Regulation of Fungal Drug Resistance and Morphogenesis by ......KDAC inhibition induces pseudohyphal morphology. 59 Figure 10. KDAC inhibition results in increased expression of hyphal

Regulation of Fungal Drug Resistance and Morphogenesis by Lysine Deacetylases

by

Xinliu Li

A thesis submitted in conformity with the requirements for the degree of Master of Science

Department of Molecular Genetics University of Toronto

© Copyright by Xinliu Li 2015

ii

Regulation of Fungal Drug Resistance and Morphogenesis by

Lysine Deacetylases

Xinliu Li

Master of Science

Department of Molecular Genetics

University of Toronto

2015

Abstract

Hsp90 is a molecular chaperone that governs drug resistance, morphogenesis, and virulence in

the leading human fungal pathogen Candida albicans. Previous work with Saccharomyces

cerevisiae and C. albicans established acetylation as a novel mechanism of post-translational

control of Hsp90 in fungi and implicated lysine deacetylases (KDACs) as key regulators of

resistance to the most common class of antifungals, the azoles. Here, by generating KDAC

deletion mutants in azole-resistant C. albicans, we discovered high level of functional

redundancy among the KDACs, and identified Hos2, Hda1, Rpd3, and Rpd31as key KDACs

responsible for mediating azole resistance. Furthermore, we identified Lysine 30 and 271 as

critical acetylation sites of C. albicans Hsp90, such that mutations at these residues compromised

Hsp90 function. Further investigations into the circuitry through which KDACs regulates drug

resistance will provide important insights into the regulatory network of C. albicans Hsp90, and

suggest new targets for treating life-threatening fungal infections.

iii

Acknowledgments

First and foremost, I would like to express my sincere gratitude to my supervisor, Dr. Leah

Cowen, for giving me the opportunity to work on this amazing project. I am grateful for your

patience and guidance in helping me through all the hurdles, and your unchanging

encouragement along the way. Your enthusiasm toward science and your commitment to your

students are constant sources of inspiration and motivation. I would also like to thank my

committee members Dr. Marc Meneghini and Dr. Frederick Roth, for all your knowledge and

valuable feedbacks towards my research project.

I want to thank all members of the Cowen Lab, both past and present, for all your help, support,

and friendship. There was always help available whenever I needed, and always a shoulder to

lean on when I’m down. But more importantly, I love the laughs we shared, the adventures we

took, and the amazing memories we built. All of you helped to make this a rewarding and fun-

filled experience that I will cherish for a lifetime.

Finally, I like to thank Mom and Dad for believing in me and supporting me in all my decisions.

Your love means the world to me.

iv

Table of Contents

Acknowledgments.......................................................................................................................... iii

Table of Contents ........................................................................................................................... iv

List of Tables ................................................................................................................................ vii

List of Figures .............................................................................................................................. viii

Abbreviations ..................................................................................................................................ix

1 Introduction .................................................................................................................................1

1.1 Candida albicans .................................................................................................................1

1.2 Antifungals ...........................................................................................................................3

1.2.1 Azoles ......................................................................................................................3

1.2.2 Mechanisms of Azole Resistance ............................................................................5

1.3 Morphogenesis .....................................................................................................................7

1.4 Hsp90 ...................................................................................................................................9

1.4.1 Hsp90 Post-translational Modification ..................................................................11

1.5 Thesis Rationale .................................................................................................................11

2 Materials and Methods ..............................................................................................................13

2.1 Strain Culture and Construction.........................................................................................13

2.1.1 Yeast Strain Culturing Conditions .........................................................................13

2.1.2 Yeast Strain Construction ......................................................................................16

2.2 DNA manipulation, Cloning, and PCR..............................................................................26

2.2.1 Plasmid construction ..............................................................................................26

2.2.2 Bacterial Strain Culturing Conditions ....................................................................33

2.2.3 Quantitative Reverse Transcription PCR (qRT-PCR) ...........................................33

2.3 Drug Susceptibility Assays ................................................................................................34

v

2.4 Protein Quantification ........................................................................................................34

2.4.1 Western ..................................................................................................................34

2.5 Hsp90 Function Assays......................................................................................................35

2.5.1 Growth Curve.........................................................................................................35

2.5.2 Glucocorticoid Receptor Activity Assay ...............................................................35

2.5.3 Calcineurin Activation ...........................................................................................35

2.6 Gene expression .................................................................................................................36

2.6.1 RNA extraction ......................................................................................................36

2.7 Microscopy.........................................................................................................................36

3 Results .......................................................................................................................................38

3.1 KDACs regulate azole resistance.......................................................................................38

3.1.1 Combined deletion of HDA1, HOS2, and RPD3, and doxycycline-mediated

transcriptional repression of RPD31 abrogate azole resistance in the

erg3Δ/erg3Δ mutant background. ..........................................................................38

3.1.2 Doxycycline-mediated transcriptional repression of RPD31 confirmed with

qRT-PCR................................................................................................................41

3.1.3 Hda1, Rpd3, Hos2, and Rpd31 do not affect Hsp90 protein level.........................44

3.1.4 Contribution of KDACs to azole resistance is not limited to the erg3Δ/erg3Δ

mutant background.................................................................................................46

3.2 Characterizing C. albicans Hsp90 acetylation mutants in S. cerevisiae. ...........................48

3.2.1 Generating Hsp90 acetylation mutants in S. cerevisiae .........................................48

3.2.2 Acetylation mutations on Hsp90 do not affect protein expression or stability. .....48

3.2.3 Acetylation mutations in Hsp90 result in hypersensitivity to Hsp90 inhibition. ...51

3.2.4 Acetylation mutations on Hsp90 impair glucocorticoid receptor activity. ............53

3.2.5 Acetylation mutations on Hsp90 do not impair calcineurin activity. ....................55

3.3 Role of KDACs in C. albicans Morphogenesis .................................................................58

3.3.1 KDAC inhibition induces pseudohyphal morphology ...........................................58

vi

3.3.2 Combined deletion of HDA1, RPD3, and HOS2, and depletion of RPD31

results in pseudohyphae formation ........................................................................61

4 Discussion .................................................................................................................................64

4.1 Summary of Findings and Discussion ...............................................................................64

4.2 Future Directions................................................................................................................66

References ......................................................................................................................................68

vii

List of Tables

Tables Pages

Table 1. C. albicans strains used in this study. 13

Table 2. S. cerevisiae strains used in this study. 14

Table 3. Plasmids used in this study. 26

Table 4. Primers used in this study. 27

viii

List of Figures

Figures Page

Figure 1. Azole resistance phenotypes of KDAC mutants. 39

Figure 2. RPD31 transcript level is repressed with doxycycline when under

the control of tetO-promoter, and restored with the complemented wild-

type promoter. 43

Figure 3. Hda1, Rpd3, Hos2, and Rpd31 do not affect Hsp90 protein level. 45

Figure 4. Azole susceptibility phenotypes of KDAC mutants. 47

Figure 5. Acetylation mutations do not affect Hsp90 protein level. 50

Figure 6. Acetylation mutations result in hypersensitivity to Hsp90

inhibition. 52

Figure 7. Hsp90 acetylation mutations impair glucocorticoid receptor

activity. 54

Figure 8. Hsp90 acetylation mutations do not impair calcineurin function. 56

Figure 9. KDAC inhibition induces pseudohyphal morphology. 59

Figure 10. KDAC inhibition results in increased expression of hyphal

specific genes. 60

Figure 11. Combined deletion of HDA1, RPD3, and HOS2, and depletion of

RPD31 enhances filamentation. 62

ix

Abbreviations

ATP Adenosine triphosphate

BME β-mercaptoethanol

CK2 Casein kinase 2

CPRG Chlorophenol red-β-D-galactopyranoside

DMSO Dimethyl sulfoxide

GdA Geldanamycin

GR Glucocorticoid receptor

HSP90 Heat shock protein 90

KAT Lysine acetyltransferase

KDAC Lysine deacetylase

LB Lysogeny broth

LiOAc Lithium acetate

NAT Nourseothricin

OD Optical density

PEG Polyethylene glycol

PBS Phosphate-buffered saline

PKC Protein kinase C

SD Synthetic defined media

SOC Super optimal broth with catabolite repression

TBS Tris-buffered saline

TSA Trichostatin A

YPD Yeast extract peptone dextrose

1

1 Introduction

1.1 Candida albicans

Fungi infect billions of people, and kill over 1.5 million people per year, at least as many as

tuberculosis and malaria (Brown, Denning et al. 2012). While superficial and mucosal infections

are extremely common, life-threatening systemic infections are typically limited to individuals

experiencing some form of immune-suppression. With the increased population of vulnerable

individuals due to the AIDS epidemic, chronic hospitalization, and medical interventions such as

chemotherapy and organ transplant, invasive fungal infections are becoming an increasingly

common public health burden worldwide (Pfaller and Diekema 2010).

Yeasts of the genus Candida are a leading cause of opportunistic fungal infections. Although a

large number of Candida species have been documented, only a few are known to cause disease

in humans (Pappas, Kauffman et al. 2009, Pfaller and Diekema 2010). Among these, C. albicans

is by far the most prevalent, responsible for 90%-100% of superficial mucosal infections and

40%-70% of disseminated infections (Pappas, Kauffman et al. 2009, Pfaller and Diekema 2010).

Unlike most other pathogenic fungi, C. albicans can exist harmlessly on our skin and mucosal

surfaces as part of the commensal microbiota, colonizing the skin, oral cavity, gastrointestinal

tract, and reproductive tract (Odds 1988, Gow and Hube 2012). However, disruption to the

normal microbial flora or compromise of the immune system may enable this fungus to

overgrow, resulting in symptomatic infections. Due to the long evolutionary history with the

human host, C. albicans is well adapted to survive and proliferate in the host environment, and is

found rarely in the soil and external environments, suggesting adaptation to a parasitic lifestyle

(Hube 2004). The majority of Candida infections are therefore from endogenous sources,

derived from commensal populations acquired prior to disease development (Taylor, Harrer et al.

2003, Pfaller and Diekema 2010). Exogenous sources of infection are also common, especially in

healthcare settings where transmission can occur from healthcare workers, other patients, and

contaminated medical devices (Asmundsdottir, Erlendsdottir et al. 2008, Pfaller and Diekema

2010), making it the fourth most common cause of hospital-acquired infections in the United

States (Pfaller and Diekema 2007).

2

Invasive candidiasis occurs when Candida species break the mucosal barrier, penetrating into

deeper tissue and gaining access to the bloodstream (Eggimann, Garbino et al. 2003).

Dissemination via the bloodstream allows the fungus to invade almost all body sites and organs,

resulting in lethal systemic disease (Pappas, Kauffman et al. 2009). Early clinical symptoms of

invasive candidiasis are non-specific and resemble other nosocomial infections, which impedes

accurate diagnosis and delays treatment, contributing to increased mortality (Eggimann, Garbino

et al. 2003, Ellepola and Morrison 2005, Morrell, Fraser et al. 2005). Even with early detection

and rigorous antifungal treatments, the attributable mortality rate of disseminated candidiasis

approaches 40% (Horn, Neofytos et al. 2009).

Due to its importance as a serious human pathogen, many aspects of C. albicans biology and

pathogenicity have been subjected to extensive research, and C. albicans genetics have advanced

significantly with the development of a number of large-scale mutant libraries (Roemer, Jiang et

al. 2003, Homann, Dea et al. 2009, Noble, French et al. 2010). However, many aspects of C.

albicans biology still make it challenging to study in the laboratory. First, C. albicans possess a

high degree of genome plasticity and is tolerant to large-scale genetic variations (Rustchenko

2007, Selmecki, Forche et al. 2010). Karyotypes of clinical isolates often show dramatic

differences due to loss of heterozygosity, aneuploidy, and gross chromosomal rearrangements

(Selmecki, Forche et al. 2010). While this is greatly beneficial for the fungus to survive

environmental stresses and rapidly evolve drug resistance (Selmecki, Gerami-Nejad et al. 2008,

Selmecki, Dulmage et al. 2009), it can hinder genetic studies. Aneuploidies that arise during

DNA transformation to modify specific genes can have profound effects on the cell and lead to

triplication of target gene (Bouchonville, Forche et al. 2009). C. albicans is also a diploid

organism. While haploid cells have recently been isolated, they are typically unstable and have

reduced fitness, and mostly revert to the diploid state (Hickman, Zeng et al. 2013). As a result,

deletions and genetic modifications of a target gene require two rounds of transformations,

increasing the probability of acquiring unwanted mutations (Rustchenko 2007, Arbour, Epp et al.

2009). The recent development of CRISPR system for C. albicans may ameliorate this challenge,

offering the potential of mutating both alleles of multiple genes in a single transformation (Vyas,

Barrasa et al. 2015). However, despite such advances, there remain additional challenges. C.

albicans lacks a conventional meiotic cycle and does not maintain plasmids (Hull, Raisner et al.

2000, Ene and Bennett 2014), rendering many powerful yeast genetic techniques such as

3

Synthetic Genetic Arrays and tetrad analysis intractable in this system. Finally, C. albicans

employs an unusual codon usage that translates the CUG codon as serine rather than the

universal leucine (Santos and Tuite 1995), which demands codon-to-codon modifications of

genetic constructs that were previously successfully used in other systems. Owing to the limited

availability of molecular tools and technical challenges of laboratory genetic manipulation in C.

albicans, many studies have relied on the genetic tractability and genomic resources of the model

yeast Saccharomyces cerevisiae. Despite an estimated divergence of ∼300 to 700 million years

of evolution between the two species (Hedges, Blair et al. 2004, Taylor and Berbee 2006),

parallel and complementary analyses have provided a powerful platform for identifying both

conserved and divergent cellular processes, and remain a valuable approach for uncovering C.

albicans genetic circuitry.

1.2 Antifungals

Treatments for fungal infections face a number of great challenges. Since fungi are eukaryotes,

like their human hosts, their close evolutionary relatedness greatly limits the number of

differential targets that can be exploited for drug development (Denning and Hope 2010, Brown,

Denning et al. 2012). There are only four classes of antifungals in clinical use compared to over

two dozen classes of antibacterials. The antifungals in clinical use target biosynthesis of the

membrane sterol ergosterol or its biosynthesis (polyenes and azoles, respectively), biosynthesis

of the cell wall polysaccharide β-(1,3)-glucan (echinocandins) or nucleic acid synthesis

(pyrimidines) (Odds, Brown et al. 2003, Denning and Hope 2010). There are also very few new

drugs currently being developed, primarily because antifungals are not predicted to generate a

large enough financial return for pharmaceutical companies (Brown, Denning et al. 2012).

Furthermore, the clinical utility of current antifungals can be compromised by severe host

toxicity or by the rapid emergence of drug resistance in fungal pathogens.

1.2.1 Azoles

Currently, the most widely deployed class of antifungals are the azoles. These synthetic

compounds were first introduced as antifungals in the late 1980s and early 1990s (Ghannoum

and Rice 1999), and their superior safety profile led to extensive use in the clinic. Azoles are

chemically classified as either imidazoles if they have two nitrogen atoms in the azole ring, or

triazoles if they have three (Sheehan, Hitchcock et al. 1999, Gomez-Lopez, Zaragoza et al.

4

2008). Azoles remain the drug of choice as initial therapy for most fungal infections and are

often recommended as prophylaxis for high-risk patients (Walsh, Anaissie et al. 2008, Pappas,

Kauffman et al. 2009, Perfect, Dismukes et al. 2010). The most commonly used azoles in the

clinic include fluconazole, itraconazole, voriconazole, and posaconazole.

Ergosterol is the functional analogue of mammalian cholesterol, and serve as a bioregulator in

the fungal cell to regulate membrane fluidity and integrity (Anderson 2005). Azoles can enter C

albicans cells through facilitated diffusion (Mansfield, Oltean et al. 2010), and disrupt the

biosynthesis of ergosterol by inhibiting the cytochrome P450-dependent enzyme lanosterol

demethylase (also referred to as 14α-sterol demethylase), encoded by ERG11 (Sheehan,

Hitchcock et al. 1999, Shapiro, Robbins et al. 2011). This leads to a block in the production of

ergosterol and an accumulation of 14-α-methyl-3,6-diol, an alternate sterol produced by the Δ-

5,6-desaturase, encoded by ERG3 (Shapiro, Robbins et al. 2011). This alternate form is toxic to

the cell, and exerts severe membrane stress as it gets incorporated into the membrane in place of

ergosterol. The depletion of ergosterol also inhibits the function of vacuolar membrane H+

ATPases, resulting in disruption of cation homeostasis within the cell, further contributing to the

antifungal activity of azoles (Zhang, Gamarra et al. 2010).

Unfortunately, resistance to azoles is becoming an increasing concern. Azoles inhibit the growth

of yeasts such as C. albicans in a fungistatic manner, rather than fungicidal (Anderson 2005).

This can leave large population of surviving fungal cells that experiences strong directional

selection for resistance (Anderson 2005). Resistance to azoles can also develop through a

number of different mechanisms, which increases the overall probably of yielding a resistant

phenotype through mutations. The resistance prone nature of azoles, compounded with their

widespread use and often long-term prophylaxis treatment regimes, has led to increasing reports

of azole resistance in the clinic, which is associated with increased treatment difficulties and

patient mortality (Pfaller 2012). There has also been an increased incidence in infections caused

by intrinsically azole-resistant fungal species, including Candida glabrata and Candida krusei,

creating major challenges for future treatments (Miceli, Diaz et al. 2011). In a recent report, the

Centers for Disease Control and Prevention has ranked fluconazole-resistant Candida as a

serious threat (CDC 2013), highlighting the need for new strategies to effectively control and

prevent the development of drug resistance.

5

1.2.2 Mechanisms of Azole Resistance

One of the most common mechanisms of azole resistance is the up regulation of efflux pumps to

decrease the intracellular accumulation of the drug. This is typically achieved through mutations

in transcriptional regulators, and represents a broad mutational target as many different non-

synonymous changes in the transcriptional regulators can lead to resistance phenotypes

(Anderson 2005). In C. albicans, the two main classes of multidrug transporters important for

azole resistance are the ATP binding cassette transporter superfamily encoded by the CDR genes

and the major facilitator class encoded by the MDR genes (Kanafani and Perfect 2008, Shapiro,

Robbins et al. 2011). Overexpression of CDR1, CDR2, and MDR1 has been shown in both

clinical and in vitro generated azole-resistant strains (Sanglard, Kuchler et al. 1995, White 1997,

Dunkel, Blass et al. 2008). Of the three, CDR1 tends to be a more significant contributor to

clinically significant resistance, with some strains exhibiting up to 10 fold increase in its

transcript levels (Sanglard, Kuchler et al. 1995, Holmes, Lin et al. 2008, Cannon, Lamping et al.

2009). Increased efflux can also lead to pleiotropic cross resistance to other substrates of the

same exporters, including other classes of antifungals (White, Marr et al. 1998).

Resistance to azoles can also occur through alterations to the drug target, either by mutation or

overexpression. A number of amino acid substitutions in Erg11 have been identified in clinical

isolates, conferring resistance by decreasing binding affinity for azoles (Sanglard, Ischer et al.

1998, Marichal, Koymans et al. 1999, Lamb, Kelly et al. 2000). Overexpression of a drug target

can titrate a drug’s effect, minimizing the impact it has on the cell. Upon exposure to azoles, the

transcription factor Upc2 is induced to upregulate genes involved in ergosterol biosynthesis,

including Erg11 (Silver, Oliver et al. 2004). Gain-of-function mutations have been identified in

UPC2 that lead to hyperactivation of the transcription factor, contributing to azole resistance

(Dunkel, Liu et al. 2008, Heilmann, Schneider et al. 2010). Another method of target

overexpression used by C. albicans is through genomic changes that increase the gene dosage of

ERG11. Gene amplification associated with aneuploidy has been shown to increase ERG11

expression, contributing to resistance in clinical isolates (Selmecki, Forche et al. 2006, Selmecki,

Gerami-Nejad et al. 2008).

Another general mechanism of azole resistance in C. albicans is through cellular signaling

pathways and stress response pathways that allows the fungus to cope with diverse stresses in its

6

environment, including stresses imposed by antifungals (Shapiro, Robbins et al. 2011). Such

pathways are important for both general tolerance to the drug, as well as resistance due to

specific mechanisms. The most well characterized example of stress response dependent

resistance in C. albicans involves loss of function mutations in the ergosterol biosynthesis gene

ERG3. This prevents the production of toxic 14-α-methyl-3,6-diol by the ERG3 encoded Δ-5,6-

desaturase when Erg11 is inhibited by the azoles, and the cell accumulates 14α-methyl fecosterol

instead (Kelly, Lamb et al. 1997). This alternate sterol is less toxic, and allows the cell to

continue to proliferate in the presence of azoles. Various erg3 mutants have been identified

among clinical isolates, although the prevalence and clinical significance remains unclear

(Martel, Parker et al. 2010, Morio, Pagniez et al. 2012, Vale-Silva, Coste et al. 2012). Loss of

function of ergsoterol biosynthesis genes creates a state of cellular stress associated with an

increased cellular demand for regulators of stress responses (Vincent, Lancaster et al. 2013).

erg3 mediated resistance is also particularly problematic as it confers cross resistance to the

polyenes, another class of antifungal that traditionally provided a treatment alternative for azole-

resistant Candida infections (Kelly, Lamb et al. 1997).

One example of a pathway involved in azole-induced membrane stress is the cyclic AMP protein

kinase A (PKA) signaling pathway. Deletions of components of this pathway increases

susceptibility to azoles, as a consequence of the resulting defect in the azole-dependent

upregulation of the CDR1 drug pump (Jain, Akula et al. 2003). Other pathways implicated in

modulating stress responses and contributing to azole resistance include Ca2+-calmodulin-

activated protein phosphatase calcineurin signaling (Cruz, Goldstein et al. 2002, Onyewu,

Blankenship et al. 2003), casein kinase 2 (CK2) serine/threonine protein kinase signaling (Bruno

and Mitchell 2005), as well as the protein kinase C (PKC) cell wall integrity pathway (LaFayette,

Collins et al. 2010). Various pathways may also interact with each other. For example,

calcineurin inhibition can reverse the azole resistance of a CK2 mutant, suggesting crosstalk

between the two (Bruno and Mitchell 2005). Interestingly, many are also connected to the Heat-

shock protein 90 (Hsp90) chaperone network. Both calcineurin and Mkc1, the terminal kinase in

the PKC regulated mitogen-activated protein kinases cascade, are Hsp90 client proteins that rely

on proper Hsp90 function for stability and activation (Singh, Robbins et al. 2009, LaFayette,

Collins et al. 2010). CK2 can regulate Hsp90 function through phosphorylation, but is also

dependent on Hsp90 for stability (Diezmann, Michaut et al. 2012). Hsp90 itself therefore plays a

7

critical role in mediating the evolution and maintenance of azole resistance in C. albicans

(Cowen and Lindquist 2005, Cowen, Carpenter et al. 2006, Cowen, Singh et al. 2009).

More than one mechanism of azole resistance can also occur within a single Candida strain,

creating an additional layer of complexity. In fact, the majority of clinical isolates with high

levels of fluconazole resistance often exhibit a combination of multiple mechanisms,

contributing to high levels of resistance (Perea, Lopez-Ribot et al. 2001, Ford, Funt et al. 2015).

For example, a prevalent form of aneuploidy found in azole-resistant isolates is the formation an

isochromosome consisting of two copies of the left arm of chromosome 5 (Selmecki, Forche et

al. 2006). This genomic region harbors both ERG11, the gene encoding azole drug target, as well

as TAC1, a transcription factor that upregulates the expression of CDR1 and CDR2 drug

exporters (Selmecki, Forche et al. 2006). Both ERG11 and TAC1 were shown to make

independent contributions to azole resistance in a manner that is directly proportional to their

gene copy number (Selmecki, Gerami-Nejad et al. 2008). Thus, gene amplification of

chromosome 5 left arm through aneuploidy contributed both to an increased expression of the

drug target and an increased cellular efflux of the drug, providing azole resistance. This also

highlights the importance of C. albicans genomic flexibility and the advantage it provides in the

evolution of drug resistance.

1.3 Morphogenesis

C. albicans is a polymorphic fungus that is capable of transitioning between distinct

morphological states. Depending on environmental cues, it can exist as either yeasts,

pseudohyphae, or true hyphae, with the latter two collectively referred to as filaments (Sudbery,

Gow et al. 2004). Yeast cells are rounded and unicellular, resembling the budding yeast S.

cerevisiae. Pseudohyphae are typically characterized by branched chains of elongated cells

attached end to end, with visible septal constrictions. Hyphae have parallel sides along their

entire length and no visible constrictions can be observed between mother and daughter cells.

While hyphae and pseudohyphae are distinct morphological states with differences in their cell

cycle regulation and septal ring localization (Sudbery 2001, Berman 2006), evidence suggests

that pseudohypae are likely an intermediate phenotype that represents the transition from yeasts

to true hyphae. Notably, increasing the expression level of a single transcription factor, Ume6, is

8

able to cause a gradual shift in cell morphology from yeasts to pseudohyphae and eventually to

true hyphae (Carlisle, Banerjee et al. 2009).

In C. albicans, the ability to transition between different morphologies has been closely coupled

to virulence. Strains that are locked in either the yeast form or the filamentous form are typically

avirulent in mouse models of disseminated candidiasis (Lo, Kohler et al. 1997, Braun, Head et al.

2000, Rocha, Schroppel et al. 2001, Laprade, Boyartchuk et al. 2002). A general model is that

yeasts cells are required for effective dissemination through the blood stream, while filaments are

responsible for tissue penetration and deep-seated infections (Saville, Lazzell et al. 2003,

Sudbery, Gow et al. 2004). Nevertheless, it’s interesting to note that most dimorphic fungal

pathogens exist solely as yeasts in the host and filaments in the environment, suggesting that the

physical ability to change form itself does not equate to virulence (Gow, Brown et al. 2002). One

important connection between morphogenesis and virulence in C. albicans lies in the fact that

numerous key transcriptional regulators of yeast-to-hyphal transition also control the expression

of major virulence genes (Lane, Birse et al. 2001, Kumamoto and Vinces 2005). For example,

filamentation leads to expression of secreted aspartic proteases such as Sap4 and Sap6 (Felk,

Kretschmar et al. 2002), associated with tissue invasion and damage, as well as adhesion proteins

such as Als3 and Hwp1 (Staab, Bradway et al. 1999, Liu and Filler 2011), which are critical for

mediating binding and attachment to host cells. Morphogenesis is also essential for the formation

of biofilms, a surface associated community of both yeast and filamentous cells embedded in

rich extracellular matrices (Blankenship and Mitchell 2006). Easily established on implanted

medical devices such as indwelling catheters, C. albicans biofilms not only serve as major

reservoirs for infection, but also pose serious challenges in the clinic due to their intrinsic

resistance to antifungals (Douglas 2003, Blankenship and Mitchell 2006). Both nonfilamentous

and hyperfilamentous strains are typically defective in biofilm formation, and either fail to

establish biofilms or are unable to disperse (Richard, Nobile et al. 2005, Uppuluri, Chaturvedi et

al. 2010, Finkel and Mitchell 2011).

Induction and regulation of morphogenesis occur through a variety of environmental cues.

Examples of conditions that induce yeast to hyphal transition include exposure to serum, increase

in pH, nutrient limitation, amino acid starvation, and elevated carbon dioxide levels, mostly

mimicking environments within the human hosts (Shapiro, Robbins et al. 2011). One important

requirement for most filamentation inducing cues, including the ones listed above, is the

9

concurrent increase in temperature to 37°C. This is due at in part to Hsp90 mediated repression

of the filamentation program, which is alleviated at higher temperatures as the cellular demand

for Hsp90 increases due to global increase in unfolded proteins, overwhelming Hsp90 functional

capacity (Shapiro, Uppuluri et al. 2009). In fact, feverish temperatures above 39°C or

pharmacological inhibition of Hsp90 alone is sufficient to promote filamentation in the absence

of other inducing cues. There is less known about signals that block filamentation or promote

hyphal to yeast transitions. The most well characterized example is the involvement of quorum

sensing. Farnesol, a quorum sensing molecule produced by C. albicans, inhibits filamentation

when present in high concentrations, thereby favoring yeast growth in dense populations of C.

albicans even in the presence of filamtation inducing cues (Enjalbert and Whiteway 2005,

Langford, Atkin et al. 2009).

1.4 Hsp90

Hsp90 is an essential molecular chaperone with a primary role in assisting the proper folding and

function of diverse proteins. While initially characterized by its upregulation during heat stress,

heat shock proteins have essential roles in the cell that extends beyond stress responses. Even

under unstressed physiological conditions, Hsp90 is highly abundant, and constitutes as much as

1-2% of total proteins in a cell (Borkovich, Farrelly et al. 1989). Based on genetic analysis in S.

cerevisiae, around 20% of yeast proteins are estimated to be influenced by Hsp90, making it the

most highly connected protein in the proteome (Taipale, Jarosz et al. 2010). Hsp90 regulates the

folding and function of diverse client proteins, including key regulators of stress responses and

cellular signaling, allowing it to occupy a central position in many biological networks (Taipale,

Jarosz et al. 2010). Much of the research on understanding Hsp90 has been driven by cancer

biology where Hsp90 tends to be overexpressed. It can function as a biochemical buffer to

chaperone oncoproteins and prevent apoptosis, allowing the cell to survive despite the

accumulation of detrimental mutations (Whitesell and Lindquist 2005). This has driven the

development of small molecules that can inhibit Hsp90 as potential anticancer agents. Some of

the known Hsp90 inhibitors include natural products geldanamycin (GdA), radicicol, and their

semi-synthetic derivatives such as 17-AAG.

Hsp90 typically functions as a homodimer in the cytoplasm, but can also be transported to the

nucleus and other organelles. Each copy of Hsp90 contains an N-terminal, a middle, and a C-

10

terminal domain. The N-terminal domain contains an unusual adenine-nucleotide-binding pocket

known as the Bergerat fold, distinct from ATP-binding domains found in other chaperones and

kinases (Whitesell and Lindquist 2005). Hydrolysis of ATP to ADP in the Bergerat fold drives

conformational changes that have an essential role in the chaperoning activity of the Hsp90

dimer. A highly charged flexible linker region connects the N-terminal to the middle domain,

which interacts directly with ATP bound in the Bergerat fold to modulate ATP hydrolysis. A

second linker connects to the C-terminal domain, which is the site of dimerization, but also plays

a role in promoting ATP hydrolysis. Hsp90 inhibitors such as geldanamycin bind to the Bergerat

fold with higher affinity than the natural nucleotide, which prevents the cycling of ATP

hydrolysis driven conformational changes, thereby blocking chaperone activity.

As a key regulator cellular stress response and signaling, Hsp90 plays an essential role in C.

albicans pathogenicity. By enabling specific signaling circuits, Hsp90 allows cells to survive the

membrane stress exerted by the azoles and rapidly evolve resistance (Cowen and Lindquist

2005). Inhibition of Hsp90 blocks the rapid emergence of resistance, transforms azoles from

fungistatic to fungicidal, abrogates existing resistance in clinical strains, and renders resistant

pathogens responsive to treatment in multiple infection models (Shapiro et al, 2011; Cowen et al,

2009; Singh et al, 2009). Even C. albicans biofilms, which are notorious difficult to manage due

to their intrinsic drug resistance, can be effectively eliminated with the combination of azoles

and Hsp90 inhibitors (Robbins, Uppuluri et al. 2011). Inhibition of Hsp90 also induces a

transition from yeast to filamentous growth and attenuates virulence, consistent with the

importance of morphological flexibility for virulence (Shapiro, Uppuluri et al. 2009).

With its powerful and broad spectrum effects, Hsp90 has emerged as an attractive therapeutic

target for treatment of fungal infections. However, there are still significant challenges. Hsp90 is

essential in all eukaryotes tested, and is one of the most conserved proteins, such that human

Hsp90 can complement the loss of Hsp90 in yeasts (Piper, Panaretou et al. 2003). While Hsp90

inhibitors have been shown to be effective against localized infection without host toxicity

(Robbins, Uppuluri et al. 2011), there was considerable toxicity in a murine model of

disseminated candidiasis that prevented observation of potential therapeutic benefits (Cowen,

Singh et al. 2009). Therefore, exploiting Hsp90 as a therapeutic target will likely require

alternative strategies to inhibit components of the Hsp90 chaperone network that are distinct

between the pathogen and host, such as the upstream regulators of Hsp90 function.

11

1.4.1 Hsp90 Post-translational Modification

While Hsp90 interacts with a large proportion of the proteome, it is not required for the proper

folding of all proteins. It possesses a diverse but specific set of client proteins, and its function

and specificity is closely regulated by post-translational modifications. Known post-translational

modifications on Hsp90 include phosphorylation, acetylation, methylation, nitrosylation, and

sumoylation (Martinez-Ruiz, Villanueva et al. 2005, Mollapour, Tsutsumi et al. 2010, Diezmann,

Michaut et al. 2012, Robbins, Leach et al. 2012, Hamamoto, Toyokawa et al. 2014, Mollapour,

Bourboulia et al. 2014).

Hsp90 acetylation has profound impact on Hsp90 function. Acetylation state of a protein is

regulated by the addition and removal of acetyl groups on lysine residues by lysine

acetyltransferases (KATs) and lysine deacetylases (KDACs). Many small molecule inhibitors of

KDACs have been described, with a number of them currently in clinical trials as anticancer

agents (Dokmanovic, Clarke et al. 2007). In contrast, inhibitors of KATs are much less studied.

In S. cerevisiae and C. albicans, inhibition of KDACs with the broad spectrum KDAC inhibitor

Trichostatin A (TSA) impaired the function of multiple Hsp90 client proteins, and abrogated

azole resistance (Robbins, Leach et al. 2012). In the pathogenic mold Aspergillus fumigatus,

Hsp90 acetylation mutants resulted in decreased azole resistance as well as decreased virulence

in a mouse model of invasive aspergillosis (Lamoth, Juvvadi et al. 2014). The divergence

between fungal and human KDACs is much greater than Hsp90, providing alternative

therapeutic targets for the treatment of fungal infections.

1.5 Thesis Rationale

At the heart of many stress response pathways and signaling networks, the molecular chaperone

Hsp90 plays a critical role in governing fungal drug resistance, morphogenesis, and virulence.

Understanding the regulatory components of the Hsp90 network not only provides valuable

insights into these complex cellular circuitries, but also allows for the identification of novel

therapeutic targets that overcomes the difficulty in specifically targeting fungal Hsp90.

Previous work by former lab member Nicole Robbins demonstrated that pharmacological

inhibition of KDACs with TSA phenocopies Hsp90 inhibition in terms of abrogating azole

resistance of both the model yeast S. cerevisiae and the pathogen C. albicans (Robbins, Leach et

12

al. 2012). In S. cerevisiae, the key targets of TSA are Rpd3 and Hda1, catalytic subunits of

distinct KDAC complexes. Deletion of either RPD3 or HDA1 alone had no impact on erg3-

mediated azole resistance, but deletion of both RPD3 and HDA1 abrogated azole resistance.

Nicole demonstrated that S. cerevisiae Hsp90 is acetylated on lysine 27 and 270, and that

compromising KDACs impairs the stability and function of Hsp90 client proteins, such as

calcineurin (Robbins, Leach et al. 2012). Beyond the model yeast, many questions remain

unanswered in the pathogen. The KDACs responsible for mediating Hsp90 deacetylation have

yet to be identified in C. albicans, and the sites of acetylation on Hsp90 and their functional

consequences have yet to be defined.

Overall, the goal of my project is to determine how lysine deacetylases regulate Hsp90 function

to govern drug resistance and morphogenesis in C. albicans.

13

2 Materials and Methods

2.1 Strain Culture and Construction

2.1.1 Yeast Strain Culturing Conditions

All C. albicans and S. cerevisiae strains used in this study are listed in Table 1. Archives of all

yeast strains used were maintained at -80°C in 25% glycerol. Strains used in experiments were

maintained on solid (2% agar added) yeast extract peptone (YPD, 1% yeast extract, 2%

bactopeptone, 2% glucose) at 4°C for no more than one month. For experiments, yeast strains

were routinely grown in either YPD medium or in synthetic defined medium (SD, 0.67% yeast

nitrogen base, 2% glucose) supplemented with amino acids.

Table 1. C. albicans strains used in this study.

Strain name Genotype Source

CaLC206

arg4 /arg4 his1 /his1 URA3/ura3 ::imm434 IRO1/iro1

::imm434 HIS1/his1::TAR-FRT

(Robbins, Leach et

al. 2012)

CaLC480 CaLC206, RPD3/rpd3::FRT This study

CaLC506 CaLC206, rpd3::FRT/rpd3::FRT This study

CaLC667 CaLC206, HDA1/hda1::FRT This study

CaLC668 CaLC206, hda1::FRT/hda1::FRT This study

CaLC1553 CaLC206, HOS2/hos2::FRT This study

CaLC1564 CaLC206, hos2::FRT/hos2::FRT This study



CaLC660 CaLC206, erg3::FRT/erg3::FRT

(Robbins, Collins et

al. 2010)

CaLC643 CaLC506, ERG3/erg3::FRT This study

CaLC663 CaLC506, erg3::FRT/erg3::FRT This study



CaLC1561 CaLC660, HOS2/hos2::FRT This study


14



CaLC2419 CaLC660, rpd31::FRT/rpd31::FRT-TetO-RPD31 This study






CaLC2404 CaLC1483, rpd31::FRT/RPD31 This study


CaLC2406 CaLC1693, rpd31::FRT/RPD31 This study



CaLC3268 CaLC1693, rpd31::FRT/rpd31::FRT-WTp-RPD31 This study

CaLC3269 CaLC1693, rpd31::FRT/rpd31::FRT-WTp-RPD31 This study

CaLC3609 CaLC660, erg3::FRT/erg3::FRT+ERG3 This study





Table 2. S. cerevisiae strains used in this study.

Strain name Genotype Plasmid Source

ScLC1965

can1-100,his3-11,15,leu2-

3,112,trp1-1,ura3-1,ade2-1,

hsc82::KANmx, hsp82::kanMx,

pdr1::KANmx, pdr3::KANmx pAG424-Hsc82

Luke

Whitesell/Susa

n Lindquist

ScLC3048

can1-100,his3-11,15,leu2-

3,112,trp1-1,ura3-1,ade2-

1,hsc82::KANmx, hsp82::kanMx,

pdr1::KANmx, pdr3::KANmx pKAT6

Susan

Lindquist

(unpublished)

15

ScLC3827

can1-100,his3-11,15,leu2-

3,112,trp1-1,ura3-1,ade2-1,


pdr1::KANmx, pdr3::KANmx

pLC868 (pAG424-

CaHSP90) This study

ScLC3862

can1-100,his3-11,15,leu2-

3,112,trp1-1,ura3-1,ade2-1,



pLC899 (pAG424-

CaHSP90K30Q) This study

ScLC3863

can1-100,his3-11,15,leu2-

3,112,trp1-1,ura3-1,ade2-1,



pLC900 (pAG424-

CaHSP90K30R) This study

ScLC4187

can1-100,his3-11,15,leu2-

3,112,trp1-1,ura3-1,ade2-1,



pLC903 (pAG424-

CaHSP90K271Q) This study

ScLC4188

can1-100,his3-11,15,leu2-

3,112,trp1-1,ura3-1,ade2-1,



pLC904 (pAG424-

CaHSP90K271R) This study

ScLC4189

can1-100,his3-11,15,leu2-

3,112,trp1-1,ura3-1,ade2-1,



pLC905 (pAG424-

CaHSP90K30Q,

K271Q) This study

ScLC4190

can1-100,his3-11,15,leu2-

3,112,trp1-1,ura3-1,ade2-1,



pLC906 (pAG424-

CaHSP90K30R,

K271R) This study

ScLC4191

can1-100,his3-11,15,leu2-

3,112,trp1-1,ura3-1,ade2-1,



pAG424-Hsc82;

pLC913

(p2A/GRGZ) This study

ScLC4192

can1-100,his3-11,15,leu2-

3,112,trp1-1,ura3-1,ade2-1,



pLC868;

pLC913


ScLC4193

can1-100,his3-11,15,leu2-

3,112,trp1-1,ura3-1,ade2-1,



pLC899;

pLC913


ScLC4194

can1-100,his3-11,15,leu2-

3,112,trp1-1,ura3-1,ade2-1,



pLC900;

pLC913


ScLC4195

can1-100,his3-11,15,leu2-

3,112,trp1-1,ura3-1,ade2-1,


pLC903;

pLC913


16


ScLC4196

can1-100,his3-11,15,leu2-

3,112,trp1-1,ura3-1,ade2-1,



pLC904;

pLC913


ScLC4197

can1-100,his3-11,15,leu2-

3,112,trp1-1,ura3-1,ade2-1,



pLC905;

pLC913


ScLC4198

can1-100,his3-11,15,leu2-

3,112,trp1-1,ura3-1,ade2-1,



pLC906;

pLC913


2.1.2 Yeast Strain Construction

2.1.2.1 Chemical Transformation of C. albicans

C. albicans strains were transformed using a polyethylene glycol (PEG)-lithium acetate (LiOAc)

protocol (Gietz and Woods 2002, Robbins, Leach et al. 2012). Strains to be transformed were

inoculated into liquid YPD and grown with shaking overnight at either 25°C or 30°C to an

OD600 of between 4 and 8. Approximately 2 x 108 cells were resuspended in 1.1 mL PEG-

LiOAc transformation mix (40% PEG, 0.1 M LiOAc pH 7.4, 1xTE, 18 mM DTT) containing 40

μL of boiled carrier DNA (5 mg/mL salmon sperm DNA) and the transforming DNA. After

incubation at 30°C for one hour, cells were heat-shocked at 42°C for 45 minutes and washed

with YPD to remove all PEG-LiOAc. For transformation with a nourseothricin (NAT) resistance

marker, heat-shocked cells were diluted in 10 mL YPD and grown at 30°C for four hours to

allow expression of the resistance construct. Cells were then spread using sterile glass beads on

solid YPD medium containing 150 µg/mL NAT. For transformation with amino acid

biosynthesis markers, heat-shocked cells were immediately resuspended in 100 μL ddH20 and

plated directly onto solid SD medium supplemented with amino acids as needed. Plates were

incubated at 30°C for two to three days or until resistant/prototrophic colonies emerged.

2.1.2.2 C. albicans Strain Construction

CaLC480 – To delete RPD3, pLC336 was digested with KpnI and SacI to liberate the RPD3

deletion cassette and transformed into CaLC206. NAT resistant transformants were PCR tested

17

for proper integration with primers oLC374/oLC275 (583 bp product) and oLC379/oLC274. The

SAP2 promoter was induced to drive expression of FLP recombinase to excise the NAT marker

cassette. The excised deleted allele was verified with primers oLC374/379 (~ 1 kb product).

CaLC506 - To delete the remaining RPD3 allele in CaLC480, pLC336 was digested with KpnI

and SacI to liberate the RPD3 deletion cassette and transformed into CaLC480. NAT resistant

transformants were PCR tested for proper integration with primers oLC374/oLC275 (583 bp

product) and oLC379/oLC274. To ensure the cassette deleted the intact allele rather than the

previously deleted allele, the presence of the previously deleted allele was confirmed with

oLC374/379 (~ 1 kb product). The SAP2 promoter was induced to drive expression of FLP

recombinase to excise the NAT marker cassette.

CaLC667 - To delete HDA1, pLC365 was digested with KpnI and SacI to liberate the HDA1


for proper integration with primers oLC540/oLC275 and oLC541/oLC274. The SAP2 promoter

was induced to drive expression of FLP recombinase to excise the NAT marker cassette.

CaLC668 - To delete the remaining HDA1 allele in CaLC667, pLC365 was digested with KpnI

and SacI to liberate the HDA1 deletion cassette and transformed into CaLC667. NAT resistant

transformants were PCR tested with primers oLC540/oLC275 and oLC541/oLC274. To ensure

the cassette deleted the intact allele rather than the previously deleted allele, presence of the

previously deleted allele was tested with oLC540/oLC541 (~1 kb fragment). The SAP2 promoter


CaLC1553 - To delete HOS2, pLC553 was digested with KpnI and SacI to liberate the HOS2


for proper integration with oLC275/oLC1452 and oLC274/oLC1453. The SAP2 promoter was

induced to drive expression of FLP recombinase to excise the NAT marker cassette.

CaLC1564 - To delete the remaining HOS2 allele in CaLC1553, pLC553 was digested with

KpnI and SacI to liberate the HOS2 deletion cassette and transformed into CaLC1553. NAT

resistant transformants were PCR tested for proper integration with oLC275/oLC1452 and

oLC274/oLC1453. To ensure the cassette deleted the intact allele rather than the previously

deleted allele, presence of the previously deleted allele was tested with oLC1452/oLC1453. The

18


cassette.

CaLC2401 - To delete RPD31, pLC705 was digested with KpnI and SacI to liberate the RPD31




CaLC2408 - To delete the remaining RPD31 allele in CaLC2401, pLC705 was digested with

KpnI and SacI to liberate the RPD31 deletion cassette and was transformed into CaLC2401.

NAT resistant transformants were PCR tested for proper integration with oLC274/oLC2418 and


deleted allele, presence of the previously deleted allele was tested with oLC2415/oLC2418.

Absence of the wild-type allele was confirmed with oLC2415/oLC2412. The SAP2 promoter

was induced to drive expression of FLP recombinase to excise the NAT marker.

CaLC643 - To delete ERG3, pLC361 was digested with KpnI and SacI to liberate the ERG3




CaLC663 - To delete the remaining ERG3 allele in CaLC643, pLC361 was digested with KpnI

and SacI to liberate the ERG3 deletion cassette and transformed into CaLC643. NAT resistant

transformants were PCR tested with oLC275/oLC499 and oLC274/oLC500. To ensure that the

cassette deleted the intact allele, presence of the previously deleted allele was tested with

oLC499/oLC500 (~1kb). Absence of the wild-type allele was confirmed with oLC499/oLC166.

The SAP2 promoter was induced to drive expression of FLP recombinase to excise the NAT

marker cassette.





19

CaLC758 - To delete the remaining HDA1 allele in CaLC669, pLC365 was digested with KpnI

and SacI to liberate the HDA1 deletion cassette and transformed into CaLC669. NAT resistant

transformants were PCR tested with primers oLC540/oLC275 (700 bp product) and

oLC541/oLC274 (~700 bp product). To ensure the cassette deleted the intact allele rather than

the previously deleted allele, presence of the previously deleted allele was tested with

oLC540/oLC541 (~1 kb fragment). The SAP2 promoter was induced to drive expression of FLP

recombinase to excise the NAT marker cassette. PCR confirmed both alleles of HDA1 were

deleted using primers oLC541/oLC594 (if an allele is present a 700bp product is formed). PCR

confirmed that both alleles of ERG3 were deleted using primers oLC166/oLC499 (if an allele is

present a 700bp product is formed).





CaLC1571 - To delete the remaining HOS2 allele in CaLC1561, pLC553 was digested with

KpnI and SacI to liberate the HOS2 deletion cassette and transformed into CaLC1561. NAT

resistant transformants were PCR tested for proper integration with oLC275/oLC1452 and


deleted allele, presence of the previously deleted allele was tested with oLC1451/oLC1452. The


cassette. Absence of the wild-type allele was confirmed with oLC1496/oLC1497.





CaLC2409 - To delete the remaining RPD31 allele in CaLC2402, pLC705 was digested with

KpnI and SacI to liberate the RPD31 deletion cassette and was transformed into CaLC2401.

NAT resistant transformants were PCR tested for proper integration with oLC274/oLC2418 and


20

deleted allele, presence of the previously deleted allele was tested with oLC2415/oLC2418.

Absence of the wild-type allele was confirmed with oLC2415/oLC2412. The SAP2 promoter

was induced to drive expression of FLP recombinase to excise the NAT marker.

CaLC2419 - The tetracycline-repressible promoter system was amplified from pLC330 using

oLC2457/2458, which contained 5' sequence homologous to the RPD31 locus. The PCR product

was transformed into CaLC2402. NAT resistant transformants were PCR tested for proper

integration using oLC300/oLC2412 as well as oLC275/oLC2415. Presence of the deleted allele

was verified with oLC2415/oLC2418. Absence of the wild type allele was confirmed with

oLC2415/ oLC2412. The SAP2 promoter was induced to drive expression of FLP recombinase to

excise the NAT marker.





CaLC1483 - To delete the remaining HDA1 allele in CaLC1482, pLC365 was digested with

KpnI and SacI to liberate the HDA1 deletion cassette and transformed into CaLC1482. NAT

resistant transformants were PCR tested with primers oLC540/oLC275 (700 bp product) and

oLC541/oLC274 (~700 bp product). To ensure the cassette deleted the intact allele rather than

the previously deleted allele, presence of the previously deleted allele was tested with

oLC540/oLC541 (~1 kb fragment). The SAP2 promoter was induced to drive expression of FLP

recombinase to excise the NAT marker cassette. PCR confirmed both alleles of HDA1 were

deleted using primers oLC541/oLC594 (if a wild-type allele is present a 700bp product is

formed).




induced to drive expression of FLP recombinase to excise the NAT marker cassette. To delete

the remaining HOS2 allele, pLC553 was digested with KpnI and SacI to liberate the HOS2

deletion cassette. To ensure the cassette deleted the intact allele rather than the previously

21

deleted allele, presence of the previously deleted allele was tested with oLC1451/oLC1452 (~1

kb fragment). The SAP2 promoter was induced to drive expression of FLP recombinase to excise

the NAT marker cassette. Absence of the wild-type allele was confirmed with

oLC1496/oLC1497.










oLC1496/oLC1497.










oLC1496/oLC1497.





22







excise the NAT marker.


deletion cassette and transformed into CaLC16936. NAT resistant transformants were PCR

tested for proper integration with oLC274/oLC2418 and oLC275/oLC2415. The SAP2 promoter








excise the NAT marker. As with CaLC2563, but an independent clone.







excise the NAT marker. As with CaLC2562, but an independent clone.

CaLC3268 - pLC809 was digested with KpnI-HF and SacI-HF to liberate the RPD31 promoter

complementation cassette and transformed into CaLC2562. NAT resistant transformants were

PCR tested for proper integration with oLC275/oLC2608 and oLC274/oLC2604. The SAP2

promoter was induced to drive expression of FLP recombinase to excise the NAT marker

23

cassette. The excised allele was verified with primers oLC2608/oLC2604. As with CaLC3269,

but an independent clone.

CaLC3269 - pLC809 was digested with KpnI-HF and SacI-HF to liberate the RPD31 promoter

complementation cassette and transformed into CaLC2563. NAT resistant transformants were

PCR tested for proper integration with oLC275/oLC2608 and oLC274/oLC2604. The SAP2

promoter was induced to drive expression of FLP recombinase to excise the NAT marker

cassette. The excised allele was verified with primers oLC2608/oLC2604. As with CaLC3268,

but an independent clone.

CaLC3609 - pLC834 was digested with BssHII to liberate the ERG3 complementation construct

along with the NAT-FLP cassette. The digested plasmid was transformed into CaLC660. NAT

resistant transformants were PCR tested for proper integration with oLC499/oLC275 (expect

2062bp) and oLC3567/oLC274 (expect 764bp). The SAP2 promoter was induced to drive

expression of FLP recombinase to excise the NAT marker cassette. The excised allele was

verified with primers oLC500/oLC162 (expect 849bp).
















24










2.1.2.3 Chemical Transformation of S. cerevisiae

S. cerevisiae strains were transformed using a PEG-LiOAc protocol (Gietz and Woods 2002).

Strains to be transformed were inoculated in liquid YPD and grown with shaking overnight at

30°C to saturation. Cells were then diluted to OD600 of 0.2 in 10 mL YPD medium and grown

to final OD600 of ~0.5. Cells were washed with 10 mL sterile ddH2O, resuspended in 60 μL of

10 mM LiOAc and incubated at 30°C for 15 minutes. The cell suspension was then transferred to

an eppendorf tube containing the following transformation mix: 10 μL of linear DNA (for

integration) or 2 μL of plasmid DNA (from a miniprep), 10 μL sterile ddH20, 10 μL of boiled

carrier DNA (salmon sperm DNA) and 300 μL of PEG-LiOAc (40% PEG, 0.1 M LiOAc). This

mixture was incubated at 30°C for 30 minutes and then immediately heat shocked for 20 minutes

at 42°C and washed twice with 200 μL sterile ddH20. Heat-shocked cells were resuspended in

100 μL ddH20 and plated directly onto solid SD medium supplemented with amino acids as

needed. Plates were incubated at 30°C for three days or until prototrophic colonies emerged.

2.1.2.4 S. cerevisiae Strain Construction

ScLC3827 - Plasmid pLC868 (pAG424-Candida albicans Hsp90) transformed into ScLC3048.

Presence of pLC868 determined by PCR using oLC3723/oLC3437. Plated ~107 cells on 0.1%

5FOA YPD plates. Deletion of pKAT6 determined by PCR with oLC11 /oLC2834.

ScLC3862 - Plasmid pLC899 (pAG424GPD-Ca-HSP90K30Q) transformed into ScLC3048.

Presence of pLC899 determined by PCR using oLC3723/3437. Plated ~107 cells on 0.1% 5FOA

YPD plates. Deletion of pKAT6 determined by PCR with oLC11 /oLC2834.

25

ScLC3863 - Plasmid pLC900 (pAG424GPD-Ca-HSP90K30R) transformed into ScLC3048.



ScLC4187 - Plasmid pLC903 (pAG424GPD-Ca-HSP90K271Q) transformed into ScLC3048.



ScLC4188 - Plasmid pLC904 (pAG424GPD-Ca-HSP90K271R) transformed into ScLC3048.



ScLC4189 - Plasmid pLC905 (pAG424GPD-Ca-HSP90K30Q, 271Q) transformed into

ScLC3048. Presence of pLC905 determined by PCR using oLC3723/3437. Plated ~107 cells on

0.1% 5FOA YPD plates. Deletion of pKAT6 determined by PCR with oLC11 /oLC2834.

ScLC4190 - Plasmid pLC906 (pAG424GPD-Ca-HSP90K30R, 271R) transformed into

ScLC3048. Presence of pLC900 determined by PCR using oLC3723/3437. Plated ~107 cells on

0.1% 5FOA YPD plates. Deletion of pKAT6 determined by PCR with oLC11 /oLC2834.

ScLC4191 - Plasmid pLC913 (p2A/GRGZ) transformed into ScLC1965. Presence of pLC913

confirmed by performing beta-galactosidase assay (CPRG).









26







2.2 DNA manipulation, Cloning, and PCR

2.2.1 Plasmid construction

Recombinant DNA procedures were performed according to standard protocols. All plasmids

constructed were sequenced to verify the absence of nonsense mutations. Plasmids used in this

study are listed in Table 3. Primers used in this study are listed in Table 4.

Table 3. Plasmids used in this study.

Plasmid name Description (Backbone) Source

pLC49 FLP-CaNAT, ampR

(Shen, Guo et al.

2005)

pLC336 CaRPD3-KO, ampR, NAT (pLC49) This study

pLC365 CaHDA1-KO, ampR, NAT (pLC49) This study

pLC553 CaHOS2-KO, ampR, NAT (pLC49) This study

pLC705 CaRPD31-KO, ampR, NAT (pLC49) This study

pLC361 CaERG3-KO, ampR, NAT (pLC49) This study

pLC330 tetO-CaHSP90, ampR, NAT (pLC49)

(Shapiro, Uppuluri et

al. 2009)

pLC834 CaERG3 complementation, ampR, NAT (pLC49) This study

pLC809 WTp-CaRPD31, ampR, NAT (pLC49) This study

pLC773 pAG424GPD-ccdB (pRS424) Susan Lindquist

pLC868 pAG424-CaHSP90 This study

pLC899 pAG424-CaHSP90K30Q This study

pLC900 pAG424-CaHSP90K30R This study

pLC903 pAG424-CaHSP90K271Q This study

27

pLC904 pAG424-CaHSP90K271R This study

pLC905 pAG424-CaHSP90K30Q, 271Q This study

pLC906 pAG424-CaHSP90K30R, 271R This study

pLC913 p2A/GRGZ

(Nathan and

Lindquist 1995)

Table 4. Primers used in this study.

Primer name Description Sequence (5’ 3’)

oLC274 pJK863down-F CTGTCAAGGAGGGTATTCTGG

oLC275 pJK863up-R AAAGTCAAAGTTCCAAGGGG

oLC374 CaRPD3-A GTTTACTTCAATTCCTCG

oLC379 CaRPD3-D CAATATGTCAAACCATGTGG

oLC388 CaRPD3-360-F-KpnI

CGGGGTACCATTCAACTTGTGAC

GATAGG

oLC389 CaRPD3+3-R-ApaI

TTGCGGGCCCCATTTTTTCTTCGG

TTGG

oLC390 CaRPD3+1440-F-SacII

TCCCCGCGGTGAATGGCAAATAA

TGTAG

oLC391 CaRPD3+1786-R-SacI

CCCGAGCTCCTTTGGATTCAAGA

ATGG

oLC536 CaHDA1-407-F-ApaI

TTGCGGGCCCCACGAATTTAGAA

ATCTCGGG

oLC537 CaHDA1+3-R-ApaI

TTGCGGGCCCCCAGTCGACATTCT

TAAAAAGG

oLC538 CaHDA1+2500-F-Not1

ATAAGAATGCGGCCGCTGATTCG

AGTAGAAACAACAAC

oLC539 CaHDA1+2892-R-SacII

TCCCCGCGGGAGAAATAACCCTC

CCAAGG

oLC540 CaHDA1-572-F CCCCAACTAGGATTACTGCC

oLC541 CaHDA1+3076-R CAGACATAAAGGCATCTGAGG

oLC1448 CaHOS2 +3-R Apa1

TTGCGGGCCCCATTTATATTAACT

ACTTTTCTCC

oLC1449 CaHOS2 – 522-F Kpn1

GGGGTACCAGGATCTAATAACTT

ATCTGG

oLC1450 CaHOS2+1363-F-NotI

AGAATGCGGCCGCTAGTTTGTCTT

GATACACATATAC

oLC1451 CaHOS2 +1887-R-SacII

TCCCCGCGGTCGTTTTGTTTATAG

AGTGG

28

oLC1452 CaHOS2 – 669-F TTCCACCGGCATTTCGTAACC

oLC1453 CaHOS2 +1999-R TATTAGCCAGGGTACTGTCG

oLC2412 CaRPD31 + 359-R CCACAATACTCAAATAATCC

oLC2413 CaRPD31 0 – R - ApaI

TTGCGGGCCCGGTGGACGAGTTT

GGTTGAG

oLC2414 CaRPD31 - 491 – F - ApaI

TTGCGGGCCCCAATAACAGTTAC

TGTCACC

oLC2415 CaRPD31 – 646 - F TTGGAATTATCGTGGTCAAGC

oLC2416 CaRPD31 + 1820 – F - NotI

ATAAGAATGCGGCCGCGAATCAT

GTAAAGTGTGAGG

oLC2417 CaRPD31 +2279 – R - SacI

CCCGAGCTCATGGAAGTTATTTA

GTGAGC

oLC2418 CaRPD31 + 2386 - R GCTTTGCCAATGATTGGTCG

oLC166 CaERG3-R4 GCTGGGAAAAATTTAGGAGC

oLC495 CaERG3+3-R-ApaI

TTGCGGGCCCCATGGTAGTAAAA

TTGGC

oLC496 CaERG3-381-F-ApaI

TTGCGGGCCCCTTTCGTTTAAGTA

TTCC

oLC497 CaERG3+1161-F-SacII

TCCCCGCGGTGATTGGTACATCTT

TGTTTTGG

oLC498 CaERG3+1545-R-SacI

CCCGAGCTCCAGTAAATATAGGA

TAATGC

oLC499 CaERG3-513-F CAAAACTACTTGTTAAGC

oLC500 CaERG3-1683-R GTTGATGTGATGTAAGTTAG

oLC594 CaHDA1+2314-F AACGGTGGAGGTAACAAGTCAGC

oLC1496 CaHOS2+467-F CAGATATTGCCATCAATTGG

oLC1497 CaHOS2+1004-R TTTCTTGGAGTATACCCACC

oLC2457 tetO-CaRPD31-pLC330-F

GCTTTCATTTCTCCACTATACAGA

TACACAGACACCAAACAACACAA

CAACTCAACCAAACTCGTCCACC

CGAGGAAGTTCCTATACTTT

oLC2458 tetO-CaRPD31-pLC330-R

AGAAATAAGCAATACGTTTCTTTT

GGTTTGGATCAACTTTCAATTCAT

CAAATGGAAGTTCAGTATACATC

GACTATTTATATTTGTATG

oLC300 Tetp-F-NotI

ATAAGAATGCGGCCGCGTTTGGT

TCAGCACCTTGTCG

oLC2608 CaRPD31 -1000-F TCTGTATGGAAACCGGATAG

oLC2604 CaRPD31 + 426 – R GATGGCAATATCACATTTACC

oLC2602 CaRPD31 + 377-R-SacI CCCGAGCTCGATCCACCACCACT

29

AATACC

oLC2603 CaRPD31 -510 -F-NotI

ATAAGAATGCGGCCGCTGGATAA

CTTGGATATTACC

oLC2606 CaRPD31-509-R-ApaI

TTGCGGGCCCATTTGGACCCATA

ACCAGTTTCC

oLC2607 CaRPD31 – 938-F-KpnI

CGGGGTACCTGGATCATTATTGTC

CTTGG

oLC496 CaERG3-381-F-ApaI

TTGCGGGCCCCTTTCGTTTAAGTA

TTCC

oLC3405 ERG3+1413-R-ApaI

ACCGTAGGGCCCGACTTTCAAGA

TTGTCCTTG

oLC3406 ERG3+1414-F-SacII

ACCGTACCGCGGGTCTTCCTTTTG

ATGTTAAG

oLC3407 ERG3+1805-R-SacI

ACCGTAGAGCTCTCCTTTCTTCCG

TTCGACC

oLC243 M13-R CAGGAAACAGCTATGAC

oLC244 M13-F GTAAAACGACGGCCAG

oLC159 CaERG3-F1 CATTTCTTTCCCTATTGTG

oLC160 CaERG3-F2 GCTCCTAAATTTTTCCCAGC

oLC161 CaERG3-F3 CATAGATGGTTACACTGGC

oLC162 CaERG3-F4 CAGTTGTCAATGGTACCG

oLC3567 CaERG3+2036-R GTAAAGGTTGACGGTGGTAGTG

oLC11 ScHSC82-5R CAGCAGATAGAGCTTCCATG

oLC2834 ScURA3+762-F GGCTGGGAAGCATATTTGAG

oLC3723 pBluescriptKS TCGAGGTCGACGGTATC

oLC3437 CaHSP90 SEQ 2001 ATTGATTGCCTTGGGATT

oLC199 CaHSP90+307R CAGATTTAGCAATAGTACCC

oLC2899 CaHSP90+159F AAGCCTTGTCTGATCCATCC

oLC321 CaHSP90 + 499F AACGAAAGATTGGGTCGTGG

oLC322 CaHSP90 + 1033F GTGTTTATCACTGATGATGC

oLC323 CaHSP90 + 1599F AAAAGCTGCTAGAGAAAAGG

oLC3273 CaHSP90K27Q-F

CAGTCTATTCAAACCAGGAAATT

TTCTTAAGAGAATTGATCTCC

oLC3274 CaHSP90K27Q-R

GGAGATCAATTCTCTTAAGAAAA

TTTCCTGGTTTGAATAGACTG

oLC3275 CaHSP90K27R-F

CAGTCTATTCAAACAGGGAAATT

TTCTTAAGAGAATTGATCTCC

30

oLC3276 CaHSP90K27R-R

GGAGATCAATTCTCTTAAGAAAA

TTTCCCTGTTTGAATAGACTG

oLC664 CaHSP90-K271/Q-F

AACTGAAGAGTTGAACAAGACCC

AACCATTATGGACCAGAAACCC

oLC665 CaHSP90-K271/Q-R

GGGTTTCTGGTCCATAATGGTTGG

GTCTTGTTCAACTCTTCAGTT

oLC666 CaHSP90-K271/R-F

AACTGAAGAGTTGAACAAGACCA

GACCATTATGGACCAGAAACCC

oLC667 CaHSP90-K271/R-R

GGGTTTCTGGTCCATAATGGTCTG

GTCTTGTTCAACTCTTCAGTT

oLC2555 CaRPD31+937-F ACTATGAGAAATGTGGCTCG

oLC2556 CaRPD31+1384-R CTTCACTTTTATCAACTTGC

oLC752 GPD1+570-F AGTATGTGGAGCTTTACTGGGA

oLC753 GPD1+766-R CAGAAACACCAGCAACATCTTC

oLC750 HWP1+872-F CCACTACTACTGAAGCCAAATC

oLC751 HWP1+1111-R AAGTGGATACTGTACCAGTTGG

oLC4000 ScPMC1+1500-F GCCAATATTGTCCTGAATTC

oLC4001 ScPMC1+1718-R TTAGAGCCAATAAAGGGTTC

oLC4003 ScRTA1+458-F TCTATTACAAGCAATTGGTG

oLC4004 ScRTA1+534-R AGCTGTAACGAGATGAGAAC

oLC3928 ScENA1+1020-F GCTGCTGTTATGGTTTCTAG

oLC3929 ScENA1+1295-R TTCTGGAGAATACCAACGTC

oLC1458 ECE1+322-F CCATTTGTTGTCAGAGCTGT

oLC1459 ECE1+575-R GCTTGTTGAACAGTTTCCAG

oLC1460 UME6+1648-F GGAGGTGTAAGTAATGACAC

oLC1461 UME6+1976-R GGTTCTTCATTGACAACTTG

oLC1466 HGC1+1267-F CCAACTAGTTCTACTGGCTC

oLC1467 HGC1+1505-R CCTAATGACGTTGAAGAATTG

oLC3942 ScACT1+865-F CTGACTACTTGATGAAGATC

oLC3943 ScACT1+1067-R TCGTTACCAATAGTGATGAC

pLC336 - This is a construct to knock out RPD3 with the NAT resistance recyclable marker.

Homology upstream of RPD3 was PCR amplified from SC5314 with primers oLC388 and

31

oLC389 and cloned into pLC49 at KpnI and ApaI. Homology downstream of RPD3 was PCR

amplified from SC5314 with primers oLC390 and oLC391 and cloned into pLC49 at SacI and

SacII.

pLC365 - This is a construct to knock out HDA1 with the NAT resistance recyclable marker.

Homology downstream of HDA1 was amplified from SC5314 genomic DNA with primers

oLC538/oLC539 and cloned into pLC49 at NotI and SacII. Homology upstream of HDA1 was

amplified from SC5314 genomic DNA with primers oLC536/oLC537 and cloned into pLC49

containing the downstream homology at ApaI. The presence of the inserts were tested by PCR

with oLC274/oLC539 and oLC275/oLC536.

pLC553 - This is a construct to knock out HOS2 with the NAT resistance recyclable marker.

Homology upstream of HOS2 was amplified from SC5314 genomic DNA with primers

oLC1448/oLC1449 and cloned into pLC49 at KpnI and ApaI. Homology downstream of HOS2

was amplified from SC5314 genomic DNA with primers oLC1450/1451 and cloned into pLC49

containing the upstream homology at NotI, SacII. The presence of the inserts were tested by PCR


pLC705 - This is a construct to knock out RPD31 with the NAT resistance recyclable marker.

Homology upstream of RPD31was amplified from SC5314 genomic DNA with primers

oLC2413/oLC2414 and cloned into pLC49 at ApaI. Homology downstream of RPD31 was

amplified from SC5314 genomic DNA with primers oLC2416/2417 and cloned into pLC49

containing the upstream homology at NotI, SacI. The presence of the inserts were tested by PCR

with oLC274/oLC2417 and oLC275/oLC2414. Presence of the inserts was also verified by

sequencing. No mutations were found.

pLC361 - This is a construct to knock out ERG3 with the NAT resistance recyclable marker.

Homology downstream of ERG3was amplified from SC5314 genomic DNA with primers

oLC497/oLC498 and cloned into pLC49 at SacII and SacI. Homology upstream of ERG3 was

amplified from SC5314 genomic DNA with primers oLC495/oLC496 and cloned into pLC49

containing the downstream homology at ApaI. The presence of the inserts were tested by PCR


32

pLC809 - This is a construct to complement tetO-RPD31 with endogenous RPD31 promoter.

Homology downstream of RPD31 was amplified from SC5314 genomic DNA with primers

oLC2602/oLC2603 and cloned into pLC49 at NotI and SacI. Homology upstream of RPD31

promoter was amplified from SC5314 genomic DNA with primers oLC2606/oLC2607 and

cloned into pLC49 containing the downstream homology at ApaI and KpnI. The presence of the

inserts were tested by PCR with oLC274/oLC2602 and oLC275/oLC2607.

pLC834 - This is a construct to complement CaERG3. Sequence containing ERG3 and its

promoter was amplified from SC5314 genomic DNA with primers was amplified from SC5314

genomic DNA with primers oLC496/oLC3405 and cloned into pLC49 at ApaI. The presence of

the insert was tested by PCR with oLC243/166 and oLC275/162, and sequence verified with

oLC243, oLC159, oLC160, and oLC161. Homology downstream of ERG3 was amplified from

SC5314 genomic DNA with primers oLC3406/oLC3407 and cloned into pLC49 containing

ERG3 at SacI and SacII. The presence of the insert was tested by PCR with oLC274/oLC500 and

oLC3406/oLC244.

pLC868 - C. albicans HSP90 gDNA open reading frame (no introns in C. albicans HSP90) was

amplified and cloned into the pDONR221 Entry vector using the BP reaction (Life

Technologies). This ORF was then flipped into the Gateway Expression vector pAGD424GPD

(aka pLC773).

pLC899 - This plasmid is based on pLC868. It underwent site directed mutagenesis to mutate

Lysine 30 to a glutamine residue using primers oLC3273 and oLC3274. The purpose was to

mimic a permanently acetylated Hsp90. The clone was sequence verified with primers oLC199,

oLC2899, oLC321, oLC322, and oLC323.


Lysine 30 to an arginine residue using primers oLC3275 and oLC3276. The purpose was to

mimic a permanently deacetylated Hsp90. The clone was sequence verified with primers

oLC199, oLC2899, oLC321, oLC322, and oLC323.



33




Lysine 271 to an arginine residue using primers oLC666 and oLC667. The purpose was to mimic

a permanently deacetylated Hsp90. The clone was sequence verified with primers oLC199,







Lysine 271 to an arginine residue using primers oLC666 and oLC667. The purpose was to mimic

a permanently deacetylated Hsp90. The clone was sequence verified with primers oLC199,


2.2.2 Bacterial Strain Culturing Conditions

Plasmids that have undergone site-directed mutagenesis were maintained in Top10 cells. All

other plasmids used were maintained in DH5α. Archives of bacterial strains were maintained at -

-80°C in 35% glycerol. Strains used in experiments were maintained on solid lysogeny broth

medium (LB, 1% tryptone, 0.5% yeast extract, 0.5% NaCl) containing appropriate selective

antibiotics at 4°C for no more than one month. For bacterial transformation experiments strains

were routinely grown in LB medium or super optimal broth with catabolite repression medium

(SOC, 0.5% yeast extract, 8.6mM NaCl, 2.5mM KCl, 20mM MgSO4, 20mM glucose). For mini-

prepping plasmids from E. coli strains, cells were grown at 37°C overnight in LB medium

containing appropriate selective antibiotics. Plasmid DNA was isolated from strains using

GenElute™ Plasmid Miniprep Kit (Sigma- Aldrich). *2% agar was added to solid media.

2.2.3 Quantitative Reverse Transcription PCR (qRT-PCR)

qRT-PCR was performed using FastSYBR Green Master Mix (Applied Biosystems) and BioRad

CFX384 Real Time System, with the following cycling conditions: 95 °C for 3min, then 95 °C

34

for 10s and 60 °C for 30s, for 40 cycles. Reactions were performed in triplicate, for two

biological replicates using the primers oLC2555/oLC2556 (RPD31), oLC752/oLC753 (GPD1),

oLC750/oLC751 (HWP1), oLC4000/oLC4001 (PMC1), oLC4003/oLC4004 (RTA1),

oLC3928/oLC3929 (ENA1), oLC1458/oLC1459 (ECE1), oLC1466/oLC1467 (HGC1),

oLC1460/oLC1461 (UME6), oLC3942/oLC3943 (ScACT1). Primer sequences are included in

Table 3. Data were analyzed using the BioRad CFX Manager 3.1. All data were normalized to

the either GPD1 or ACT1 reference gene. Error bars show the standard error.

2.3 Drug Susceptibility Assays

Minimum inhibitory concentration assays were performed using 96-well microtiter plates, as

previously described (Cowen and Lindquist 2005, Singh, Robbins et al. 2009). A gradient of

Fluconazole (Sequoia Research Products) was initiated at a starting concentration of 256 µg/ml

and diluted 2-fold per well, where the final well contained no fluconazole. When a constant

amount of doxycycline (DOX) was present, it was at a concentration of 1 µg/ml. Fluconazole

stock was prepared in ddH2O; DOX was prepared in ddH2O. Overnight cultures were diluted to

~103 cells/ml and used to inoculate wells to a final volume of 0.2 ml/well. Plates were wrapped

in foil and incubated at 30°C for 48 hrs. Final cell densities were determined by measuring OD

600 using a spectrophotometer (Molecular Devices). Data were plotted using Java Treeview

1.1.3. Susceptibility was assessed in duplicate for at least two biological replicates. To test

cidality, cells from the MIC plates were spotted on YPD agar plates using a spotter (Frogger,

V&P Scientific, Inc). Spots were photographed after 48hrs of incubations at 30°C.

2.4 Protein Quantification

2.4.1 Western

Saturated overnight yeast cultures were diluted and grown to mid-log phase in YPD at 30°C.

Cells were pelleted, washed with PBS, and resuspended in 200 μl of lysis buffer containing 50

mM Hepes pH 7.5, 150 mM NaCl, 5 mM EDTA, and 1% Triton. Cells were transferred to a 2

mL screw-cap tube filled with ~250 μl glass beads. Cells were disrupted by bead beating for 4

minutes. Total collected lysates were cleared by centrifugation for 10 minutes at 4°C and protein

concentrations were determined by Bradford analysis. Protein samples were mixed with one fifth

volume of 6X sample buffer, boiled for 5 minutes, and then separated on a 8% acrylamide SDS-

35

PAGE gel. Protein was electrotransferred to PVDF membrane (Bio-Rad Laboratories, Inc.) and

blocked with 5% skim milk in phosphate buffered saline with 0.1% tween 20. Blots were

hybridized with antibody against CaHsp90 (1:10000 dilution, (Burt, Daly et al. 2003)), Cdc28

(1:5000, anti-PSTAIRE, Santa Cruz Biotechnology, Santa Cruz, CA), Tub1 (1:5000, AbD

Serotec).

2.5 Hsp90 Function Assays

2.5.1 Growth Curve

Overnight cultures were diluted to ~103 cells/ml and used to inoculate wells to a final volume of

0.2 ml/well in 96-well microtiter plates (Sarstedt). Cells were grown in YPD at 30°C with and

without 65 µM of geldanamycin. Optical density measurements (OD600) were taken every 2

hours for 72 hours.

2.5.2 Glucocorticoid Receptor Activity Assay

Overnight S. cerevisiae cultures were diluted and grown to mid-log phase in SD at 30°C.

Cultures were then diluted to OD600 of 0.2 and added to 96-well microtiter plates (Sarstedt) at

50 µl per well. Cells were treated with or without 10µM deoxycorticosterone (Sigma D6875,

dissolved in ethanol) for 1 hour at 30°C while shaking. 100 µl of chlorophenol red-β-D-

galactopyranoside (CPRG) substrate (100 mM Hepes, 150 mM NaCl, 5 mM L-aspartate, 10 g/L

BSA, 0.05% Tween, 0.5% SDS, 1.2 mM CPRG (Roche 884308) dissolved in ddH2O, pH 7.25)

were added to each well and shaken at 20°C for 15 min. Absorption values were taken at OD578

using a spectrophotometer.

2.5.3 Calcineurin Activation

Overnight cultures were diluted and grown to mid-log phase in YPD at 30°C. Cells were

exposed to 200 mM CaCl2 for 30 min and immediately pelleted for RNA extraction, as described

below. Transcript levels of ENA1, RTA1, and PMC1 were monitored, referenced to ACT1.

36

2.6 Gene expression

2.6.1 RNA extraction

For determining RPD31 expression in KDAC mutants, overnight cultures were diluted and

grown to mid-log phase in YPD with or without 1 µg/ml of DOX. DOX treated cells were

exposed to DOX for at least 6 hours.

For determining expression of hyphal-specific genes in response to TSA, overnight cultures were

diluted and grown in YPD at 30 °C in the absence or presence of 6 or 24 μg/mL TSA for 6 hours.

RNA extraction was performed using a Qiagen RNeasy mini kit using following the protocol:

Frozen cell pellets were resuspended in 600 μL RLT lysis buffer containing β-mercaptoethanol

(BME) and 600 μL acid-washed silica beads in a 2 mL screw cap tube. Cells were mechanically

disrupted by bead-beating for 30 seconds for four cycles with 1 minute on ice between each

cycle. Lysate (~350 μL) was transferred to an eppendorf and centrifuged at max speed for 2

minutes. Lysate was transferred to a new eppendorf and 350 μL of 70% EtOH was added and

mixed gently before solution was added to a spin column and centrifuged at max speed for 15

seconds. Flow through was discarded and the column was washed with 350 μL of RW1 buffer

followed by two washes with 500 μL of RPE buffer. RNA was eluted from column with 87.5 μL

of RNAse free water and treated with RNasefree DNase (QIAGEN). Purified RNA was

immediately placed on ice or at -80°C for long-term storage. RNA concentration in samples was

determined by Nanodrop and 2μg of RNA was used for subsequent cDNA synthesis using the

AffinityScript Multi Temperature cDNA Synthesis Kit (Agilent Technologies). RNA samples

were only used for experiments if the RNA did not appear degraded when run on a 1% agarose

gel and visualized by ethidium bromide staining.

2.7 Microscopy

To determine the changes in C.albicans morphology in response to KDAC inhibition, overnight

cultures were diluted and grown in YPD at 30 °C in the absence or presence of 24 μg/mL TSA.

TSA treated cells were exposed to TSA for 6 hours. For determining cell morphology in KDAC

mutants, overnight cultures were diluted and grown to mid-log phase in YPD with or without 1

µg/ml of DOX. DOX treated cells were exposed to DOX for at least 6 hours. Imaging was

37

performed with differential interference contrast microscopy using a Zeiss Axio Imager.MI with

Axiovision software (Carl Zeiss) at 40x magnification.

38

3 Results

3.1 KDACs regulate azole resistance

3.1.1 Combined deletion of HDA1, HOS2, and RPD3, and doxycycline-

mediated transcriptional repression of RPD31 abrogate azole

resistance in the erg3Δ/erg3Δ mutant background.

To identify the KDAC(s) responsible for mediating azole resistance, Nicole Robbins generated

various KDAC deletion mutants in an erg3Δ/erg3Δ mutant background. Unlike in S. cerevisiae,

deletion of HDA1 and RPD3 did not phenocopy TSA and had no effect on azole resistance of C.

albicans erg3 mutants, implicating additional or alternate KDACs. Another candidate KDAC is

Hos2, which was identified as an Hsp90 genetic interactor in C. albicans based on

hypersensitivity of the hos2Δ/hos2Δ mutant to Hsp90 inhibitors under diverse growth conditions

(Diezmann, Michaut et al. 2012). Hos2 is likely to function upstream of Hsp90 regulating its

function given that Hos2 stability was not affected by depletion of Hsp90. Hos2 has also been

found to have a modest repressive effect on filamentation, providing an additional link between

Hos2 and phenotypes influenced by Hsp90 (Hnisz, Majer et al. 2010). Surprisingly, deletion of

all three of these KDACs had no impact on azole resistance of the erg3Δ/erg3Δ mutant.

Consistent with the possibility of additional functional redundancy, we identified a second

homolog of S. cerevisiae RPD3 in C. albicans, called RPD31. Nicole was unable to delete

RPD31 in the KDAC mutant backgrounds and thus constructed doxycycline (DOX)-repressible

RPD31 conditional expression strains. Replacing the native RPD31 promoter with the tetO

promoter had no impact on erg3-mediated azole resistance on its own or in the context of the

erg3Δ/erg3Δ hda1/hda1Δ rpd3Δ/rpd3Δ mutant, but abrogated azole resistance of the

erg3Δ/erg3Δ hda1/hda1Δ rpd3Δ/rpd3Δ hos2Δ/hos2Δ mutant in the presence of DOX. DOX-

mediated transcriptional repression of RPD31 in this background also caused a major growth

defect, which could explain the difficulty in generating the deletion mutant. I have confirmed

Nicole’s original phenotypic characterization of these strains using a fluconazole minimum

inhibitory concentration assay (Figure 1). These results indicate that the combined deletion of

HDA1, HOS2, RPD3, and DOX-mediated transcriptional repression of RPD31 abrogate azole

resistance in the erg3Δ/erg3Δ mutant background.

39

40

Figure 1. Azole resistance phenotypes of KDAC mutants. Left panel: Fluconazole MIC assays

were conducted in YPD medium without DOX (-) or with 1 µg/mL DOX. Growth was measured

by absorbance at 600 nm after 24 hours at 30°C. Optical densities were averaged for duplicate

measurements. Data was quantitatively displayed with colour using Treeview (see colour bar).

Right panel: combined deletion of HDA1, HOS2, and RPD3, and doxycycline-mediated

transcriptional repression of RPD31 creates a fungicidal combination with fluconazole. Cells

from the MIC assays were then spotted onto YPD medium plate without drug and incubated at

30°C for 48 hours to assess viability.

41

To validate that the observed phenotype was indeed due to depletion of RPD31, I complemented

the tetO-RPD31/rpd31Δ mutant strain by replacing the tetO promoter of RPD31 with the wild-

type promoter (WTp-RPD31). To confirm restoration of the wild-type phenotypes, I performed a

fluconazole minimum inhibitory concentration (MIC) assays in the presence and absence DOX

(Figure 1). The complemented strain regained fluconazole resistance and demonstrated the same

phenotype as the erg3Δ/erg3Δ hda1/hda1Δ rpd3Δ/rpd3Δ hos2Δ/hos2Δ strain, confirming that the

loss of fluconazole resistance is indeed due to depletion of RPD31 in the erg3Δ/erg3Δ

hda1/hda1Δ rpd3Δ/rpd3Δ hos2Δ/hos2Δ background.

I further performed cidality assays by spotting cells from the MIC plates onto solid medium

without drug and assaying for viability (Figure 1). This reveals the fungistatic nature of

fluconazole – while it was successful at inhibiting growth of wild-type fungal cells, the cells are

able to proliferate once they are removed from the drug. However, in the presence of DOX, the

erg3Δ/erg3Δ hda1/hda1Δ rpd3Δ/rpd3Δ hos2Δ/hos2Δ tetO-RPD31/rpd31Δ mutant strain was

hypersensitive to fluconazole. Even very low concentrations of fluconazole were fungicidal, as

shown by the lack of colony formation on solid agar following drug exposure. This is

reminiscent of the treatment with either the Hsp90 inhibitor geldanamycin or pan-specific KDAC

inhibitor TSA, which both created fungicidal combinations with fluconazole (Robbins, Leach et

al. 2012).

Notably, azole resistance was partially reduced in the KDAC depletion strain even in the absence

of DOX. This could reflect the insufficient expression of the RPD31 transcript by a single allele

in this background, or that the transcript is misregulated under the exogenous tetO promoter.

3.1.2 Doxycycline-mediated transcriptional repression of RPD31

confirmed with qRT-PCR.

To confirm appropriate regulation of RPD31 expression and to address the reason for the partial

reduction in azole resistance without DOX, I performed quantitative RT-PCR to monitor RPD31

transcript levels in various KDAC deletion mutants in the presence and absence of DOX (Figure

2). RPD31 transcript level was drastically down regulated in the erg3Δ/erg3Δ hda1/hda1Δ

rpd3Δ/rpd3Δ hos2Δ/hos2Δ tetO-RPD31/rpd31Δ mutant strain in the presence of DOX,

confirming appropriate DOX-dependent repression of RPD31 under the tetO promoter. RPD31

42

expression in the complemented strain was comparable to the erg3Δ/erg3Δ hda1/hda1Δ

rpd3Δ/rpd3Δ hos2Δ/hos2Δ RPD31/rpd31Δ strain with and without the addition of DOX,

confirming successful restoration of RPD31 expression by replacing the tetO promoter with the

WT promoter. RPD31 transcript level was overexpressed in the erg3Δ/erg3Δ hda1/hda1Δ

rpd3Δ/rpd3Δ hos2Δ/hos2Δ tetO-RPD31/rpd31Δ strain in the absence of DOX, which could

contribute to the partial reduction in azole resistance. This suggests that both over-expression and

repression of RPD31 can affect azole resistance in this context, and that RPD31 levels must be

carefully regulated in the cell.

43

Figure 2. RPD31 transcript level is repressed with doxycycline when under the control of

tetO-promoter, and restored with the complemented wild-type promoter. Strains were

grown in the absence (blue bars) or presence of 1 μg/mL DOX (red bars). RPD31 transcript

levels were normalized to GPD1. Data are means +/- standard error for triplicate samples.

44

3.1.3 Hda1, Rpd3, Hos2, and Rpd31 do not affect Hsp90 protein level.

Next, I performed Western analysis to determine whether these KDACs affect Hsp90 protein

level (Figure 3). Hsp90 protein level was not altered in the erg3Δ/erg3Δ hda1/hda1Δ

rpd3Δ/rpd3Δ hos2Δ/hos2Δ tetO-RPD31/rpd31Δ mutant strain in the presence of DOX compared

to the wild-type strain, indicating these KDACs do not regulate Hsp90 protein expression or

stability. This is consistent with the previous finding that shows pharmacological KDAC

inhibition by TSA impaired Hsp90 protein function, but did not reduce Hsp90 transcript or

protein levels (Robbins, Leach et al. 2012).

45

Figure 3. Hda1, Rpd3, Hos2, and Rpd31 do not affect Hsp90 protein level. Strains were

grown to log phase in the absence or presence of 1 μg/mL DOX. Cdc28 protein level and

Ponceau S stain are used to ensure equivalent amount of protein was loaded per sample.

46

3.1.4 Contribution of KDACs to azole resistance is not limited to the erg3Δ/erg3Δ mutant background.

To ensure that the KDAC dependent azole resistance I observed is not restricted to the

erg3Δ/erg3Δ mutant background, I generated ERG3 complementation strains of a number of key

KDAC mutants. By re-introducing the wild-type ERG3 allele to the erg3Δ/erg3Δ mutant

background, I was able to effectively test the impact of KDAC depletion on basal fluconazole

tolerance of cells with functional Erg3. The complemented erg3Δ/erg3Δ+ERG3 strain regained

azole sensitivity and displayed growth similar to that of a wild-type strain, confirming the proper

function of the introduced ERG3 allele. As before, the hda1/hda1Δ rpd3Δ/rpd3Δ hos2Δ/hos2Δ

tetO-RPD31/rpd31Δ mutant showed partial increase in azole sensitivity even in the absence of

DOX, indicated by reduced growth at concentrations above the MIC. However, based on the

spotting assay for cidality, it is clear that the cells are still viable. Combined deletion of HDA1,

HOS2, and RPD3, and doxycycline-mediated transcriptional repression of RPD31 creates a

fungicidal combination with fluconazole (Figure 4), as indicated by the lack of colony formation

in spotting assays even after 48hrs of incubation, confirming that the contribution of KDAC to

azole resistance is not limited to the erg3Δ/erg3Δ mutant background but rather a general

phenomenon.

47

Figure 4. Azole susceptibility phenotypes of KDAC mutants. Left panel: Fluconazole MIC

assays were conducted in YPD medium without DOX (-) or with 1 µg/mL DOX. Growth was

measured by absorbance at 600 nm after 72 hours at 30°C. Optical densities were averaged for

duplicate measurements. Data was quantitatively displayed with colour using Treeview (see

colour bar). Right panel: combined deletion of HDA1, HOS2, and RPD3, and doxycycline-

mediated transcriptional repression of RPD31 creates a fungicidal combination with fluconazole.

Cells from the MIC assays were then spotted onto YPD medium plate without drug and

incubated at 30°C for 48 hours to assess viability.

48

3.2 Characterizing C. albicans Hsp90 acetylation mutants in S. cerevisiae.

3.2.1 Generating Hsp90 acetylation mutants in S. cerevisiae

To test the connection between KDAC mediated loss of azole resistance and Hsp90, and

understand how the acetylation status of C. albicans Hsp90 affects its function, I aimed to make

Hsp90 acetylation mutants. I began by attempting to identify the critical acetylation sites on

Hsp90 that are responsible for azole resistance in C. albicans. The two candidate residues that I

focused on were lysine residues K30 and K271. Changes in acetylation status of the

corresponding residues were found to affect Hsp90 function in both S. cerevisiae and the

pathogenic mold Aspergillus fumigatus (Robbins, Leach et al. 2012, Lamoth, Juvvadi et al.

2014). Thus, I tried to generate acetylation mimic (lysine to glutamine, K30Q and K271Q) and

deacetylation mimic (lysine to arginine, K30R and K271R) mutations for these Hsp90 residues

either individually or combined.

However, after months of trying different cloning and transformation techniques, including using

various strain backgrounds, changing the order of how each construct is introduced to the cell, as

well as using constitutive or conditional expression systems, I was not able to introduce these

mutations in C. albicans without amplification of a wild-type HSP90 allele. Ultimately, I turned

to the model yeast S. cerevisiae, which has many more genetic tools available compared to C.

albicans, as well as the ability to maintain plasmids. In S. cerevisiae, Hsp90 is encoded by two

nearly identical genes, HSC82 and HSP82. We obtained a strain that carries a copy of HSC82 on

a plasmid as the only source of Hsp90 in the cell (Nathan and Lindquist 1995). Using a plasmid

shuffling technique, I introduced expression plasmids that contained either the wild-type C.

albicans HSP90 (CaHSP90) or the various acetylation mutant CaHSP90 genes. Transformants

were then allowed to lose the original plasmid containing HSC82 (ScHSP90), generating S.

cerevisiae strains that rely on CaHSP90 as the only source of Hsp90.

3.2.2 Acetylation mutations on Hsp90 do not affect protein expression or

stability.

First, I examined CaHsp90 proteins levels in these strains by performing Western blots (Figure

5). Acetylation mutations at either one or both candidate residues did not alter Hsp90 protein

49

levels relative to the wild type, indicating these mutations do not affect the expression or stability

of the protein.

50

Figure 5. Acetylation mutations do not affect Hsp90 protein level. Western performed on S.

cerevisiae strains carrying either the wild-type or various acetylation mutant versions of C.

albicans HSP90. Proteins were extracted from log phase growing cells. Tubulin level is used as

loading control.

51

3.2.3 Acetylation mutations in Hsp90 result in hypersensitivity to Hsp90

inhibition.

Next, I went on to look at whether these mutations affected Hsp90 protein function. Based on

results from S. cerevisiae, I anticipated that impairing the ability of Hsp90 to cycle between

acetylated and de-acetylated states might impair Hsp90 function and cause hypersensitivity to

Hsp90 inhibition (Robbins, Leach et al. 2012). I tested this hypothesis by growing the various

mutants in the presence and absence of the pharmacological Hsp90 inhibitor geldanamycin

(Figure 6). In YPD rich medium, strains carrying either the wild-type or mutant versions of

CaHSP90 showed comparable growth to the strain carrying wild-type ScHSP90, indicating that

both wild-type and acetylation mutant CaHSP90 is able to support robust growth in S. cerevisiae.

In the presence of geldanamycin, the strain carrying wild-type CaHSP90 grew worse than the

strain carrying wild-type ScHSP90, suggesting that exogenous CaHSP90 is not able to fully

compensate for the function of endogenous ScHSP90. Strains with a single acetylation mutation

at either K30 or K271 were hypersensitive to geldanamycin, and the phenotype was exacerbated

when both residues were mutated. This suggests that the acetylation status of both K30 and K271

influences Hsp90 function. Importantly, the geldanamycin hypersensitivity was seen with both

the acetylation mimic and the deacetylation mimic mutants, indicating that neither the acetylated

nor the deacetylated form is sufficient, but rather the proper cycling of the post-translational

modification is required.

52

Figure 6. Acetylation mutations result in hypersensitivity to Hsp90 inhibition. Area under

the curve calculated for growth curves over 72hrs at 30°C in YPD rich medium with or without

geldanamycin. Growth was measured by absorbance at 600 nm.

53

3.2.4 Acetylation mutations on Hsp90 impair glucocorticoid receptor

activity.

Next, I tested the activity of various known client proteins of Hsp90 to assess the impact of K30

and K271 on Hsp90 client protein function. First, I examined the effect of Hsp90 acetylation on

glucocorticoid receptor (GR) activation. GR is a well characterized Hsp90 client protein in

mammals, and it has been used extensively in yeast as a reporter of Hsp90 function (Pratt,

Galigniana et al. 2004). I transformed my acetylation mutant strains with a plasmid that contains

the mouse GR under the control of a constitutive promoter as well as a lacZ reporter gene under

the control of glucocorticosteroid response elements (Nathan and Lindquist 1995). When Hsp90

is functional and can assist in proper folding of GR, addition of the hormone deoxycorticosterone

leads to activation of GR, allowing it to translocate to the nucleus and bind to response elements

in the promoter of its target genes, thereby activating their transcription. Testing GR activation in

response to deoxycorticosterone in the acetylation mutants revealed a similar trend as the

geldanamycin sensitivity assay (Figure 7). Strains carrying CaHSP90 showed reduced activation

compared to strain carrying wild-type ScHSP90. Acetylation mutations resulted in various

degrees of reduced GR activation compared to the wild-type CaHSP90, with the double mutants

having the most severe phenotype. This is consistent with the previous observation that the

proper regulation of acetylation states at both K30 and K271 are critical for Hsp90 function.

54

Figure 7. Hsp90 acetylation mutations impair glucocorticoid receptor activity. Log phase

cells were diluted to OD600 of 0.2 and grown for 1 hour in YPD at 30°C with or without 10 µM

deoxycorticosterone. β-galactosidase activity was measured by incubating the cells for 15 min

with CPRG substrate, and taking absorbance at 578 nm. Fold induction was calculated by taking

the ratio of the deoxycorticosterone induced cells over the uninduced.

55

3.2.5 Acetylation mutations on Hsp90 do not impair calcineurin activity.

I then tested whether acetylation mutations on Hsp90 affected the function of the client protein

phosphatase calcineurin. Normally, upon activation in response to calcium, calcineurin

dephosphorylates the transcription factor Crz1 to drive expression of its target genes containing

calcineurin-dependent response elements in their promoters. When Hsp90 function is

compromised, it can no longer bind and stabilize calcineurin to keep it poised for activation, and

the activation is therefore blocked. Previous gene expression analyses have identified a number

of genes that are faithfully upregulated in a calcineurin/Crz1 dependent manner in S. cerevisiae

upon calcium activation, including ENA1, RTA1, and PMC1 (Karababa, Valentino et al. 2006). I

used qualitative RT-PCR to monitor the transcript of these genes in the various Hsp90

acetylation mutants after exposure to calcium chloride (Figure 8). While all three genes tested

showed robust increase in expression following treatment, no consistent decrease in activation

was observed for the various acetylation mutant strains compared to the wild-type CaHSP90

strain, and no clear trend can be seen between the single and the double acetylation mutants. This

suggests that the acetylation states at K30 and K271 on Hsp90 do not have a major effect on

Hsp90’s ability to chaperone calcineurin.

The fact that acetylation mutants of Hsp90 had impaired GR activation but had no major defect

in calcineurin activity suggests that Hsp90 acetylation may have distinct effects on different

client proteins. This would be consistent with previous finding for regulation of S. cerevisiae

Hsp90 by acetylation (Robbins, Leach et al. 2012), and phosphorylation (Mollapour, Tsutsumi et

al. 2010).

56

57

Figure 8. Hsp90 acetylation mutations do not impair calcineurin function. Transcript levels

of known calcineurin target genes ENA1, PMC1, and RTA1 were determined by qRT-PCR. Log

phase cells were treated with either blank or 200 mM calcium chloride for 30 min before RNA

extractions. Data are means +/- standard error for triplicate samples. *, p<0.05 compared to

Sc+CaHSP90 for strains with Hsp90 acetylation mutations.

58

3.3 Role of KDACs in C. albicans Morphogenesis

C. albicans is a polymorphic organism, and the transition between yeast and filamentous forms is

crucial for virulence, as mutants locked in either form are generally avirulent (Shapiro, Robbins

et al. 2011). Our lab has shown that compromising Hsp90 function induces a switch from yeast

to filamentous growth (Shapiro, Uppuluri et al. 2009). Since Hsp90 acetylation state is an

important determinant of its function, KDACs are expected to play a role in morphogenesis.

3.3.1 KDAC inhibition induces pseudohyphal morphology

First, to explore the connection between KDACs and filamentaton, I grew cells in the presence

of TSA and observed their morphology (Figure 9). Treatment with TSA consistently induced

pseudohyphal morphology in C. albicans. This is distinct from the filamentation phenotype

induced by Hsp90 inhibition (Shapiro, Uppuluri et al. 2009, Senn, Shapiro et al. 2012, Shapiro,

Sellam et al. 2012). While it does provide a link between KDACs and phenotypes influenced by

Hsp90, it also suggests that KDACs have additional targets that also influence morphogenesis.

In an independent approach to quantify changes in cell morphology, I monitored the transcript

levels of filament-specific genes by performing qRT-PCR on wild-type C. albicans treated with

low or high doses of TSA (Figure 10). Multiple filament-specific genes were included in my

analysis. As expected, the transcript level of all filament-specific genes tested increased in the

presence of TSA, and the effect was even stronger with the higher drug concentration. This

shows that KDAC inhibition does indeed lead to a shift towards filamentous growth, and

validates that these genes can be used as representative reporter genes for assessing

morphogenesis in this context.

59

Figure 9. KDAC inhibition induces pseudohyphal morphology. Strains were grown in liquid

rich medium at 30 °C in the absence or presence of 24 μg/mL TSA. Images are representative

fields of view.

60

Figure 10. KDAC inhibition results in increased expression of hyphal specific genes. Wild-

type C. albicans cells were grown in liquid rich medium at 30 °C in the absence or presence of 6

or 24 μg/mL TSA for 6 hours. HWP1, ECE1, HGC1, and UME6 transcript levels were

normalized to GPD1. Data are means +/- standard deviations for triplicate samples. *, p<0.005

compared to the YP only condition.

61

3.3.2 Combined deletion of HDA1, RPD3, and HOS2, and depletion of

RPD31 results in pseudohyphae formation

Next, I wanted to determine which KDACs are responsible for mediating the TSA induced

pseudohyphal morphology. While the KDAC deletion strains were initially generated in the

erg3Δ/erg3Δ background to assess their effects on azole resistance, they are not appropriate for

morphogenesis analyses, as erg3 loss of function has been associated with impaired

filamentation. Using the various KDAC mutant strains complemented with the wild-type allele

of ERG3, I investigated the effects of these KDACs on morphogenesis (Figure 11a). Cells

became more pseudohyphal as more KDACs are deleted. The hda1/hda1Δ rpd3Δ/rpd3Δ

hos2Δ/hos2Δ tetO-RPD31/rpd31Δ strain was the most pseudohyphal in both the absence or

presence of DOX, similar to TSA treated wild-type cells (Figure 11a, Figure 9).

I also monitored the changes in cell morphology by quantifying the transcript level of hyphal cell

wall protein Hwp1 through qRT-PCR (Figure 11b). The hda1/hda1Δ rpd3Δ/rpd3Δ hos2Δ/hos2Δ

tetO-RPD31/rpd31Δ strain displayed the highest level of HWP1 transcript in both the absence

and presence of DOX, confirming the microscopy results. The increased filamentation in the

absence of DOX in this strain is likely attributed to the overexpression of RPD31 under the tetO

promoter (Figure 2), reminiscent of the increased azole sensitivity under the same condition

(Figure 1, Figure 4), and once again highlight the importance of proper regulation of RPD31.

The RPD31 promoter complemented strain had similar morphology and HWP1 expression as the

hda1/hda1Δ rpd3Δ/rpd3Δ hos2Δ/hos2Δ RPD31/rpd31Δ strain, confirming that the filamentous

phenotype is indeed due to the replacement of the native RPD31 promoter with the tetO

promoter in the hda1/hda1Δ rpd3Δ/rpd3Δ hos2Δ/hos2Δ background. These results indicate that

Hda1, Hos2, Rpd3, and Rpd31 together regulate KDAC-dependent morphogenesis.

62

63

Figure 11. Combined deletion of HDA1, RPD3, and HOS2, and depletion of RPD31

enhances filamentation. A. DIC microscopy images of strains grown in liquid rich medium at

30°C in the absence or presence of 1 μg/mL DOX for 6 hours. Images are representative fields of

view. B. Cells grown in the same condition were used for quantitative RT-PCR. HWP1 transcript

levels were normalized to GPD1. Data are means +/- standard deviations for triplicate samples.*,

p<0.005 compared to the wild-type in the same condition.

64

4 Discussion

4.1 Summary of Findings and Discussion

My work established Hda1, Rpd3, Hos2, and Rpd31 as key KDACs regulating azole resistance

in C. albicans. Together, the loss of these four KDACs abrogated resistance and basal tolerance

of azoles, recapitulating the effect of inhibition of KDACs or Hsp90 (Figure 1, Figure 4). The

effect of KDACs on Hsp90 is likely through altering chaperone function, as Hsp90 protein levels

were unchanged (Figure 3). K30 and K271 are critical acetylation sites on CaHSP90, as

mutations that mimic acetylation or deacetylation at these residues resulted in impaired Hsp90

function, shown by the increased sensitivity to Hsp90 inhibitor (Figure 6). Both K30 and K271

appear to be making independent contributions to Hsp90 regulation, as mutations of both sites

resulted in a more severe phenotype than either of the single mutations alone. This led to a defect

in the activity of GR (Figure 7), but had no effect on the activation of calcineurin dependent

genes (Figure 8), suggesting that Hsp90 acetylation might be differentially regulating a specific

subset of its client proteins. The same four KDACs also resulted in a stable pseudohyphal

morphology (Figure 11), consistent with exposure to TSA (Figure 9, Figure 10).

KDACs have been previously implicated in azole resistance. TSA was the first KDAC inhibitor

that was demonstrated to increase susceptibility to azoles, and this effect to initially largely

attributed to its effect on gene expression (Smith and Edlind 2002). A fungal specific inhibitor of

Hos2 activity has also been shown to be synergistic with azoles in multiple fungal pathogens,

including C. albicans (Pfaller, Messer et al. 2009). More recently, in a different strain

background, deletion of either Rpd3 or Hda1 alone was able to enhance the efficacy of azoles

(Li, Cai et al. 2015). All of these results support the contribution of KDACs to azole resistance.

In this study, I showed that it is actually the combined loss of four KDACs – Hda1, Rpd3, Hos2,

and Rpd31 – that is required to abrogate azole resistance. The fact that all four KDACs had to be

depleted before loss of resistance is observed demonstrates the surprisingly high level of

functional redundancy among the fungal KDACs. These KDACs function in distinct complexes,

and previous work in S. cerevisiae typically demonstrates a division of labour, with the KDACs

carrying out largely non-overlapping functions, both in terms of regulation of gene expression

and general protein acetylation (Robyr, Suka et al. 2002, Kaluarachchi Duffy, Friesen et al.

2012). Here, my results suggest they have overlapping roles in azole resistance, and could

65

compensate for the loss of each other through their functional redundancy, well enough for the

cell to survive the effect of the antifungal.

In all three Hsp90 functional assays tested, the acetylation mimic (K to Q) and deacetylation

mimic (K to R) mutations yielded similar phenotypes. When a defect is present, such as during

growth in geldanamycin or GR activation, the severity was similar regardless whether the residue

was mimicking the acetylated or deacetylated state. This suggest that it is not the acetylation

state of the residue that matters, but rather the ability to cycle between the acetylated and the

deacetylated forms that’s critical for proper Hsp90 function. This is not a new concept. Hsp90

chaperone cycle is an incredibly dynamic process, where it associated and dissociates with co-

chaperones and client proteins as it is pushed through the cycle with ATP hydrolysis (Taipale,

Jarosz et al. 2010, Li, Soroka et al. 2012). Similarly, CK2 is known to phosphorylate Hsp90 at

threonine 22 (Mollapour, Tsutsumi et al. 2011). In this case, both the phosphomimic mutants and

mutants that cannot be phosphorylated destabilize its client kinases and alter GR activity

(Mollapour, Tsutsumi et al. 2011), suggesting that the ability to cycle between phospho states is

key for proper Hsp90 function.

Differential regulation of client proteins appears to be a common theme with post-translational

modifications that regulate Hsp90 function. For example, in S. cerevisiae, compromising

phosphorylation of Hsp90 by Swe1 resulted in destabilization of client kinases, but did not affect

GR activation (Mollapour, Tsutsumi et al. 2010). Similarly, acetylation of Hsp90 in S. cerevisiae

regulates calcineurin activation, the heat shock response, and GR activation, but had no effect on

v-Src-induced toxicity (Robbins, Leach et al. 2012). In my study, I showed that acetylation of

Candida Hsp90 modulates the activity of GR, but did not impair calcineurin activity, again

demonstrating selectivity. Interestingly, calcineurin activity has been shown to be blocked by

TSA in C. albicans (Robbins, Leach et al. 2012), which suggests that calcineurin function is

indeed modulated by Hsp90 acetylation. One possible explanation for the apparent disparity seen

here it that there are additional Hsp90 acetylation sites apart from K30 and K271 that are

mediating Hsp90 interaction with calcineurin, such that substitution of K30 and K271 is not

sufficient to recapitulate the effects of TSA on calcineurin function.

66

4.2 Future Directions

In this study, using the GR reporter and calcineurin activity, I demonstrated that Hsp90

acetylation is likely regulating Hsp90 function in enabling activation of a selected subset of

client proteins. However, the precise mechanisms that underlie this selectivity and the members

of this specific subset remain elusive. Future experiments should take an unbiased approached to

investigate the global effect of Hsp90 acetylation state on all Hsp90 clients and how it shifts the

Hsp90 chaperone network. One approach is to compare the physical interactors of Hsp90 in the

wild type vs. acetylation mutant strains using mass spectrometry. Determining interactors that

are specifically gained or lost in the acetylation mutant strains could provide a much more

comprehensive list of clients influenced by Hsp90 acetylation. This approach also allows us to

probe whether acetylation alters Hsp90’s interaction with its co-chaperones. Hsp90 has multiple

co-chaperones that help provide specificity in terms of client proteins, as co-chaperones can

modulate Hsp90 interaction with specific subsets of clients (Taipale, Jarosz et al. 2010). Loss of

interaction with a single co-chaperone could mean the loss of proper regulation for all the clients

recognized by that particular co-chaperone. Comparison should also be made between the

different acetylation mutants as well to assess the independent contributions to client regulation

by different acetylation sites on Hsp90. Together, these can provide valuable insights into Hsp90

regulation by acetylation, and reveal which downstream effectors are mediating the KDAC

mediated loss of azole resistance.

While much of my work focused on Hsp90 mediated effects of KDACs, it is important to

recognize that the KDACs likely influence azole resistance and morphogenesis through other

mechanisms as well. KDACs play a major role in epigenetics and regulation of gene expression

by controlling acetylation state of histones (Kurdistani and Grunstein 2003). Depending on the

identity of the KDAC and the regulation of its target genes, this could have profound effects on

C. albicans biology. To fully appreciate the effect of KDACs, it would be beneficial to identify

and characterize additional targets of KDACs that are important for azole resistance and

morphogenesis. Gene expression studies could be performed with the various mutants to identify

genes only modulated in the higher order mutant that has azole sensitivity and pseudohyphal

phenotypes. This could also reveal level of functional redundancy in terms of regulation of gene

expression. Alternatively, this could be done in an unbiased approach by screening through

various available libraries of C. albicans mutants, and search for mutants that no longer filaments

67

in response to KDAC inhibition, which would indicate their requirement in KDAC-dependent

morphogenesis.

Given the connection between Hsp90 and C. albicans pathogenicity, it would be valuable to

know how Hsp90 acetylation affects C. albicans virulence in animal models of infection. In A.

fumigatus, strains carrying an acetylation mutant version of Hsp90 showed a significant decrease

in virulence in a murine model of inhalational invasive aspergillosis (Lamoth, Juvvadi et al.

2014). A similar experiment could be conducted with Candida Hsp90 acetylation mutants in a

murine model of disseminated candidiasis. This would provide a direct test of the potential

efficacy of a KDAC inhibitor in an in vivo system.

Overall, by investigating the circuitry through which KDACs regulate drug resistance and

morphogenesis, my work provides important insights into the regulatory network of C. albicans

Hsp90, and suggests new targets for treating life-threatening fungal infections.

68

References

Anderson, J. B. (2005). "Evolution of antifungal-drug resistance: mechanisms and pathogen

fitness." Nat Rev Microbiol 3(7): 547-556.

Arbour, M., E. Epp, H. Hogues, A. Sellam, C. Lacroix, J. Rauceo, A. Mitchell, M. Whiteway and

A. Nantel (2009). "Widespread occurrence of chromosomal aneuploidy following the routine

production of Candida albicans mutants." FEMS Yeast Res 9(7): 1070-1077.

Asmundsdottir, L. R., H. Erlendsdottir, G. Haraldsson, H. Guo, J. Xu and M. Gottfredsson

(2008). "Molecular epidemiology of candidemia: evidence of clusters of smoldering nosocomial

infections." Clin Infect Dis 47(2): e17-24.

Berman, J. (2006). "Morphogenesis and cell cycle progression in Candida albicans." Curr Opin

Microbiol 9(6): 595-601.

Blankenship, J. R. and A. P. Mitchell (2006). "How to build a biofilm: a fungal perspective."

Curr Opin Microbiol 9(6): 588-594.

Borkovich, K. A., F. W. Farrelly, D. B. Finkelstein, J. Taulien and S. Lindquist (1989). "hsp82 is

an essential protein that is required in higher concentrations for growth of cells at higher

temperatures." Mol Cell Biol 9(9): 3919-3930.

Bouchonville, K., A. Forche, K. E. Tang, A. Selmecki and J. Berman (2009). "Aneuploid

chromosomes are highly unstable during DNA transformation of Candida albicans." Eukaryot

Cell 8(10): 1554-1566.

Braun, B. R., W. S. Head, M. X. Wang and A. D. Johnson (2000). "Identification and

characterization of TUP1-regulated genes in Candida albicans." Genetics 156(1): 31-44.

Brown, G. D., D. W. Denning, N. A. Gow, S. M. Levitz, M. G. Netea and T. C. White (2012).

"Hidden killers: human fungal infections." Sci Transl Med 4(165): 165rv113.

Bruno, V. M. and A. P. Mitchell (2005). "Regulation of azole drug susceptibility by Candida

albicans protein kinase CK2." Mol Microbiol 56(2): 559-573.

Cannon, R. D., E. Lamping, A. R. Holmes, K. Niimi, P. V. Baret, M. V. Keniya, K. Tanabe, M.

Niimi, A. Goffeau and B. C. Monk (2009). "Efflux-mediated antifungal drug resistance." Clin

Microbiol Rev 22(2): 291-321, Table of Contents.

Carlisle, P. L., M. Banerjee, A. Lazzell, C. Monteagudo, J. L. Lopez-Ribot and D. Kadosh

(2009). "Expression levels of a filament-specific transcriptional regulator are sufficient to

determine Candida albicans morphology and virulence." Proc Natl Acad Sci U S A 106(2): 599-

604.

CDC (2013). Antibiotic resistance threats in the United States, 2013. Centres for Disease Control

and Prevention, Atlanta, U.S. Deparment of Health and Human Services. .

69

Cowen, L. E., A. E. Carpenter, O. Matangkasombut, G. R. Fink and S. Lindquist (2006).

"Genetic architecture of Hsp90-dependent drug resistance." Eukaryot Cell 5(12): 2184-2188.

Cowen, L. E. and S. Lindquist (2005). "Hsp90 potentiates the rapid evolution of new traits: drug

resistance in diverse fungi." Science 309(5744): 2185-2189.

Cowen, L. E., S. D. Singh, J. R. Kohler, C. Collins, A. K. Zaas, W. A. Schell, H. Aziz, E.

Mylonakis, J. R. Perfect, L. Whitesell and S. Lindquist (2009). "Harnessing Hsp90 function as a

powerful, broadly effective therapeutic strategy for fungal infectious disease." Proc Natl Acad

Sci U S A 106(8): 2818-2823.

Cruz, M. C., A. L. Goldstein, J. R. Blankenship, M. Del Poeta, D. Davis, M. E. Cardenas, J. R.

Perfect, J. H. McCusker and J. Heitman (2002). "Calcineurin is essential for survival during

membrane stress in Candida albicans." EMBO J 21(4): 546-559.

Denning, D. W. and W. W. Hope (2010). "Therapy for fungal diseases: opportunities and

priorities." Trends Microbiol 18(5): 195-204.

Diezmann, S., M. Michaut, R. S. Shapiro, G. D. Bader and L. E. Cowen (2012). "Mapping the

Hsp90 genetic interaction network in Candida albicans reveals environmental contingency and

rewired circuitry." PLoS Genet 8(3): e1002562.

Dokmanovic, M., C. Clarke and P. A. Marks (2007). "Histone deacetylase inhibitors: overview

and perspectives." Mol Cancer Res 5(10): 981-989.

Douglas, L. J. (2003). "Candida biofilms and their role in infection." Trends Microbiol 11(1):

30-36.

Dunkel, N., J. Blass, P. D. Rogers and J. Morschhauser (2008). "Mutations in the multi-drug

resistance regulator MRR1, followed by loss of heterozygosity, are the main cause of MDR1

overexpression in fluconazole-resistant Candida albicans strains." Mol Microbiol 69(4): 827-

840.

Dunkel, N., T. T. Liu, K. S. Barker, R. Homayouni, J. Morschhauser and P. D. Rogers (2008).

"A gain-of-function mutation in the transcription factor Upc2p causes upregulation of ergosterol

biosynthesis genes and increased fluconazole resistance in a clinical Candida albicans isolate."

Eukaryot Cell 7(7): 1180-1190.

Eggimann, P., J. Garbino and D. Pittet (2003). "Epidemiology of Candida species infections in

critically ill non-immunosuppressed patients." Lancet Infect Dis 3(11): 685-702.

Ellepola, A. N. and C. J. Morrison (2005). "Laboratory diagnosis of invasive candidiasis." J

Microbiol 43 Spec No: 65-84.

Ene, I. V. and R. J. Bennett (2014). "The cryptic sexual strategies of human fungal pathogens."

Nat Rev Microbiol 12(4): 239-251.

Enjalbert, B. and M. Whiteway (2005). "Release from quorum-sensing molecules triggers hyphal

formation during Candida albicans resumption of growth." Eukaryot Cell 4(7): 1203-1210.

70

Felk, A., M. Kretschmar, A. Albrecht, M. Schaller, S. Beinhauer, T. Nichterlein, D. Sanglard, H.

C. Korting, W. Schafer and B. Hube (2002). "Candida albicans hyphal formation and the

expression of the Efg1-regulated proteinases Sap4 to Sap6 are required for the invasion of

parenchymal organs." Infect Immun 70(7): 3689-3700.

Finkel, J. S. and A. P. Mitchell (2011). "Genetic control of Candida albicans biofilm

development." Nat Rev Microbiol 9(2): 109-118.

Ford, C. B., J. M. Funt, D. Abbey, L. Issi, C. Guiducci, D. A. Martinez, T. Delorey, B. Y. Li, T.

C. White, C. Cuomo, R. P. Rao, J. Berman, D. A. Thompson and A. Regev (2015). "The

evolution of drug resistance in clinical isolates of Candida albicans." Elife 4: e00662.

Ghannoum, M. A. and L. B. Rice (1999). "Antifungal agents: mode of action, mechanisms of

resistance, and correlation of these mechanisms with bacterial resistance." Clin Microbiol Rev

12(4): 501-517.

Gietz, R. D. and R. A. Woods (2002). "Transformation of yeast by lithium acetate/single-

stranded carrier DNA/polyethylene glycol method." Methods Enzymol 350: 87-96.

Gomez-Lopez, A., O. Zaragoza, J. L. Rodriguez-Tudela and M. Cuenca-Estrella (2008).

"Pharmacotherapy of yeast infections." Expert Opin Pharmacother 9(16): 2801-2816.

Gow, N. A., A. J. Brown and F. C. Odds (2002). "Fungal morphogenesis and host invasion."

Curr Opin Microbiol 5(4): 366-371.

Gow, N. A. and B. Hube (2012). "Importance of the Candida albicans cell wall during

commensalism and infection." Curr Opin Microbiol 15(4): 406-412.

Hamamoto, R., G. Toyokawa, M. Nakakido, K. Ueda and Y. Nakamura (2014). "SMYD2-

dependent HSP90 methylation promotes cancer cell proliferation by regulating the chaperone

complex formation." Cancer Lett 351(1): 126-133.

Hedges, S. B., J. E. Blair, M. L. Venturi and J. L. Shoe (2004). "A molecular timescale of

eukaryote evolution and the rise of complex multicellular life." BMC Evol Biol 4: 2.

Heilmann, C. J., S. Schneider, K. S. Barker, P. D. Rogers and J. Morschhauser (2010). "An

A643T mutation in the transcription factor Upc2p causes constitutive ERG11 upregulation and

increased fluconazole resistance in Candida albicans." Antimicrob Agents Chemother 54(1):

353-359.

Hickman, M. A., G. Zeng, A. Forche, M. P. Hirakawa, D. Abbey, B. D. Harrison, Y. M. Wang,

C. H. Su, R. J. Bennett, Y. Wang and J. Berman (2013). "The 'obligate diploid' Candida albicans

forms mating-competent haploids." Nature 494(7435): 55-59.

Hnisz, D., O. Majer, I. E. Frohner, V. Komnenovic and K. Kuchler (2010). "The Set3/Hos2

histone deacetylase complex attenuates cAMP/PKA signaling to regulate morphogenesis and

virulence of Candida albicans." PLoS Pathog 6(5): e1000889.

71

Holmes, A. R., Y. H. Lin, K. Niimi, E. Lamping, M. Keniya, M. Niimi, K. Tanabe, B. C. Monk

and R. D. Cannon (2008). "ABC transporter Cdr1p contributes more than Cdr2p does to

fluconazole efflux in fluconazole-resistant Candida albicans clinical isolates." Antimicrob

Agents Chemother 52(11): 3851-3862.

Homann, O. R., J. Dea, S. M. Noble and A. D. Johnson (2009). "A phenotypic profile of the

Candida albicans regulatory network." PLoS Genet 5(12): e1000783.

Horn, D. L., D. Neofytos, E. J. Anaissie, J. A. Fishman, W. J. Steinbach, A. J. Olyaei, K. A.

Marr, M. A. Pfaller, C. H. Chang and K. M. Webster (2009). "Epidemiology and outcomes of

candidemia in 2019 patients: data from the prospective antifungal therapy alliance registry." Clin

Infect Dis 48(12): 1695-1703.

Hube, B. (2004). "From commensal to pathogen: stage- and tissue-specific gene expression of

Candida albicans." Curr Opin Microbiol 7(4): 336-341.

Hull, C. M., R. M. Raisner and A. D. Johnson (2000). "Evidence for mating of the "asexual"

yeast Candida albicans in a mammalian host." Science 289(5477): 307-310.

Jain, P., I. Akula and T. Edlind (2003). "Cyclic AMP signaling pathway modulates susceptibility

of Candida species and Saccharomyces cerevisiae to antifungal azoles and other sterol

biosynthesis inhibitors." Antimicrob Agents Chemother 47(10): 3195-3201.

Kaluarachchi Duffy, S., H. Friesen, A. Baryshnikova, J. P. Lambert, Y. T. Chong, D. Figeys and

B. Andrews (2012). "Exploring the yeast acetylome using functional genomics." Cell 149(4):

936-948.

Kanafani, Z. A. and J. R. Perfect (2008). "Antimicrobial resistance: resistance to antifungal

agents: mechanisms and clinical impact." Clin Infect Dis 46(1): 120-128.

Karababa, M., E. Valentino, G. Pardini, A. T. Coste, J. Bille and D. Sanglard (2006). "CRZ1, a

target of the calcineurin pathway in Candida albicans." Mol Microbiol 59(5): 1429-1451.

Kelly, S. L., D. C. Lamb, D. E. Kelly, N. J. Manning, J. Loeffler, H. Hebart, U. Schumacher and

H. Einsele (1997). "Resistance to fluconazole and cross-resistance to amphotericin B in Candida

albicans from AIDS patients caused by defective sterol delta5,6-desaturation." FEBS Lett

400(1): 80-82.

Kumamoto, C. A. and M. D. Vinces (2005). "Contributions of hyphae and hypha-co-regulated

genes to Candida albicans virulence." Cell Microbiol 7(11): 1546-1554.

Kurdistani, S. K. and M. Grunstein (2003). "Histone acetylation and deacetylation in yeast." Nat

Rev Mol Cell Biol 4(4): 276-284.

LaFayette, S. L., C. Collins, A. K. Zaas, W. A. Schell, M. Betancourt-Quiroz, A. A. Gunatilaka,

J. R. Perfect and L. E. Cowen (2010). "PKC signaling regulates drug resistance of the fungal

pathogen Candida albicans via circuitry comprised of Mkc1, calcineurin, and Hsp90." PLoS

Pathog 6(8): e1001069.

72

Lamb, D. C., D. E. Kelly, T. C. White and S. L. Kelly (2000). "The R467K amino acid

substitution in Candida albicans sterol 14alpha-demethylase causes drug resistance through

reduced affinity." Antimicrob Agents Chemother 44(1): 63-67.

Lamoth, F., P. R. Juvvadi, E. J. Soderblom, M. A. Moseley, Y. G. Asfaw and W. J. Steinbach

(2014). "Identification of a key lysine residue in heat shock protein 90 required for azole and

echinocandin resistance in Aspergillus fumigatus." Antimicrob Agents Chemother 58(4): 1889-

1896.

Lane, S., C. Birse, S. Zhou, R. Matson and H. Liu (2001). "DNA array studies demonstrate

convergent regulation of virulence factors by Cph1, Cph2, and Efg1 in Candida albicans." J Biol

Chem 276(52): 48988-48996.

Langford, M. L., A. L. Atkin and K. W. Nickerson (2009). "Cellular interactions of farnesol, a

quorum-sensing molecule produced by Candida albicans." Future Microbiol 4(10): 1353-1362.

Laprade, L., V. L. Boyartchuk, W. F. Dietrich and F. Winston (2002). "Spt3 plays opposite roles

in filamentous growth in Saccharomyces cerevisiae and Candida albicans and is required for C.

albicans virulence." Genetics 161(2): 509-519.

Li, J., J. Soroka and J. Buchner (2012). "The Hsp90 chaperone machinery: conformational

dynamics and regulation by co-chaperones." Biochim Biophys Acta 1823(3): 624-635.

Li, X., Q. Cai, H. Mei, X. Zhou, Y. Shen, D. Li and W. Liu (2015). "The Rpd3/Hda1 family of

histone deacetylases regulates azole resistance in Candida albicans." J Antimicrob Chemother

70(7): 1993-2003.

Liu, Y. and S. G. Filler (2011). "Candida albicans Als3, a multifunctional adhesin and invasin."

Eukaryot Cell 10(2): 168-173.

Lo, H. J., J. R. Kohler, B. DiDomenico, D. Loebenberg, A. Cacciapuoti and G. R. Fink (1997).

"Nonfilamentous C. albicans mutants are avirulent." Cell 90(5): 939-949.

Mansfield, B. E., H. N. Oltean, B. G. Oliver, S. J. Hoot, S. E. Leyde, L. Hedstrom and T. C.

White (2010). "Azole drugs are imported by facilitated diffusion in Candida albicans and other

pathogenic fungi." PLoS Pathog 6(9): e1001126.

Marichal, P., L. Koymans, S. Willemsens, D. Bellens, P. Verhasselt, W. Luyten, M. Borgers, F.

C. Ramaekers, F. C. Odds and H. V. Bossche (1999). "Contribution of mutations in the

cytochrome P450 14alpha-demethylase (Erg11p, Cyp51p) to azole resistance in Candida

albicans." Microbiology 145 ( Pt 10): 2701-2713.

Martel, C. M., J. E. Parker, O. Bader, M. Weig, U. Gross, A. G. Warrilow, N. Rolley, D. E.

Kelly and S. L. Kelly (2010). "Identification and characterization of four azole-resistant erg3

mutants of Candida albicans." Antimicrob Agents Chemother 54(11): 4527-4533.

Martinez-Ruiz, A., L. Villanueva, C. Gonzalez de Orduna, D. Lopez-Ferrer, M. A. Higueras, C.

Tarin, I. Rodriguez-Crespo, J. Vazquez and S. Lamas (2005). "S-nitrosylation of Hsp90

73

promotes the inhibition of its ATPase and endothelial nitric oxide synthase regulatory activities."

Proc Natl Acad Sci U S A 102(24): 8525-8530.

Miceli, M. H., J. A. Diaz and S. A. Lee (2011). "Emerging opportunistic yeast infections."

Lancet Infect Dis 11(2): 142-151.

Mollapour, M., D. Bourboulia, K. Beebe, M. R. Woodford, S. Polier, A. Hoang, R. Chelluri, Y.

Li, A. Guo, M. J. Lee, E. Fotooh-Abadi, S. Khan, T. Prince, N. Miyajima, S. Yoshida, S.

Tsutsumi, W. Xu, B. Panaretou, W. G. Stetler-Stevenson, G. Bratslavsky, J. B. Trepel, C.

Prodromou and L. Neckers (2014). "Asymmetric Hsp90 N domain SUMOylation recruits Aha1

and ATP-competitive inhibitors." Mol Cell 53(2): 317-329.

Mollapour, M., S. Tsutsumi, A. C. Donnelly, K. Beebe, M. J. Tokita, M. J. Lee, S. Lee, G.

Morra, D. Bourboulia, B. T. Scroggins, G. Colombo, B. S. Blagg, B. Panaretou, W. G. Stetler-

Stevenson, J. B. Trepel, P. W. Piper, C. Prodromou, L. H. Pearl and L. Neckers (2010).

"Swe1Wee1-dependent tyrosine phosphorylation of Hsp90 regulates distinct facets of chaperone

function." Mol Cell 37(3): 333-343.

Mollapour, M., S. Tsutsumi, A. W. Truman, W. Xu, C. K. Vaughan, K. Beebe, A.

Konstantinova, S. Vourganti, B. Panaretou, P. W. Piper, J. B. Trepel, C. Prodromou, L. H. Pearl

and L. Neckers (2011). "Threonine 22 phosphorylation attenuates Hsp90 interaction with

cochaperones and affects its chaperone activity." Mol Cell 41(6): 672-681.

Morio, F., F. Pagniez, C. Lacroix, M. Miegeville and P. Le Pape (2012). "Amino acid

substitutions in the Candida albicans sterol Delta5,6-desaturase (Erg3p) confer azole resistance:

characterization of two novel mutants with impaired virulence." J Antimicrob Chemother 67(9):

2131-2138.

Morrell, M., V. J. Fraser and M. H. Kollef (2005). "Delaying the empiric treatment of Candida

bloodstream infection until positive blood culture results are obtained: a potential risk factor for

hospital mortality." Antimicrob Agents Chemother 49(9): 3640-3645.

Nathan, D. F. and S. Lindquist (1995). "Mutational analysis of Hsp90 function: interactions with

a steroid receptor and a protein kinase." Mol Cell Biol 15(7): 3917-3925.

Noble, S. M., S. French, L. A. Kohn, V. Chen and A. D. Johnson (2010). "Systematic screens of

a Candida albicans homozygous deletion library decouple morphogenetic switching and

pathogenicity." Nat Genet 42(7): 590-598.

Odds, F. C. (1988). Candida and candidosis. London, Baillière Tindall.

Odds, F. C., A. J. Brown and N. A. Gow (2003). "Antifungal agents: mechanisms of action."

Trends Microbiol 11(6): 272-279.

Onyewu, C., J. R. Blankenship, M. Del Poeta and J. Heitman (2003). "Ergosterol biosynthesis

inhibitors become fungicidal when combined with calcineurin inhibitors against Candida

albicans, Candida glabrata, and Candida krusei." Antimicrob Agents Chemother 47(3): 956-

964.

74

Pappas, P. G., C. A. Kauffman, D. Andes, D. K. Benjamin, Jr., T. F. Calandra, J. E. Edwards, Jr.,

S. G. Filler, J. F. Fisher, B. J. Kullberg, L. Ostrosky-Zeichner, A. C. Reboli, J. H. Rex, T. J.

Walsh, J. D. Sobel and A. Infectious Diseases Society of (2009). "Clinical practice guidelines for

the management of candidiasis: 2009 update by the Infectious Diseases Society of America."

Clin Infect Dis 48(5): 503-535.

Perea, S., J. L. Lopez-Ribot, W. R. Kirkpatrick, R. K. McAtee, R. A. Santillan, M. Martinez, D.

Calabrese, D. Sanglard and T. F. Patterson (2001). "Prevalence of molecular mechanisms of

resistance to azole antifungal agents in Candida albicans strains displaying high-level

fluconazole resistance isolated from human immunodeficiency virus-infected patients."

Antimicrob Agents Chemother 45(10): 2676-2684.

Perfect, J. R., W. E. Dismukes, F. Dromer, D. L. Goldman, J. R. Graybill, R. J. Hamill, T. S.

Harrison, R. A. Larsen, O. Lortholary, M. H. Nguyen, P. G. Pappas, W. G. Powderly, N. Singh,

J. D. Sobel and T. C. Sorrell (2010). "Clinical practice guidelines for the management of

cryptococcal disease: 2010 update by the infectious diseases society of america." Clin Infect Dis

50(3): 291-322.

Pfaller, M. A. (2012). "Antifungal drug resistance: mechanisms, epidemiology, and

consequences for treatment." Am J Med 125(1 Suppl): S3-13.

Pfaller, M. A. and D. J. Diekema (2007). "Epidemiology of invasive candidiasis: a persistent

public health problem." Clin Microbiol Rev 20(1): 133-163.

Pfaller, M. A. and D. J. Diekema (2010). "Epidemiology of invasive mycoses in North

America." Crit Rev Microbiol 36(1): 1-53.

Pfaller, M. A., S. A. Messer, N. Georgopapadakou, L. A. Martell, J. M. Besterman and D. J.

Diekema (2009). "Activity of MGCD290, a Hos2 histone deacetylase inhibitor, in combination

with azole antifungals against opportunistic fungal pathogens." J Clin Microbiol 47(12): 3797-

3804.

Piper, P. W., B. Panaretou, S. H. Millson, A. Truman, M. Mollapour, L. H. Pearl and C.

Prodromou (2003). "Yeast is selectively hypersensitised to heat shock protein 90 (Hsp90)-

targetting drugs with heterologous expression of the human Hsp90beta, a property that can be

exploited in screens for new Hsp90 chaperone inhibitors." Gene 302(1-2): 165-170.

Pratt, W. B., M. D. Galigniana, J. M. Harrell and D. B. DeFranco (2004). "Role of hsp90 and the

hsp90-binding immunophilins in signalling protein movement." Cell Signal 16(8): 857-872.

Richard, M. L., C. J. Nobile, V. M. Bruno and A. P. Mitchell (2005). "Candida albicans biofilm-

defective mutants." Eukaryot Cell 4(8): 1493-1502.

Robbins, N., C. Collins, J. Morhayim and L. E. Cowen (2010). "Metabolic control of antifungal

drug resistance." Fungal Genet Biol 47(2): 81-93.

Robbins, N., M. D. Leach and L. E. Cowen (2012). "Lysine deacetylases Hda1 and Rpd3

regulate Hsp90 function thereby governing fungal drug resistance." Cell Rep 2(4): 878-888.

75

Robbins, N., P. Uppuluri, J. Nett, R. Rajendran, G. Ramage, J. L. Lopez-Ribot, D. Andes and L.

E. Cowen (2011). "Hsp90 governs dispersion and drug resistance of fungal biofilms." PLoS

Pathog 7(9): e1002257.

Robyr, D., Y. Suka, I. Xenarios, S. K. Kurdistani, A. Wang, N. Suka and M. Grunstein (2002).

"Microarray deacetylation maps determine genome-wide functions for yeast histone

deacetylases." Cell 109(4): 437-446.

Rocha, C. R., K. Schroppel, D. Harcus, A. Marcil, D. Dignard, B. N. Taylor, D. Y. Thomas, M.

Whiteway and E. Leberer (2001). "Signaling through adenylyl cyclase is essential for hyphal

growth and virulence in the pathogenic fungus Candida albicans." Mol Biol Cell 12(11): 3631-

3643.

Roemer, T., B. Jiang, J. Davison, T. Ketela, K. Veillette, A. Breton, F. Tandia, A. Linteau, S.

Sillaots, C. Marta, N. Martel, S. Veronneau, S. Lemieux, S. Kauffman, J. Becker, R. Storms, C.

Boone and H. Bussey (2003). "Large-scale essential gene identification in Candida albicans and

applications to antifungal drug discovery." Mol Microbiol 50(1): 167-181.

Rustchenko, E. (2007). "Chromosome instability in Candida albicans." FEMS Yeast Res 7(1): 2-

11.

Sanglard, D., F. Ischer, L. Koymans and J. Bille (1998). "Amino acid substitutions in the

cytochrome P-450 lanosterol 14alpha-demethylase (CYP51A1) from azole-resistant Candida

albicans clinical isolates contribute to resistance to azole antifungal agents." Antimicrob Agents

Chemother 42(2): 241-253.

Sanglard, D., K. Kuchler, F. Ischer, J. L. Pagani, M. Monod and J. Bille (1995). "Mechanisms of

resistance to azole antifungal agents in Candida albicans isolates from AIDS patients involve

specific multidrug transporters." Antimicrob Agents Chemother 39(11): 2378-2386.

Santos, M. A. and M. F. Tuite (1995). "The CUG codon is decoded in vivo as serine and not

leucine in Candida albicans." Nucleic Acids Res 23(9): 1481-1486.

Saville, S. P., A. L. Lazzell, C. Monteagudo and J. L. Lopez-Ribot (2003). "Engineered control

of cell morphology in vivo reveals distinct roles for yeast and filamentous forms of Candida

albicans during infection." Eukaryot Cell 2(5): 1053-1060.

Selmecki, A., A. Forche and J. Berman (2006). "Aneuploidy and isochromosome formation in

drug-resistant Candida albicans." Science 313(5785): 367-370.

Selmecki, A., A. Forche and J. Berman (2010). "Genomic plasticity of the human fungal

pathogen Candida albicans." Eukaryot Cell 9(7): 991-1008.

Selmecki, A., M. Gerami-Nejad, C. Paulson, A. Forche and J. Berman (2008). "An

isochromosome confers drug resistance in vivo by amplification of two genes, ERG11 and

TAC1." Mol Microbiol 68(3): 624-641.

76

Selmecki, A. M., K. Dulmage, L. E. Cowen, J. B. Anderson and J. Berman (2009). "Acquisition

of aneuploidy provides increased fitness during the evolution of antifungal drug resistance."

PLoS Genet 5(10): e1000705.

Senn, H., R. S. Shapiro and L. E. Cowen (2012). "Cdc28 provides a molecular link between

Hsp90, morphogenesis, and cell cycle progression in Candida albicans." Mol Biol Cell 23(2):

268-283.

Shapiro, R. S., N. Robbins and L. E. Cowen (2011). "Regulatory circuitry governing fungal

development, drug resistance, and disease." Microbiol Mol Biol Rev 75(2): 213-267.

Shapiro, R. S., A. Sellam, F. Tebbji, M. Whiteway, A. Nantel and L. E. Cowen (2012). "Pho85,

Pcl1, and Hms1 signaling governs Candida albicans morphogenesis induced by high

temperature or Hsp90 compromise." Curr Biol 22(6): 461-470.

Shapiro, R. S., P. Uppuluri, A. K. Zaas, C. Collins, H. Senn, J. R. Perfect, J. Heitman and L. E.

Cowen (2009). "Hsp90 orchestrates temperature-dependent Candida albicans morphogenesis via

Ras1-PKA signaling." Curr Biol 19(8): 621-629.

Sheehan, D. J., C. A. Hitchcock and C. M. Sibley (1999). "Current and emerging azole

antifungal agents." Clin Microbiol Rev 12(1): 40-79.

Shen, J., W. Guo and J. R. Kohler (2005). "CaNAT1, a heterologous dominant selectable marker

for transformation of Candida albicans and other pathogenic Candida species." Infect Immun

73(2): 1239-1242.

Silver, P. M., B. G. Oliver and T. C. White (2004). "Role of Candida albicans transcription

factor Upc2p in drug resistance and sterol metabolism." Eukaryot Cell 3(6): 1391-1397.

Singh, S. D., N. Robbins, A. K. Zaas, W. A. Schell, J. R. Perfect and L. E. Cowen (2009).

"Hsp90 governs echinocandin resistance in the pathogenic yeast Candida albicans via

calcineurin." PLoS Pathog 5(7): e1000532.

Smith, W. L. and T. D. Edlind (2002). "Histone deacetylase inhibitors enhance Candida albicans

sensitivity to azoles and related antifungals: correlation with reduction in CDR and ERG

upregulation." Antimicrob Agents Chemother 46(11): 3532-3539.

Staab, J. F., S. D. Bradway, P. L. Fidel and P. Sundstrom (1999). "Adhesive and mammalian

transglutaminase substrate properties of Candida albicans Hwp1." Science 283(5407): 1535-

1538.

Sudbery, P., N. Gow and J. Berman (2004). "The distinct morphogenic states of Candida

albicans." Trends Microbiol 12(7): 317-324.

Sudbery, P. E. (2001). "The germ tubes of Candida albicans hyphae and pseudohyphae show

different patterns of septin ring localization." Mol Microbiol 41(1): 19-31.

Taipale, M., D. F. Jarosz and S. Lindquist (2010). "HSP90 at the hub of protein homeostasis:

emerging mechanistic insights." Nat Rev Mol Cell Biol 11(7): 515-528.

77

Taylor, B. N., T. Harrer, E. Pscheidl, A. Schweizer, M. Rollinghoff and K. Schroppel (2003).

"Surveillance of nosocomial transmission of Candida albicans in an intensive care unit by DNA

fingerprinting." J Hosp Infect 55(4): 283-289.

Taylor, J. W. and M. L. Berbee (2006). "Dating divergences in the Fungal Tree of Life: review

and new analyses." Mycologia 98(6): 838-849.

Uppuluri, P., A. K. Chaturvedi, A. Srinivasan, M. Banerjee, A. K. Ramasubramaniam, J. R.

Kohler, D. Kadosh and J. L. Lopez-Ribot (2010). "Dispersion as an important step in the

Candida albicans biofilm developmental cycle." PLoS Pathog 6(3): e1000828.

Vale-Silva, L. A., A. T. Coste, F. Ischer, J. E. Parker, S. L. Kelly, E. Pinto and D. Sanglard

(2012). "Azole resistance by loss of function of the sterol Delta(5),(6)-desaturase gene (ERG3) in

Candida albicans does not necessarily decrease virulence." Antimicrob Agents Chemother

56(4): 1960-1968.

Vincent, B. M., A. K. Lancaster, R. Scherz-Shouval, L. Whitesell and S. Lindquist (2013).

"Fitness trade-offs restrict the evolution of resistance to amphotericin B." PLoS Biol 11(10):

e1001692.

Vyas, V. K., M. I. Barrasa and G. R. Fink (2015). "A CRISPR system permits genetic

engineering of essential genes and gene families." Sci Adv 1(3): e1500248.

Walsh, T. J., E. J. Anaissie, D. W. Denning, R. Herbrecht, D. P. Kontoyiannis, K. A. Marr, V. A.

Morrison, B. H. Segal, W. J. Steinbach, D. A. Stevens, J. A. van Burik, J. R. Wingard, T. F.

Patterson and A. Infectious Diseases Society of (2008). "Treatment of aspergillosis: clinical

practice guidelines of the Infectious Diseases Society of America." Clin Infect Dis 46(3): 327-

360.

White, T. C. (1997). "Increased mRNA levels of ERG16, CDR, and MDR1 correlate with

increases in azole resistance in Candida albicans isolates from a patient infected with human

immunodeficiency virus." Antimicrob Agents Chemother 41(7): 1482-1487.

White, T. C., K. A. Marr and R. A. Bowden (1998). "Clinical, cellular, and molecular factors that

contribute to antifungal drug resistance." Clin Microbiol Rev 11(2): 382-402.

Whitesell, L. and S. L. Lindquist (2005). "HSP90 and the chaperoning of cancer." Nat Rev

Cancer 5(10): 761-772.

Zhang, Y. Q., S. Gamarra, G. Garcia-Effron, S. Park, D. S. Perlin and R. Rao (2010).

"Requirement for ergosterol in V-ATPase function underlies antifungal activity of azole drugs."

PLoS Pathog 6(6): e1000939.

Documents

Regulation of Fungal Drug Resistance and Morphogenesis by ......KDAC inhibition induces pseudohyphal morphology. 59 Figure 10. KDAC inhibition results in increased expression of hyphal