Regulation of multidrug resistance-associated protein 2 (MRP2

Regulation of multidrug resistance-associated protein 2 (MRP2;ABCC2) by the nuclear

receptors PXR, FXR, and CAR.

Heidi R. Kast* , Bryan Goodwin §, Paul T. Tarr*, Stacey A. Jones §, Andrew M. Anisfeld*, Catherine M.

Stoltz§, Peter Tontonoz<, Steve Kliewer§, Timothy M.Willson§ and Peter A. Edwards*!¶

Departments of *Biological Chemistry and Medicine, <Pathology and Laboratory Medicine and Howard Hughes Medical Institute, !Molecular Biology Institute, University of California, Los Angeles, 90095; and §GlaxoSmithKline, Nuclear Receptor Discovery Research, Research Triangle Park, NC 27709

†H.R.K. and B.G. contributed equally to this work.

¶Corresponding author:Peter A. Edwards Ph.D. Department of Biological ChemistryCHS 33-257University of California, Los Angeles10833 Le Conte Avenue Los Angeles, CA 90095Tel: (310 )206-3717FAX: (310) 794-7345e-mail: [email protected]

Abbreviated Title: Regulation of MPR2 by PXR, FXR, and CAR.Key Words: PXR, FXR, CAR, MRP2, bile acids

Copyright 2001 by The American Society for Biochemistry and Molecular Biology, Inc.

JBC Papers in Press. Published on November 12, 2001 as Manuscript M109326200 by guest on February 20, 2018

http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

Abstract

The multidrug resistance-associated protein 2 (MRP2, ABCC2), mediates the

efflux of several conjugated compounds across the apical membrane of the hepatocyte

into the bile canaliculi. We identified MRP2 in a screen designed to isolate genes that are

regulated by the farnesoid X-activated receptor (FXR; NR1H4), an orphan member of

the nuclear receptor superfamily. MRP2 mRNA levels were induced following treatment

of human or rat hepatocytes with either naturally occurring (chenodeoxycholic acid,

CDCA) or synthetic (GW4064) FXR ligands. In addition, we have shown that MRP2

expression is regulated by the xenobiotic receptors PXR (NR1I2, pregnane X receptor)

and CAR (NR1I3, constitutive androstane receptor). Thus, treatment of rodent

hepatocytes with the PXR agonists dexamethasone and PCN and the CAR activator

phenobarbital resulted in a robust induction of MRP2 mRNA levels. The

dexamethasone- and PCN-dependent induction of MRP2 expression was not evident in

hepatocytes derived from PXR-null mice. In contrast, induction of MRP2 by

phenobarbital, an activator of CAR, was comparable in wild-type and PXR null mice.

An unusual 26-bp sequence was identified 440 bp upstream of the MRP2

transcription initiation site that contains an everted repeat of the AGTTCA hexad

separated by 8 nucleotides (ER-8). PXR, CAR, and FXR bound with high-affinity to this

element as heterodimers with the 9-cis retinoic acid receptor α (RXRα; NR2B1).

Luciferase reporter gene constructs containing 1 kb of the rat MRP2 promoter were

prepared and transiently transfected into HepG2 cells. Luciferase activity was induced in

a PXR-, CAR-, or FXR-dependent manner. Furthermore, the isolated ER-8 element

2

by guest on February 20, 2018http://w

ww

.jbc.org/D

ownloaded from

http://www.jbc.org/

was capable of conferring PXR-, CAR-, and FXR-responsiveness on a heterologous

thymidine kinase promoter. Mutation of the ER-8 element abolished the nuclear

receptor-response. These studies demonstrate that MRP2 is regulated by three distinct

nuclear receptor signaling pathways which converge on a common response element in

the 5’-flanking region of this gene.

3


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/

Introduction

Members of the nuclear receptor superfamily of ligand-activated transcription

factors have critical roles in many aspects of development and adult physiology,

including cholesterol homeostasis, bile acid biosynthesis and transport, and xenobiotic

metabolism. Recently two orphan nuclear receptors, the farnesoid X-activated receptor

(FXR, NRIH4) and the pregnane X receptor (PXR, NR1I2) were shown to be activated

by an overlapping spectrum of bile acids (1-5). These results indicate that bile acids

function as hormonal ligands, in addition to their well-established roles in the

solubilization and absorption of lipids and fat-soluble vitamins from the intestinal lumen.

The primary bile acids chenodeoxycholic acid and cholic acid (CDCA and CA,

respectively) are synthesized in the liver from either cholesterol or oxysterols, via the

neutral or acidic pathways before being transported across the basement membrane of the

hepatocyte into the bile canaliculi and stored in the gall bladder (reviewed in 6,7).

Following their excretion into the intestinal lumen, bile acids can be further metabolized

by bacteria into secondary (deoxycholic acid (DCA) or lithocholic acid (LCA)) or tertiary

bile acids, prior to their resorption in the distal ileum. Defects in this cycle are associated

with various diseases. For example, impaired bile flow (cholestasis) can result in the

hepatic accumulation of supra-physiological levels of both toxic bile acids (e.g. LCA, 3-

keto-LCA) and toxins that would normally be excreted in the bile (8).

FXR is activated by bile acids with the rank order of potency CDCA>DCA=LCA>CA (3). In

vitro studies have shown that FXR binds as a heterodimer with the 9-cis retinoic acid receptor α (RXRα;

NR2B1) to repeats of the AGGTCA hexad. These elements can be both inverted repeats

4


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/

with a single nucleotide spacer (IR-1) and direct repeats separated by 3 or 4 bases (DR-3

or DR-4, respectively) (9,10). However, to date, all known FXR target genes including

the small heterodimer partner (SHP; NR0B2) (11,12), ileal bile acid-binding protein (I-

BABP) (5,13), bile salt export pump (Bsep, ABCC11) (14,15), phospholipid transfer

protein (PLTP) (10,16) and apolipoprotein C-II (apoC-II) (17) contain a functional IR-1

element in either the proximal promoter or distal enhancer elements. Activation of FXR

in vivo is associated with a reduction in plasma triglyceride levels (14,17,18), inhibition of

hepatic bile acid biosynthesis (11,12) and increased transport of bile acids from the

intestinal lumen into the enterocytes and back to the liver (5,13,14). Thus, FXR appears

to play important roles in the regulation of bile acid biosynthesis, bile acid transport and

in lipoprotein metabolism.

Recent studies have demonstrated that PXR is also activated by bile acids,

although the rank order of potency (3-keto-LCA>LCA>DCA=CA) differs from that of

FXR (1,4). Unlike FXR, PXR is highly activated by a number of diverse, structurally

unrelated, foreign compounds (referred to as xenobiotics) (19,20) that include

pregnenolone 16α-carbonitrile (PCN) and dexamethasone (21). Activation of PXR

results in increased expression of a number of cytochrome P450 (CYP) genes including

Cyp3a11, CYP3A4, and various CYP2B subfamily members which are involved in the

metabolism of a wide array of xenobiotics and endogenous substrates, prior to their

excretion into the bile (19,20,22-27).

Hepato-toxic bile acids, such as LCA and its metabolite 3-keto-LCA, activate

PXR and result in increased hepatic expression of the genes encoding CYP3A and

5


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/

OATP2, the organic anion transporting polypeptide (1,4). OATP2 is involved in the

transport of bile acids and organic anions from the blood into hepatocytes (28,29), whilst

CYP3A superfamily members are active in the hepatic metabolism of these compounds,

prior to their excretion into the bile (4,30,31). Defects in these pathways result in hepatic

accumulation of numerous compounds and subsequent hepatotoxicity. Activation of

PXR also results in decreased expression of CYP7A1 that encodes the regulatory enzyme

of bile acid biosynthesis (1), by an as yet undefined mechanism. These data suggest that

PXR regulates genes that control hepatic uptake and metabolism of many compounds,

including bile acids.

The constitutive androstane receptor (CAR, NR1I4), like FXR and PXR, binds

DNA as a heterodimer with RXRα (27,32-34). CAR exhibits a high degree of

constitutive transcriptional activity which can be inhibited by the androstane metabolites

androstenol and androstanol (35). Unlike PXR, CAR is located in the cytoplasm and

translocates to the nucleus on exposure of the cell to a variety of structurally diverse

compounds, including the barbiturate phenobarbital (PB) (25,36-38). PXR and CAR

bind to common response elements in the promoters of CYP2B and CYP3A subfamily

members that conform to the DR-3, DR-4 or ER-6 (everted repeat with 6-bp spacer)

architecture (19-26,39). The convergence of the PXR and CAR signaling pathways on

common response elements suggests that interplay between these receptors is likely to be

a significant factor in the regulation of these xenobiotic metabolizing enzymes.

MRP2 (multidrug resistance-associated protein 2; ABCC2) is a member of the

ATP-binding cassette (ABC) family of transporter proteins. Formerly known as cMOAT

6


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/

(canalicular multispecific organic anion transporter), MRP2 is a 190 kDa

phosphoglycoprotein localized in the canalicular (apical) membrane of hepatocytes and is

involved in the transport of organic anions, including sulfated and glucuronidated bile

salts, as well as glutathione, a major driving force in the bile salt-independent bile flow.

Notably, MRP2 is active in the transport of xenobiotics (including the anti-cancer drugs

cisplatin, anthacyclines, vinca alkaloids and methotrexate) and various glutathione-,

glucuronate-, and sulfate-conjugates (40-45). Natural mutations in the MRP2 gene

have been linked to Dubin-Johnson syndrome/hyperbilirubinemia II, a disorder in which

patients exhibit impaired transfer of anionic conjugates into the bile (reviewed in 46).

Mutations in the MRP2 gene in Wistar (TR-) or Eisai hyperbilirubinemic (EBHR) rats

result in impaired secretion of conjugates of xenobiotics and endogenous compounds,

such as bilirubin, into the bile (41,42). Although MRP2 expression is highest in the

canalicular membrane of the liver, it is also expressed in the kidney, jejunum, and ileum

where it may also be involved in the excretion of toxic compounds from the body (45).

Recent studies have demonstrated that rifampicin, a PXR ligand, induces MRP2

mRNA expression in the liver of rhesus monkeys, small intestine of humans and in

primary cultures of human hepatocytes (47-49) X. In addition, earlier studies had shown

that MRP2 mRNA and protein levels were induced when rats were treated with

dexamethasone, by a glucocorticoid receptor-independent manner (50,51). Furthermore,

the up-regulation of MRP2 gene expression upon the treatment of rats with the anti-

glucocorticoid/ anti-progestin RU486 and the anti-fungal clotrimazole, known PXR

ligands, has been observed (50). Since rifampicin, dexamethasone, PCN, RU486, and

7


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/

clotrimazole have been shown to activate PXR (36,52) it seemed likely that the MRP2

gene was a target for activated PXR.

In the current study, we demonstrate that treatment of human, rat or murine hepatocytes with

ligands for FXR, PXR or CAR results in increased expression of MRP2 mRNA. In addition, we identify

and characterize a novel binding site in the proximal promoter of the rat MRP2 gene that is bound by

PXR/RXR, CAR/RXR or FXR/RXR heterodimers. This site functions as a highly responsive FXR, PXR

and CAR response element. Finally we demonstrate that ligands for FXR, PXR or CAR can activate

expression of reporter genes controlled either by the rat MRP2 proximal promoter or by two copies of the

novel hormone response element identified in the MRP2 promoter. These studies suggest that ligands for

FXR, PXR and CAR activate transcription of the MRP2 gene in order to promote excretion of conjugated

toxic agents from the hepatocyte into the bile.

8


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/

Experimental Procedures

Materials – The FXR specific agonist GW4064 was a gift from Dr. Patrick Maloney (GlaxoSmithKline)

(18). LG100153 was kindly provided by Dr. Richard Heyman (Ligand Pharmaceuticals) (53). The

retroviral vector MSCV-IRES-neo plasmid was a gift from Dr. Owen Witte (University of California, Los

Angeles). Mammalian expression vectors for rat FXR (pCMX-rFXR), human RXRα (pCMX-

hRXRα) and VP16-rFXR were gifts from Dr. Ron Evans (Salk Institute, La Jolla, CA). The

sources of other reagents and plasmids have been noted elsewhere (17). Pregnenolone

16α-carbonitrile (PCN), dexamethasone, rifampicin, and sodium phenobarbital (PB) were

purchased from the Sigma Chemical Co. (St. Louis, MO).

Cell Culture and Stable Cell Lines- The generation and maintenance of wild-type and

stably infected HepG2 cells has been described (10). The FAO cells were maintained in

DMEM + 10% calf serum. Primary cultures of rat and mouse hepatocytes, prepared as

described elsewhere (54), were maintained in Williams’ media E (Invitrogen, Rockville,

MD) supplemented with 100 nM dexamethasone, 100 U/ml penicillin G, 100 µg/ml

streptomycin, and insulin-transferrin-selenium (ITS-G; Invitrogen). Human

hepatocytes were obtained from Dr. Stephen Strom (University of Pittsburgh). Twenty-

four h after isolation, hepatocytes were treated with either GW4064 (10 µM), PCN (10

µM), PB (1 mM) or rifampicin (0.1-10 µM) which were added to the culture medium as

1000 x stocks in DMSO (PB was directly dissolved into the medium). Control cultures

received vehicle (DMSO) alone. Cells were cultured for 48 h prior to harvest and total

RNA isolated using the TRIzol reagent (Invitrogen) according to the manufacturer’s

instructions.

9


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/

Supression Subtractive Hybridization –Total RNA was isolated from HepG2-vector cells

treated with DMSO (driver RNA) and from HepG2-FXR cells treated for 24 h with 50

µM CDCA (tester RNA). The driver and tester RNA were used in suppression subtractive

hybridization (55) using the PCR-Select Subtraction Kit (CLONTECH Laboratories,

Palo Alto, CA) according to the manufacturers instructions.

RNA Isolation and Northern Blot Hybridization – Unless otherwise indicated, HepG2

derived cell lines were cultured in medium containing super-stripped FBS for 24 h

before the addition of ligand or DMSO (vehicle) for an additional 24 h. Total RNA was

isolated using TRIzol reagent and was resolved (10 µg/per lane) on a 1% agarose/ 2.2 M

formaldehyde gel, transferred to a nylon membrane (Hybond N+, Amersham Pharmacia

Biotech Inc.), and cross-linked to the membrane with UV light. cDNA probes were

radiolabeled with [α-32P]dCTP using the rediprimeTM II labeling kit (Amersham

Pharmacia Biotech). Membranes were hybridized using the QuikHyb Hybridization

Solution (Stratagene, La Jolla, CA) according to the manufacturer’s protocol. Blots were

normalized for variations of RNA loading by hybridization to a control probe, either

glyceraldehyde-3-phosphate dehydrogenase (GAPDH), rat 18S ribosomal cDNA, or the

ribosomal protein 36B4. The RNA levels were quantitated using a PhosphorImager

(ImageQuant software, Molecular Dynamics, Sunny Vale, CA).

Electrophoretic Mobility Shift Assays (EMSAs) Electrophoretic mobility-shift assays

(EMSA) were performed essentially as described elsewhere (23). rPXR and rCAR,

10


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/

hFXR, and hRXRα were synthesized from the pSG5-rPXR, pSG5-rCAR, pSG5-hFXR,

and pSG5-hRXRα expression vectors, respectively, using the TNT T7 Coupled

Reticulocyte System (Promega, Madison, WI). Unprogrammed lysate was prepared

using the pSG5 expression vector (Stratagene). Binding reactions contained 10 mM

HEPES, pH 7.8, 60 mM KCl, 0.2% nonidet P-40, 6% glycerol, 2 mM dithiothreitol, 2 µg

poly(dI-dC)•poly(dI-dC), and 1-2 µl each of synthesized receptor protein. Control

incubations received unprogrammed lysate alone. Reactions were pre-incubated on ice

for 10 min prior to the addition of [32P]-labeled double-stranded oligonucleotide probe

(0.2 pmol). Competitor oligonucleotides were added to the pre-incubation at 100- or

500-fold molar excess. Samples were held on ice for a further 20 min and the protein-

DNA complexes resolved on a pre-electrophoresed 5% polyacrylamide gel in 0.5 x TBE

(45 mM Tris-borate, 1 mM EDTA) at room temperature. Gels were dried and

autoradiographed at -70°C for 1-2 h. Oligonucleotide probes used in EMSAs are shown

in Fig. 5A.

Reporter Genes – The rat MRP2 proximal promoter (-1034 to –15, relative to the

translation start site) (56) was amplified from rat genomic DNA using primers

5’ggggtaccgcaaaagaacaagttgtttaa3’ and 5’ggggctagcgcttctgttacgaagactcttc3’ (reverse

primer 1, RP1) and cloned into KpnI/NheI sites of the pGL3 basic vector (Promega),

generating pGL3-MRP2-1. The two copy ER-8 (pTk-2xER-8) was generated by

annealing the oligonucleotides

5’gatctaacatctctgtgaactcttaaccaagttcaaactgaatgatgtaacatctctgtgaactcttaaccaagttcaaactgaa3’ and

11


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/

5’gatcttcagtttgaacttggttaagagttcacagagatgttacatcattcagtttgaacttggttaagagttcacagagatgtta3’

before ligation into BamHI/BglII digested Tk-Luc. The two ER-8 sites are bolded. The

two copy mutant ER-8 (pTk-Mut2xER-8) was generated using the same method and the

primers

5’gatctaacatctctgtgTTctcttaaccaagAAcaaactgaatgatgtaacatctctgtgTTctcttaaccaagAAcaaactgaa3’

and

5’gatcttcagttttgTTcttggttaagagAAcacagagatgttacatcattcagtttgTTctggttaagagAAcacagagatgtta3’.

Mutations are capitalized.

Transient Transfections and Reporter Gene Assays- HepG2 cells were transiently transfected using the

MSB Mammalian Transfection Kit (Stratagene), with minor modifications. HepG2 cells in 48 well plates

were transiently transfected with reporter plasmid (100 ng), and either 50 ng pSG5-rCAR, 50 ng pSG5-

rPXR, or 25 ng pCMX-rFXR, together with 5 ng pCMX-hRXRα, and 50 ng pCMV-β-

galactosidase as indicated in the specific legends. Each well received a total of 200 ng of

DNA. After 3.5 h the cells were treated with 10% superstripped FBS and one of the

following ligands: pregnenolone 16α-carbonitrile (PCN), LG100153 (synthetic RXR-

agonist), 3-(2,6-dichlorophenyl)-4-(3-carboxy-2-chloro-stilben-4-yl)-oxymethyl-

5-isopropyl-isoxazole (GW4064), or chenodeoxycholic acid (CDCA). After 24 h, the

cells were lysed and assayed for luciferase and β-galactosidase activity (10).

12


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/

Results

Induction of MRP2 by Bile Acids and the Synthetic FXR Ligand GW4064 – In an effort

to identify target genes that are regulated by the bile acid receptor FXR, we infected

human HepG2 cells with retroviral vectors that expressed either FXR and the neomycin-

resistant gene, or the neomycin-resistant gene alone (17). G418 resistant cells were

isolated, and pooled cell populations were propagated which harbored either the vector

alone (HepG2-vector) or overexpressed FXR (HepG2-FXR). Total RNA was isolated

from HepG2-vector or HepG2-FXR cells that had been treated for 24 h with either

vehicle (DMSO) or the FXR ligand CDCA (50 µM), respectively. Suppression

subtractive hybridization was then used to identify mRNAs (cDNAs) that were induced

when the HepG2-FXR cells were treated with 50 µM CDCA (see Experimental

Procedures). The isolated cDNAs that encode putative FXR-regulated genes were

sequenced and shown to correspond to a number of known genes, including apoC-II

(17). Here we report on MRP2, a second FXR target gene identified using this approach.

In order to confirm that MRP2 mRNA levels were induced in response to CDCA,

we performed Northern blot assays (Fig. 1). Addition of CDCA to HepG2 cells resulted

in a dose and time-dependent increase in MRP2 mRNA; induction was observed within

12 hours, continued for 48 hours (Fig. 1A) and was maximal at 200 µM CDCA (Figs.1B

and 1C). In parallel, two previously reported FXR-target genes, that encode SHP (11,

12) and apoC-II (17), were induced by CDCA (Fig. 1B and 1C). In addition, the

synthetic FXR ligand GW4064 (18) increased both MRP2 and SHP expression, further

13


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/

suggesting that this induction is FXR-dependent (Fig. 1C). Maximal induction of MRP2

was observed with 200 µM CDCA which distinguishes it from other FXR target genes

including apoC-II (17) and SHP (Fig. 1B and 1C). The induction of these latter two

mRNAs is maximal at 100 µM CDCA, and the induction is largely attenuated at 200 µM

CDCA (Figs. 1B and 1C).

Induction of MRP2 mRNA Levels Following Activation of PXR or CAR The dose-

dependent induction of MRP2 expression by CDCA (maximal at >200 µM) suggested

that the human MRP2 gene is regulated by PXR, which is known to be activated by

pathophysiological concentrations of bile acids. To test the hypothesis that MRP2

mRNA levels are induced by a PXR-dependent mechanism, primary human hepatocytes

were treated for 48 h with the macrocyclic antibiotic rifampicin or the putative anti-

depressant hyperforin (Fig. 2), two drugs known to activate human PXR (21,57). The

data of Fig. 2 show that low levels (1µM) of both rifampicin and hyperforin result in a

parallel increase in the levels of the mRNAs encoding MRP2 and CYP3A4. These

results provide support for the hypothesis that MRP2 mRNA levels are induced following

activation of PXR. In contrast, SHP mRNA levels were unaffected by either drug (Fig.

2).

The data shown in Figs. 1 and 2 demonstrate that MRP2 mRNA levels are

induced when human liver cells are incubated with ligands for either FXR or PXR. To

determine whether MRP2 expression responded in a similar fashion in rodents, we

incubated primary rat hepatocytes with ligands known to activate different nuclear

14


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/

receptors. MRP2 mRNA levels increased significantly when the hepatocytes were

incubated in the presence of PXR ligands (PCN or dexamethasone), an FXR ligand

(GW4064) or a CAR activator (PB) (Fig. 3A). As expected, PCN, dexamethasone and

PB also increased the expression of CYP3A23 a known PXR/CAR target gene (19,25)

(Fig. 3A). Additionally, GW4064 treatment resulted in a modest increase in CYP3A23

expression. However, FXR is not known to regulate CYP3A23 expression and this

induction may be a result of cross-over activation of PXR at the concentration of

GW4064 used (10 µM). In contrast, SHP mRNA levels were induced only when cells

were incubated with GW4064 but were unaffected by PCN, dexamethasone or PB (Fig.

3A). Interestingly, expression of BSEP was significantly induced by PCN and

dexamethasone and, to a lesser extent by PB (Fig. 3A). Although BSEP expression is

regulated by FXR in both rodents and humans (14,15,58) (Fig. 3A), this is the first report

to demonstrate regulation of this gene by PXR agonists. Taken together, these data

suggest that the expression of both BSEP and MRP2 mRNAs are induced by ligands

known to activate FXR, PXR or CAR.

In order to extend our results, we treated a rat hepatoma cell line (FAO) with

several ligands that activate FXR, PXR or CAR. MRP2 mRNA levels are significantly

induced when FAO cells are treated with CDCA, GW4064, PCN or 3 keto-LCA (Fig.

3B). As expected, SHP expression was highly activated by the FXR ligands CDCA and

GW4064, weakly activated by 3-keto-LCA and unaffected by the PXR ligand PCN (Fig.

3B). Taken together, the data of Figs. 1-3 suggest that MRP2 mRNA levels are induced

in both human and rodent cells following activation of either FXR, PXR or CAR.

15


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/

To further establish the role of PXR in the induction of MRP2, we incubated

primary hepatocytes, derived from PXR wild-type or PXR null mice, with ligands for

PXR or CAR (Fig. 4). As expected, Cyp3a11 expression in the wild-type cells was

induced by PXR ligands (PCN and dexamethasone) and/or a CAR activator (PB) (Fig. 4)

(36). In line with an earlier report (1), CYP3A11 mRNA levels were not induced when

the PXR ligands (PCN or dexamethasone) were added to the PXR null cells (Fig. 4). In

contrast to PCN and dexamethasone, PB slightly induced expression of CYP3A11 in the

PXR null cells (Fig. 4), consistent with a PXR-independent mechanism of induction by

this drug in rodent hepatocytes. As expected from the data shown in Figs. 1-3, MRP2

mRNA levels were induced when primary hepatocytes, derived from wild-type mice,

were incubated with PCN, PB, or dexamethasone (Fig. 4). However a different pattern

emerged when the PXR null hepatocytes were treated with the same drugs; first, we noted

that the basal levels of MRP2 mRNA were increased 2-fold in the PXR null cells,

indicating that PXR may function to repress MRP2 expression under basal, non-activated

conditions. In addition, in the absence of PXR, the MRP2 promoter may become more

accessible to other transcription factors with a higher basal activity. Such factors include

CAR which we demonstrate binds to the same response element as PXR. Secondly, we

noted that MRP2 mRNA levels were no longer induced by PCN or dexamethasone,

consistent with the proposal that PXR is required for activation of MRP2 by these two

drugs. Thirdly, we noted that in response to PB the MRP2 mRNA levels were still

induced in the PXR null cells (Fig. 4), consistent with this drug activating MRP2 by a

PXR-independent mechanism. Since PB is known to induce nuclear translocation of

16


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/

CAR in rodents (36), this observation further suggests that MRP2 is activated by this

third member of the nuclear receptor superfamily.

The MRP2 promoter contains a novel element that is bound by either FXR/RXR,

PXR/RXR or CAR/RXR. Analysis of the published nucleotide sequence 5’ of the

transcriptional start site of the rat MRP2 gene identified a 26-bp sequence (-401 to –376,

relative to the translation start site) that contains two perfect copies of the AGTTCA

hexad organized as an ER-8 (everted repeat with 8-bp spacer) (Fig. 5A). Although

neither FXR, PXR, nor CAR have been shown to bind to an ER-8, we performed

electrophoretic mobility shift assays (EMSAs) with an oligonucleotide corresponding to

this site, designated rMRP2 ER-8, (Figs. 5B, 5C). The results shown in Fig. 5B

demonstrate that PXR, CAR, and FXR are capable of binding the rMRP2 ER-8 probe as

heterodimers with RXRα. Thus, PXR, CAR and FXR were incapable of binding the

rMRP2 ER-8 probe in the absence of RXRα (Fig. 5B). However, the addition of

recombinant RXRα resulted in the appearance of a robust protein-DNA complex. The

ability of PXR/CAR/FXR to interact with this element was further examined by

competition EMSAs. A 100-fold molar excess of unlabeled rMRP2 ER-8 efficiently

competed with a previously reported PXR- and CAR-binding motif, the ER-6 element

from the CYP3A4 promoter (20, 22, 23, 27), for binding to PXR-RXRα and CAR-

RXRα heterodimers (Fig. 5C, top panels). Mutation of either half-site (rMRP2 ER-8mut1 and

rMRP2 ER-8mut2 probes) abolished the direct binding of PXR/CAR-RXRα

heterodimers (data not shown) and the ability of the probe to compete for PXR/CAR-

17


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/

RXRα binding with the CYP3A4 ER-6 (Fig. 5C, top panels). Similarly, the rMRP2 ER-

8 oligonucleotide was capable of effectively competing with an FXR response element

from the human I-BABP gene (hI-IBABP IR-1) (Fig. 5C, lower panel). In contrast, no

competition was observed when the competitor DNA contained mutations of either half-

site (rMRP2 ER-8mut1 and rMRP2 ER-8mut2 probes) (Fig. 5C, lower panel). These

results indicate that the rMRP2 ER-8 site is a high-affinity PXR, CAR, and FXR binding

motif. Moreover, the observation that mutation of either of the AGTTCA half-sites

results in complete loss of nuclear receptor binding function demonstrates that

PXR/CAR/FXR-RXRα heterodimers are directly interacting with the ER-8 and not

cryptic binding motifs embedded within this site.

The ER-8 in the MRP2 proximal promoter is required for transcriptional activation.

To investigate the mechanism involved in transcriptional regulation of the MRP2

gene, we cloned the rat MRP2 proximal promoter (-1034 to –15, relative to the

translation start site) into a luciferase reporter construct. The reporter plasmid pGL3-

MRP2-1 was transiently transfected into HepG2 cells in the presence or absence of

plasmids encoding PXR, CAR, or FXR and RXR and the cells were subsequently treated

with receptor-specific ligands. In the absence of co-transfected PXR, the MRP2

promoter reporter gene was not activated by PCN (Fig. 6A). Co-transfection of a rat PXR

expression vector resulted in ~2-fold induction in reporter gene activity following the

addition of PCN. The reporter construct was not induced when either PXR or PCN was

absent (Fig. 6A). In addition, co-transfection of the pGL3-MRP2-1 construct and a

18


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/

CAR expression vector resulted in a 2-fold increase in reporter gene activity. No further

induction was observed when PCN was added to the cell medium, consistent with a

previous report that demonstrated that CAR is constitutively active when expressed in

HepG2 cells (33). The MPR2 promoter-reporter construct was also activated 2-fold in

the presence of the FXR synthetic compound GW4064 and FXR (Fig. 6B).

To investigate the effects of multiple ligands and multiple nuclear receptors on the

activity of the MRP2 promoter, we constructed a luciferase reporter gene under the

control of either two copies of the wild-type ER-8 (pTk-2xER-8) or the mutant ER-8

(pTk-Mut2xER-8). The expression of the pTk-Luciferase control vector (pTk-Luc)

was not affected by PXR, CAR, FXR or ligands for PXR or FXR (data not shown).

However, the pTk-2xER-8-Luc reporter was activated over 100-fold in a PXR- and

PCN-dependent process (Fig. 6C). The reporter gene was activated ~ 150-fold by CAR

and this induction was independent of PCN or GW4064 (Fig. 6C), which is consistent

with the constitutive activation of CAR in HepG2 cells. The Tk-2xER-8 reporter gene

was also activated ~ 60-fold by a process that required FXR co-expression and addition

of the FXR ligand GW4064 (Fig. 6C). In contrast, the activity of the mutant ER-8

reporter gene was low and was unaffected by coexpression of PXR, CAR or FXR and

their ligands (Fig. 6C). As expected, a luciferase reporter gene driven by three copies of

the PXRE derived from the CYP3A23 gene was specifically activated in a PXR- and

PCN-dependent manner (Fig. 6C). These data demonstrate that the ER-8 from the rat

MRP2 proximal promoter acts as a functional response element and mediates the

transcriptional activation of the MRP2 gene by ligand-activated PXR or FXR, or the

19


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/

constitutively active nuclear receptor CAR.

20


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/

Discussion

The current study identifies MRP2 as a gene that is activated by FXR and bile acids. MRP2 is a

member of the ABC superfamily of transporter proteins, and is predicted to contain 12 transmembrane

domains and two ATP binding cassettes. In addition, we demonstrate that hepatic MRP2 expression is

induced by CAR or ligand-activated PXR. Since hepatic MRP2 is localized to the canalicular membrane

and functions to transport a variety of conjugated compounds from the hepatocyte into bile, our data

suggest that activation of FXR, PXR or CAR is likely to enhance the excretion of these compounds from

the body (Fig. 7).

Surprisingly, all three nuclear receptors were shown to activate MRP2 gene

expression via a novel hormone response element (ER-8) in the proximal promoter of the

gene. Further studies will be necessary to determine whether activation of the MRP2

gene by different ligands is dependent upon competition between FXR/RXR, PXR/RXR

and CAR/RXR for this ER-8 element under normal physiological conditions.

The DNA sequences that function as hormone response elements for FXR, PXR or CAR were

once thought to be fairly specific. However, even with the identification of relatively few target genes for

each nuclear receptor, it has become apparent that such DNA sequences can be quite varied. For example,

IR-1 (5,10,11,13,14,16,17), IR-0 (59) and ER-8 (current study) have now been shown to function as

FXR-response elements in a number of genes. DR-3, DR-4, ER-6 and ER-8 (current study) elements

have been shown to function as PXR and CAR binding motifs (reviewed in 39,60,61). It is not known how

each nuclear receptor heterodimer can form a transcriptionally active complex with such diverse DNA

sequences. Presumably, the two DNA binding motifs present in the heterodimeric complex have

considerable flexibility so as to allow stable interaction with the two hexads (AGGTCA, or variants

thereof) that may be separated by 0-8 nucleotides.

In addition to MRP2, a number of other transporter proteins, including BSEP,

MDR1 and MDR3 are localized to the canalicular membrane of the hepatocyte (Fig. 7).

21


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/

These proteins facilitate the export of bile salts (BSEP), phospholipids (human MDR3/

murine mdr2) and hydrophobic compounds/drugs (MDR1) into the bile. BSEP

expression has recently been shown to be stimulated by bile acids in an FXR-dependent

manner (14,15). Likewise, MDR1 has been shown to be a direct PXR target (62). These

findings provide an additional link between multiple nuclear receptors and hepatic

excretion of various compounds.

As illustrated in Fig. 7, PXR induces transcription of the OATP2 gene, which

results in the uptake of organic anions and bile salts across the basal membrane (1).

Hepatic uptake of bile acids is facilitated by a number of transporters including the

sodium taurocholate cotransporting polypeptide (NTCP) (63). PXR also mediates the

transcriptional induction of hepatic CYP3A4 which, in turn, metabolizes a large number

of endogenous and exogenous compounds (21,23). The current study demonstrates that

FXR, PXR and CAR activate the expression of MRP2 which is involved in the

subsequent transport of many of these compounds into the bile. This coordinate

regulation results in a net clearance of compounds from the blood (OATP2),

detoxification of these compounds within the hepatocyte (CYP3A) and efflux of these

compounds into the bile (MRP2), whereupon they can ultimately be excreted into the

intestine and from the body.

22


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/

Acknowledgments

We thank Drs. R. Heyman, O. Witte, P. Maloney, and R. Evans for providing plasmids

and reagents. This work was supported by grants from the National Institutes of Health

(HL30568 to P.A.E.), the Laubisch fund (to P.A.E.) and predoctoral training grants (US

Department of Education #P200A80113) (to H.R.K. and A.M.A.).

Abbreviations

apoC-II, apolipoprotein C-II; BARE, bile acid response element; BSEP, bile salt export

pump; CA, cholic acid; CAR, constitutive androstane receptor; CARE, CAR response

element; CDCA, chenodeoxycholic acid; cMOAT, canalicular multispecific organic

anion transporter; CYP, cytochrome P450; DCA, deoxycholic acid; DEX,

dexamethasone; DMSO, dimethyl sulfoxide; DR-n, direct repeat with n-bp spacer;

EMSA, electrophoretic mobility shift assay; ER-n, everted repeat with n-bp spacer;

FXR, farnesoid X-activated receptor; FXRE, FXR response element; GW4064, 3-(2,6-

dichlorophenyl)-4-(3’-carboxy-2-chloro-stilben-4-yl)-oxymethyl-5-isopropyl-

isoxazole; I-BABP, ileal bile acid binding protein; IR-n, inverted repeat with n-bp

spacer; LG100153, synthetic RXR-agonist; MPR2, multidrug resistance-associated

protein; PB, phenobarbital; PCN, pregnenolone 16α-carbonitrile; PXR, pregnane X-

receptor; PXRE, PXR response element; rCAR, rat CAR; rPXR, rat PXR; hRXRα,

human 9-cis retinoic acid receptor α; SHP, small heterodimer partner.

23


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/

Figure Legends

FIG. 1. Induction of MRP2 mRNA by Bile Acids. (A) MRP2 mRNA levels are induced

by CDCA. HepG2-FXR cells were incubated with 100 µM CDCA for the indicated

times. Total RNA was isolated, separated on a 1% agarose/formaldehyde gel, transferred

to a nylon membrane and sequentially hybridized to radiolabeled cDNA probes for

MRP2, SHP, apo-CII and 18S-ribosomal RNA, as described in Experimental

Procedures. (B) Different concentrations of CDCA are required for maximum induction

of MRP2, apoC-II and SHP mRNA levels. HepG2-FXR cells were treated for 24 h with

increasing concentrations of CDCA (0, 50, 100, 150, 200 and 250 µM). RNA was

isolated and Northern analysis was performed as described above. (C) MRP2 is regulated

by a synthetic FXR-specific agonist. HepG2 cells were treated with the indicated

concentrations of the FXR synthetic agonist GW4064, or CDCA for 24 h. Total RNA

was isolated and Northern analysis performed as described above. The results shown in

panels A-C are representative of two to three experiments.

FIG. 2. Induction of MRP2 mRNA in Human Hepatocytes by PXR Ligands.

Human primary hepatocytes were treated for 48 h with vehicle (DMSO), the indicated

concentrations of rifampicin, or hyperforin (1 µM). RNA was isolated and analyzed as

described in Fig. 1.

FIG. 3. Ligands for FXR, PXR and CAR Induce MRP2 mRNA Expression in Rat Hepatocytes. (A)

MRP2 mRNA levels are induced in primary rat hepatocytes. Primary rat hepatocytes were incubated with

10 µM dexamethasone, PCN, or GW4064, 1 mM PB, or vehicle alone (0.1% DMSO) as

24


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/

described in Experimental Procedures. RNA was isolated and Northern blots performed

as described in Fig. 1. The same membrane was hybridized sequentially with the

indicated radiolabeled probes. (B) Induction of MRP2 mRNA levels in FAO cells. FAO

cells were treated with CDCA (100 or 200 µM), GW4064 (1 µM), PCN (10 µM), 3-

keto-LCA (100 µM) or DMSO (0.1%) for 24 h. Total RNA was isolated and Northern

analysis was performed as described in Fig. 1.

FIG. 4. Induction of MRP2 mRNA in primary cultures of hepatocytes from wild-type

and PXR-null mice. Primary hepatocytes from wild-type (+/+) and PXR (-/-) mice

were treated for 48 h with PCN (10 µM), dexamethasone (Dex; 10 µM), PB (1 mM), or

PCN and PB prior to isolation and preparation of RNA. Northern analysis of MRP2 and

CYP3A11 was performed as described in Fig. 1.

FIG. 5. The PXR/RXR, CAR/RXR and FXR/RXR heterodimers bind to the ER-8 in the

proximal promoter of the MRP2 gene. (A) The nucleotide sequence corresponding to the

putative PXR/RXR, CAR/RXR and FXR/RXR binding site at –401 to –376 from the rat

MPR2 promoter is shown (rMPR2 ER-8). Mutations within the ER-8 are shown in

lower case. Hexameric consensus sites are bolded. In addition, the sequences of the ER-

6 located in the CYP3A4 promoter and the IR-1 from the human I-BABP gene are

shown. (B) PXR, CAR and FXR bind to the rMRP2 ER-8. In vitro translated PXR,

CAR or FXR were incubated with RXR and the 26-bp rat MRP2 oligonucleotide from

the proximal promoter (rMRP2-NR), as describe in Experimental Procedures. The

25


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/

shifted DNA-protein complexes were identified by autoradiography. (C) PXR/RXR,

CAR/RXR, and FXR/RXR R XXheterodimers bind to the rMRP2ER-8 with high affinity.

Either PXR, CAR or FXR were incubated with RXR and the indicated radiolabeled

probes in the presence of unlabeled competitor DNA (100 or 500-fold molar excess) as

indicated and described in Experimental Procedures.

FIG. 6. Transactivation of the rat MRP2 proximal promoter by PXR, CAR and FXR. (A)

HepG2 cells were co-transfected with either rat PXR or rat CAR and the pGL3 reporter

gene under the control of the rat proximal promoter (-1034 to –15, relative to the

translation start site, pGL3-MRP2-1). Cells were treated with vehicle (DMSO) or PCN

(10 µM) for 48 h following the transfection. Relative light units for the reporter gene are

shown after normalization for minor changes in transfection efficiencies. (B) HepG2

cells were transiently transfected with rat FXR and the pGL3-MRP2-1 reporter

construct. Cells were treated with vehicle (DMSO) or GW4064 (1 µM) and LG100153

(100 nM) for 48 h. Fold induction is shown following normalization with β-

galactosidase. (C) HepG2 cells were transfected with a reporter gene construct

containing two copies of the ER-8 from the rat cMOAT promoter linked to a luciferase

reporter gene (pTk-2xER-8), the Tk-Luciferase vector under the control of two copies

of the mutant ER-8 (pTk-Mut2xER-8), or three copies of the PXR response element

from the CYP3A23 promoter (3xCyp3A23). Each reporter was cotransfected with either

rat PXR, rat CAR or rat FXR. Following the transfection, cells were treated with DMSO,

PCN (10 µM), or GW4064 (1 µM) for 24 h. Fold induction was determined after

26


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/

normalization for changes in transfection efficiencies. All transfections were performed

in triplicate, and the results varied less than 10%. Each experiment was repeated > 3

times with similar results. The data shown in panels A-C are representative of two to

three experiments.

FIG. 7. A model of transporter proteins in the liver. Activation of the hepatic FXR/RXR

heterodimer stimulates the export of bile salts (BS) and organic anions (OA) from the

hepatocyte into the bile by increasing the expression of the bile salt export pump (BSEP)

and the multidrug resistance associated protein 2 (MRP2) (FXR and its target genes are

shown in red). Activation of the PXR/RXR heterodimer increases the uptake of organic

anions from the blood across the basal membrane by increasing the expression levels of

the organic anion transporting polypeptide (OATP2) (PXR and its target genes are shown

in blue). Within the hepatocyte, organic anions and bile salts are further metabolized by

CYP3A which is itself regulated by PXR and RXR. These metabolites are then

transported from the hepatocyte into the bile canaliculi via MRP2. MRP2 expression is

induced by activated PXR/RXR, or CAR/RXR (fuschia), in addition to FXR/RXR.

PXR/RXR also increase the expression of the multidrug resistance protein 1 (MDR1),

which transports amphipathic compounds across the canalicular membrane in an ATP

dependent manner. NTCP, sodium taurocholate cotransporting polypeptide, facilitates

the uptake of bile acids from the blood. MDR2/3, multidrug resistance protein 2/3.

27


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/

References

1. Staudinger, J. L., Goodwin, B., Jones, S. A., Hawkins-Brown, D., MacKenzie, K.

I., LaTour, A., Liu, Y., Klassen, C. D., Brown, K. K., Reinhard, J., Willson, T.

M., Koller, B. H., and Kliewer, S. A. (2001) Proc. Natl. Acad. Sci. U. S. A.

98(6), 3369-3374

2. Wang, H., Chen, J., Hollister, K., Sowers, L. C., and Forman, B. M. (1999) Mol.

Cell 3(5), 543-53

3. Parks, D. J., Blanchard, S. G., Bledsoe, R. K., Chandra, G., Consler, T. G.,

Kliewer, S. A., Stimmel, J. B., Willson, T. M., Zavacki, A. M., Moore, D. D., and

Lehmann, J. M. (1999) Science 284(5418), 1365-8

4. Xie, W., Radominska-Pandya, A., Shi, Y., Simon, C., Nelson, M. C., Ong, E. S.,

Waxman, D. J., and Evans, R. M. (2001) Proc. Natl. Acad. Sci. U. S. A. 98(6),

3375-3380

5. Makishima, M., Okamoto, A. Y., Repa, J. J., Tu, H., Learned, R. M., Luk, A.,

Hull, M. V., Lustig, K. D., Mangelsdorf, D. J., and Shan, B. (1999) Science

284(5418), 1362-5

6. Russell, D. W., and Setchell, K. D. (1992) Biochemistry 31(20), 4737-49

7. Schwarz, M., Lund, E. G., and Russell, D. W. (1998) Curr. Opin. Lipidol. 9(2),

113-8

8. Radominska, A., Treat, S., and Little, J. (1993) Sem. Liver Dis. 13(3), 219-34

9. Forman, B. M., Goode, E., Chen, J., Oro, A. E., Bradley, D. J., Perlmann, T.,

28


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/

Noonan, D. J., Burka, L. T., McMorris, T., Lamph, W. W., Evans, R. M., and

Weinberger, C. W. (1995) Cell 81(5), 687-93

10. Laffitte, B. A., Kast, H. R., Nguyen, C. M., Zavacki, A. M., Moore, D. D., and

Edwards, P. A. (2000) J. Biol. Chem. 275(14), 10638-47

11. Goodwin, B., Jones, S. A., Price, R., R., Watson, M. A., McKee, D. D., Moore, L.

B., Galardi, C., Wilson, J. G., Lewis, M. C., Roth, M., E., Maloney, P., R.,

Willson, T., M., and Kliewer, S., A. (2000) Mol. Cell 6, 517-526

12. Lu, T. T., Makishima, M., Repa, J. J., Schoonjans, K., Kerr, T. A., Auwerx, J.,

and Mangelsdorf, D. J. (2000) Mol. Cell 6(3), 507-15

13. Grober, J., Zaghini, I., Fujii, H., Jones, S. A., Kliewer, S. A., Willson, T. M., Ono,

T., and Besnard, P. (1999) J. Biol. Chem. 274(42), 29749-54

14. Sinal, C., J., Tohkin, M., Miyata, M., Ward, J. M., Lambert, G., and Gonzalez, F.

J. (2000) Cell 102, 731-744

15. Ananthanarayanan, M., Balasubramanian, N., Makishima, M., Mangelsdorf, D. J.,

and Suchy, F. J. (2001) J. Biol. Chem. 276(31), 28857-65

16. Urizar, N. L., Dowhan, D. H., and Moore, D. D. (2000) J. Biol. Chem. 275(50),

39313-7

17. Kast, H. R., Nguyen, C. M., Sinal, C. J., Jones, S. A., Laffitte, B. A., Reue, K.,

Gonzalez, F. J., Willson, T. M., and Edwards, P. A. (2001) Mol. Endo. (In Press)

18. Maloney, P. R., Parks, D. J., Haffner, C. D., Fivush, A. M., Chandra, G., Plunket,

K. D., Creech, K. L., Moore, L. B., Wilson, J. G., Lewis, M. C., Jones, S. A., and

Willson, T. M. (2000) J. Med. Chem. 43(16), 2971-4

29


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/

19. Kliewer, S. A., Moore, J. T., Wade, L., Staudinger, J. L., Watson, M. A., Jones, S.

A., McKee, D. D., Oliver, B. B., Willson, T. M., Zetterström, R. H., Perlmann, T.,

and Lehmann, J. M. (1998) Cell 92(1), 73-82

20. Blumberg, B., Sabbagh, W., Jr., Juguilon, H., Bolado, J., Jr., van Meter, C. M.,

Ong, E. S., and Evans, R. M. (1998) Genes Dev. 12(20), 3195-205

21. Goodwin, B., Hodgson, E., and Liddle, C. (1999) Mol. Pharm. 56(6), 1329-39

22. Bertilsson, G., Heidrich, J., Svensson, K., Asman, M., Jendeberg, L., Sydow-

Bäckman, M., Ohlsson, R., Postlind, H., Blomquist, P., and Berkenstam, A.

(1998) Proc. Natl. Acad. Sci. U. S. A. 95(21), 12208-13

23. Lehmann, J. M., McKee, D. D., Watson, M. A., Willson, T. M., Moore, J. T., and

Kliewer, S. A. (1998) J. Clin. Invest. 102(5), 1016-23

24. Xie, W., Barwick, J. L., Simon, C. M., Pierce, A. M., Safe, S., Blumberg, B.,

Guzelian, P. S., and Evans, R. M. (2000) Genes Dev. 14(23), 3014-23

25. Smirlis, D., Muangmoonchai, R., Edwards, M., Phillips, I. R., and Shephard, E.

A. (2001) J. Biol. Chem. 276(16), 12822-12826

26. Goodwin, B., Moore, L. B., Stoltz, C. M., McKee, D. D., and Kliewer, S. A.

(2001) Mol. Pharm. 60(3), 427-31

27. Sueyoshi, T., Kawamoto, T., Zelko, I., Honkakoski, P., and Negishi, M. (1999) J.

Biol. Chem. 274(10), 6043-6

28. Noé, B., Hagenbuch, B., Stieger, B., and Meier, P. J. (1997) Proc. Natl. Acad.

Sci. U. S. A. 94(19), 10346-50

29. Reichel, C., Gao, B., Van Montfoort, J., Cattori, V., Rahner, C., Hagenbuch, B.,

30


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/

Stieger, B., Kamisako, T., and Meier, P. J. (1999) Gastroenterology 117(3), 688-

95

30. Bremmelgaard, A., and Sjövall, J. (1980) J. Lipid Res. 21(8), 1072-81

31. Furster, C., and Wikvall, K. (1999) Biochim. Biophys. Acta 1437(1), 46-52

32. Honkakoski, P., Zelko, I., Sueyoshi, T., and Negishi, M. (1998) Mol. Cell. Biol.

18(10), 5652-8

33. Baes, M., Gulick, T., Choi, H. S., Martinoli, M. G., Simha, D., and Moore, D. D.

(1994) Mol. Cell. Biol. 14(3), 1544-51

34. Wei, P., Zhang, J., Egan-Hafley, M., Liang, S., and Moore, D. D. (2000) Nature

407(6806), 920-3

35. Forman, B. M., Tzameli, I., Choi, H. S., Chen, J., Simha, D., Seol, W., Evans, R.

M., and Moore, D. D. (1998) Nature 395(6702), 612-5

36. Moore, L. B., Parks, D. J., Jones, S. A., Bledsoe, R. K., Consler, T. G., Stimmel,

J. B., Goodwin, B., Liddle, C., Blanchard, S. G., Willson, T. M., Collins, J. L.,

and Kliewer, S. A. (2000) J. Biol. Chem. 275(20), 15122-7

37. Kawamoto, T., Sueyoshi, T., Zelko, I., Moore, R., Washburn, K., and Negishi, M.

(1999) Mol. Cell. Biol. 19(9), 6318-22

38. Honkakoski, P., Moore, R., Washburn, K. A., and Negishi, M. (1998) Mol.

Pharm. 53(4), 597-601

39. Sueyoshi, T., and Negishi, M. (2001) Ann. Rev. Pharm. Tox. 41(3), 123-43

40. Paulusma, C. C., and Oude Elferink, R. P. (1997) J. Mol. Med. 75(6), 420-8

41. Paulusma, C. C., Bosma, P. J., Zaman, G. J., Bakker, C. T., Otter, M., Scheffer,

31


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/

G. L., Scheper, R. J., Borst, P., and Oude Elferink, R. P. (1996) Science

271(5252), 1126-8

42. Büchler, M., König, J., Brom, M., Kartenbeck, J., Spring, H., Horie, T., and

Keppler, D. (1996) J. Biol. Chem. 271(25), 15091-8

43. Kawabe, T., Chen, Z. S., Wada, M., Uchiumi, T., Ono, M., Akiyama, S., and

Kuwano, M. (1999) FEBS Lett. 456(2), 327-31

44. Schrenk, D., Baus, P. R., Ermel, N., Klein, C., Vorderstemann, B., and

Kauffmann, H. M. (2001) Toxic. Lett. 120(1-3), 51-7

45. Evers, R., Kool, M., van Deemter, L., Janssen, H., Calafat, J., Oomen, L. C.,

Paulusma, C. C., Oude Elferink, R. P., Baas, F., Schinkel, A. H., and Borst, P.

(1998) J. Clin.Invest. 101(7), 1310-9

46. Keppler, D., and Arias, I. M. (1997) FASEB J. 11(1), 15-8

47. Fromm, M. F., Kauffmann, H. M., Fritz, P., Burk, O., Kroemer, H. K., Warzok,

R. W., Eichelbaum, M., Siegmund, W., and Schrenk, D. (2000) Amer. J. Path.

157(5), 1575-80

48. Kauffmann, H. M., Keppler, D., Gant, T. W., and Schrenk, D. (1998) Archiv.

Toxic. 72(12), 763-8

49. Dussault, I., Lin, M., Hollister, K., Wang, E. H., Synold, T. W., and Forman, B.

M. (2001) J. Biol. Chem. 276, 33309-12

50. Courtois, A., Payen, L., Guillouzo, A., and Fardel, O. (1999) FEBS Lett. 459(3),

381-5

51. Demeule, M., Jodoin, J., Beaulieu, E., Brossard, M., and Béliveau, R. (1999)

32


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/

FEBS Lett. 442(2-3), 208-14

52. Jones, S. A., Moore, L. B., Shenk, J. L., Wisely, G. B., Hamilton, G. A., McKee,

D. D., Tomkinson, N. C., LeCluyse, E. L., Lambert, M. H., Willson, T. M.,

Kliewer, S. A., and Moore, J. T. (2000) Mol. Endo. 14(1), 27-39

53. Boehm, M. F., Zhang, L., Badea, B. A., White, S. K., Mais, D. E., Berger, E.,

Suto, C. M., Goldman, M. E., and Heyman, R. A. (1994) J. Med. Chem. 37(18),

2930-41

54. LeCluyse, E., Bullock, P., Parkinson, A., and Hochman, J. (1996) in Models for

assessing drug absorption and metabolism (Borchardt, R. T., Smith, P. L., and

Wilson, G., eds) Vol. v. 8., pp. 121-159, Plenum, New York

55. Diatchenko, L., Lau, Y. F., Campbell, A. P., Chenchik, A., Moqadam, F., Huang,

B., Lukyanov, S., Lukyanov, K., Gurskaya, N., Sverdlov, E. D., and Siebert, P. D.

(1996) Proc. Natl. Acad. Sci. U. S. A. 93(12), 6025-30

56. Kauffmann, H. M., and Schrenk, D. (1998) Biochem. Biophys. Res. Com. 245(2),

325-31

57. Moore, L. B., Goodwin, B., Jones, S. A., Wisely, G. B., Serabjit-Singh, C. J.,

Willson, T. M., Collins, J. L., and Kliewer, S. A. (2000) Proc. Natl. Acad. Sci.

U. S. A. 97(13), 7500-2

58. Schuetz, E. G., Strom, S., Yasuda, K., Lecureur, V., Assem, M., Brimer, C.,

Lamba, J., Kim, R. B., Ramachandran, V., Komoroski, B. J., Venkataramanan, R.,

Cai, H., Sinal, C. J., Gonzalez, F. J., and Schuetz, J. D. (2001) J. Biol. Chem. , In

press

33


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/

59. Song, C. S., Echchgadda, I., Baek, B., Ahn, S. C., Oh, T., Roy, A. K., and

Chatterjee, B. (2001) J. Biol. Chem. , In Press

60. Kliewer, S. A., Lehmann, J. M., and Willson, T. M. (1999) Science 284(5415),

757-60

61. Moore, J. T., and Kliewer, S. A. (2000) Toxic. 153(1-3), 1-10

62. Geick, A., Eichelbaum, M., and Burk, O. (2001) J. Biol. Chem. 276(18), 14581-

14587

63. Müller, M., and Jansen, P. L. (1997) Amer. J. Physiol. 272(6 Pt 1), G1285-303

34


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/

EdwardsCatherine M. Stoltz, Peter Tontonoz, Steve Kliewer, Timothy M. Willson and Peter A.

Heidi R. Kast, Bryan Goodwin, Paul T. Tarr, Stacey A. Jones, Andrew M. Anisfeld,nuclear receptors PXR, FXR, and CAR

Regulation of multidrug resistance-associated protein 2 (MRP2;ABCC2) by the

published online November 12, 2001J. Biol. Chem.

10.1074/jbc.M109326200Access the most updated version of this article at doi:

Alerts:

When a correction for this article is posted•

When this article is cited•

to choose from all of JBC's e-mail alertsClick here


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/lookup/doi/10.1074/jbc.M109326200

http://www.jbc.org/cgi/alerts?alertType=citedby&addAlert=cited_by&cited_by_criteria_resid=jbc;M109326200v1&saveAlert=no&return-type=article&return_url=http://www.jbc.org/content/early/2001/11/12/jbc.M109326200.citation

http://www.jbc.org/cgi/alerts?alertType=correction&addAlert=correction&correction_criteria_value=early/2001/11/12/jbc&saveAlert=no&return-type=article&return_url=http://www.jbc.org/content/early/2001/11/12/jbc.M109326200.citation

http://www.jbc.org/cgi/alerts/etoc

http://www.jbc.org/

Documents

Regulation of multidrug resistance-associated protein 2 (MRP2