RDB

MITM

R

hrtabtpiwapwpyqtcaiBvcNwirtmf

5

Protein Expression and Purification 15, 162–170 (1999)Article ID prep.1998.0996, available online at http://www.idealibrary.com on

1

efolding, Purification, and Characterization of a Loopeletion Mutant of Human Bcl-2 fromacterial Inclusion Bodies

alcolm Anderson,1 David Blowers, Neil Hewitt, Philip Hedge, Alexander Breeze,an Hampton, and Ian Taylorarget Discovery, Cancer & Infection Research Departments and Protein Structure Laboratory, Zeneca Pharmaceuticals,ereside, Alderley Park, Macclesfield, Cheshire SK10 4TG, United Kingdom

eceived May 28, 1998, and in revised form September 23, 1998

tkcdcsdidi

slnqcbqapBdaBoCBh

podts

This report describes the cloning of recombinantuman Bcl-2, in which the putative disordered loopegion has been replaced with a flexible linker andhe hydrophobic C-terminus has been replaced with6xHis tag (Bcl-2(6–32)-AAAA-Bcl-2(86–206)-HHHHHH, ab-reviation rhBcl-2; amino acid numbering excludeshe initiating methionine). This protein was ex-ressed in Escherichia coli where it accumulated in

nsoluble form in inclusion bodies. After lysis theashed inclusion bodies were solubilized and an L-rginine assisted protein refolding route was em-loyed to obtain biologically active protein. rhBcl-2as purified further by nickel chelate chromatogra-hy to give protein of >95% purity, with an overallield of 5 mg per g of E. coli cell paste. Edman se-uencing showed that ;90% of the rhBcl-2 retainedhe initiating methionine residue. Analytical size ex-lusion chromatography suggested that the refoldednd purified rhBcl-2 was monomeric in nondenatur-ng solution. Purified protein had an affinity for aax BH3 domain peptide comparable to that for inivo folded recombinant human Bcl-2 and suppressedaspase activation in a cell-free assay for apoptosis. 1HMR spectroscopy of rhBcl-2, both free and complexedith the Bax BH3 domain peptide, provided further ev-

dence for the structural and functional integrity of theefolded protein. These findings parallel and extendhose of Muchmore et al., who found that a loop deletionutant of human Bcl-XL retained anti-apoptotic

unction. © 1999 Academic Press

1 To whom correspondence should be addressed. Fax: 01625

t12126. E-mail: Malcolm.Anderson@alderley.zeneca.com.

62

The process by which an individual cell, respondingo internal or external signals, induces its own death isnown as apoptosis or programmed cell death. Pro-esses in which apoptosis is involved include tissueevelopment and homeostasis, elimination of geneti-ally damaged cells, and the establishment of immuneelf-tolerance (1,2). Diseases in which apoptosis is re-uced include cancer, autoimmune disorders, and viralnfections. Increased apoptosis is seen in AIDS, neuro-egenerative disorders, myelodysplastic syndromes,schemic injury, and toxin-induced liver disease (1).

Bcl-2 was originally identified in a t(14:18) chromo-omal translocation found in human B-cell follicularymphomas (3,4). It was found to repress apoptosisormally initiated by various stimuli (5–7). Subse-uently, a family of apoptosis suppressor proteins in-luding Bcl-2, Bcl-XL, Mcl-1, A1, Bcl-w, and Ced-9 haseen identified. These proteins share conserved se-uence regions termed Bcl-2 homology domains 1, 2, 3,nd 4 (BH1, BH2, BH3, and BH4). A second group ofroteins including Bax, Bak, Bad, Bik, Hrk, Bim, andcl-XS have one or more of the BH1, BH2, and BH3omains and promote apoptosis (8–10). Bcl-2 has thebility to homodimerize or to heterodimerize with Bax,cl-XL, Bcl-XS, A1, and Bad (11) and to interact withther unrelated proteins such as Raf-1, calcineurin,ED-4, and p53-BP2 (12). It has been suggested thatcl-2 family proteins are regulated through homo- andeterodimerization (13).The biochemical mechanism by which Bcl-2 re-

resses apoptosis remains unclear. Structural studiesn Bcl-XL have revealed similarities to colicins andiphtheria toxins, which act as channel forming pro-eins in membranes (14). Functional studies have alsohown that Bcl-XL and Bcl-2 can form pores in syn-

hetic lipid membranes (15,16). It has therefore been

1046-5928/99 $30.00Copyright © 1999 by Academic Press

All rights of reproduction in any form reserved.

splmrp(vdc

csXwtcfCBdflms

rt;tht(aac

M

C

fa

wwPc

cpEws

E

t(gw(O

L

imcccsbtow(3

L

fpnlpnpMIppsfn

utmc

t

163PURIFICATION OF HUMAN Bcl-2 FROM INCLUSION BODIES

uggested that Bcl-2 may act as a channel formingrotein, regulating ion transport across the intracellu-ar membranes in which it resides, including the outer

itochondrial membrane (12). Bcl-2 has been found toegulate activation of the caspase family of cysteineroteases (17,18), a recognized element of apoptosis19,20). Caspases can be activated via a pathway in-olving the release of cytochrome c from the mitochon-ria (21), and Bcl-2 overexpression is known to blockytochrome c release (22,23).In the present work, large quantities of pure and

orrectly folded rhBcl-2 were required for structuraltudies. Following the precedent set in a study of Bcl-L, which shares a high degree of sequence homologyith Bcl-2, the hydrophobic C-terminus of Bcl-2 was

runcated (14). In addition, the putative flexible looponnecting the a1 and a2 helices was replaced withour alanine residues, and a 6xHis tag was added at the-terminus resulting in the construct Bcl-2(6–32)-AAAA-cl-2(86–206)-HHHHHH. Replacement of the putativeisordered and highly mobile loop region with a shortexible linker and deletion of the hydrophobic C-ter-inal amino acids were hoped to be potential aids to

tructural studies.Methods have been described previously for the pu-

ification of .10mg quantities of murine Bcl-2 missinghe C-terminal hydrophobic amino acids (24) and500-mg quantities of full-length human Bcl-2 (25). In

his article a method is described for the purification ofuman Bcl-2 modified in a manner analogous to one ofhe mutations of Bcl-XL described by Muchmore et al.14). The combination of L-arginine assisted refoldingnd a 6xHis tag for purification resulted in an efficientnd rapid route for producing .15mg quantities oforrectly folded, .95% pure rhBcl-2.

ATERIALS AND METHODS

loning and Generation of Expression Constructs

The construct was assembled in two halves from aull-length human Bcl-2 clone by polymerase chain re-ction (PCR) using the following primers:

NdeIA: 59CTAGTGCTCATATGACAGGGTACGATAACCGGGA39

PstIB: 59TAGTGCTGCAGCCGCTCCCGCATCCCACTCGTAGC39

PstIC: 59CTGCGGCTGCAGCAAGCCCGGTGCCACCTGTGGT39

EcoRID: 59ACGTGAATTCAATGATGATGATGATGATGCCGCATGCT-

GGGGCCGTACA39.

The products of PCRs using oligos A 1 B and C 1 Dere digested with PstI and ligated. A full-length productas obtained using the ligated product as a template forCR using primers A 1 D, and the DNA sequence was

onfirmed. The PCR product was cloned into the tetracy- b

line-resistant vector pTB 375 (a vector based on the T7olymerase Studier expression system (26)) via NdeI andcoRI sites present in the oligonucleotides. The constructas transformed into a Studier expression system host

train, BL21(DE3)pLysS.

xpression Studies

A 100ml culture in Luria–Bertani (LB)2 medium con-aining tetracycline (15 mg/ml) and chloramphenicol40 mg/ml) was diluted 1:15 into fresh medium andrown overnight at 37°C to OD600nm 0.6 before inductionith 0.1 mM isopropyl-b-D-thiogalactopyranoside

IPTG). The culture was harvested after 3 h at 37°C atD600nm 0.88.

arge-Scale Fermentation

The strain was grown for 16 h (LB medium contain-ng tetracycline (10 mg/ml) and chloramphenicol (34g/ml) at 37°C) in shake flasks to OD550nm ;5. Thisulture was inoculated into high biomass medium (27),ontaining tetracycline (10 mg/ml) and chlorampheni-ol (34 mg/ml), in a 20-liter fermenter (B. Braun, Mel-ungen, Germany). Cells were grown aerobically in fedatch culture at 37°C, pH 6.7, with dissolved oxygenension maintained at 50% air saturation. Expressionf Bcl-2 was induced 6 h post inoculation (OD550nm ;24)ith 1 mM IPTG, and cells were harvested 5.5 h later

OD550nm ;38) by batch centrifugation (7000g at 4°C for0 min).

ysis of E. coli and Solubilization of Inclusion Bodies

Unless otherwise stated all procedures were per-ormed at 4°C. E. coli cell paste (300 g) was resus-ended using a Kinematica PT6000 homogenizer (Ki-ematica GMBH, Basel, Switzerland) in 4.5 liters of

ysis buffer (50 mM Tris–HCl, 500 mM NaCl, 2 mMhenylmethylsulfonyl fluoride, 1 mM 2-mercaptoetha-ol, 1 mg/ml aprotinin, 1 mg/ml leupeptin, 1 mg/mlepstatin, pH 8.0). The cells were lysed using a cooledanton Gaulin type lab 60 homogenizer (APV Gaulin

nternational, Hilversum, Holland), recirculating at aressure of 3000 psi for 15 min followed by one com-lete pass through the homogenizer at the same pres-ure. The resulting lysate was centrifuged at 23,000gor 45 min before aspirating and discarding the super-atant.The cell lysate pellet was washed by resuspension,

sing the Kinematica PT6000 homogenizer, in 4.0 li-ers of wash buffer (50 mM Tris–HCl, 2.0 M urea, 2M EDTA, 1 mM 2-mercaptoethanol, pH 8.0) before

entrifuging once more at 23,000g for 45 min. The

2 Abbreviations used: LB, Luria–Bertani; IPTG, isopropyl-b-D-hiogalactopyranoside; 1D, one-dimensional; PARP, poly(ADP-ri-

ose)polymerase.

s4Mnncfd

F

iwlTTawctwyHa

wGdtocbdrrti

aaap1N4

A

pLb1Db

fPmm(a2wp

fwb2pwen(At

EFaMSdaNap1udp

W

S

P

P

it

164 ANDERSON ET AL.

upernatant was discarded and the pellet solubilized in.0 liters of solubilization buffer (50 mM Tris–HCl, 6.0

guanidine hydrochloride, 10 mM 2-mercaptoetha-ol, pH 8.0) using the Kinematica PT6000 homoge-izer to fully solubilize the pellet. The solubilized in-lusion body solution was prepared for storage by rapidreezing of 50ml aliquots in a methanol/solid carbonioxide bath, and was stored at 280°C.

olding and Purification

Solubilization buffer (50 ml) containing the dissolvednclusion bodies was thawed and, with rapid mixing,as added dropwise at a rate of 10 ml/min into 4.0

iters of refolding buffer (400 mM L-arginine, 10 mMris–HCl, 10 mM 2-mercaptoethanol, pH 8.0 at 4°C).he vessel containing the refolding mixture was madeirtight and the refolding process allowed to continueith stirring for 20 h at 4°C. Using an Amicon CH2RS

rossflow diafiltration system and two S1Y10 car-ridges (Millipore, Bedford, MA), the refolding solutionas concentrated to approximately 500 ml before dial-sis against 4.0 liters of dialysis buffer (50 mM Tris–Cl, 100 mM NaCl, 10 mM 2-mercaptoethanol, pH 8.0,t 4°C).An 11mm diameter chromatography column packedith 7.5 ml Ni-NTA agarose (Qiagen GMBH, Hilden,ermany) was equilibrated with 10 column volumes ofialysis buffer before loading the dialyzed and concen-rated refolding solution onto the column at a flow ratef 0.5 ml/min. Using a flow rate of 1.0 ml/min theolumn was washed with 10 column volumes of washuffer (50 mM Tris–HCl, 100 mM NaCl, 10 mM imi-azole, 10 mM 2-mercaptoethanol, pH 8.0, at 4°C) toemove weakly bound or nonspecifically bound impu-ities. Elution of bound protein was effected using elu-ion buffer (50 mM Tris–HCl, 100 mM NaCl, 200 mM

TABLE 1

Yields for Major Steps of the Recovery, Refolding,and Purification Procedure

SamplePurity

(%)Yield for each

step (%)Cumulative

yield (%)

ashed celllysate pellet 80 90 90

olubilizedinclusion bodies 85 .99 90

ost refolding andconcentration 85 15 14

ost Ni-NTAchromatography .95 75 10

Note. Percentage purity figures are for rhBcl-2 relative to contam-nating proteins; all figures were derived from densitometric quan-itation of Coomassie stained SDS–PAGE analysis.

midazole, 10 mM 2-mercaptoethanol, pH 8.0, at 4°C) A

t 1.0 ml/min. Fractions of 5.0 ml were collected, andfter analysis by SDS–PAGE and measurement of UVbsorption spectra (200–350 nm), those containingure rhBcl-2 were pooled. The pool was dialyzed into00 equivalent volumes of storage buffer (20 mMaH2PO4, 50 mM NaCl, 2 mM dithiothreitol, pH 7.4, at°C), and stored at 4°C prior to analysis.

nalysis of Purified rhBcl-2

Analytical techniques were performed at room tem-erature. For SDS–PAGE all samples were diluted inaemmli buffer (28) containing 2-mercaptoethanol,oiled for 2 min, and loaded onto a 8–16% gradient,.5mm thickness 3 10-well Novex gel (Novex, Saniego, California). Gels were stained with Coomassielue R-250.Reverse-phase chromatographic analysis was per-

ormed using a Pharmacia Smart system (Amershamharmacia Biotech, Uppsala, Sweden) fitted with aRPC C2/C18 SC2.1/10 column. At a flowrate of 100l/min, the column was equilibrated in Milli-Q water

Millipore), 2.7% acetonitrile, 0.1% trifluoroacetic acid,nd elution was performed using a linear gradient of.7 to 81% acetonitrile. Approximately 1.5 mg of proteinas loaded onto the column. Detection of eluted com-onents was by absorbance at 214 and 280 nm.Analytical size-exclusion chromatography was per-

ormed using a Pharmacia Smart system equippedith a Superdex 75 PC3.2/30 column. The runninguffer was 40 mM NaH2PO4, 150 mM NaCl, 2 mM-mercaptoethanol, pH 7.4. After equilibration, ap-roximately 5 mg of protein was loaded onto the columnhich was run at a flowrate of 50 ml/min. Detection ofluted components was by absorbance at 214 and 280m. Standards of molecular weights 13.7 and 25 kDaribonuclease A and chymotrypsinogen A, respectively,mersham Pharmacia Biotech) were analyzed under

he same conditions.Edman degradation was carried out on a Perkinlmer 477A peptide sequencer (Applied Biosystems,oster City, CA) with on-line detection of PTH aminocids. Mass spectra were acquired using a FinniganAT TSQ 7000 with electrospray source (Finnigan,

an Jose, CA) and on-line Perkin Elmer microgradientelivery system (200LC autosampler, 140C ABI pump,nd 235C diode array detector; Perkin Elmer Corp.,orwalk, CT). rhBcl-2 (16 mg) was loaded directly on ton ABI/Brownlee Aquapore C18 100 3 1 mm reverse-hase column equilibrated in Milli Q water (Millipore),2% acetonitrile, 0.1% trifluoroacetic acid, and the col-mn was developed with a 12 to 66% acetonitrile gra-ient at a flow rate of 50 ml/min. The eluted proteinsassed directly into the mass spectrometer.Isoelectric focusing was performed with a Pharmacia

mpholine PAGplate gel, using 1.0 M H3PO4 for the

atCUt

a6tMa

b(rslwBtCtfpuqzie

B

stf(sym0aasNNTCv(s

X

pCsmm(sav

R

E

aaspptWaGnrgm

L

cc(witmrbrgafio

R

easa

165PURIFICATION OF HUMAN Bcl-2 FROM INCLUSION BODIES

node solution and 1.0 M NaOH for the cathode solu-ion. Isoelectric markers were run on the same gel (pIalibration Kit Electran range 4.7–10.6; BDH, Dorset,K). After electrophoresis (1500 V, 50 mA, 30 W, 1.5 h)

he gel was stained in Coomassie blue R-250.Protein concentrations were determined by amino

cid analysis (hydrolysis in vacuo for 24 h at 115°C inN HCl/Phenol), and UV spectrometry using a correc-

ion factor calculated by Protean (DNASTAR Inc.,adison, WI) of 0.50 mg/ml for 1.00 absorbance units

t 280 nm.

1H NMR of rhBcl-2

rhBcl-2 was transferred into sodium phosphateuffer (0.1 M) containing 2 mM dithiothreitol and 8%v/v) D2O, pH 7.75, by successive rounds of dilution andeconcentration over 10kDa cutoff membranes intirred-cell and Centricon ultrafiltration devices (Mil-ipore). A complex of rhBcl-2 with a Bax BH3 peptideas prepared by addition of a 1.5-fold molar excess ofax (49–77) peptide followed by several cycles of dilu-

ion and reconcentration in the above buffer using aentricon device. One-dimensional (1D) 1H NMR spec-

ra of rhBcl-2 and its BH3 peptide complex (;0.1 mMor the peptide complex; slightly less for the uncom-lexed protein) were acquired at 25°C and 600 MHzsing a flip-back WATERGATE–NOESY pulse se-uence and a 5mm 1H5

15N/13C6 probe equipped with a-gradient coil on a Varian Unity spectrometer (Var-an, Palo Alto, CA). Data were processed using 3Hzxponential line broadening.

ax BH3 Peptide Binding Affinity Assay

Binding of the Bax BH3 peptide (residues 49–77,equence VPQDASTKKLSECLKRIGDELDSNMELQR)o Bcl-2(1–218)-HHHHHHGS-cmyc was determined asollows. To each well in a Microlite 1 microtiter plateDynex, Chantilly, VA) 40 ml reagent 1 (125 pM 125Itreptavidin (Amersham, Bucks., U.K.), 125 nM biotin-lated Bax BH3 peptide, 20 mM Tris–HCl, pH 6.8, 100M NaCl, 1 mM Na2EDTA, 1 mM 2-mercaptoethanol,

.2% NP40) was added. Reagent 2 (50 ml) was thendded (100 nM Bcl-2(1–218)-HHHHHHGS-cmyc, 200 nMnti c-myc antibody, 0.75 mg/well SPA beads (Amer-ham, Bucks., U.K.), 20 mM Tris–HCl, pH 6.8, 100 mMaCl, 1 mM Na2EDTA, 1 mM 2-mercaptoethanol, 0.2%P40). The plates were read after 25 h on a Packardopcount (Packard Instrument Company, Meriden,T). The concentration of in vitro folded rhBcl-2 or inivo folded human Bcl-2 that gave a 50% inhibitionIC50) of the signal in this assay was determined by

erially diluting and adding 10ml aliquots to reagent 1. w

enopus Egg Extract Caspase Inhibition Assay

This assay was designed to mimic the cleavage ofoly(ADP-ribose) polymerase (PARP) by the XenopusPP-32 gene product (29). Cleavage of PARP has beenhown to be an early event in apoptosis in many mam-alian cell lines (30,31). Caspase activity was deter-ined by assaying cleavage of a fluorogenic peptide

Ac-DEVD-AMC) based on the known cleavage siteequence of PARP (DEVD2G (30)). All techniques andssay conditions were identical to those described pre-iously (17).

ESULTS

xpression Studies

Analysis of the culture by Coomassie blue staining ofn SDS–PAGE separation showed a band between 15nd 18 kDa not present prior to induction (data nothown). The same analysis technique applied to sam-les of the lysate supernatant and lysate pellet, pre-ared by sonication followed by centrifugation, showedhe recombinant protein was almost totally insoluble.

estern blotting of the latter SDS–PAGE separationnd probing with a Ni-NTA-HRP conjugate (QiagenMBH) confirmed the presence of a poly-His tag (dataot shown). In an attempt to increase the proportion ofhBcl-2 accumulating in soluble form, cultures wererown at 20°C, and induction was performed with 0.01M IPTG, but without success.

arge-Scale Fermentation and Lysis

From 6 liters of culture 300 g of cell paste was re-overed, and microscopic observations showed that theells contained inclusion bodies. SDS–PAGE analysisFig. 1) shows that rhBcl-2 with an apparent moleculareight between 15 and 18 kDa was produced in the

nduced bacteria. The high level of expression meanthat the crude lysate contained 35% rhBcl-2, and re-oval of the lysate supernatant resulted in 80% pure

hBcl-2. A further degree of purification was achievedy washing the inclusion bodies, giving 85% purehBcl-2. Solubilization of the inclusion bodies in 6.0 Muanidine hydrochloride occurred instantaneously,nd the yield for this step was found to be .99%. Thesegures were calculated by densitometric quantitationf Coomassie blue stained SDS–PAGE.

efolding and Purification of rhBcl-2

Experiments indicated that refolding occurred morefficiently using a dilution technique rather than gradu-lly dialyzing away the denaturant (analyzed by Coomas-ie blue stained SDS–PAGE of post folding supernatantnd pellet samples; data not shown). However, even

hen employing the dilution method a slight cloudiness

atttttmwbD

A

fiptad

uutsmr

phdIs

mdl

mafqcm

fai

Frgea

Fmtscw

166 ANDERSON ET AL.

ppeared in the refolding solution, suggesting precipita-ion/aggregation of some rhBcl-2. The solution containinghe refolded rhBcl-2 was dialyzed, prior to which concen-ration was necessary to keep the dialysis step at a prac-ical scale. During the concentration and dialysis theurbidity of the solution increased. Prior to Ni-NTA chro-atography, dialysis was necessary to remove arginine,hich has been shown previously to prevent efficientinding of 6xHis fusion proteins to Ni-NTA agarose (R. A.avies, personal communication).

nalysis of Purified rhBcl-2

Analysis by reverse-phase chromatography of puri-ed rhBcl-2 (Fig. 2A) showed it to be homogeneous; theeak eluting at 7.5 min (6.0% acetonitrile) correspondso dithiothreitol. rhBcl-2 eluted at 51.75 min (63.7%cetonitrile) and integration of the chromatogram in-icated .99% purity.The purified rhBcl-2 product had an apparent molec-

lar weight of approximately 18 kDa by SDS–PAGEnder reducing conditions, and densitometric quanti-ation indicated it to be .95% pure (Fig.1). Analyticalize-exclusion chromatography showed it to be mono-eric in solution (Fig. 2B). The molecular weight for

hBcl-2 was 16 kDa calculated by this technique.Isoelectric focusing resolved one major band with a

I of 6.5 to 7.0 and two minor bands with slightlyigher pI (,7.5). This was consistent with the pre-icted value of 6.72 calculated by Protean (DNASTARnc., Madison, WI). The minor bands probably repre-

IG. 1. rhBcl-2 expression, refolding, and purification. Lanes: 1,olecular weight markers; 2, whole cell lysate; 3, lysate superna-

ant; 4, lysate pellet; 5, washed inclusion bodies; 6, solubilized inclu-ion bodies; 7, post refolding, dialysis, and concentration; 8, Ni NTAhromatography unbound material; 9, Ni NTA chromatographyash step; 10, purified rhBcl-2 eluted from Ni NTA column.

ent unrelated protein impurities, since the more likely t

odifications to the rhBcl-2 (oxidation of cysteines oreamidation of asparagines or glutamines) would haveowered the protein’s net pI.

Electrospray mass spectrometry (Fig. 3) showed aain peak consistent with the average mass calculated

s 18,537.0 Da for rhBcl-2, using the Bcl-2 a sequencerom the Swissprot database to derive the rhBcl-2 se-uence. The peak at ;18,400 Da is consistent with thealculated average mass for rhBcl-2 with the initiatingethionine removed (18,405.8 Da).Edman degradation analysis showed the sequence

or Bcl-2, residues 6 to 22 (TGYDNREIVMKYIHYKL);pproximately 90% of the protein retained the initiat-ng methionine.

IG. 2. (A) Analytical reverse-phase chromatogram of purifiedhBcl-2. Detection was via UV absorbance at 214 nm, and the linearradient of 2.7 to 81% acetonitrile is illustrated. (B) Analytical sizexclusion chromatogram of purified rhBcl-2. Detection was via UVbsorbance at 214 nm. Arrows mark the retention times for chymo-

rypsinogen A (1) and ribonuclease A (2).

1

socoi

rdafrcp;

B

wpfttbmastv

X

li(ntflot

y m

F(ad

167PURIFICATION OF HUMAN Bcl-2 FROM INCLUSION BODIES

D 1H NMR spectroscopy of rhBcl-2 and Its Complexwith Bax BH3 Domain

The rhBcl-2 protein gave a well-dispersed 1H NMRpectrum (Fig. 4A). The spectrum displays many res-nances upfield of 0.5 ppm and downfield of 9.5 ppm,haracteristic of a folded, globular protein. Additionf a molar excess of Bax (49 –77) peptide (represent-ng the BH3 domain of Bax) to a separate sample of

FIG. 3. Deconvoluted electrospra

IG. 4. Six hundred megahertz 1D 1H NMR spectra of (A) rhBcl-2;B) rhBcl-2 complexed with Bax (49–77) peptide. The spectra werecquired with 512 transients and a relaxation delay of 1.5 s. The x

6enotes resonances due to small-molecule buffer impurities.

hBcl-2, followed by removal of unbound peptide asescribed under Materials and Methods, resulted insignificantly shifted spectrum, consistent with the

ormation of a specific complex (Fig. 4B). The averageesonance line widths for both complexed and un-omplexed rhBcl-2 are consistent with those ex-ected for a predominantly monomeric species of18 kDa.

ax BH3 Peptide Binding Affinity

This assay measures the ability of ligand to competeith in vivo folded human Bcl-2 for binding to a Baxeptide (based on the known BH3 domain sequencerom Bax). The aim of this experiment was to comparehe affinity of in vitro refolded and purified rhBcl-2 tohat of in vivo folded human Bcl-2(1-218)-HHHHHH forinding to the Bax BH3 peptide. Using the assay for-at described earlier, the concentration of refolded

nd purified rhBcl-2 that gave a 50% inhibition of theignal in this assay (IC50) was 0.25 mM. This was foundo be less than a factor of 2 higher than the IC50 of inivo folded human Bcl-2 at 0.14 mM (Fig. 5).

enopus Egg Extract Caspase Inhibition Assay

Previous data have shown that a crude insect cellysate containing full-length, in vivo folded Bcl-2 inhib-ts the activation of the CPP-32 gene productcaspase-3) in this assay (17). Using this assay tech-ique, full-length in vivo folded Bcl-2 at a concentra-ion of ;300 nM was found to inhibit cleavage of theuorogenic peptide (data not shown). It has been dem-nstrated that in vitro folded rhBcl-2 at a concentra-ion of ;300 nM was an equally effective inhibitor (Fig.

ass spectrum of purified rhBcl-2.

).

D

smBaaapwors

roi

anpbL

attH

9tew;pmEmsiwwt(

aicc

Fict

FvBft

168 ANDERSON ET AL.

ISCUSSION

We have expressed rhBcl-2 at high level, defined auccessful refolding route, and purified it to near ho-ogeneity. Refolded and purified rhBcl-2 is active in aax BH3 peptide binding assay and inhibits caspasectivation. 1H NMR indicates that the protein is foldednd monomeric in solution at ;100 mM concentrationnd is capable of binding a Bax BH3 domain-derivedeptide under these conditions. Expression of rhBcl-2as estimated at 50 mg per g wet cell paste, and theverall yield of 5 mg per g wet cell paste was compa-able with that reported for murine Bcl-2(1–203) using aimilar expression system (24).

L-Arginine has been used successfully to enhance theefolding of recombinant mouse Bcl-2 (24) as well asther proteins (32–35). Despite this, its mode of action

IG. 5. Competition assay for binding to Bax BH3 peptide by inivo folded c-myc tagged human Bcl-2 using (A) in vivo folded humancl-2 (without c-myc tag); IC50 calculated as 0.14 mM, and (B) re-

olded, purified rhBcl-2; IC50 calculated as 0.25 mM. Arrows denotehe IC50 values.

s not understood. In common with the strong denatur- (

nt guanidinium chloride, L-arginine contains a gua-idino group, but is thought to destabilize native foldedrotein structure much more weakly (36). It is widelyelieved that by mildly destabilizing the folded state,-arginine enhances protein folding by lowering thectivation energy for unfolding partially misfolded pro-ein, and so allows a greater proportion of the proteino reach the most energetically favorable folded state.owever, this hypothesis remains unproved.Edman sequencing indicated that approximately

0% of the purified rhBcl-2 retained the initiating me-hionine, a result which was in agreement with thelectrospray mass spectrometry data. Other proteinsith threonine at amino acid position 1 typically retain10% of initiating methionine residues (D. Barratt,ersonal communication). The low level of N-terminalethionine removal is unlikely to reflect saturation of. coli methionine aminopeptidase, because a similarutation of Bcl-2 equally highly expressed in the same

train of E. coli was found to have full removal of thenitiating methionine (unpublished data). Previousork has suggested that a protein expressed in E. coliith a threonine residue adjacent to the initiating me-

hionine should retain the methionine in ;10% of cases37).

The affinity of rhBcl-2 for Bax BH3 peptide and itsbility to inhibit caspase activation provide strong ev-dence that the molecule is functionally active, a claimorroborated by the NMR spectroscopic data on theomplex with the Bax BH3 peptide. These findings also

IG. 6. Xenopus egg extract caspase inhibition assay. Fluoresencentensity is proportional to cleavage of fluorogenic peptide byaspase, and progress of cleavage with time is indicated under con-rol conditions (solid triangles) and in the presence of 300 nM rhBcl-2

solid squares).

aBao

ttNt

A

KJRtDam

R

1

1

1

1

1

1

1

1

1

1

2

2

2

2

2

2

2

2

2

2

3

3

3

169PURIFICATION OF HUMAN Bcl-2 FROM INCLUSION BODIES

ct as further evidence to support the hypothesis thatcl-2 is structurally highly homologous to Bcl-XL, sincesimilar construct of Bcl-XL had anti-apoptotic activity

nly marginally less than wild-type Bcl-XL in vivo (14).At the time of writing, structural studies are con-

inuing. It should be noted that the solubility limit forhis protein appears to be lower than ideal for X-ray- orMR-based structure determination under the solu-

ion conditions examined to date (unpublished data).

CKNOWLEDGMENTS

We gratefully acknowledge the assistance of Dave Holland andaren Malbon for oligonucleotide synthesis, Phil Trueman, Sarahones, and Donna Massey for DNA sequencing, Janice Young andachel Williams for Edman sequencing, and Steve Rayner for elec-

rospray mass spectrometric analysis. Thanks are also due to Rickavies for practical advice on the use of Ni-NTA chromatographynd to Derek Barratt for data relating to processing of initiatingethionine in E. coli.

EFERENCES

1. Thompson, C. B. (1995) Apoptosis in the pathogenesis and treat-ment of disease. Science 267, 1456–1462.

2. Raff, M. C. (1992) Social controls on cell survival and cell death.Nature 356, 397–400.

3. Tsujimoto, Y., Gorham, J., Cossman, J., Jaffe, E., and Croce,C. M. (1985) The t(14;18) chromosome translocations involved inB-cell neoplasms result from mistakes in VDJ joining. Science229, 1390–1393.

4. Korsmeyer, S. J. (1995) Regulators of cell death. Trends Genet.11, 101–105.

5. Vaux, D. L., Cory, S., and Adams, J. M. (1988) Bcl-2 gene pro-motes haemopoietic cell survival and cooperates with c-myc toimmortalize pre-B cells. Nature 335, 440–442.

6. Nunez, G., London, L., Hockenbery, D., Alexander, M., McKearn,J. P., and Korsmeyer, S. J. (1990) Deregulated Bcl-2 gene ex-pression selectively prolongs survival of growth factor-deprivedhemopoietic cell lines. J. Immunol. 144, 3602–3610.

7. Hockenbery, D. M., Oltvai, Z. N., Yin, X.-M., Milliman, C. L., andKorsmeyer, S. J. (1993) Bcl-2 functions in an antioxidant path-way to prevent apoptosis. Cell 75, 241–251.

8. Inohara, N., Ding, L., Chen, S., and Nunez, G. (1997) harakiri, anovel regulator of cell death, encodes a protein that activatesapoptosis and interacts selectively with survival-promoting pro-teins Bcl-2 and Bcl-XL. EMBO J. 16, 1686–1694.

9. White, E. (1996) Life, death, and the pursuit of apoptosis. GenesDev. 10, 1–15.

0. O’Connor, L., Strasser, A., O’Reilly, L. A., Hausmann, G., Ad-ams, J. M., Cory, S., and Huang, D. C. S. (1998) Bim: a novelmember of the Bcl-2 family that promotes apoptosis. EMBO J.17, 384–395.

1. Farrow, S. N., and Brown, R. (1996) New members of the Bcl-2family and their protein partners. Curr. Opin. Genet. Dev. 6,45–49.

2. Reed, J. C. (1997) Double identity for proteins of the Bcl-2 family.Nature 387, 773–776.

3. Oltvai, Z. N., and Korsmeyer, S. J. (1994) Checkpoints of duelingdimers foil death wishes. Cell 79, 189–192.

4. Muchmore, S. W., Sattler, M., Liang, H., Meadows, R. P., Har-lan, J. E., Yoon, H. S., Nettesheim, D., Chang, B. S., Thompson,

C. B., Wong, S. L., Ng, S. L., and Fesik, S. W. (1996) X-ray and

NMR structure of human Bcl-XL, an inhibitor of programmedcell death. Nature 381, 335–341.

5. Minn, A. J., Velez, P., Schendel, S. L., Liang, H., Muchmore,S. W., Fesik, S. W., Fill, M., and Thompson, C. B. (1997) Bcl-XL

forms an ion channel in synthetic lipid membranes. Nature 385,353–357.

6. Schendel, S. L., Xie, Z., Montal, M. O., Matsuyama, S., Montal,M., and Reed, J. C. (1997) Channel formation by antiapoptoticprotein Bcl-2. Proc. Natl. Acad. Sci. USA 94, 5113–5118.

7. Cosulich, S. C., Green, S., and Clarke, P. R. (1996) Bcl-2 regu-lates activation of apoptotic proteases in a cell-free system. Curr.Biol. 6, 997–1005.

8. Rao, L., and White, W. (1997) Bcl-2 and ICE family of apoptoticregulators: making a connection. Curr. Opin. Genet. Dev. 7,52–58.

9. Yuan, J., and Horvitz, H. R. (1990) The Caenorhabditis elegansgenes ced-3 and ced-4 act cell autonomously to cause pro-grammed cell death. Dev. Biol. 138, 33–41.

0. Alnemri, E. S., Livingston, D. J., Nicholson, D. W., Salvesen, G.,Thornberry, N. A., Wong, W. W., and Yuan, J. (1996) HumanICE/CED-3 protease nomenclature. Cell 87, 171.

1. Liu, X., Kim, C. N., Yang, J., Jemmerson, R., and Wang, X.(1996) Induction of apoptotic program in cell-free extracts: Re-quirement for dATP and cytochrome c. Cell 86, 147–157.

2. Kluck, R. M., Bossy-Wetzel, E., Green, D. R., and Newmeyer,D. D. (1997) The release of cytochrome c from mitochondria: Aprimary site for Bcl-2 regulation of apoptosis. Science 275, 1132–1136.

3. Yang, J., Liu, X., Bhalla, K., Kim, C. N., Ibrado, A. M., Cai, J.,Peng, T.-I., Jones, D. P., and Wang, X. (1997) Prevention ofapoptosis by Bcl-2: Release of cytochrome c from mitochondriablocked. Science 275, 1129–1132.

4. Vance, B. A., Zacharchuk, C. M., and Segal, D. M. (1996) Recom-binant mouse Bcl-2(1-203). Two domains connected by a longprotease-sensitive linker. J. Biol. Chem. 271, 30811–30815.

5. Haldar, S., Jena, N., Dubois, G. C., Takayama, S., Reed, J. C.,Fu, S. S., and Croce, C. M. (1994) Purification and characteriza-tion of the bcl-2 protein. Arch. Biochem. Biophys. 315, 483–488.

6. Studier, F. W., and Moffatt, B. A. (1986) Use of bacteriophage T7RNA polymerase to direct selective high-level expression ofcloned genes. J. Mol. Biol. 189, 113–130.

7. Kara, B. V., and Hockney, R. C. (1991) Leucine imbalance stim-ulates accumulation of G-CSF in E. coli, in “Biologicals fromRecombinant Microorganisms: Production and Recovery” (M. D.White, S. Reuveny, and A. Shafferman, Eds.), pp. 47–53, VCH,Weinheim.

8. Laemmli, U. K. (1970) Cleavage of structural proteins during theassembly of the head of bacteriophage T4. Nature 227, 680–685.

9. Cosulich, S. C., Worrall, V., Hedge, P. J., Green, S., and Clarke,P. R. (1997) Regulation of apoptosis by BH3 domains In a cell-free system. Curr. Biol. 7, 913–920.

0. Lazebnik, S. H., Kaufmann, S. H., Desnoyers, S., Poirier, G. G.,and Earnshaw, W. C. (1994) Cleavage of poly(ADP-ribose) poly-merase by a proteinase with properties like ICE. Nature 371,346–347.

1. Nicholson, D. W., Ali, A., Thornberry, N. A., Vaillancourt, J. P.,Ding, C. K., and Gallant, M. (1995) Identification and inhibitionof the ICE/CED-3 protease necessary for mammalian apoptosis.Nature 376, 37–43.

2. Rudolph, R. (1990) Renaturation of recombinant, disulfide-bonded proteins from inclusion bodies, in “Modern Methods inProtein and Nucleic Acid Research” (H. Tschesche, Ed.), pp.

149–172, de Gruyter, New York.

3

3

3

3

3

170 ANDERSON ET AL.

3. Buchner, J., and Rudolph, R. (1991) Renaturation, purificationand characterization of recombinant Fab-fragments produced inEscherichia coli. Bio/Technology 9, 157–162.

4. Brinkmann, U., Buchner, J., and Pastan, I. (1992) Independentdomain folding of Pseudomonas exotoxin and single-chain im-munotoxins: Influence of interdomain connections. Proc. Natl.Acad. Sci. USA 89, 3075–3079.

5. Lin, W. J., and Traugh, J. A. (1993) Renaturation of casein

kinase II from recombinant subunits produced in Escherichia

coli: Purification and characterization of the reconstituted ho-loenzyme. Protein Expression Purif. 4, 256–264.

6. Rudolph, R., and Lilie, H. (1996) In vitro folding of inclusion bodyproteins. FASEB J. 10, 49–56.

7. Hirel, P.-H., Schmitter, J.-M., Dessen, P., Fayat, G., and Blan-quet, S. (1989) Extent of N-terminal methionine excision fromEscherichia coli proteins is governed by the side-chain length ofthe penultimate amino acid. Proc. Natl. Acad. Sci. USA 86,

8247–8251.