proliferating ce11 nuclear antigen. J . Biol. Chem. 264, 2489-2497.

Syvaoja, J. E.(1990). DNA polymerase E: The latest member in the farnily of rnarnmalian DNA polymerases. BioEssays 12, 533-536.

Tarnanoi, F. and Stillman, B. W.(1982). Function of adenovims terminal protein in the initiation of DNA replication. Proc. Nari. Acad. Sci. USA 79, 222 1-2225.

Theis, J. F. and Newlon, C. S.(1994). Domain B of ARS307 contains two functional elements and contributes to chromosomal replication origin function. Mol. Cell. Biol. 14, 7652-7659.

Therrien, M., Chang, H. C., Solomon, N. M., Karim, F. D., Wassarman, D. A.. and Rubin. G. M.(1995). KSR, a novel protein kinase required for RAS signal transduction. Cell83, 879-888.

Thiem, S. M. and Miller, L. K(1989). A baculovirus gene with a novel transcription pattern encodes a with a zinc finger and a leucine zipper. J. ~ i r o i . 63. 4489-4497.

Thommes, P., Ferrari, E.. Jessberger, R., and Hubscher, U.(1992). Four different DNA heiicases from calf thymus. J. Biol. Chem. 267,6063-6073.

Thornmes, P. and Hubscher, U.(1990). DNA helicase from calf thymus. Purification to appearent homogeneity and biochemical characterization of the enzyme. J. Biol. Chem. 265, 14347- 143%.

Thukral, S. K., Blain, G. C., Chang, K. K. H., and Fields, S.(1994). Distinct residues of human p53 implicated in binding to DNA, simian virus 40 large T antigen, 53BP1. and 53BP2. Mol. Cell. Biol. 14, 8315-8321.

Thommes, P. and Hübscher, U.(1992). Eukaryotic DNA helicases: Essential enzymes for DNA transactions. Chromosoma 101, 467-473.

Tjia, S. T., Carstens, E. B., and Doerfler, W.(1979). Infection of Spodoptera fmgiperda cells with Autogropha californicn nuclear polyhedrosis virus. II. The virai DNA and the kinetics of its replication. Virology 99,391-409.

Tomalski, M. D. and Miller, L. K(1991). Insect paralysis by baculovims-mediated expression of a mite neurotoxin gene. Namre 352, 82-85.

Tomalski, M. D., Wu, J., and Miller, L. K.(1988). The location, sequence, transcription, and regulation of a baculovirus DNA polymerase gene. Virology 167.59 1-600.

Tsurimoto, T., Faixman, M. P., and Stillman, B.(1989). Sirnian virus 40 DNA replication in vitro: Identification of multiple stages of initiation. Mol. CeIl. Biol. 9, 3839-3849.

Tsurimoto, T., Melendy, T., and Stillman, B.(1990). Sequential initiation of lagging and leading strand synthesis by two different polymerase complexes at the SV40 DNA replication origin. Nature (London) 346, 534-539.

Tsurimoto, T. and Stillman, B.(1989). Purification of a cellular replication factor, RF-C, that is required for coordinated synthesis of leading and lagging strands dunng simian virus 40 DNA replication in vitro. Mol. Cell. Biol. 9,609-619.

Tsurimoto, T. and Stillman, B.(1990). Functions of replication factor C and proliferahng- ce11 nuclear antigen: Functional similarity of DNA polyrnerase accessory proteins from human cells and bactenophage T4. Proc. Nat!. Acad. Sci. USA 87, 1023-1027.

Tsunmoto, T. and Stillman, B.(1991a). Replication factors required for SV40 DNA replication in vitro. II. Switching of DNA polymerase a and 6 during initiation of leading and lagging strand synthesis. J . Biol. Chem. 266, 1961-1968.

Tsurimoto, T. and Stillman, B.(1991b). Replication factors required for SV40 DNA replication irl r~itro. 1. DNA structure-specific recognition of a primer-template junction by eukaryotic DNA polymerases and their accessory proteins. J. Biol. Chem. 266, 1950- 1960.

Turchi, J. J., Huang, L., Murante, R. S., Kim, Y., and Bambara, R. A.(1994). Enzymatic completion of mammalian lagging-strand DNA replication. Proc. Natl. Acad. Sci. USA 91, 9803-9807.

Tuteja, N. and Tuteja, R.(1996). DNA helicases: The long unwinding road. Nature Genetics 13, 11-12.

Uhlrnann, F., Cai, J. S., Flores-Rozas, H., Dean, F. B., FinkeIstein, J., OiDonnell, M., and Hurwitz, J.(1996). In vitro reconstitution of human replication factor C from its five subunits. Proc. Natl. Acad. Sci. USA 93, 6521-6526.

Vail, P. V. and Jay, D. L.(1973). Pathology of a nuclear polyhedrosis virus of the alfalfa looper in altemate hosts. J . Invertebr. Porhol. 21, 198-204.

Vaughn, J. L., Goodwin, R. H., Tompkin, G. L., and McCawley, P.(1977). The establishment of mo insect ce11 lines from the insect Spodoptera frugiperda (Lepidoptera:Noctuidae). In Vitro 13, 2 13-2 17.

Vogelstein, B. and Gillespie, P.(1979). Preparative and analytical purification of DNA from agarose. Proc. Nat!. Acad. Sci. USA 76, 615-6 19.

Wîga, S., Bauer, G., and Stillman. B.(1994). Reconstitution of complete SV40 DNA replication with purified replicarion factors. J . Biol. Chem. 269, 10923- 10934.

Waga, S. and Stillman, B.(1994). Anatomy of a DNA replication fork revealed by reconstitution of SV40 DNA replication i>i vitro. Narwe 369, 207-2 12.

Wahle, E.. Lasken, R. S., and Kornberg, A.(1989a). The dnaB-dnaC replication protein complex of Escherichia coli. I I Role of the complex in mobilizing dnaB functions. J. Biol. Cheni. 264, 2469-2475.

Wahle, E., Lasken, R. S., and Komberg, A.(1989b). The dnaB-dnaC replication protein cornplex of Escherichia coli. 1. Formation and properties. J. Biol. Chem. 264, 2463- 2468.

Wang, D., Jing, N. H., and Lin, Q. S.(1996). Stearylamine liposome as a new efficient reagent for DNA transfection of eukaryotic cells. Biochem. Biophys. Res. Commun. 226, 450-455.

Wang, H. H., Fraser, M. J., and Cary, L. C.(1989). Transposon mutagenesis of baculoviruses: Analysis of TFP3 lepidopteran transposon insertions at the FP locus of nuclear polyhedrosis vhses . G w e 81, 97-108.

Wang, J. C(1996). DNA topoisomerases. Ami. Rev. Biochem. 65, 635-692.

Wang, T. S. -F.(1991). Eukaryotic DNA polymerases. Ann. Rev. Biochem. 60, 513- 552.

Wang, T. S. -F.(1996). DNA replication ijz ezikaryotic c e h (DePanphilis, M. L.. Ed.) Cold Spnng Harbor Laboratory Press, New York. 46 1-494.

Wang, X. and Kelly, D. C(1983). Baculovinis replication: Purification and identification of the Trichoplicsia n i nuclear polyhedrosis virus-induced DNA polymerase. J. Gen. Vir-01-64, 2229-2236.

Washburn, B. K. and Kushner, S. R.(1993). Characterization of DNA helicase II from a rcvrD252 mutant of Escherichia coli. J. Bacterio!. 175, 341 -350.

Wilson, M. E.(1988). A synthetic peptide to the predicted 6.9K mnslation product of the HindUI-H/EcoRI-D region of the AcNPV genome induces antibodies to the basic DNA-binding protein. Virus Res. 9, 2 1-3 1.

Wilson, M. E., Mainprize, T. H., Friesen, P. D., and Miller, L. K.(1987). Location, transcription, and sequence of a baculovirus gene encoding a srnall arginine-rich polypeptide. 3. Virol. 61-66 1-666.

Wilson, M. E. and Miller, L. K(1986). Changes in the nucleoprotein complexes of a baculovinis DNA during infection. Virofogy 151,315-328.

Wilson, M. E. and Price, K. H.(1988). Association of Autographa californica nuclear polyhedrosis virus (AcMNPV) with the nuclear ma&. Virology 167,233-241.

Wilson, R., Ainscough, R., Anderson, K., Baynes, C., Berks, M., Bonfield, J., Bunon, J., Connell, M., Copsey, T., Cooper, J., and et al, (1994). 2.2 Mb of contiguous nucleotide sequence from chromosome III of c. elegans. Nature 368, 32-38.

Wold, M. S.(1997). Replication protein A: A heterotrimeric, single-süanded DNA-binding protein required for eukaryotic DNA metabolism. Ann. Rev. Biochern. 66,61-92.

Wold, M. S. and Kelly, T.(1988). Purification and characterization of replication protein A, a cellular protein required for in vitro replication of simian virus 40 DNA. Proc. Nati. Acad. Sei. OSA 85, 2523-2527.

Wong, S. W. and Schaffer, P. A.(W 1). Elements in the transcriptional regulatory region flanking herpes simplex virus type 1 oi-iS stimulate origin function. /. Vii-0l.65~2601- 2611.

Wood. H. A.(1980). Isolation and replication of an occlusion body deficient mutant of the Arrtogropho califon~ica nuclear polyhedrosis virus. Viralogy 105, 338-344.

Wysokenski, D. A. and Yates, J. L.(1989). Multiple EBNAl-binding sites are required to fom an EBNA 1-dependent enhancer and to activate a minimal replicative origin within oriP of Epstein-Barr virus. J . Virol. 63, 2657-2666.

Yan, H., Merchant, A. M.. and Tye, B. K(1993). Ce11 cycle-regulated nuclear localization of MCMZ and MCM3, which are required for the initiation of DNA synthesis at chromosomal replication origins in yeast. Gelles Dev. 7,2149-2160.

Yasuda, S. and Hirota, Y.(1977). Cloning and mapping of the replication origin of Escherichia coli. Proc. Nati. Acad. Sci. USA 74, 5458-5462.

Yates, J., Warren, N., Reisman, D., and Sugden, B.(1984). A cis-acting element from the Epstein-Barr genome that permits stable replication of recombinant plasrnids in latently infected cells. Proc. Natl. Acod. Sei. USA 81, 3806-38 10.

Yates, J. L. and Guan, N.(1991). Epstein-Barr virusdenved plasmids replicate only once per ce11 cycle and are not amplified after entry into celis. J. Virol. 65,483488.

Yates, J. L., Warren, N., and Sugden, B.(1985). Stable replication of plasmids denved from Epstein-Barr vins in various mamrnalian ce1Is. Nature (London) 313, 8 12-8 15.

Yoo, S. and Guarino, L. A.(1994a). Functional dissection of the ie2 gene product of the baculovims Autographa californica nuclear polyhedrosis virus. viroLgy 202, 164- 173

Yoo. S. and Guarino, L. A.(1994b). The Autogropha californica nuclear polyhedrosis virus iel gene encodes a transcriptional regulator. Virology 202,746-753.

Yu, H.(1990). Gene expression and replication of AcMNPV in cultured insect cells, Queen's University, Kingston, Ont..

Zhang, J., Tan, C. -K., McMullen, B., Downey, K. M., and So, A. G.(1995). Cloning of the cDNAs for the small subunits of bovine and human DNA polymerase 6 and chromosomal location of the human gene. Genornics 29. 179- 186.

Zhang, X., Efstathiou. S., and Simmons, A.(1994). Identification of novel herpes sirnplex virus replicative intermediates by field inversion gel electrophoresis: Implications for virai DNA amplification strategies. Virology 202. 530-539.

Zhou, J. Q., Tan, C. K., So, A. G., and Downey, K. M.(1996). Purification and characterization of the catalytic subunit of human DNA polymerase 6 expressed in baculovinis-infected insect cells. J. Biol. Chem ,271,29740-29745

Zhu. L. and Weller, S. K(1992). The six conserved helicase motifs of the UL5 gene product, a component of the herpes simplex virus type 1 helicase-pnrnase, are essential for its function. J . Virol. 66, 469-479.

Zmudzka, B. Z., Fornace, A., Collins, J., and Wilson, S. H.(1988). Charactenzation of DNA polymerase P mRNA: Cell-cycle and growth response in cultured human cells. Nucleic Acids Res. 16, 9587-9596.

Zyskind, J. W. and Smith, D. W.(1986). The bacterial origin of replication, oriC. Ce11 46, 489-490.

IMAGE NALUATION TEST TARGET (QA-3)

APPLIED IMAGE. lnc - = 1653 East Main Street - -* - - Rochester. NY 14609 USA -- -- - - Phone: 71 W482-0300 -- -- - - Fax: 71 61288-5989

Q 1993. A q p t i i Image. Inc.. All Rights Rrtserved