UNIVERSIDADE DE LISBOA

INSTITUTO SUPERIOR TÉCNICO

Redesign of Lactic Acid Bacteria for

plasmid DNA production

A strategy for increase the plasmid copy number

Maria Santos Carlos Martins

Supervisors: Prof. Gabriel António Amaro Monteiro, Prof. José António Leonardo dos Santos

Examination Committee

Chairperson: Prof. Leonilde de Fátima Morais Moreira

Supervisor: Prof. Gabriel António Amaro Monteiro

Member of the Committee: Prof. Duarte Miguel de França Teixeira dos Prazeres

Thesis to obtain the Master of Science Degree in

Biotechnology

December 2015

ii

“Our greatest weakness lies in giving up. The most certain way to succeed is always to

try just one more time”

Thomas A. Edison

iii

Acknowledgements

In first place, I would like to thank to my supervisor, the Professor Gabriel Monteiro, for all

the support, for the confidence when accepted me to this project and for the constant availability

to discuss ideas, answer to my questions and give suggestions to improve my work. In addition

I also thanks to Professor José Santos for all the help and advices.

In the other hand, I want to leave a big thanks to PhD student Sofia Duarte which has a

contagious love for “our” lactic acid bacteria and a huge dedication to the laboratory which helps

anyone to feel comfy to ask questions and for help. In addition, I am also grateful to her by all

the techniques and procedures that she taught me and by our constant change of ideas that in

many times was privileged moments where emerge new ideas for our works . Furthermore, I

want leave in this work my contentment to Sofia for our team spirit and for the mutual trust

because together during this last year we really work has a good team which was essential

especially in the more filled days and in some disappointing moments after failed attempts.

Moreover I want to express my acknowledgement to the master Sílvia Andrade for the

transmission of all her knowledge and the state of the art of the project that she started and I

continued. I also want to say thanks to her by all the time that she dedicated to teach me all the

procedures and techniques despite the fact that when I started the work she was in her last

weeks in the laboratory.

Furthermore, I want thanks to Claúdia Alves to all change of ideas and support in the

laboratory, especially in more “engineer techniques” which in several moments was very

important to this biologist and for the company in the long days of cell growths.

I also want to thank to my other laboratory colleagues, specially to Sara Sousa Rosa, Cátia

Jorge, Inês Meleiro, Rita Santos, Diana Cipriano and João Filipe and to all the others

colleagues of IBB group, for all the availability to help me and give me suggestions to improve

my work. In addition, I want to let the recognition to technician Ricardo Pereira and Dona Rosa

for the constant work to maintain the laboratory working and for all the help.

In addition, I want to express my gratitude for the unconditional support and constant help of

my mother and father, that even though they don’t understand my work they constant try to

understand and help me. I also say thanks to my brother by the constant good mood that

cheers me up especially when the work doesn’t go so well. Furthermore I would like to thank to

my cousin, Rosarinho, for the constant support and interest in the development of my work. I

also want to thank to the rest of my family, namely to my grandmother, Rosário for the constant

interest and support.

In the other hand, I would like to thank to my friends, especially Marta, Joana and Carlos,

for the support and friendship. And finally to my scout family, by the constant support and

encouragement especially during this year that I decided to do the formation for chief of the

scouts at the same time that I’m doing the master thesis.

iv

Abstract

Vaccines based on plasmid DNA are promising tools for prevention of infectious diseases

and treatment of autoimmune diseases and cancers. Nowadays, plasmids are produced by E.

coli cells which produce lipopolysaccharides that can co-purify with pDNA and generate

inflammatory responses. This work proposes the use of lactic acid bacteria (LAB) as host cells

for pDNA production. LAB are recognized as GRAS microorganisms and associated with

probiotic characteristics. However, LAB produce much less amount of plasmid then E. coli and

so this work aims to redesign LAB and plasmid sequences for the improvement of pDNA

production.

The ribosome binding site (RBS) of the pAMβ1 origin of replication of the pTRKH3 plasmid

was modified by site-directed mutagenesis in order to increase the expression of RepE protein

and a consequent increase plasmid copy number (PCN) in LAB. The quantification of PCN of

modified plasmids was performed by an optimized Real-Time PCR method in which the

determination of the PCN was based in the ratio between the amplification of erm gene present

in pTRKH3 and of the amplification of the single-copy housekeeping feoA gene, in which were

considered the amplification efficiencies of each gene. After a preliminary optimization of the

culture conditions for highest plasmid production Lactococcus lactis LMG 19460 grown in

shake-flask using M-17 medium supplemented with 20g/l of glucose was able to harbour

71.4±14.4 copies of the non-modified plasmid pTRKH3 and 261.7±42.3 copies of a modified

pTRKH3_3nuc plasmid. This value of PCN turns this system into a valid alternative for pDNA

production.

Key-words: DNA vaccines, lactic acid bacteria, plasmid DNA, ribosome binding site,

plasmid copy number, Quantitative Real-time PCR.

v

Resumo

As vacinas baseadas em plasmídeos (pDNA) são ferramentas promissoras na

prevenção de doenças infeciosas e tratamento de doenças autoimunes e cancros. Atualmente,

a produção é realizada em E. coli que produz lipopolissacáridos que podem ser co-purificados

com o pDNA e originar respostas inflamatórias. Neste trabalho, as células hospedeiras para a

produção de pDNA serão as bactérias ácido-lácticas, microrganismos com o estatuto GRAS

associados a características probióticas. Contudo estas produzem uma muito menor

quantidade de pDNA que E. coli, como tal o objetivo deste trabalho é redesenhar bactérias

ácido-lácticas e plasmídeos para aumentar a produção de pDNA.

O local de ligação ao ribossoma da origem de replicação pAMβ1 do plasmídeo

pTRKH3 foi alvo de mutagénese dirigida para aumentar a expressão da proteína RepE e

consequentemente aumentar o número de cópias de pDNA em bactérias ácido-lácticas. A

determinação do número de cópias de plasmídeo foi realizada através um método otimizado de

PCR em tempo real, baseado na amplificação do gene erm presente no pTRKH3 em relação à

amplificação do gene endógeno, feoA, tendo em conta as diferenças de eficiência de

amplificação dos dois genes. Depois de uma otimização das condições de cultura favoráveis a

uma maior produção de pDNA em Lactococcus lactis LMG 19460, num crescimento celular em

Erlenmeyer com o meio de cultura M-17 suplementado com 20g/l de glucose, esta estirpe

apresenta 71.4±14.4 cópias do plasmídeo não modificado e 261.7±42.3 cópias do plasmídeo

modificado pTRKH3_3nuc. Estes números de cópias tornam este sistema numa alternativa

válida para a produção de pDNA.

Palavras-chave: vacinas de DNA, bactérias ácido-lácticas, DNA plasmídico, local de

ligação ao ribossoma, número de cópias de plasmídeo, PCR Quantitativo em Tempo Real.

vi

List of contents

1. Introduction ................................................................................................................................................... 1

1.1. Plasmid DNA and Vaccines .................................................................................................................... 1

1.2. Plasmid DNA Manufacture ..................................................................................................................... 4

1.3. Lactic Acid Bacteria ................................................................................................................................ 6

1.3.1. Industrial Applications of Lactic Acid Bacteria ....................................................................................... 7

1.3.2.Applications in Human Health of Lactic Acid Bacteria ............................................................................ 8

1.3.3.Plasmids and Lactic Acid Bacteria ......................................................................................................12

1.3.4.Plasmid Mechanisms of Replication ....................................................................................................13

1.3.5.Plasmid Copy Number .......................................................................................................................14

1.3.5.1. Mechanisms of Plasmid Copy Number Control ................................................................................15

1.3.6.pTRKH3 – a useful vector for Lactic Acid Bacteria ...............................................................................16

1.3.7. Replicon pAMβ1 ...............................................................................................................................18

1.3.8. Ribosome Binding Site and its role ....................................................................................................19

2. Materials and Methods .................................................................................................................................20

2.1. Bacterial Strains and Plasmids ..............................................................................................................20

2.2. Growth conditions of E. coli DH5α..........................................................................................................20

2.3.DH5α Chemically Competent cells ..........................................................................................................21

2.4. Transformation of E. coli DH5α with pTRKH3 and purification of the vector .............................................21

2.5. Digestion of pTRKH3.............................................................................................................................21

2.6. Modification of RBS in pAMβ1 origin of pTRKH3 ....................................................................................22

2.6.1. Site Directed Mutagenesis .................................................................................................................22

2.7. Culture conditions of L. lactis LMG 19460 and L. plantarum CCUG 61730 ..............................................23

2.8. LAB Electrocompetent Cells ..................................................................................................................23

2.9. Electroporation of L. lactis LMG 19460 and L. plantarum CCUG 61730 and plasmid purification ..............24

2.10. Colony PCR ........................................................................................................................................25

2.11. Gene Knock-out Strategy ....................................................................................................................26

2.12. Molecular Distinction of Lactococcus lactis LMG 19460 and Lactobacillus plantarum CCUG 61730 .......27

2.13. Equivalence Between Optical Density and Number of Cells ..................................................................28

2.14. L. lactis LMG 19460 growth conditions to evaluate pDNA copy numbers ...............................................29

2.14.1. Microplate cell growth of L. lactis LMG 19460 ...................................................................................29

2.14.2. Shake-flask cell growth of L. lactis LMG 19460.................................................................................30

2.15. Quantitative RT-PCR analysis of plasmid copy number in L. lactis cells ................................................31

2.15.1. Preparation of pDNA and gDNA standards.......................................................................................31

2.15.2. Sample preparation for qPCR ..........................................................................................................32

2.15.3. Real-Time quantitative PCR for determination of plasmid content .....................................................33

2.15.4. Confirmation of amplification specificity ............................................................................................33

2.15.5. Plasmid copy number determination based in the use of the Relative Quantification method of Real-Time PCR ..........................................................................................................................................33

2.15.6. Plasmid copy number determination based in the Standard Curve Method .........................................34

2.15.7. Statistical analysis of Quantitative Real-Time Results .......................................................................34

2.16. Miniprep analysis of plasmid copy number in L. lactis cells ...................................................................34

3. Results and Discussion ................................................................................................................................35

3.1. Modification of RBS in pAMβ1 origin of pTRKH3 ....................................................................................35

vii

3.2. Equivalence between Optical Density and Number of Cells ....................................................................36

3.3. Optimization of electroporation of L. lactis LMG 19460 and L. plantarum CCUG 61730 ...........................37

3.4. Gene Knock-out Strategy – Preliminary Results .....................................................................................40

3.5. Molecular distinction of Lactococcus lactis LMG 19460 and Lactobacillus plantarum CCUG 61730 ..........44

3.6. Optimization of L. lactis LMG 19460 growth conditions to study pDNA copy numbers ..............................46

3.6.1. Optimization of culture volume in microplate and shake-flask systems ................................................46

3.6.2. Optimization of growth medium in microplate .....................................................................................48

3.7. Cell growth in the optimized conditions of L. lactis LMG 19460 transformed with pTRKH3 and its derivatives to study pDNA copy numbers in the microplate and shake-flask systems .....................................51

3.8. Plasmid Copy Number Quantification of L. lactis transformed with pTRKH3 and its derivatives ................56

3.8.1. Preliminary Plasmid Copy Number Quantification by Miniprep ............................................................56

3.8.2. Quantitative Real-Time PCR for determination of plasmid copy number - Standard Curve Method .......58

3.8.3. Improved method of Quantitative Real- Time PCR for determination of plasmid copy number – based in a endogenous control ...................................................................................................................60

4. Conclusion ...................................................................................................................................................65

5. Future Work .................................................................................................................................................66

6. References ..................................................................................................................................................67

Appendix .........................................................................................................................................................73

Appendix I- Agarose electrophoresis gel with the products of real-time PCR procedure. .................................73

Appendix II- Melting curves of the two real-time PCR products. .....................................................................73

List of figures

Figure 1- LPS molecules inside a membrane of Gram-negative bacteria. .................................................. 3

Figure 2- Steps of pDNA manufacture. .................................................................................................... 4

Figure 3- Applications of Lactic Acid Bacteria in Industry. ......................................................................... 8

Figure 4- Applications in human health of Lactic Acid Bacteria................................................................ 12

Figure 5- Rolling-circle and theta mechanisms of plasmid replication. ..................................................... 14

Figure 6 - ctRNA-based replication control. ............................................................................................ 16

Figure 7 - Physical map of plasmid pTRKH3. ......................................................................................... 17

Figure 8- Schematic representation of the replication region of pAMβ1. .................................................. 18

Figure 9 - Agarose gel electrophoresis showing the products of a double digestion of pTRKH3 with two

restriction enzymes HindIII and EcoRI. .................................................................................................. 35

Figure 10 - Sequencing result of the site-directed mutagenesis procedure with the first pair of mutagenic

primers (F3 and R3) which originated the modified vector pTRKH3_3nuc...........................................36

Figure 11 - Sequencing result of the site-directed mutagenesis procedure with the second pair of

mutagenic primers (F2 and R2) which originated the modified vector pTRKH3_5nuc.. ............................. 36

Figure 12 - L. lactis cells in hemocytometer chamber. ............................................................................ 37

Figure 13 - Agarose gel electrophoresis of the products of colony PCR of L. plantarum CCUG 61730

transformed with pTRKH3. .................................................................................................................... 40

Figure 14 - Agarose gel electrophoresis with pKD13, pKD46 and pCP20 plasmids purified from E. coli

DH5α.. .................................................................................................................................................. 41

Figure 15 - Agarose gel electrophoresis of the product of colony PCR to Lactococcus lactis LMG 19460

transformed with pKD46. ....................................................................................................................... 43

Figure 16- Agarose gel electrophoresis of the product of PCR amplification of the kanamycin cassette. ... 43

Figure 17 - Agarose gel electrophoresis of the products of PCR reaction with primers hisG and recA in

both strains. .......................................................................................................................................... 44

Figure 18 - Agarose gel electrophoresis of the products of PCR reaction with primers hisG in L. lactis strain

transformed with the different plasmids. ................................................................................................. 46

Figure 19 - Growth curves of L. lactis in the different well culture volumes (5ml, 3.75ml, 2.5ml and 1.25ml)

in a microplate system........................................................................................................................... 47

viii

Figure 20 - Growth curve and pH variation of L. lactis transformed with pTRKH3 in the different shake-flask

culture volumes..................................................................................................................................... 47

Figure 21- Growth curve of L. lactis transformed with pTRKH3 in the six different mediums by using

microplate system.. ............................................................................................................................... 49

Figure 22 - pH variation of the six different media during the cell growth of L. lactis transformed with

pTRKH3 in microplate system. .............................................................................................................. 50

Figure 23 - Growth curve of L. lactis transformed with pTRKH3, pTRKH3_4nuc, pTRKH3_3nuc and

pTRKH3_5nuc in M-17 medium supplemented with 20g/l of glucose in microplate and shake-flask

systems.. .............................................................................................................................................. 52

Figure 24 - pH variation of L. lactis transformed with pTRKH3, pTRKH3_4nuc, pTRKH3_3nuc and

pTRKH3_5nuc in M-17 medium supplemented with 20g/l of glucose in microplate and shake-flask systems

. ........................................................................................................................................................... 53

Figure 25 - Growth curve of L. lactis transformed with pTRKH3, pTRKH3_4nuc, pTRKH3_3nuc and

pTRKH3_5nuc in MRS medium in microplate and shake-flask systems. ................................................. 54

Figure 26 - Growth curve of L. lactis transformed with pTRKH3, pTRKH3_4nuc, pTRKH3_3nuc and

pTRKH3_5nuc in M-17 medium in microplate and shake-flask systems.. ................................................ 54

Figure 27 - Growth curve of L. lactis transformed with pTRKH3, pTRKH3_4nuc, pTRKH3_3nuc and

pTRKH3_5nuc in MRS supplemented with 5g/l of lactose in microplate and shake-flask systems. ........... 54

Figure 28 - pH variation of L. lactis transformed with pTRKH3, pTRKH3_4nuc, pTRKH3_3nuc and

pTRKH3_5nuc in MRS, M-17 and MRS medium supplemented with 5g/l of lactose in microplate system. 55

Figure 29 - pH variation of L. lactis transformed with pTRKH3, pTRKH3_4nuc, pTRKH3_3nuc and

pTRKH3_5nuc in MRS, M-17 and MRS medium supplemented with 5g/l of lactose in shake-flask system.

............................................................................................................................................................ 55

Figure 30 - Plasmid copy number of pTRKH3 in the six different media in the final of the exponential phase

of cells grown in microplates (10h 30min) according to the miniprep quantification. ................................. 56

Figure 31- Plasmid copy number of pTRKH3, pTRKH3_4nuc, pTRKH3_3nuc and pTRKH3_5nuc in the

MRS medium, M-17 medium and MRS medium supplemented with lactose in microplate and shake-flask

system, in the final of the exponential phase of cell growth (10h 30min), according to miniprep

quantification. ....................................................................................................................................... 57

Figure 32 - Plasmid copy number of pTRKH3, pTRKH3_4nuc, pTRKH3_3nuc and pTRKH3_5nuc in the

MRS medium, M-17 medium and MRS medium supplemented with lactose in microplate and shake-flask

system, in the final of the exponential phase of cell growth (10h 30min), according to miniprep

quantification. ....................................................................................................................................... 57

Figure 33 - Plasmid copy number of pTRKH3, pTRKH3_4nuc, pTRKH3_3nuc and pTRKH3_5nuc in M-17

medium supplemented with glucose in two shake-flasks, according to miniprep quantification. ................ 58

Figure 34 - Standard curve based in the erm gene amplification used to quantify the plasmid copy number

of pTRKH3 and its derivatives (pTRKH3, pTRKH3_4nuc, pTRKH3_5nuc).. ............................................. 59

Figure 35 - Plasmid copy number of pTRKH3, pTRKH3_4nuc, pTRKH3_3nuc and pTRKH3_5nuc in M-17

medium supplemented with 20 g/l of glucose in two shake-flasks, according to the Standard Curve

Method. ................................................................................................................................................ 59

Figure 36 - Standard curve based in the endogenous single-copy gene amplification (feoA gene) used to

quantify the plasmid copy number of pTRKH3 and its derivatives (pTRKH3, pTRKH3_4nuc,

pTRKH3_5nuc).. ................................................................................................................................... 60

Figure 37- Plasmid copy number of pTRKH3 in the six different media according to the quantitative Real-

Time Method which use the relation of amplification between the plasmid gene (erm) and the endogenous

single-copy gene (feoA). ....................................................................................................................... 61

Figure 38 - Plasmid copy number of pTRKH3, pTRKH3_4nuc, pTRKH3_3nuc and pTRKH3_5nuc in the

MRS medium, M-17 medium and MRS medium supplemented with lactose in microplate and shake-flask

system according to the Quantitative Real-Time Method which use the relation of amplification between

the plasmid gene (erm) and the endogenous single-copy gene (feoA). ................................................... 62

Figure 39- Plasmid copy number of pTRKH3, pTRKH3_4nuc, pTRKH3_3nuc and pTRKH3_5nuc in M-17

medium supplemented with glucose in microplate system , at two different of cell growth times (10h

30min and 24h) according to the Quantitative Real-Time Method which use the relation of amplification

between the plasmid gene (erm) and the endogenous single-copy gene (feoA).. ..................................... 63

Figure 40 - Plasmid copy number of pTRKH3, pTRKH3_4nuc, pTRKH3_3nuc and pTRKH3_5nuc in M-17

medium supplemented with glucose in two shake-flasks, according to the Quantitative Real-Time Method

which use the relation of amplification between the plasmid gene (erm) and the endogenous single-copy

gene (feoA). .......................................................................................................................................... 64

ix

List of tables

Table 1- Probiotic effects of Lactic Acid Bacteria on human health.. .......................................................... 9

Table 2 - Characteristics of the bacterial strains used in this work. .......................................................... 20

Table 3 - Plasmid vectors used in this work. ........................................................................................... 20

Table 4 - Mutagenic primers for Site Directed Mutagenesis. ................................................................... 22

Table 5 - Strategy to realize the Site Directed Mutagenesis of RBS. ....................................................... 22

Table 6 - Electroporation conditions of L. lactis LMG 19460 and L. plantarum CCUG 61730. ................... 25

Table 7 - Primers for erythromycin gene used in the PCR colony procedure............................................ 25

Table 8 - Primers for ampicillin resistance gene of pKD46 and for the generation of kanamycin cassette. 27

Table 9 - Species-specific primers for Molecular Distinction of Lactococcus lactis LMG 19460 and

Lactobacillus plantarum CCUG 61730. .................................................................................................. 28

Table 10- Primers sequence for erm and feoA genes used in the quantitative RT-PCR procedure and size

of amplified fragments for the both primers used. ................................................................................... 32

Table 11 - Electroporation conditions and number of transformants of L. lactis and L. plantarum strains

with the different vectors (pTRKH3, pTRKH3_3nuc, pTRKH3_4nuc, pTRKH3_5nuc). ............................. 38

Table 12 - Result from the purification (O.D.600nm, concentration and ratios) of colonies originated from two

different electroporation conditions of L. plantarum strain: A - 1010

cells, 1,000ng of pTRKH3 and 1,250V of

electric pulse; B - 3×1010

cells, 1,000ng of pTRKH3 and 1,250V of electric pulse. ................................... 39

Table 13 - Summary table with the amplicons sizes from the genes that were used for species

identification. ........................................................................................................................................ 44

Table 14 - pTRKH3 purification concentrations after 10h 30min of cell growth in the different shake-flask

culture volumes..................................................................................................................................... 48

Table 15 - Maximum specific growth rates in the six different media (MRS, M-17, Elliker, MRS

supplemented with 5g/l of lactose, M-17 medium supplemented with 20g/l of glucose, M-17 medium

supplemented with 20g/l of glucose and 13.2mM of sodium citrate).....................................................50

Table 16 - Maximum specific growth rates of L. lactis transformed with pTRKH3, pTRKH3_4nuc,

pTRKH3_3nuc and pTRKH3_5nuc in M-17 medium supplemented with 20g/l of glucose in microplate and

shake-flask systems. ............................................................................................................................. 52

x

List of abbreviations

BLG - betalactoglobulin

bp - base pair

CD - Crohn’s disease

ctRNA - countertranscript RNA

CV-N - microbiocidal cyanovirin-N

DNA - Deoxyribonucleic acid

dsDNA - double-strand DNA

dso - plus origin of replication

EFSA - European Food Safety Authority

FDA - Food and Drug Administration

GRAS - Generally recognized as safe

HIC - Hydrophobic Interaction

Chromatography

LAB - Lactic Acid Bacteria

LB - Luria Bertani Medium

LPS - Lypopolysaccharide

MCS - Multiple Cloning Site

MRS – Man, Rogosa and Sharpe Medium

ORF - Open Reading Frame

PCN - Plasmid copy number

pDNA - plasmid DNA

qPCR - Quantitative PCR

QPS - Qualified Presumption of Safety

RBS - ribosome binding site

RC - rolling-circle

Rep - Replication protein

RNA - Ribonucleic Acid

SD - Shine-Dalgarno

SEC - Size-exclusion Chromatography

ssDNA - single strand DNA

sso - single-strand origin

UTR - untranslated region

1

1. Introduction

1.1. Plasmid DNA and Vaccines

Besides chromossomal DNA, some bacteria can harbour independent genetic elements,

called plasmids. A plasmid is a small, double-stranded circular or linear DNA molecule capable of

autonomous replication. Plasmids (pDNA) are naturally present in many bacterial species, and they

also take place in some eukaryotes. Often, the genes carried in plasmids provide bacteria with genetic

advantages, such as antibiotic resistance or metabolic pathways useful under certain environmental

conditions although they are likely to constitute a slight metabolic burden to the host. To be stably

maintained in their hosts minimizing the metabolic burden, plasmids control their replication,

consequently the copy number of a given plasmid within a specific host and growth conditions. [1, 2]

Over the years, scientists have taken advantage of pDNA to use as tool to clone, transfer, and

manipulate genes for many different types of applications. In the last decades, pDNA has been a very

useful source for the development of biopharmaceuticals, mainly for gene therapy and DNA

vaccination. The discovery that plasmid DNA vaccines can induce both humoral and cellular immune

responses in several disease models, offers the potential to develop a new and safer generation of

vaccines. Since 1995, the approved gene-therapy protocols using plasmid DNA-based delivery vectors

increased exponentially, representing around 25% of the current gene therapy clinical trials. [3,4,5,6,7,8]

Vaccines based on pDNA are very promising tools both for the prevention of infectious

diseases (e.g. malaria, tuberculosis, HIV and others) and for the treatment of autoimmune and cancer

diseases. The development of this new generation of vaccines is only possible due to the ability to

induce both humoral and cellular immune responses against antigens encoded by recombinant DNA,

including the activation of CD8+ and CD4

+ T lymphocytes, which secrete cytokines and have a

regulatory role in antibody production.[6,9,8]

pDNA vaccines have shown several advantages over

current vaccines, which includes: induction of cellular and humoral immune responses; flexible genetic

design; lack of infection risk; stability of reagents; the relatively low cost of manufacturing in a

microbial host; and easy conditions of store (without necessity of refrigeration during the distribution of

the vaccines). Other additional advantage of the DNA vaccines is the fact that these vectors are non-

replicating outside the bacterial host, encode and express only the target antigen, and are not live and

consequently cannot revert to a disease causing form as the case of viral vectors. [4, 5, 6, 7]

pDNA vaccines have two general features reflecting its dual functionality: the unit responsible

for propagation in microbial cells and the unit that expresses the vaccine gene in the transfected

eukaryotic cells. For achieve this dual functionality are required: (i) an origin of replication allowing for

growth in bacteria; (ii) a bacterial antibiotic resistance gene (for plasmid selection during bacterial

culture); (iii) a promoter for optimal expression in mammalian cells; (iv) a polyadenylation sequence for

stabilization of mRNA transcripts; and (v) specific nucleotide sequences that play a central role in the

immunogenicity of these vaccines. [4, 6, 7]

2

Escherichia coli is the most used host for the propagation of pDNA, because it is very robust,

able of fast growth with minimal nutritional requirements, can provide high pDNA yields, the

procedures for downstream processing of plasmid in this host are already very well-established and

finally the genome of E. coli is completed sequenced which facilitates the application of molecular

techniques. However E. coli has some disadvantages like genetic instability and as Gram-negative

bacteria contains extremely immunogenic endotoxins, or lipopolysaccharides (LPS) in its outer

membrane, which results in safety concerns regarding its use. [4, 5]

The lipopolysaccharides have a strong effect on the mammalian immune system and are of

huge significance in the pathophysiology of many disease processes. LPS are expressed in all Gram-

negative bacteria and are essential to the structural and functional integrity of the Gram-negative

bacteria outer membrane. Lipopolysaccharides are consisted by conserved regions comprising the

critical molecules that are shared between bacterial species which assist in either the development

and/or maintenance of a component/structure that is critical for survival of the bacteria, and by the

variable regions containing segments that are not essential for the bacteria, allowing for evolutionary

variation catastrophic consequences. [10, 11]

In other hand, lipopolysaccharides are one of the primary targets of the innate arm of the

mammalian immune system. Recognition of the presence of LPS by cells such as monocytes and

macrophages give to the mammalian host a rapid recognition and reaction way to the Gram-negative

infections. This innate response against LPS normally involves the release of a range of

proinflammatory mediators, like TNF-α, IL-6 and IL1β, which in confined sites of infection and in

modest levels benefit the host by promoting inflammation and priming the immune system to eliminate

the invading organisms. But, in situations where the body is extremely exposed to LPS or systemically

(e.g. when LPS enters into the blood stream) a systemic inflammatory reaction can take place, leading

to multiple organ failure, sepsis shock and potentially death. [10, 11]

The lipopolysaccharides are constituted by three domains: the lipid A, the polysaccharide core

and the O antigen which are represented in the Figure 1. Lipid A is the highly hydrophobic and is the

endotoxically active part of the molecule. Normally, lipid A is composed of glucosamine-based

phospholipids, like β-D-GlcN-(1-6)-α-D-GlcN disaccharide, and constitutes the outer monolayers of the

outer membranes of the majority of the Gram-negative bacteria. The polysaccharide core structure is

much conserved between different strains and species and is divided in inner and outer core. The

inner core is adjacent to the lipid A and consists in a high proportion of unusual sugars such as 3-

deoxy-D-manno-octulosonic acid and L-glycero-D-manno heptose. The outer core extends further

from the bacterial surface and is more probably consisted of more usual sugars such as hexoses and

hexosamines. The O-polysaccharide, or O-chain is usually composed of the repeating units of one to

eight glycosyl residues and this composition differs between strains by means of the sugars,

sequence, chemical linkage, substitution, and ring forms utilized. The O-chain is the outermost part of

the LPS molecules expressed on bacteria so it is the major antigen targeted by host antibody

responses. This region is also recognized by the innate arm of the immune system, playing a role in

both the activation and inhibition of complement activation. [10, 12, 13]

3

Figure 1- LPS molecules inside a membrane of Gram-negative bacteria. [59]

Since of the net negative charge of both LPS and DNA, these molecules could be co-purified

by the ion exchange principle used in the purification of plasmid DNA, but the existing commercial kits

can exclude the LPS molecules. On the other hand, the utilization of Gram-positive hosts, which do

not produce LPS, abolishes this dependency on the absolute efficiency of LPS-removing purification

procedures. [4]

Furthermore, the E. coli vaccine plasmids are normally maintained during growth by plasmid

encoded antibiotic resistance and addition of antibiotics to the growth medium. Consequently,

antibiotics may be contaminants in the purified DNA vaccines with the risk of inducing allergic

responses in some predisposed individuals. In addition, in the last decades a huge scientific and

regulatory focus has grown around the use of antibiotic resistance genes, by for the reason that the

pDNA may transform the microflora of the patients by spreading of the resistance genes. [4]

By the reasons mentioned above, currently have been developed some works investigating

other hosts microorganisms, such as the food-grade organisms, Lactic Acid Bacteria (LAB) like

Lactococcus lactis, as hosts for production of pDNA vaccines due to the lack of LPS molecules

(because LAB are Gram-positive bacteria) and to its food grade status. But, taking into account the

benefits and drawbacks, E. coli is presently the most suitable host for pDNA production on industrial

scale. [4, 5]

Despite its huge potential, pDNA vaccines are still under development and a therapeutic

product for humans has not yet reached the market. Nowadays, only a few numbers of products are

licensed for veterinary applications (e.g. the West Nile Innovator a DNA vaccine for West Nile virus in

horses and the LifeTide-SW5 a gene therapy delivery for releasing of Growth hormone in pigs) and

several clinical trials in phase I, II and III. [5] The DNA vaccination market is growing and with it a

4

technological and economical need to improve production methods. For example, there are still

various opportunities to improve the upstream stages of plasmid vaccines manufacturing such as

development of host strains, one way to increase the yield and quality of a plasmid product. [4, 5, 6]

1.2. Plasmid DNA Manufacture

For one real application of pDNA in health is necessary to develop a large-scale plasmid DNA

manufacturing processes to move the gene therapy and DNA vaccines from the laboratory to the

clinical trials and finally to the market. Developing processes of pDNA begins at a bench scale, with

the construction and selection of suitable expression and production microorganisms, optimization of

cell growth conditions (upstream processing), followed by fermentation step and in the last the

isolation and purification steps (downstream processing). The three main steps of plasmid DNA

manufacturing (upstream processing, fermentation and downstream processing), are illustrated in the

Figure 2. [8]

Figure 2- Steps of pDNA manufacture. [8]

During the planing and preparation of the upstream processing and fermentation stages is

necessary to plan and take decisions about several aspects like: the design, selection and

optimization of suitable plasmid vectors, production microorganism strains (generally Escherichia coli

strains is the host strain most used) and growth conditions, with the view to obtain high quantities of

stable and supercoiled plasmid DNA. To take these decisions it is necessary to bear in mind that the

success of the purification steps, in order to obtain a high quantity of supercoiled pDNA, is

considerably affected by the impurities and contaminants present and in the process streams which

is closely related with the upstream and fermentation processing conditions. [8]

The supercoiled plasmid isoform is one significant parameter to determine the quality and to

control the final product as suggested by the Food and Drug Administration agency, because

supercoiled plasmids appears to be more efficient in generating an immune response, as already

showed in vivo tests. In this sense, has been developed studies on improving the chromatography

process to obtain this isoform separated from the others and in other study fields, like molecular

5

biology, in which the DNA gyrase and sigma factor σS (rpoS) genes have shown an significant role in

the regulation of plasmid topology and could be one potential gene mutation targets to increase

fraction of supercoiled in the plasmids produced. [5]

Other strategy that can improve the yield and the quality of the plasmid DNA produced is the

knockout of some genes in the producing strains, two good examples are the endA and recA genes.

The endA gene encodes a DNA-specific endonuclease 1 and recA codes for a protein fundamental for

the recBCD pathway of homologous recombination. Deletion of endA can improve the quality of

plasmid preparations by eliminating non-specific degradation of DNA by the endonuclease. But it is

needed to take into account that the plasmid nicking and degradation can also be caused by other

non-endA-mediated factors. In addition, the deletion of recA can give origin to a decrease in the

undesirable homologous recombination. The process of homologous recombination can gave origin to

changes in the pDNA as well as the formation of plasmid multimers, which originates an increasing in

plasmid free-cells. However, it is needed to take into consideration that the effect of these type of

mutations are very strain and/or plasmid dependent. [5]

After the fermentation stage is necessary realize the cell lysis step, generally by alkaline lysis,

following this step is produced a precipitate which is composed by cell debris, denatured proteins and

nucleic acids, and this must be removed normally by a solid-liquid operation (e.g. filtration). [8]

Subsequently, is required realize the clarification and concentration steps, projected to

eliminate proteins and host nucleic acids, to increase the plasmid mass fraction and to prepare

plasmid extracts for the later purification steps. The main objective in the clarification step is the

elimination of high molecular weight RNA. Subsequent to clarification step, pDNA is usually

concentrated by polyethylene glycol precipitation to eliminate remove small nucleic acids and to

reduce the volume of process streams before chromatographic purification. [8,14]

In the final step, are used the chromatography processes in order to separate supercoiled

plasmid DNA from structurally related impurities like open circular and linear plasmid DNA, genomic

DNA, high molecular weight RNA and endotoxins. Chromatography is a scalable and reproducible

method for the large-scale purification of supercoiled pDNA, in which the size and chemical properties

of the pDNA molecules (charge and hydrophobicity), the accessibility of the nucleotide bases to

ligands, and the topological constraints of the supercoiling are used to exploit the differential

interaction of the pDNA with solid supports. The selection of the chromatographic modalities is based

in the nature and distribution of the residual impurities and contaminants and by the plasmid dosage

necessary. One example of a chromatography strategy already used to produce plasmid

biopharmaceuticals uses in the first step the hydrophobic interaction chromatography (HIC) to the

initial capture, purification and concentration of supercoiled pDNA, in which by loading the column with

a high ionic strength is possible remove gDNA fragments, RNA, proteins and endotoxins. In the

second step is used size-exclusion chromatography (SEC) to separate supercoiled plasmid DNA from

other plasmid topoisomers (relaxed, linear and denatured plasmid) and to replace the plasmid medium

for the appropriate formulation or storage buffer. [6, 8]

6

1.3. Lactic Acid Bacteria

Lactic acid bacteria (LAB) constitute a taxonomic heterogeneous group of Gram-positive

bacteria, with many characteristics in common: facultative anaerobes, non-sporulating and non-motile

bacteria. This group includes species of Lactobacillus, Lactococcus, Leuconostoc, Enterococcus,

Pediococcus and Streptococcus. LAB with few exceptions, as the name indicates, are a group of

organisms that have the ability of produce a common end product the lactic acid, from the

fermentation of sugars, mainly glucose. In addition to lactic acid (homofermentative LAB), these

bacteria can also produce significant amounts of acetic acid, ethanol and carbon dioxide

(heterofermentative LAB). [15, 16, 17, 18, 19, 20]

LAB have limited biosynthetic capabilities and have the need of preformed amino acids, B-

vitamins, purines, pyrimidines, and a sugar as a carbon and energy source, which is converted in to

lactic acid. These nutritional needs limit their habitats to those in which the necessary compounds are

abundant. However, LAB reside in a huge number of niches, namely milk, wine, meat, plant surfaces,

the oral cavity, the gastrointestinal tract, and the vagina of vertebrates. Some specific species of LAB

are essential members of endogenous microbiota that is associated with many mucosa compartments

of the body, for example, in the human ileum and jejunum, lactobacilli and streptococci are highly

represented (103-10

5 organisms per gram of luminal contents). In addition, a huge number of different

species of LAB are a considerable part of the food chain and widespread in human, animal and plant

microflora. In many of these situations, LAB acts as commensal bacteria on mucosal surfaces and

skin of many animal species, but their incidence and distribution are different according to the animal

species. [16, 18, 19, 20, 21, 22, 23]

In addition, some lactic acid bacteria have a fundamental role in the maintenance of intestinal

homeostasis and have beneficial effect on physiologic and pathological processes of the host due to

their particular health-promoting characteristics, mainly their capacity to modulate the immune system.

Because of these health benefits, LAB have been characterized as probiotics. According to Food and

Agricultural Organization of United Nations probiotics are ““live microorganisms which when

administered in proper amounts confer a health benefit on the host”. The efficiency of probiotics is

strain-specific, and each strain can contribute to host in a strain-specific way and by different

mechanisms. Along the years lactic acid bacteria also have been associated to many probiotic

characteristics as detoxifying carcinogens, with the metabolism of cholesterol, with antimicrobial

activity and enhancement of mucosal barrier function against ingested pathogens in addition to the

most well-known probiotic characteristic as modulator of immune system. So many times, LAB are

commercialized as probiotics claimed to have health-promoting properties for the consumer. [16, 18, 19, 20,

21, 22, 23]

A big number of LAB species have a long and safe history of use in the production, the

consumption and in the preservation of fermented foods and beverages. As a result they are

Generally Recognized As Safe (GRAS) according to the U.S. Food and Drug Administration (FDA)

and fulfill criteria of the Qualified Presumption of Safety (QPS) according to the European Food Safety

7

Authority (EFSA). The major reason behind this classification is the knowledge that the food-grade

LAB are non-pathogenic not even when given overt opportunity, as would be the case in an ongoing

disease. [15, 17, 19, 24, 25]

Nowadays, between all the members that comprises the LAB group Lactococcus lactis is the

best characterized member and is considered the model organism of this group, not only because its

broad use in dairy industry with an considerable economic impact but also because other reasons: (i)

some strains of this species are already completely sequenced genome; (ii) it is genetically easy to

manipulate; (iii) many genetic tools have already been developed for these species; (iv) L. lactis is a

non-invasive facultative and mesophilic heterofermentative bacterium that is extensively used in the

dairy industry. [17]

1.3.1. Industrial Applications of Lactic Acid Bacteria

The interest in LAB has dramatically increased in the past decades due to the growing

industrial importance of these bacteria for the manufacturing of foodstuffs (mainly in the dairy

industry). Because of their metabolism LAB species are normally related with the preparation of

fermented foods, like yogurt (e.g. Steptococcus and Lactobacillus strains), cheese (e.g. Lactococcus

strains), milk, bread, butter, wine, sausages, fermented meats, pickles and silage. This process,

known as “lactic fermentation of foods”, starts about 8000 B.C and constitutes one of the most

primordial forms of food preservation used by humans. Food conservation by LAB is a result of

acidification of the medium (pH 4.5-3.5) and at same time the production of several antibacterial

agents, like bacteriocins and organic compounds. [17, 18, 20]

Some species of LAB, like Lactobacillus acidophilus, are responsible for production of

bacteriocins, which are ribossomally synthesized antimicrobial peptides. Bacteriocins can have a

narrow inhibitory spectrum limited to related bacteria or a broad inhibitory spectrum that includes

various food pathogens. In this way, bacteriocins have attracted a growing interest in the last years

due to their potential application in food industry as natural preservatives or they can be produced

directly in the food as a part of the starter culture. LAB can also produce vitamins (e.g. folate, vitamin

B12, vitamin K2, riboflavin and thiamine), enzymes (e.g.aminopeptidase, α-amylase, lipase,

superoxide dismutase and peptidases etc.) which can improve the aroma and flavor of the fermented

foods, exopolysaccharides which can have several functions like thickeners, emulsifiers, gelling

agents and physical stabilizers and low-calorie sweeteners (e.g. manitol, sorbitol and xylitol). [20, 21, 26]

In last years, the exclusive use of Lactic Acid Bacteria as a microorganism for food

fermentation has moved to a useful resource to develop biopharmaceuticals, biotecnologically

important proteins and as DNA delivery vehicles like DNA vaccines. In Figure 3 is possible to see all

the possible applications of LAB in the various industrial fields. [17, 20, 27]

8

Figure 3- Applications of Lactic Acid Bacteria in Industry, adapted from [28]

.

1.3.2 Applications in Human Health of Lactic Acid Bacteria

The safe status of LAB, their capacity to survive the passage through the gastrointestinal tract,

and the gradual availability of tools for genetic modification led to its increasing use for novel medical

applications. The emergence areas for application of these bacteria are their utilization as probiotics

and the most promising, is their use as live vectors for antigenic, therapeutic protein or DNA delivery

to mucosal surfaces. The reason of the increasing interest about the mucosal delivery is due to this

type of delivery enhances the potency and specificity of therapeutic proteins for chronic diseases and

mucosal infections. The mucosal delivery of therapeutic proteins offers also several advantages over

the classical systemic routes like: reduction of the potential side effects, easy administration and the

possibility to modulate both systemic and mucosal immune responses. [17,19, 25, 29]

Functional properties of probiotics have been established for many therapeutic applications.

However, the health benefits provided by probiotics are strain-specific, therefore no probiotic strain will

have all the proposed benefits, not even strains of the same species. This probiotic effects varies

greatly, for example, from acts in the reducing of the gastrointestinal disorders to the protecting

against colon cancer. In Table 1 is possible to see some probiotic effects on human health of different

species of LAB. [20, 30]

9

Table 1- Probiotic effects of Lactic Acid Bacteria on human health. Adapted from [20]

.

Lactic Acid Bacteria

Probiotic effects on human health

Lactobacillus rhamnosus GG

- May shorten the course of rotavirus causing diarrhea. - Helps to alleviate the symptoms of ulcerative colitis and atopic dermatitis.

Lactobacillus casei - Reduces the severity and duration of diarrhea. - It can stimulate the immune system of the gut and alleviates the symptoms of Crohn’s disease.

Lactobacillus acidophilus

- Secretes lactic acid which reduces the pH of the gut and inhibits the development of pathogens. - Reduces blood cholesterol.

Lactobacillus johnsonii - Effective in inhibition of H.pylori and against inflammation.

Lactobacillus plantarum

- Produces short-chain fatty acids that block the generation of carcinogenic agents by reducing enzyme activities.

Lactobacillus fermentum

- Effective in restoration of a normal microflora. - Effective against bacterial vaginosis flora.

Lactobacillus reuteri - Reduces the duration of diarrhea.

Enterococcus faecium - Can reduce blood cholesterol leading to decreased blood pressure.

In the lasts years, many works have used LAB for the expression and secretion of

heterologous proteins. Between LAB species, L. lactis is the most used for heterologous protein

production, because this organism is considered the model of lactic acid bacteria and the majority of

the genetic tools (e.g. cloning and expression vectors) for LAB were developed in this organism.

Furthermore, L. lactis is considered a good candidate for heterologous protein production because it

secretes relatively few proteins and only one, Usp45, in measurable quantities. In addition, the most

used L. lactis strain (MG1363) is plasmid-free and does not produce any extracellular proteases. But,

the main advantage of using L. lactis as a live vector for mucosal delivery of therapeutic proteins

resides in its amazing safety profile (a non-invasive and non-pathogenic organism). All of these

features give the reason why the most relevant studies focusing in the use of LAB as protein and DNA

delivery vectors have been realized in L. lactis. So the capacity of L. lactis to produce many different

proteins of health interest has been evidently in the last two decades. [29, 31, 32]

One of the major’s illustrative examples of the application of LAB to mucosal delivery of

therapeutic molecules taking advantage of the probiotic characteristics of L. lactis is the case of

Inflammatory bowel diseases (IBD). Inflammatory bowel diseases are a group of gut disorders

characterized by an uncontrolled inflammatory response to the luminal contents. The most frequent

forms of IBD are ulcerative colitis (UC) and Crohn’s disease (CD), which differ by the region of the gut

where the inflammation progresses and the depth of inflammatory damage. Symptoms for UC and CD

include severe or chronic abdominal pain, bloody diarrhea, weight loss, fever, fatigue and loss of

appetite. Until the moment, no cure has been identified for IBD by this reason therapy is often

symptomatic or to maintain the patient free of symptoms. In last year’s, the application of recombinant

LAB with probiotic effects for the treatment and prevention of colitis, one of the forms of this disease,

has been studied by using the IL-10-secreting L. lactis. The delivery of cytokine IL-10, a potent anti-

10

inflammatory and an essential factor in induction and maintenance of immune tolerance, as a therapy

for colitis demonstrate that this cytokine can down regulate the inflammation that affects these

patients. Daily mucosal administration of IL-10-secreting L. lactis caused a 50% reduction in colitis and

prevented the emergence of colitis in IL10-/- mice that spontaneously develop severe colitis. This

beneficial effect was dependent on the secretion of IL-10 by live lactococci in situ. Notably, a 10000-

fold lower dose of IL-10 was required compared with intravenous injection of the cytokine. This

indicates that greatly improved IL-10 delivery has been achieved by mucosal delivery of IL-10 by using

recombinant L. lactis. [18, 19, 25]

Additionally, the treatment of acute intestinal inflammation may be a means to avoid the onset

of IBD. To try treat the acute intestinal inflammation, was studied the potential use of LAB for mucosal

delivery of peptides of the trefoil factor family (TFF). Secretory trefoil peptides TFF1, 2 and 3 are

recognized for their strong protective and healing effects after mucosal damage. However, when

administered orally, they adhere to the mucus of the small intestine and are thus absorbed ate the

caecum. By contrast, intragastric administration of TFF-secreting L. lactis led to active delivery of TFF

peptides at the mucosa of the colon and effectively prevented and healed the acute intestinal

inflammation. Other recent approach for the treatment of this disease is the use of probiotic bacteria,

L. lactis and Lactobacillus casei, genetically engineered to produce and secrete Elafin. Elafin is a

protease inhibitor that has been studied for its anti-inflammatory properties at mucosal surfaces. The

produced Elafin reaches the colon, prevents the inflammation, accelerates mucosal healing and

restores colon homeostasis in the mice and human models. These promising results suggest the

potential clinical applications for human health of Elafin delivered by probiotic bacteria. In conclusion,

recombinant LAB shows significant potential for mucosal therapy of inflammatory bowel disease in

humans. [18, 19, 25]

Recently, it has also been investigated the mucosal delivery of allergen-expressing LAB for

the immunotherapy of the type I allergies, based on the discovery that some strains of LAB modulate

T-cell responses to an expressed or co-administered antigen towards a TH1-type immune response.

[18]

Other possible application of LAB in the human health is in the development of anti-infective

strategies such as in the prevention of HIV-1 transmission. The cell-binding and fusion processes of

HIV-1 provide potential target sites for the inhibition of infection. For example, the binding of gp120 to

the extracellular domains of CD4 on immune cells is the first step in viral access, and can be blocked

by the high-affinity interaction of the microbiocidal cyanovirin-N (CV-N) protein that are present on

gp120. The human commensal S. gordinii strain is used as a host for the expression of CV-N, which

was expressed as a fusion protein and attach CV-N to the cell wall. By this mechanism, the

recombinant S. gordonii capture HIV-1 virions in vitro on its cell surface. [18]

The mucosal delivery of vaccines for large-scale immunization programs is an objective of the

World Health Organization for economical, logistical, and safety reasons. A current development in the

use of LAB as mucosal delivery vehicles has been in the field of DNA vaccination. The DNA vaccines

11

have some important advantages like the ability to induce both cellular and humoral immune

responses, the expression of many antigens or epitopes using only one DNA vector, and leads to the

expression of post-translationally modified antigens by host cells resulting in presentation of

conformationally restricted epitopes to the immune system, the opposite situation of bacteria-mediated

delivery of protein antigens. [18, 22, 29]

The attention that World Health Organization pays to the mucosal (oral) vaccines is due to its

many advantages, such as: induce efficient systemic and mucosal immune responses, by inducing

mucosal IgA antibody responses, with fewer side effects than systemic vaccines; low manufacturing

costs and easy administration (without need of needles and trained personnel). However, in the case

of bacteria-mediated delivery of proteins to the mucosal surfaces (instead of DNA delivery) a large

amount of protein needs to be administered because the majority of protein will suffer degradation and

only small quantities surviving degradation at mucosal surfaces such as the gastrointestinal tract. [17, 22,

23, 29]

Most common DNA delivery vectors are attenuated strains of known pathogens. Although

attenuated, these vectors still have the potential for reversion to a virulent state. The established

safety profile of LAB, namely L. lactis, was a motive for its investigation as a DNA delivery vector. L.

lactis have several safety advantages as a DNA delivery vehicle, like: (i) non-production of

lipopolysaccharides in its outer membrane, including endotoxins and biogenic amines, (ii) good growth

in chemically defined media, (iii) genetic integrity of bulk purified plasmid molecules and (iv) available

molecular tools to efficiently express antigens and therapeutic molecules. These properties make

L. lactis a promising and safe host-vector for the development of systems that promote efficient DNA

delivery into eukaryotic cells for new mucosal vaccines. [17, 23, 29, 33]

Recently it was showed that a plasmid composed by an expression cassette containing the

eukaryotic promoter and a cDNA encoding bovine betalactoglobulin (BLG), a main cow’s milk allergen,

can be transferred from L. lactis to epithelial cells of the small intestine. The transitory BLG production

is sufficient to induce a Th1-driven immune response characterized by a very low level of serum BLG-

specific IgC2a and protection against further sensitization with BLG and cholera toxin. [19]

The delivery of DNA vaccines using LAB is appealing given the possibility to use mucosal

routes of administration, although the immune responses have been much less potent than those

showed for injected DNA vaccines. Several studies are in progress to improve DNA vaccine delivery

by expressing pathogen invasions such as internalin A and FnBPA, whose receptors are expressed

on the basolateral membrane of intestinal epithelial cells, in LAB. In reality, recent data indicate that

only a small portion of epithelial cells in vitro and in vivo take up targeted L. lactis. [22]

In conclusion, he future progresses and implementation of LAB vaccines depend on numerous

factors: the cost, the acceptability as contained genetically modified organisms and the efficacy.

However has already been showed successful vaccination and protection using recombinant LAB in

rodent models so the next challenge will be to show their efficacy and advantages over injected

vaccines in animals and humans. [22]

12

In the last years, the use of recombinant LAB for mucosal delivery of therapeutic compounds,

as well as DNA vaccines, has increased significantly. In spite of much progress, gaps remain in our

understanding of the full potential of recombinant LAB and several questions continue unanswered. [17,

18]

In the Figure 4 is possible to see all the possible applications of lactic acid bacteria in the

human health.

Figure 4- Applications in human health of Lactic Acid Bacteria. Adapted from [18]

.

1.3.3. Plasmids and Lactic Acid Bacteria

Many species of LAB, including lactococci, streptococci, lactobacillus and pediococcus,

contain endogenous plasmids, the majority of this plasmids are cryptic. Only few LAB plasmid-

encoding functions are identified. These functions could be divided into four main categories: i)

hydrolysis of proteins, (ii) metabolism of carbohydrates (e.g. galactose, lactose, maltose or sorbitol),

amino acids and citrate, (iii) production of bacteriocins, exopolyssaccharides, and pigments, and (iii)

resistance to antibiotics (e.g. chloramphenicol, erythromycin, kanamycin, streptomycin and

tetracycline), heavy metals, and phages. [21, 34, 35, 36]

The number, functions and size of endogenous plasmids varies greatly between the different

species of LAB. For example, at least 25 species of Lactobacillus have endogenous plasmids, and

often contain multiple (1 to 16) different plasmids in one single strain. But in case of Lactococcus

species the endogenous plasmids are normally present in low number and are smaller. [21, 34, 37]

One of the first’s practical applications of endogenous LAB plasmids took advantage of their

ability to digest lactose. Lactose is very abundant in milk products, and is not tolerated by many

people who have congenital lactase deficiency. Clinical manifestations of this problem include

diarrhea, abdominal colic and flatulence. These symptoms appear with milk ingestion, but are

practically absent when yogurt is ingested. This phenomenon can have three possible explanations: (i)

13

live bacteria present in yogurt consume lactose during yogurt production, (ii) live bacteria present in

yogurt provide the deficient host with supplemental lactase, and (iii) the bacteria stimulate endogenous

production of this enzyme by the intestinal mucosa of the host. These hypotheses show the

importance of the presence of LAB in the dairy products and their probiotic effect in human. This

hydrolysis capacity can be also used in dairy products to increase sweetness and prevent lactose

crystallization. In addition, the others plasmid-encoding functions can also be applied, like for example

exopolysaccharides can improve the quality of texture in fermented dairy products; the determinants of

drug resistance can be used to construct new vectors with selective markers; and the capacity of

producing pigments can be applied as an alternative genetic marker. [17, 21, 34]

In addition, some strains of LAB like Lactococcus lactis LMG 19460 and Lactobacillus

plantarum CCUG 61730, don’t have native plasmids. This characteristic makes these strains a target

to use optimized vectors, in order to become the LAB a suitable host for the pDNA production. Since

the presence of endogenous plasmids can lead to an additional metabolic burden and the plasmid

incompatibilities may occur between modified vectors and endogenous plasmids, which can lead to

competition for components required for their replication and the weaker plasmid can disappear. [21]

Genetic analysis on LAB gave rise to the identification and characterization of numerous

plasmids, which may be divided into two classes reflecting their mode of replication: rolling-circle

plasmids and theta plasmids. Although many of these plasmids are not yet characterized, in the future

this characterization may result in to new molecules and new vectors with many different applications.

[38]

1.3.4. Plasmid Mechanisms of Replication

Plasmids of lactic acid bacteria replicates by two different mechanisms: rolling-circle and theta

mechanisms. Plasmids from both mechanisms have been used to construct plasmid vectors. Some

small (˂ 15kb) and multicopy plasmids replicate by the rolling-circle (RC) mechanism. This mechanism

has two main steps: (i) Leading strand synthesis - the plasmid-encoded initiator of replication protein

(Rep) binds to and introduces a strand- and site-specific nick in plus origin of replication (dso), on

supercoiled DNA. The leading-strand replication initiates by extension synthesis at the free 3’ OH end

at the nick with the participation of the host-encoded products (e.g. DNA polymerase III, single-

stranded DNA-binding protein, helicase). When the replication machinery reaches the reconstituted

origin, perhaps the same or other Rep molecule introduces a new cut on the plasmid DNA, releasing

the displaced strand as a single-strand DNA molecule. (ii) Synthesis of the lagging strand - the ssDNA

is converted into double-strand DNA (dsDNA) through the synthesis of the lagging strand by host

proteins initiating at the single-strand origin (sso). [36, 38, 40, 41]

In the other hand, the theta mechanism implies the melting of the parental strands, synthesis

of a primer RNA, and initiation of DNA synthesis by covalent extension of the primer RNA. DNA

synthesis is continuous on one of the strands (leading strand) and discontinuous on the other (lagging

strand), although synthesis of the two strands appears to be coupled. Theta mechanism can initiates

14

from one or various origins, and replication can be uni- or bidirectional. In the Figure 5 is possible to

see the rolling-circle and theta mechanisms of replication. [42]

Figure 5- Rolling-circle and theta mechanisms of plasmid replication. [43, 44]

Normally plasmids with RC type from Gram-positive bacteria, like LAB, have a wide host

range, with some replicating even in Gram-negative bacteria, while the theta plasmids have a more

restricted host range. Although the RC plasmids are recognized to exhibit structural or segregational

instability after the cloning of relatively small DNA fragments. This instability is because of the nature

of the replication mechanism involving ssDNA intermediates; this mechanism can give origin to

plasmid deletions or generation of high-molecular-mass plasmid multimers that are structurally

unstable. But in the other hand, RC plasmids are easier to introduce into various hosts compared with

theta-replicating plasmids and by this reason can be more suitable for cloning and gene expression.

Furthermore, theta plasmids can lead to slower growth of the host. However, the theta plasmids are

structurally and segregationally more stable than RC plasmids and for this reason, they can

accommodate large DNA inserts. But despite all the drawbacks, nowadays RC vectors are the most

used in the laboratories that work with LAB. [38, 45, 46]

1.3.5. Plasmid Copy Number

Plasmid copy number (PCN) determines the gene dosage accessible for expression and the

amount of plasmid as a final product. By these reasons the high copy number plasmids are usually

chosen for recombinant protein expression in order to obtain a better dosage effect. And in the other

hand, in some case the use of low/moderate copy plasmids can be useful to achieve a tighter control

of gene expression, a high segregational stability, ability to replicate big pieces of DNA and a low

metabolic burden for the host. So the determination of PCN in host cells during pDNA manufacture is

essential to pDNA vaccine development. [60, 63]

Several methods for the determination of plasmid copy number have already been described,

like the more traditional, in which the PCN was determinate by DNA hybridization with the use of

radioactive probes, by gel electrophoresis or by the use of high performance liquid chromatography.

15

Although these methods are time-consuming; need a largue quantities of sample; have low

reproducibility and analytical precision; are just valid in a limited dynamic range and normally is not

convenient for high-throughput analysis and for process control. [60, 62, 63]

In comparison with the above mentioned methods Real-time Quantitative PCR (qPCR)

technology has many advantages: a great sensitivity and precision, faster and reliable quantification of

the PCN in the samples, a wide range of quantification, most sensitive and precise method, no

requirement of sample pretreatment steps (e.g. purification steps) neither post-PCR steps, need of

reduced amounts of samples and suitable to high-throughput analysis. [60, 61,62]

1.3.5.1 Mechanisms of Plasmid Copy Number Control

Plasmid copy number is mainly controlled by the origin of replication and mode of replication

however host physiology also plays a significant role in plasmid replication. [60, 63]

Many natural plasmids are stably maintained at their characteristic copy number within the

growing bacterial population, controlling their concentration and regulating the rate of replication. The

minimal portion of a plasmid that replicates with the characteristic copy number of the parental plasmid

is called replicon. The replicon contains the ori and genes encoding specific replication initiator

proteins (Rep) that bind the ori and their regulating factors. To guarantee that the number of plasmids

per cell is stable over time, numerous mechanisms have evolved to regulate plasmids replication and

tightly control plasmid copy number. [1, 39]

If the copy number of a plasmid becomes too small, plasmid-free cells (which replicates faster

because doesn’t have the burden of the plasmids) will probably outnumber the cells with plasmid. On

the other hand, if there are too many copies of a plasmid per cell, the plasmid replication can exhaust

resources essential for normal cellular function. In addition, it is needed to have attention that plasmids

which utilize the same replication system cannot co-exist in the same bacterial cell, because it may

exist incompatibility. Although despite the many different plasmids available, apparently all the

plasmids maintain their number of copies by negative regulatory mechanisms that adjust the rate of

replication per plasmid copy in response to fluctuations in the copy number. Three main mechanisms

are being studied: (i) iteron-binding mechanisms; (ii) the countertranscript RNA (ctRNA)-based control

mechanism; (iii) mechanism with the action of ctRNA and a protein. [2, 39]

In the first mechanism the directly repeated sequences (iterons) complex with cognate

replication initiator proteins (Rep), inactivating them. [39]

The countertranscript RNA based control mechanisms are widespread within plasmids

replicating by different mechanisms, but sharing a similar genetic structure in the control region: an

“essential RNA” that is necessary for plasmid replication and a countertranscript of the essential RNA

(ctRNA) which works as a inhibitor of the system. The ctRNAs bind to its complementary near the 5’

end of essential RNA, inhibiting replication of the plasmid (Figure 6). An important characteristic of this

16

type of systems is that the rate of synthesis of the inhibitor, ctRNA, is much higher than that of the

essential RNA. Since the ctRNA is transcribed by a constitutive promoter and has a short half-life, its

intracellular concentration is proportional to plasmid copy number. ctRNAs can regulate plasmid copy

number by a multiplicity of mechanisms including: the inhibition of primer maturation essential for

replication, the inhibition of translation of the essential Rep protein, and by transcriptional

attenuation. [2, 39]

Figure 6 - ctRNA-based replication control. [39]

The third mechanism involves the ctRNA based control mechanism and at the same time the

action of the regulatory proteins. In this mechanism is possible to find two different categories: (i) the

ctRNA plays the major regulatory role, while the protein has been proposed as only with an auxiliary

role; and (ii) the transcriptional repressor proteins play the main regulatory role. Recently, in this

second category a novel mode of regulation was discovered, involving a ctRNA and a transcriptional

repressor protein, wherein the promoter directing the expression of the essential rep gene in these

plasmids is not constitutive, but regulated by a Cop protein, one example of this regulation is found in

the plasmid pAMβ1. [2]

1.3.6. pTRKH3 – a useful vector for Lactic Acid Bacteria

A useful vector for cloning must have: (i) a replicon for vector amplification in the host cells, (ii)

auxotrophic markers or antibiotic resistance genes to facilitate the identification of inserts/ hosts with

the vector, and (3) multiple cloning site with unique restriction sites for one or more different restriction

endonucleases (to facilitate the insertion of the gene of interest). Because the gene manipulation and

vector amplification in E.coli is much easier than in Lactobacillus (or LAB in general), shuttle vectors

for E.coli and Lactobacillus are frequently required and constructed. These shuttle vectors have to

contain the replicons and genetic markers functional in these two different organisms. In the selection

17

of the genetic markers is necessary to take into account that lactic acid bacteria have natural

resistance to many antibiotics, in this sense, the most common antibiotics used are choramphenicol,

erytromycin and tetracycline which LAB are generaly susceptible. Until today, numerous vectors were

constructed for genetic engineering of Lactobacillus, like for example the vector pTRKH3. [ 21, 46, 51]

pTRKH3 is a shuttle cloning vector for Gram-positive (Lactococcus, Enterococcus,

Streptococcus and Lactobacillus) and Gram-negative bacteria (E. coli) with 7.8 kb and has been used

in the last years as the backbone for the construction of expression vectors. This vector has a medium

copy number (30-40) in E. coli, and a high copy number (45-85) in Gram-positive hosts. [52, 53, 54]

This vector was constructed by incorporating the E. coli p15A plasmid origin of replication into

the pAMβ1-derived vector. The resulting vector was structurally stable in Gram-positive hosts,

which is a common feature of theta-replicating plasmids, and also displayed good structural

stability in E. coli, maybe due to lack of a resolvase-encoding gene. This vector have two

genetic markers: erythromycin resistance (ery) marker which allows the selection in the majority of the

species of LAB and at the same time in E. coli; and tetracycline (tet) resistance marker that is only

expressed in E. coli and in general is inactivated by the insertion of the gene of the interest because

this region is generally used as multiple cloning site (MCS). Since the gene manipulation and vector

amplification in E. coli is much easier than in LAB, shuttle vectors for E. coli and LAB are frequently

used, in this sense in this work all the procedures of modification of the vector are previously realized

in E. coli DH5α. In the Figure 7 is possible to find the physical map of vector pTRKH3. [52, 53, 54]

Figure 7 - Physical map of plasmid pTRKH3. [54]

18

1.3.7. Replicon pAMβ1

In the last years, numerous studies have highlighted the advantage of plasmid vectors

replicating by the theta mode (high structural stability and a wide host range). The most well-known

vectors of this group are derivatives of pAMβ1. Studies shows that the theta-type plasmid pAMβ1 was

more stably maintained in L.lactis than the RCR-type plasmid pWV01, and can be a good candidate

for the development of efficient and stable cloning vectors in this organism. [47, 48, 49, 50]

pAMβ1 is a low-copy-number, promiscuous, conjugative, 26.5kb plasmid isolated from

Enterococcus faecalis which replicates in Gram-positive bacteria by a unidirectional theta-type mode.

Several plasmids isolated from streptococci and enterococci are related to pAMβ1 and form the

pAMβ1 plasmid family. Its replication involves at least three elements: (i) the plasmid-encoded RepE

protein, (ii) a 44bp origin which contains the initiation site for leading-strand synthesis and (iii) the host-

encoded DNA polymerase I, which initiates leading-strand synthesis. RepE was shown to be a factor

limiting replication, and its production is tightly controlled at the transcriptional level by a repressor

(CopF) and by attenuation (ctRNA mechanism). [47, 48, 50]

Elements implicated in the control of RepE are located within a ≈1kb segment mapping

upstream of RepE open reading frame (ORF). This segment, called the copy-control region, is shown

in Figure 8. This region contains two ORFs, D and F, located on the same strand as repE, and an

intergenic region of ≈350bp carrying two major promoters (PDE and PCT) and two rho-independent

terminators (TDE and TCT). PDE guides the transcription of ORFD and repE, while PCT drives the

synthesis of a small countertranscript RNA, complementary to the non-coding region of ORFD-repE

mRNA. These elements control RepE synthesis by a ctRNA driven transcriptional attenuation

mechanism. [36, 47, 48]

In the other hand, the RepE is also controled by a protein CopF, coded by ORFF. CopF is a

repressor that regulates negatively the plasmid copy number by acting as transcriptional repressor of

the repE promoter (PDE), probably by binding to an operator located immediately upstream of it. This

repression is about 10-fold, which can account for the more or less 10-fold increase of the copy

number of pAMβ1-derived plasmids upon inactivation of the copF gene. Surprisingly, CopF acts

independently of the ctRNA transcriptional attenuation system characterized above. Furthermore, the

two systems of RepE regulation appear to be additive, resulting in a 100-fold repression of repE

transcription. [47, 48, 50]

Figure 8- Schematic representation of the replication region of pAMβ1. [48]

19

1.3.8. Ribosome Binding Site and its role

Ribosomes have an essential role in cells by reading mRNA and synthesizing proteins.

Because codons are three bases long, translational initiation must be directed to within one base on

the mRNA. This requires a pattern of approximately 54 nucleotides in the mRNA known as a ribosome

binding site which includes the initiation codon. In prokaryotes, the ribosome binding site (RBS), which

promotes efficient and accurate translation of mRNA, is called the Shine-Dalgarno (SD) sequence.

This purine-rich sequence of 5' untranslated region (UTR) of the mRNA transcript interacts with the

UCCU core sequence of the 3'-end of 16S rRNA (located within the 30S small ribosomal subunit)

during translation initiation. Various Shine-Dalgarno sequences, which are composed by

approximately 10 nucleotides upstream from the AUG start codon, have been found in prokaryotic

mRNAs. [55, 56, 64]

The efficiency of translation initiation, the rate-limiting step in the protein synthesis, depends

on the recruitment of ribosomes to the Shine-Dalgarno sequence, which can be stronger or weaker

depending on variations in this sequence and the distance from the translation initiation codon

(generally 5-6bp). The RBS strength is also dependent on the upstream and downstream mRNA

sequence due to the formation of local secondary structures that can influence or inhibit ribosome

binding. [55, 56, 57, 58, 65]

Several studies have created libraries of RBS sequences with the objective of optimize the

ribosome binding site sequence in order to increase the protein synthesis. In addition, some of these

studies also developed strategies to minimize mRNA secondary structures in the proximity of the RBS,

for example by the mutation of specific nucleotides upstream or downstream of the RBS, in order to

enhance translational efficiency. Nowadays, the prediction of the strength of prokaryotic ribosome

binding site can be greatly facilitated by the use of several bioinformatics tools like for example the

theoretical Anderson RBS library. This type of tools can be very useful in choosing a stronger RBS for

pAMβ1 origin replication which can gives origin to a higher level of production of RepE protein and

consequently increasing the plasmid copy number in lactic acid bacteria. [55, 56, 57, 58, 64, 65]

20

2. Materials and Methods

2.1. Bacterial Strains and Plasmids

During this work were used three different bacterial strains that are shown in the Table 2 and

four different plasmids which are illustrated in Table 3.

Table 2 - Characteristics of the bacterial strains used in this work.

Strain Characteristics Source

Escherichia coli

DH5α

F

- Φ80lacZΔM15 Δ(lacZYA-argF) U169 recA1 endA1 hsdR17

(rk-, mk+) phoAsupE44 λ- thi

-1 gyrA96 relA1

Invitrogen

Lactococcus

lactis

LMG 19460

Wild type, plasmid free

BCCM Collection

Lactobacillus

plantarum

CCUG 61730

Wild type, plasmid free

Collection of

Culture University

of Göteborg

Table 3 - Plasmid vectors used in this work.

Plasmid

Characteristics

Source

pTRKH3

Original E. coli/LAB shuttle with 7.8kb (7766bp)

BCCM/LMBP

Plasmid Collection

pTRKH3_3nuc

Original vector target of a site-directed mutagenesis approach

in the RBS sequence.

This work

pTRKH3_5nuc This work

pTRKH3_4nuc Andrade, S..

2.2. Growth conditions of E. coli DH5α

E. coli DH5α cells were grown in Luria Bertani (LB) medium (20 g/l) from NZYTech composed

by: tryptone 10g/l, yeast extract 5g/l, NaCl 5g/l and pH between 6.8 and 7.2. These cells were grown

in a pre-inoculum by one overnight, in 15ml falcon tubes containing 5ml of LB medium supplemented

with 500μg/ml of erythromycin stock solution (150mg/ml) when cells contain the pTRKH3 vector or its

derivatives, and were incubated at 37ºC with 250rpm of agitation in an ARALAB orbital shaker (model

AGITORB 200). When cells reached the exponential growth phase were transferred to a 100ml shake-

flask containing 20ml of LB medium and 500μg/ml of erythromycin (only if the vector or its derivatives

are present) and were incubated at same conditions (37°C and 250rpm) during approximately 4-5

hours until reached the O.D.600nm of 1-1.5, measured in U-2000 spectrophotometer (Hitachi®).

Subsequently, these cells were used to make cell banks in 20% (v/v) glycerol, in aliquots of 100μl that

were stored at - 80°C in 1.5ml microcentrifuge tubes.

21

2.3.DH5α Chemically Competent cells

The E. coli DH5α cells were grown up to the O.D.600nm 1-1.5 (as described in section 2.2) and

were centrifuged at 4,000g during 10min. The supernatants were discarded, and the pellets were

resuspended in 2ml of filtered (by a 0.22µm filter) and cooled TSS buffer (20g/L LB; 5% DMSO; 50mM

MgCl2; 10% PEG 8000 (w/v); pH 6.5.) and then were incubated for 10min on ice. Then aliquots with

100μl of this mixture were stored at - 80ºC in 1.5ml microcentrifuge tubes.

2.4. Transformation of E. coli DH5α with pTRKH3 and purification of the

vector

E. coli DH5α cells were transformed with the pTRKH3 vector or its derivatives by heat shock. This

procedure was performed by the addition of 10ng to the one aliquot of competent cells (above

section), and incubated during 30min in the ice. Then the mixture was heated for 1min at 42ºC and

then chilled on ice for 2min followed by the addition of 1ml LB and incubation at 37ºC during one hour.

Finally, these cells were plated on LB agar medium supplemented with 500µg/ml of erythromycin

(selective medium, only cells with plasmid can grow) and were incubated at 37ºC for 24-48 hours.

After this the cell banks were made (as explained in the section 2.2). Following, plasmid DNA was

purified with the High Pure Plasmid Isolation Kit from Roche following the manufacturer’s instructions.

The pDNA obtained with the kit was eluted either in 100µl of elution buffer or in 100µl of water

autoclaved and filtered (PCR grade water) if this plasmid was to be used for electroporation

procedure. The pDNA solutions were stored at 4ºC to be used in the next days or stored at -20°C until

needed. The concentration of the purified DNA samples was measured with Nanodrop

Spectrophotometer (Nanovue Plus, GE), and purification degree was determined focusing on

A260/280 and A260/230 ratios, both desirable to be near to 1.8-2, indicating that RNA and proteins

presence and other contaminants respectively, are minimal. The purification was confirmed by the

observation of samples run on a 1% agarose gel electrophoresis.

2.5. Digestion of pTRKH3

To confirm the quality and integrity of the vector pTRKH3 a double digestion with two

restriction enzymes from Promega, HindIII (restriction site: A^AGCTT) and EcoRI (restriction

site:G^AATTC) was performed. The combined action of these two enzymes gives origin to three

fragments: 5,265bp, 1,523bp and 978bp. This double digestion was performed with: 1,000ng of

pTRKH3, 0.5µl (10U/µl) of HindIII, 0.5µl of EcoRI (12U/µl), 10% of 10X Buffer B and filtered and

sterilized milli-Q water (PCR grade water) to achieve the final volume of the reaction (10-15 µl). The

mixture was incubated during 2hours at 37ºC. Finally, was run on a 1% agarose gel electrophoresis to

confirm the presence of the expected fragments and evaluate the integrity of the vector.

22

2.6. Modification of RBS in pAMβ1 origin of pTRKH3

In order to increase the plasmid copy number in LAB cells, will be tested one different RBS

sequence. To predict and design one putatively stronger RBS sequence to replace the wild-type RBS

present in pAMβ1 origin of pTRKH3 was used the theoretical Anderson library. [58]

In order to perform

this modification in the RBS it was used a Site Directed Mutagenesis approach.

2.6.1. Site Directed Mutagenesis

To perform the site directed mutagenesis procedure it is necessary mutagenic primers which

have high homology to the DNA strand that will be synthesized. These mutagenic primers (Table 4)

were designed with the help of QuickChange Primer Design program. [66]

In the Table 5 is possible see

the strategy to execute the modification on the RBS. Two different pairs of primers were used: the first

pair will switch 3 nucleotides (giving origin to pTRKH3_3nuc) and the second pair will switch the 2

nucleotides remaining (giving origin to pTRKH3_5nuc), with the objective that in the final of the

procedure obtain the desired modified sequence of RBS (CAG GA CCC).

Table 4 - Mutagenic primers for Site Directed Mutagenesis.

Primer

Sequence

Length

(bp)

Tm (ºC)

Forward

primer-F3

5’ - TTTATATAAGTTTTACATTCATCATGATTCATACAGGCTCCAGCT TCTATAAATGAATACAAAAAAAGCAATCAAACG-3’

78

78

Reverse

primer-R3

5 ’- CGTTTGATTGCTTTTTTTGTATTCATTTATAGAAGCTGGAGCCTG

TATGAATCATGATGAATGTAAAACTTATATAAA - 3’

78

78

Forward

primer-F2

5’- TTTACATTCATCATGATTCATACAGGGTCCTGCTTCTATAAATGA

ATACAAAAAAAG - 3’

57

73

Reverse

primer-R2

5’ – CTTTTTTTGTATTCATTTATAGAAGCAGGACCCTGTATGAATCAT

GATGAATGTAAA - 3’

57

73

Table 5 - Strategy to realize the Site Directed Mutagenesis of RBS.

The site directed mutagenesis strategy was carried out by using a commercial kit the

Novagen® KOD Hot Start DNA Polymerase and the thermocycler TGradient (Biometra). Each reaction

mixture with the KOD Hot Start DNA Polymerase contained: 50ng of template pDNA (pTRKH3 or

Original RBS sequence GTGGAGTT

One pair of primers (F3 and R3) to switch 3 nucleotides CTGGAGCC

One pair of primers (F2 and R2) to switch 2 nucleotides CAGGACCC

Final objective CAGGACCC

23

pTRKH3_3nuc), 0.5µl of KOD Hot Start DNA Polymerase (0.02U/µl final concentration), 2.3µl of MgSO4

(2.3mM final concentration), 2.5µl of buffer KOD (1X concentrated), 2.5µl of dNTP’s (0.22mM final

concentration), 1.3µl (0.52µM final concentration) of each primer (forward and reverse primers) and

PCR grade water to obtain the final volume of 25µl. The conditions of PCR used: 3min at 95ºC; 30

cycles of: 1min at 95ºC, 1min at 65ºC and 8min at 70ºC. At the final of each PCR reaction was added

to the mixture 2µl of the enzyme DpnI that was incubated during 2 hours at 37ºC. The enzyme DpnI

have the function of digest the template DNA that is methylated whereas the modified pTRKH3 is not

yet methylated and is not digested by this enzyme. The modified plasmids were used to transform

DH5α cells (section 2.4), where the amplification of the plasmid occurs. Finally the plasmid DNA

produced inside these cells was purified with the High Pure Plasmid Isolation Kit (Roche), the

purification of the plasmid was quantified and evaluated in the Nanodrop Spectrophotometer by the

measuring the pDNA concentration and analysis of the ratios (as explained above) and by the

visualization on a 1% agarose gel electrophoresis. Finally, the real confirmation of the mutagenesis

was achieved by sequencing by Stabvida Company.

2.7. Culture conditions of L. lactis LMG 19460 and L. plantarum CCUG 61730

The LAB cells were microaerophilically grown on Man, Rogosa and Sharpe (MRS) medium (54.3

g/l), from Frilabo, which have the following composition: Peptospecial 10g/l, Beef extract 10g/l, Yeast

Extract 5g/l, Glucose 20g/l, Triammonium Citrate 2g/l, Sodium Acetate 5g/l, Magnesium Sulphate

0.2g/l, Manganese Sulphate 0.05g/l, Di-Potassium Phosphate 2g/l, 1ml of Tween 80g/l and pH of 6.2.

Both used strains of LAB were microaerophilically grown on MRS medium (52g/l) but with some

differences, L. lactis LMG 19460 was grown at 30ºC with 100rpm of agitation in an orbital shaker

(ARALAB orbital shaker model AGITORB 200), but L. plantarum CCUG 61730 was grown at 37ºC

without agitation. LAB cells were grown in a pre-inoculum overnight, at the different temperatures and

agitation according to the strain, in 15ml falcon tubes contain 5ml of MRS medium supplemented with

5µg/ml of erythromycin (1.5mg/ml of stock concentration), when these cells contained the pTRKH3

vector. In the next day, the pre-inoculum was used to start a new culture, by the addition of these cells

to a MRS fresh medium up to O.D.600nm=0.1. The cells grown for more 6-7 hours, until the end of the

exponential phase ( according to Andrade, S.) and cell banks were made in 20% (v/v) glycerol, in 100

µl aliquots, and were stored at - 80ºC. [67]

2.8. LAB Electrocompetent Cells

In order to transform the LAB strains with the intended vector and its derivatives, LAB competent

cells were treated according with the protocol adapted from Palomino, M. et al., in which the cells were

grown in high salt concentration. [68]

The LAB cells were grown overnight at the conditions adequate

from each strain (section 2.7) in 15ml falcon tubes containing 5ml of MRS medium. In the next day,

the pre-inoculum was used to start a new culture, by the addition of these cells to a MRS fresh

medium up to O.D.600nm=0.1, in an 100ml shake-flask containing 100ml of the same new fresh medium

24

supplemented with 0.7M NaCl. Subsequently, the cells were grown during 24 hours at the conditions

adequate for each strain; the growth was stopped by incubation on ice for 10min and then cells were

centrifuged for 3min at 6,000g, at 4ºC. Then, the cells were washed for 4 times with ice-cooled PCR

grade water. Finally aliquots of 100µl of LAB competent cells, with 2×109 cells in case of L. lactis and

with 2×1010

cells in case of L. plantarum, were made with 20% glycerol and stored at -80ºC. If the

aliquots of LAB competent cells are being used directly for electroporation the aliquots of cells are

made with PCR grade water. [67]

2.9. Electroporation of L. lactis LMG 19460 and L. plantarum CCUG 61730

and plasmid purification

The electroporation procedure can be affected by many factors (e.g. growth phase, electrical

conditions and many other factors) and varies a lot depending of the species and even between

strains of the same species. By these reasons for the study of plasmid copy numbers of pTRKH3

vector and its derivatives (pTRKH3_3nuc, pTRKH3_4nuc and pTRKH3_5nuc) in the two strains of

LAB (Lactococcus lactis LMG 19460 and Lactobacillus plantarum CCUG 61730) was essential to

optimize this procedure for each strain and also for each vector. [68, 69, 70]

To perform the electroporation procedure is important to take into account the number of cells

present in each cuvette of electroporation., To achieve the number of cells the following relation was

used, O.D.600nm=0.1 is equivalent to 7x107cells/ml, according to Jones, S., et al.

[73] The

electrotransformation of L. lactis LMG 19460 and L. plantarum CCUG 61730 cells was carried out by

usingan electroporator with pulse controller (BTX ECM 399) in different conditions (number of cells,

pDNA concentration, electric pulse) that are illustrated in Table 6. In all experiments the 1 mm

electroporation cuvettes were maintained 30min on ice before electroporation. For all the conditions

tested the plasmids (pTRKH3, pTRKH3_3nuc, pTRKH3_4nuc, pTRKH3_5) purified from E. coli DH5α

(section 2.4) was eluted in 100µl PCR grade water in order to avoid the presence of salts that can

result in electric arc during the electroporation procedure. After the electroporation procedure all the

cell suspensions from the different conditions were immediately diluted by the addition of 900µl of

MRS medium and were incubated for 3 hours in different conditions according to the strain (Table 6).

After this period, cells were plated on MRS agar supplemented with erythromycin (5 or 10µg/ml) and

incubated for 48-72 hours for selection of transformant colonies. Cell banks were made from each

colony and pDNA purification was done by Nucleospin plasmid from Macherey Nagel Bioanalysis

(Isolation of low-copy plasmids protocol with the first two steps of the protocol “Isolation of plasmids

from Gram-positive bacteria”, which includes one step of addition of 10mg/ml of Lysozyme in order to

facilitate the lysis of the cell wall of these Gram-positive bacteria). Following the purification process,

DNA concentration was measured with Nanodrop Spectrophotometer (Nanovue Plus, GE), and

purification degree was determined focusing on A260/280 and A260/230 ratios and by visualization on

an agarose gel. In addition the four purified vectors (pTRKH3, pTRKH3_4nuc, pTRKH3_3nuc and

25

pTRKH3_5nuc) were sequenced by Stabvida Company to confirm their sequence integrity in LAB

cells.

Table 6 - Electroporation conditions of L. lactis LMG 19460 and L. plantarum CCUG 61730.

Strain

Number of cells in

100 µl frozen

aliquots

pDNA

concentration

(ng)

Electric pulse

conditions

Recuperation

conditions

Erythromycin concentration

(µg/ml)

Lactococcus

lactis LMG 19460

2×109 500

3 × 1800V

4 × 1800V 5 × 1800V

3 hours in MRS at 30ºC

5

Lactobacillus plantarum

CCUG 61730

1010

3×10

10

1011

1000 1 × 1250V

2 × 1250V 3 hours in

MRS at 37ºC 10

2.10. Colony PCR

The PCR colony procedure was carried out to confirm cell transformation with pTRKH3, in this

PCR reaction was amplified a sequence of gene of resistance to erythromycin (ery), by the use of

specific primers for this gene, only present in the plasmid pTRKH3 (DH5α, Lactococcucs lactis LMG

19460 and Lactobacillus plantarum CCUG 61730 don’t have genes of resistance to ery in their

genomes). The transformed colonies (which grow in the medium supplemented with erythromycin)

were picked to an eppendorf containing 70µl of PCR grade water. Fifty µl of this volume was incubated

at 99ºC during 5min in order to burst the cells, the remaining 20µl were kept in sterile conditions to be

plated at the end if positive PCR products were obtained. Following the heat treatment, the cells were

centrifuged at 12,000g during 1min at 4ºC and 10µl of the supernatant (containing the pDNA) were

used to in the PCR reaction. The commercial kit NovaTaqTM

hot Start Master Mix was used for the

PCR reaction, each reaction mixture of 50µl contains: 10µl of pDNA, 25µl of Master Mix (1X

concentrated), 0.5µl (0.1µM final concentration) of each forward and reverse primers (Table 7) and the

volume of PCR grade water necessary to obtain the final volume. Normally, as negative control of

this procedure one PCR reaction with a mixture with all the components and 10µl PCR grade water

instead of the supernatant (containing the pDNA). The conditions of PCR were: 9min at 95ºC; 30

cycles of: 30s at 94ºC, 30s at 56.9ºC and 1min at 72ºC; 10min at 72ºC. At the end the PCR products

were run in a 1% agarose gel electrophoresis.

Table 7 - Primers for erythromycin gene used in the PCR colony procedure.

Primer designation

Primer sequence Tm (ºC)

Size of amplified

fragment (bp)

Ery_forward 5’- CCATGCGTCTGACATCTATCTG- 3’ 55.2 190

Ery_reverse 5’- CTGTGGTATGGCGGGTAAGT- 3’ 55.2

26

2.11. Gene Knock-out Strategy

The gene knock-out protocol used in this work is based in the work of Datsenko and Wanner.

[71]

This protocol original established for E. coli was adapted and optimized in order to be applicable for

the modification of the L. lactis strain.

The concentration of the different antibiotics to select cells harboring each of the three plasmids

involved in this protocol (pKD13, pKD46 and pCP20) had to be optimized and it is described in results

section.

In the first step, L. lactis strain was electroporated with the pKD46 plasmid by using of 2×109 cells

in 100µl L. lactis electrocompetent cells, 1,000ng of the pKD46 plasmid and the application of an

electric pulse with 1,250V. The electroporated cells were allowed to recover in MRS medium during 3

hours at 30ºC. After this period, cells were plated on MRS agar supplemented with 100 µg/ml of

ampicillin and incubated for 48-72 hours for selection of transformant colonies. The confirmation of the

transformation with the pKD46 was performed by the PCR colony procedure described above, but in

this case was used a pair of primers (Table 8) to amplify the gene of resistance to ampicillin (amp)

encoded in the pKD46 sequence and consequently the annealing temperature used in the PCR was

adapted for 52ºC.

After the successful electroporation of L. lactis strain with pKD46 was performed the in silico

design of the necessary primers and PCR amplification of the kanamycin cassette. This cassette

contains the kanamycin resistance gene delimited by FRT (FLP recombinase Recognition Target)

sites to facilitate in the final of the process the excision of the kanamycin resistance gene, two priming

sites (coincident with the start and the final of the kanamycin resistance gene) and the homology

sequence (with homology to the area of the genome near to the nth gene). The commercial kit

Platinum PCR SuperMix was used for the PCR reaction, each reaction mixture of 50µl contains:

10ng of pKD13 plasmid (which contains the kanamycin resistance cassette), 45µl of Master Mix (1X

concentrated), 1µl (0.2µM final concentration) of each forward and reverse primers (kancass_nth

primers, Table 8) and the volume of PCR grade water necessary to obtain the final volume. The

conditions of PCR used for the amplification of the kanamycin cassette were: 2min at 94ºC; 30 cycles

of: 25s at 94ºC, 25s at 55ºC and 1min and 30s at 72ºC; 10min at 72ºC. In the end the PCR product

was run in a 1% agarose gel electrophoresis and was excised the band corresponded to the

kanamycin cassette (without exposing to the staining solution of ethidium bromide and the UV light).

Subsequently the excised band was purified by use of NZYGelpure kit from Nzytech.

27

Table 8 - Primers for ampicillin resistance gene of pKD46 and for the generation of kanamycin cassette.

Primer name Primers Sequence Size of

amplified fragment (bp)

Amp_pKD46

Forward primer: 5’-GCGATCTGTCTATTTCGTTC -3’ 614

Reverse primer: 5’-GTTCTGCTATGTGGCGCGGT -3’

Kancass_nth

Forward primer: 5’- AGAGAAAGAAACCACAAGAAGATTTTTAT ATTCCTTTGGATGGACCATGGAATAGTTAATGTGTAGGCTGGA-3’

1604 Reverse primer: 5’- GGTCTGAGCCAATATCAGCAAGTCTTGCT

CCATTATCAACATAATTAGCTACTGCTTTCATCCGTCGACCTGCAG-3’

2.12. Molecular Distinction of Lactococcus lactis LMG 19460 and

Lactobacillus plantarum CCUG 61730

With the objective to distinguish and also to identify possible unintentional exchanges between the

two LAB strains used in this work, it was establish a molecular procedure, based in Salbi et al. (2014),

to distinguish the two strains: Lactococcus lactis LMG 19460 and Lactobacillus plantarum CCUG

61730. This molecular procedure is based on the use of two species-specific primers, one primer for

recA gene for Lactobacillus species and another primer for hisG gene for Lactococcus species. [72]

The LAB cells (Lactococcus lactis LMG 19460, Lactobacillus plantarum CCUG 61730 and

Lactococcus lactis LMG 19460 transformed with the vector pTRKH3 and its derivatives) were grown

overnight, at the different temperatures and agitation according to the strain (already described 2.7), in

15ml falcon tubes contain 5ml of MRS medium supplemented with 5µg/ml of erythromycin (only in the

cells that containing the pTRKH3 vector and its derivatives). In the next day, the O.D.600nm was

measured in a U-2000 spectrophotometer (Hitachi®) to check the growth of the LAB cells and then the

extraction the genomic DNA by Wizard Genomic DNA Purification Kit (Promega) was performed. After

the extraction process, gDNA concentration was measured using the Nanodrop Spectrophotometer

(Nanovue Plus, GE). Subsequently, the purified genomic DNA was used to do the PCR reactions with

the two pairs of species-specific primers (recA forward and reverse primers and hisG forward and

reverse primers). Table 8 describes the sequence of the primers and the size of the fragments

originated with each one of the primers. These PCR reactions were carried out with Novagen® KOD

Hot Start DNA Polymerase Novagen® and each reaction mixture of 25µl contains: 2.5µl of buffer KOD

(1X concentrated), 2.5µl of dNTP’s (0.2mM final concentration), 1µl of MgSO4 (1mM final

concentration), 200ng of purified genomic DNA, 0.75µl (0.3µM final concentration) of each forward and

reverse primer (Table 9), 0.5µl of KOD Hot Start DNA Polymerase (0.02U/µl final concentration) and

PCR grade water to obtain the final volume of 25µl. To check possible unspecific amplifications and

the specificity of the primers (recA and hisG) the PCR was made for both species with both primers.

The conditions of PCR reaction for primer recA were: 3min at 95ºC; and 35 cycles of: 1min at 95ºC,

1min at 52.5ºC and 1min at 70ºC. In the other hand, the conditions of PCR reaction for primer hisG

were: 3min at 95ºC; and 35 cycles of: 1min at 95ºC, 1min at 41.5ºC and 1min at 70ºC. In the end all

the PCR products were run in a 1% agarose gel electrophoresis.

28

Table 9 - Species-specific primers for Molecular Distinction of Lactococcus lactis LMG 19460 and Lactobacillus

plantarum CCUG 61730.

Strain Gene Primers Sequence Size of

amplified fragment (bp)

Lactococcus lactis LMG 19460

hisG Forward primer: 5’- CTTCGTTATGATTTTACA-3’

933 Reverse primer: 5’- CAATATCAACAATTCCAT-3’

Lactobacillus plantarum CCUG 61730

recA

Forward primer: 5’- CCGTTTATGCGGAACACCTA-3’

318 Reverse primer: 5’-

TCGGGATTACCAAACATCAC-3’

2.13. Equivalence Between Optical Density and Number of Cells

The relation normally used for LAB between O.D.600nm and number of cells (O.D.600nm = 0.1 or 7 x

107

cells/ml, according to Jones et al. [73]

) was confirmed with the two LAB strains used (Lactococcus

lactis LMG 19460 and Lactobacillus plantarum CCUG 61730). The strains were grown in a pre-

inoculum overnight, at the different temperatures and agitation according to the strain (as already

mentioned in section 2.7), in 15ml falcon tubes contain 5ml of MRS medium. In the next day, these

pre-inocula were used to start a new culture, by the addition of these cells to a MRS fresh medium up

to O.D.600nm=0.1, in new 15ml falcon tubes contain 5ml of new fresh medium. Two samples of each

strain were harvested after 3.5 hours and 5.5 hours. The samples of each strain were plated on MRS

agar in different dilutions. The dilutions chosen for plating correspond to the ones that theoretical give

origin to cells number that is possible count in a 9cm Petri dish (30 to 300 colonies) and one dilution

below and other above of this dilution in which are possible to count. To determine what dilutions

correspond to these criteria the general relation for LAB cells between optical density and cell number

(O.D.600nm=0.1 or 7x107cells/ml) was used. Twenty four hours after, the colonies of Lactobacillus

plantarum CCUG 61730 strain were counted (plates that contains a number of colonies above 300

were discarded). In the other hand, 48 hours after the same procedure was realized for the

Lactococcus lactis LMG 19460 strain. With the number of colonies obtained, the respective dilution

and the O.D.600nm measured in the respective sample a relation between number of cells per milliliter

and the O.D.600nm was established.

In addition, in order to confirm the relation between the number of cells and the optical density,

cells were countedin a hemocytometer. For this 10µl (1:10 dilution) of one L. lactis culture at the end

of the exponential phase of the cell growth was mixed with 2µl of methylene blue by gently pipetting,

and then 10µl of this mix were loaded into hemocytometer (from KOVA Glasstic Slide 10). Count was

performed in Leica DMLB microscope under a 50x objective and a 10x ocular (500x magnification).

29

2.14. L. lactis LMG 19460 growth conditions to evaluate pDNA copy numbers

2.14.1. Microplate cell growth of L. lactis LMG 19460

A preliminary cell growth of the L. lactis strain was made in polypropylene square 24-deepwell

microplates (from EnzyScreen company) in order to optimize the volume of culture in each well. For

this purpose, the L. lactis competent cells was growth in 15ml falcon tubes containing 5ml of MRS

medium, overnight at 30ºC, 100rpm. In the next day, the pre-inoculum was used to start a new culture,

at 30ºC, 100rpm, by the addition of these cells to a MRS fresh medium up to O.D.600nm=0.1, in four

different volumes of culture (distributed by the lines of the 24-well microplate): 1.25ml (50% of the

recommended volume), 2.5ml (the recommended volume), 3.75ml and 5ml (150% and 200% of the

recommend volume respectively). After inoculation the optical density of the growth of L. lactis

competent cells in the different volumes was measured in a Spectrostar Nano from BMG LABTECH,

at each 1h 30min until 12 hours of growth. From the 3 hours of growth onwards it was performed

replicate measurements of the optical density using the well of the previous measure. [74]

Then, the 24-well microplate format was used to optimize the growth medium for L. lactis

transformed with pTRKH3. For this objective, cell banks of the L. lactis transformed with pTRKH3

vector were grown in 15ml falcon tubes containing 5ml of MRS medium supplemented with 5µg/ml of

erythromycin, overnight at 30ºC, 100rpm. In the following day, the pre-inoculum was used to start a

new culture with an O.D.600nm=0.1, by the addition of the correct volume of these cells in sets

(composed by six different media) of 8 wells with 3.75ml each one,. The six media used were: Man,

Rogosa and Sharpe (MRS) medium, from the Liofilchem, which have the following composition:

Peptospecial 10g/l, Beef extract 10g/l, Yeast Extract 5g/l, Glucose 20g/l, Triammonium Citrate 2g/l,

Sodium Acetate 5g/l, Magnesium Sulphate 0.2g/l, Manganese Sulphate 0.05g/l, Di-Potassium

Phosphate 2g/l, 1ml of Tween 80g/l and pH of 6.2; M-17 medium from Sigma- Aldrich composed by

ascorbic acid 0.5g/l, lactose 5g/l, magnesium sulfate 0.25g/l, meat extract 5g/l, meat peptone 2.5g/l,

sodium glycerophosphate 19g/l, soya peptone 5g/l, tryptone 2.5g/l, yeast extract 2.5g/l and pH of 7.2;

Elliker medium constituted by pancreatic digest of casein 20g/l, glucose 5g/l, lactose 5g/l, sucrose 5g/l,

yeast extract 5g/l, NaCl 4g/l, gelatin 2.5g/l, sodium acetate 1.5g/l, ascorbic acid 0.5g/l and pH of 6.8;

MRS medium supplemented with 5g/l of lactose from the stock solution (250g/l); M-17 medium

supplemented with 20g/l of glucose from the stock solution (500g/l); and M-17 medium supplemented

with 20g/l of glucose and 13.2mM of sodium citrate. The six different media were supplemented with

5µg/ml of erythromycin. Upon the inoculation, the optical density of the growth of L. lactis transformed

with pTRKH3 in the different media was measured at each 1h 30min until the 12 hours of growth and

in at the end of the growth (24 hours). As already explained, from the 3 hours of growth onwards it

was performed replicate measurements of the optical density using the well of the previous measure

and from the same wells was collected 1ml in order to measure the pH along the growth. Additionally,

samples were collected at 10h 30min and 24h of the growth in order to later evaluate plasmid copy

number by miniprep purification (collection volume with an optical density equal to 10 at 10h 30min of

growth and an optical density of 5 at 24 hours of growth) and by quantitative real time PCR analysis

(100µl of volume for the both times of collection). [75]

30

In the other hand, the 24-well microplate platform was used to grow L. lactis transformed with

the original vector (pTRKH3) and with the modified vectors (pTRKH3_3nuc, pTRKH3_4nuc,

pTRKH3_5nuc). For this purpose, cell banks of L. lactis transformed with pTRKH3, pTRKH3_3nuc,

pTRKH3_4nuc and pTRKH3_5nuc were grown, in 15ml falcon tubes containing 5ml of MRS medium

supplemented with 5µg/ml of erythromycin, overnight at 30ºC, 100rpm. In the next day, the four

different pre-inocula were used to start a new culture, at 30ºC 100rpm, by the addition of these cells to

the wells with 3.75ml of M-17 medium supplemented with 20g/l of glucose and 5µg/ml of erythromycin

up to O.D.600nm=0.1. After inoculation the optical density of the growth was measured at each 1h 30min

until the 12 hours of growth and in the final of the growth (24 hours).The replicated optical density

measurements and pH monitorization was performed as already explained. Additionally, samples

were collected at the 10h 30min and 24h of the growth to later quantifiy plasmid copy number by

miniprep purification (collection volume with an optical density equal to 30) and quantitative real time

PCR analysis (100µl of volume in the both times of collections).

Finally the microplate platform was used to grow L. lactis transformed with original vector and

with the modified vectors (pTRKH3_3nuc, pTRKH3_4nuc, pTRKH3_5nuc) in MRS medium, M-17

medium and MRS medium supplemented with 5g/l of lactose. For this objective, the pre-inoculum of

the L. lactis with the four different vectors was prepared and grown in the same way of the cell growth

above described. In the following day, the four different pre-inoculums was used to start a new culture,

at 30ºC 100rpm, by the addition of these cells to the wells with 3.75ml of the three media (MRS, M-17

and MRS supplemented with 5g/l of lactose) and 5µg/ml of erythromycin up to O.D.600nm=0.1. After

inoculation the optical density of the growth were measured at five different points of the cell growth: 0,

4h 30min, 7h 30min, 10h 30min and 24 hours. Additionally to the measure of the optical density in

these five points was collected 1ml of each one of the different cells populations for the measure of the

pH. Also, in similarity with the previous cell growth was realized collections at the 10h30min and 24h

of the growth to later realize miniprep purification (collection volume with an optical density equal to 4

at 10h 30min of growth and an optical density of 3 at 24 hours of growth) and quantitative real time

PCR analysis (100µl of volume in the both times of collections).

2.14.2. Shake-flask cell growth of L. lactis LMG 19460

A preliminary 100ml shake-flask cell growth of the L. lactis transformed with pTRKH3 was

carried out in order to optimize the culture volume in the shake-flask. For this, cell banks of L. lactis

transformed with pTRKH3 were grown, in 15ml falcon tubes containing 5ml of MRS medium, overnight

at 30ºC, 100rpm. In the next day, the pre-inoculum was used to start a new culture, at 30ºC, 100rpm,

by the addition of these cells up to O.D.600nm=0.1, to M-17 medium supplemented with 20g/l of

glucose and 5µg/ml of erythromycin, in three different volumes of culture: 25ml, 50ml and 75ml. Each

cell culture was replicated in two different 100ml shake-flasks in order to have replica points along the

cell growth. Following inoculation the optical density of the growth of L. lactis transformed with

pTRKH3 in the different volumes was measured in each 1h 30min until the 13h 30min of growth and in

the final of the growth (24hours) using a U-2000 spectrophotometer (Hitachi®). Additionally was

31

collected 1ml of culture medium of each shake-flask at three points of the cell growth (0h, 10h 30min

and 24h) in order to measure the pH. To evaluate the influence of the culture volume in the pDNA

production 5ml of each shake-flask at 10h 30min and 24 hours were collected to later make a miniprep

purification followed by pDNA quantification.

Additionally the shake-flask platform was used to perform the cell growth of L. lactis

transformed with pTRKH3, pTRKH3_3nuc, pTRKH3_4nuc and pTRKH3_5nuc. For this, cell banks of

the L. lactis transformed with pTRKH3, pTRKH3_3nuc, pTRKH3_4nuc and pTRKH3_5nuc were

grown, divided according to the vector of each one,15ml falcon tubes containing 5ml of MRS medium

supplemented with 5µg/ml of erythromycin, overnight at 30ºC, 100rpm. In the following day, the four

different pre-inoculums was used to start a new culture, at 30ºC 100rpm, by the addition of these cells,

up O.D.600nm=0.1, to the 100ml shake-flask with 75ml of M-17 medium supplemented with 20g/l of

glucose and 5µg/ml of erythromycin. Each one of the four cell populations was grown in two different

100ml shake-flasks in order to have replica points along the cell growth. After inoculation the optical

density of the growth were measured in each 1h 30min until the 10h 30min of growth and at 24 hours.

In addition were collected samples to measure the pH by the same procedure realized to the previous

described shake-flask growth. Also was realized collections at the 10h30min and 24h of the growth to

later realize miniprep analysis (collection volume with an optical density equal to 30) and quantitative

real time PCR analysis (100µl of volume in the both times of collections).

Finally, was realized one shake-flask cell growth of L. lactis transformed with pTRKH3,

pTRKH3_3nuc, pTRKH3_4nuc and pTRKH3_5nuc similar to the above mentioned cell growth, only

with some differences: each L. lactis cell population was grown in three different shake-flask with three

different mediums (MRS medium, M-17 medium and MRS medium supplemented with 5g/l of lactose)

and the collection volume for miniprep analysis has realized for one optical density of 10 in each

shake-flask.

2.15. Quantitative RT-PCR analysis of plasmid copy number in L. lactis

cells

The quantification of plasmid copy number in L. lactis LMG 19460 was performed in the

Roche LightCycler detection system using the FastStart DNA Master SYBR Green I kit. The

quantification of the plasmid copy number (PCN) was based on the ratio between the amplification of

erm gene, the selective marker for erythromycin resistance of the pTRKH3 vector and the

amplification of the feoA gene, one single-copy gene of Lactococcus lactis subsp. lactis Il1403

genome which has a high degree of homology with the L. lactis strain of this work. [76, 93]

2.15.1. Preparation of pDNA and gDNA standards

The first step for the quantitative RT-PCR procedure consisted in performing several dilutions

of previously purified pDNA and gDNA from L. lactis LMG 19460 strain, with Nucleospin plasmid from

Macherey Nagel Bioanalysis Kit and with Wizard Genomic DNA Purification Kit respectively, in PCR

grade water, in order to obtain five different concentrations of pDNA and gDNA (0.5pg/µl, 5pg/µl,

32

50pg/µl, 500pg/µl; and 5000pg/µl) necessary for the construction of the two calibration curves (plasmid

and genome curve). In order to achieve a high degree of precision, each dilution of the both calibration

curves was conducted in triplicate and in the end the standard curves were constructed based in the

average result of each point of the standard curves.

2.15.2. Sample preparation for qPCR

Samples of L. lactis LMG 19460 without plasmid were collected from overnight cultures grown

at 30ºC and 100rpm, in a 15ml falcon containing 5ml of MRS medium as previously described. The

100µl samples of L. lactis were stored at -20ºC and were used for spiking the capillaries for the

standard curve of pTRKH3. In all the samples analyzed was used the same amount of cells in each

one of the capillaries (1000 cells per capillary) the only exception was the capillaries with the five

points of gDNA.

The PCR reaction mixtures were prepared containing: 2 µl of 10x SYBR Green Mixture, 1µl

(0.5µM) of each (erm and feoA) forward and reverse primers (Table 10) according to the reaction

mixture,1.6µl of MgCl2 (3mM) and 10.4µl of PCR-grade water, for a final volume of 16µl. Once the erm

and feoA reaction mixtures and dilutions were done, the capillaries were prepared with numerous

samples for a final volume of 20µl per capillary. A negative control was done in duplicate, adding 4µl of

PCR grade waterto 16µl of each one the reaction mixtures. Another negative control was made in

duplicate, with 2µl of non transformed L. lactis cells (1,000 cells), 2µl of sterilized and filtrated MilliQ

water and 16µl of erm reaction mixture. The erm calibration curve was obtained by mixing 2µl of non

transformed L. lactis cells (1,000 cells) with 2µl of each one of the five above mentioned pDNA diluted

solutions and 16µl of reaction mixture. The constructing of feoA calibration curve implied the same

mixture but without L. lactis cells, this volume was completed with PCR grade water. Two µl (with

1,000 cells) of L. lactis transformed with one of the four plasmids (pTRKH3, pTRKH3_4nuc,

pTRKH3_3nuc and pTRKH3_5nuc) coming from the different conditions of cell growth, were equally

added to 2µl of PCR grade water and to 16µl of each one of the reaction mixtures (erm and feoA

mixtures). Each one of the samples including the negative controls was done in duplicate and in

triplicate in the case of the capillaries with the points of the both calibration curves.

Table 10- Primers sequence for erm and feoA genes used in the quantitative RT-PCR procedure and size of

amplified fragments for the both primers used.

Gene

Primers Sequence

Size of amplified

fragment (bp)

ery Forward primer: 5’- CTTCGTTATGATTTTACA-3’

190 Reverse primer: 5’- CAATATCAACAATTCCAT-3’

feoA Forward primer: 5’-TCAGACGCCGCTTGATGGAC-3’

89 Reverse primer: 5’-AGTTCAAGAGGGTCGCCAAGTG-3’

33

2.15.3. Real-Time quantitative PCR for determination of plasmid content

Arranged all the capillaries with qPCR reaction mixtures went to a LightCycler detection

system and were incubated at 95ºC for 10min in order to activate FastStart DNA polymerase and lyse

cells. After this period of time, 40 cycles of quantitative RT-PCR were performed, with each cycle

consisting in incubation periods of 10 seconds at 95°C for denaturation step, followed by 5 seconds at

57°C to allow the annealing of the primers as well as the insertion of the dye, and finalized at 72°C for

14 seconds to amplify the DNA chains. Finally, a denaturation step was made at 70°C for 30 seconds

followed by a melting step based on a temperature gradient, with an increase of 0.05°C per second,

from 70°C to 95°C, with a final cooling at 40°C for 30 seconds.

2.15.4. Confirmation of amplification specificity

Since SYBR Green binds to the dsDNA in a sequence-independent way, was necessary avoid

the non-specific amplification, to check this the melting peaks analysis of the two PCR products (erm

and feoA amplicons) was realized. So the melting process of dsDNA originates a strong reduction in

the fluorescent signal around the melting temperature (Tm) of each PCR product, resulting in a peak in

the negative derivative of melting curve. By this reason is necessary to verify if the two different PCR

products show two melting temperatures. In addition, after real time PCR reaction a 1% agarose gel

electrophoresis was done in order to observe if the two amplified fragments have the expected size

(erm products with 190pb and feoA products with 89bp). These two analyses allow check the

presence of non-specific amplifications with the primer sets tested.

2.15.5. Plasmid copy number determination based in the use of the Relative

Quantification method of Real-Time PCR

In order to determine the plasmid copy number, by using the relative quantification method of

Real-Time PCR, the first step was the construction of standard curves for plasmid DNA and for

genomic DNA. These curves were constructed placing the log values of the five concentrations values

of pDNA or gDNA (x-axis) versus the corresponding threshold cycles values obtained (y-axis). The

slope of each standard curve was used to determine the amplification efficiency (E) according to the

equation 1:

E 10 (-

1

slope) (1)

Finally, the plasmid copy number (PCN) was determined by the application of equation 2

considering the different amplification efficiencies obtained by the standard curves and the Ct values

of the several samples in the presence of erm (Cte) and feoA (Ctf) primers: [77]

PCN EfCtf

EeCte (2)

34

2.15.6. Plasmid copy number determination based in the Standard Curve

Method

Additionally, was determined the plasmid copy numbers of the samples based in the standard

curve method, which only have in account the amplification of the target gene (erm), for this

determination was used the following equation (3):

Plasmid copy number per cell ( pg 2µl 6.0221 10

23molecules/mol

7766bp 660g

mol 1 1012 ng/g

) Number of cells in capillary (3)

This equation was based in the concentration of pTRKH3 of each sample (represented by X),

the number of molecules per mol expressed by Avogadro constant, the plasmid base pair number of

the pTRKH3 (7,766bp) and the average molecular weight of DNA base pair (660 g/mol).[78]

The concentration of each sample (X) was obtained by the equation (4)

X= 10 CT- ( )

(4)

Where b and m is y intercept and the m is the slope, respectively, of the linear regression of

the standard curve for the plasmid.

2.15.7. Statistical analysis of Quantitative Real-Time Results

The different plasmid copy numbers of the four plasmids obtained by the relative quantification

method of real-time PCR was statistic analyzed by the application of the t-Student test, in order to

determine if the differences between modified plasmids (pTRKH3_4nuc, pTRKH3_3nuc and

pTRKH3_5nuc) and non modified pTRKH3 have statistical significance (p˂0.05).

2.16. Miniprep analysis of plasmid copy number in L. lactis cells

After the realization of miniprep procedure, as already mentioned ( section: Electroporation of

L. lactis LMG 19460 and L. plantarum CCUG 61730 and plasmid purification) the calculation of

plasmid copy number of each sample as realized by the application of the following equation (5):

Plasmid copy number per cell ( ng 6.0221 10

23molecules/mol

7766bp 660g

mol 1 10 ng/g

) Number of cells in the sample (5)

This equation was realized based in the mass obtained in the final of the miniprep purification

(represented by X), the number of molecules per mol expressed by Avogadro constant, the plasmid

base pair number of the pTRKH3 (7766 bp) and the average molecular weight of DNA base pair (660

g/mol).[78]

35

3. Results and Discussion

3.1. Modification of RBS in pAMβ1 origin of pTRKH3

To make possible the objective of this work, the efficient production of pDNA by LAB as host, it

is necessary to overcome a major drawback in the use of LAB for pDNA production: the low copy

number of plasmids per LAB cell, which leads to low plasmid yields when compared with the most

used host (E. coli). To overcome this problem, the ribosome binding site (RBS) of the pAMβ1 origin of

replication of the pTRKH3 was modified by site-directed mutagenesis, in order to achieve a higher

level of production of the RepE protein and ultimately to increase the plasmid copy number in LAB. [4, 5,

55, 56, 57, 58, 64, 65]

In order to modify the RBS sequence it was used the theoretical Anderson library to predict

and design a putatively stronger RBS sequence. The new RBS sequence was designed and then

synthesized by two rounds of site-directed mutagenesis (by the use of two different pairs of mutagenic

primers) in order to achieve the desired modified sequence of RBS (CAGGACCC). [58]

Before site-directed mutagenesis the integrity and identity of the pDNA template (pTRKH3)

was checked by a double digestion. By the analysis of the agarose gel electrophoresis present in

Figure 9 showing the result of double digestion of pTRKH3 with two restriction enzymes (HindIII and

EcoRI) it is possible to see the three expected fragments with 5,265bp, 1,523bp and 978bp.

Figure 9 - Agarose gel electrophoresis showing the products of a double digestion of pTRKH3 with two restriction

enzymes HindIII and EcoRI. Lane L- Molecular-weight marker (NYZ DNA Ladder III, NYZTech). Lane 2- Purified

pTRKH3 digested with HindIII and EcoRI, in black squares are marked the fragments originated from this double

digestion: 5,265bp, 15,23bp and 978bp.

36

After the verification of the integrity and identity of the pTRKH3 it was used as template for the

site-directed mutagenesis. In figure 10, it is shown the sequencing of the pAMβ1 origin of replication

after the first round of mutagenesis, which gave origin to the RBS sequence of CTGGAGCC and is

denominated as pTRKH3_3nuc.

Figure 10 - Sequencing result of the site-directed mutagenesis procedure with the first pair of mutagenic primers

(F3 and R3) which originated the modified vector pTRKH3_3nuc. The green colour highlights the desired target

sequence of RBS in this step of mutagenesis approach. The uppercase letters represent the expected pAMβ1

origin for the modified pTRKH3_3nuc and the lowercase letters represent the sequencing result for the same

plasmid.

Finally, in the Figure 11 it is shown the sequencing result of site-directed mutagenesis with the

second pair of mutagenic primers which originates the final desired RBS sequence: CAGGACCC,

giving origin to pTRKH3_5nuc.

Figure 11 - Sequencing result of the site-directed mutagenesis procedure with the second pair of mutagenic

primers (F2 and R2) which originated the modified vector pTRKH3_5nuc. The green colour highlights the final

desired target sequence of RBS. The uppercase letters represents the expected pAMβ1 origin for the modified

pTRKH3_5nuc and the lowercase letters represents the sequencing result for the same plasmid.

In addition, in this work was studied other modified sequence of RBS of the vector

(GGGGACAA) which was previous produced in our laboratory and was denominated as

pTRKH3_4nuc. [67]

3.2. Equivalence between Optical Density and Number of Cells

This procedure had the objective to verify if the relation between optical density and number of

cells per volume normally used for LAB (O.D.600nm=1 or 7x108cells/ml), according to Jones et al, is also

applicable in the LAB strains used in this work. [73]

To achieve the ratio between optical density and number of cells for L. lactis and L. plantarum,

as already mentioned in the materials and methods section, it was used the number of colonies

counted after plating serial dilutions. In average, the equivalence between O.D.600nm=1 and cells/ml

was 13.1×108 for L. lactis LMG 19460 and 17.3×10

8 for the L. plantarum CCUG 61730. By the

37

analysis of these values is possible to conclude that the theoretical relation generally applied for LAB

cells also can be applied to these particular strains because the difference is not significant and these

differences probably comes from the fact that this procedure only takes into account the viable cells

and from the typical experimental error associated with all the experimental procedures.

It should be noted this equivalence is fundamental to establish a rapid and easy way to known

the number of cells present in a determined volume by the measurement of optical density, in several

subsequent procedures that implicate manipulation of the LAB cells. For example, for the plasmid

copy number quantification, of the original vector and the three modified vectors per cell in the

different conditions of cell growth.

The previous method only quantifies the viable cells. In order to quantify the total number of

cells collected at the final of the exponential growth phase, cells from a sample of L. lactis LMG 19460

were counted by using a hemocytometer. Figure 12 shows part of an area of a hemocytometer

obtained with an optical microscope of a sample used to count the total number of cells.

Figure 12 - L. lactis cells in hemocytometer chamber.

The cells number counted in a specific area/volume of the hemocytometer was multiplied by

the dilution factor which resulted in 16×108cells/ml. Although, in all the experimental procedures was

used the theoretical relation (O.D.600nm=1 or 7x108

cells/ml) in order to overcome the experimental

error associated with both procedures that were performed one time each.[73]

3.3. Optimization of electroporation of L. lactis LMG 19460 and L.

plantarum CCUG 61730

Electrotransformation is a very high efficient method of transformation for a wide range of

gram-negative and positive bacteria including several lactic acid bacteria. However, the transformation

efficiency is strain dependent and varies from 102-10

7 transformants per µg of pDNA. Several factors

can influence the electrotransformation efficiency like: the growth phase in which the cells were

38

harvested (cells harvested in the middle of the exponential growth phase show higher transformation

efficiency when compared with cells harvested in the beginning of this phase), the number of cells (an

adequate cell density enhances the interaction between cells and pDNA and reduces the electrical

pulse damage), the concentration and size of the plasmid, the medium composition, the

characteristics of the applied electric pulse and the specific characteristics of the species and strains.

Finally, other significant parameter is the effect of the cell wall weakening agents, factor especially

important in Gram-positive bacteria like LAB that have a thick cell wall which is highly resistant to

mechanical disruption, for example, the current work’s protocol used a high concentration of NaCl to

increase the sensitivity to lysis by decreasing the peptidoglycan cross-linking. The conjugation and

relation between all these factors influence the efficiency of transformation. With this multiplicity of the

factors that affects the electrotransformation is essential to optimize the transformation conditions for

the two strains used in this study. [68, 70, 79, 80]

In order to optimize the electroporation conditions of L. lactis LMG 19460 and L. plantarum

CCUG 61730 strains several different parameters like: voltage of the electric pulse (750 V-2,500 V),

number of the electric pulses (1–5x), number of cells (2×109cells,10

10cells and 3×10

10cells in 100µl),

pDNA concentration (250-1000ng), time for cell recuperation after electroporation and before plating

(ranging from 3 hours to 12 hours) and erythromycin concentration in MRS plates (2.5-10µg/ml) were

tested lonely or in an combined form. Between all the conditions tested, Table 11 only shows the

conditions in which the two strains and the four plasmids (pTRKH3, pTRKH3_3nuc, pTRKH3_4nuc,

pTRKH3_5nuc) gave transformed colonies.

Table 11 - Electroporation conditions and number of transformants of L. lactis and L. plantarum strains with the

different vectors (pTRKH3, pTRKH3_3nuc, pTRKH3_4nuc, pTRKH3_5nuc).

Strain

Plasmid

pDNA

concentration

(ng)

Number of

cells in

100µl aliquots

Electric pulse

conditions (V)

Recuperation

conditions

Erythromycin

(µg/ml)

Number of

transformants

Lactococcus

lactis

LMG 19460

pTRKH3

500

2×10

9

3×1,800

3 hours, 30ºC

5

1

pTRKH3_4nuc

500

2×10

9

3×1,800

4

pTRKH3_3nuc

500

2×109

3×1,800

1

pTRKH3_5nuc

500

2×10

9

5×1,800

1

4×1,800

2

Lactobacillus

plantarum CCUG 61730

pTRKH3

1000

1010

1×1,250

3 hours, 37ºC

10

3

2×1,250

8

10

11

1,250

uncountable

3×1010

1,250

302

39

The modified plasmids (pTRKH3_3nuc, pTRKH3_4nuc and pTRKH3_5nuc) were not used to

transform the L. plantarum strain. This is due to the fact that despite the considerable amount of

transformed colonies obtained after the electroporation of L. plantarum strain with pTRKH3 (Table 11),

in any of the colonies form the different electroporation conditions was possible to purify intact

plasmids as was confirmed by agarose gel electrophoresis. To illustrate this in more detail, Table 12

showed three colonies originated from two electroporation conditions (1010

(A) or with 3×1010

(B) cells

in 100µl of L. plantarum competent cells, 1,000ng of pTRKH3 and 1,250V of electric pulse).

Table 12 - Result from the purification (O.D.600nm, concentration and ratios) of colonies originated from two

different electroporation conditions of L. plantarum strain: A - 1010

cells, 1,000ng of pTRKH3 and 1,250V of electric

pulse; B - 3×1010

cells, 1,000ng of pTRKH3 and 1,250V of electric pulse.

Electroporation

condition

O.D.600nm

Concentration (ng/µl)

A260/A280

A260/A230

A 1.13 6.2 2.385 0.873

B 1.10 39.5 1.580 4.788

B 1.02 8.4 1.732 0.703

This is an apparent contradictory result in which the transformed colonies of L. plantarum with

pTRKH3 grow in the presence of erythromycin in the liquid medium until an optical density near to one

and the concentration of the purified plasmid resulted in values between 6.2 to 39.5ng/µl but no

purified plasmid was seen in an agarose gel. It is unlikely that the colonies obtained from the different

conditions of electroporation of L. plantarum with pTRKH3 were false positives. Therefore, some

selected colonies from the different electroporation conditions (including three of the above colonies)

were used to perform a colony PCR procedure in order to verify the transformation of this strain with

the vector.

The agarose gel with the products of a colony PCR procedure of L. plantarum transformed

with pTRKH3 show the amplification of 190bp fragment from the plasmid, which corresponds to part of

the erythromycin gene present in pTRKH3, at least in the colonies run on lanes 5, 8 and 11 (Figure

13).

40

Figure 13 - Agarose gel electrophoresis of the products of colony PCR of L. plantarum CCUG 61730 transformed

with pTRKH3. Lane L- Molecular-weight marker (NYZ DNA Ladder III, NYZTech). Lane 1- Negative control of

colony PCR reaction (the reaction mixture was equal but instead of pDNA was used PCR grade water). Lane 2-5-

Electroporation condition of 1010

cells in 100µl of L. plantarum competent cells, 1,000ng of pTRKH3 and 1,250V of

electric pulse. Lane 6-11- Electropororation condition of 3×1010

cells in 100µl of L. plantarum competent cells,

1,000ng of pTRKH3 and 1250V of electric pulse. In the square is possible to see the amplification in some of the

colonies the erythromycin gene which proves the successful transformation of L. plantarum with pTRKH3.

This positive result observed from the PCR colony assay is apparently contradictory with the

result from the pTRKH3 plasmid purification procedure and the ability of cells to grow in the presence

of the antibiotic. This can be explained by the expression of endonucleases (endA) and recombinases

genes (namely recA and recU) in the L. plantarum strain, which could lead to unspecific degradation

and/or homologous recombination. [5]

This result highlights the need to establish a gene knock-out

strategy of these genes in order to improve the yield and the quality of pDNA produced by this host .

[81]

3.4. Gene Knock-out Strategy – Preliminary Results

In order to knock-out the endonucleases and recombinases genes in the LAB strains to

increase the yield and the quality of the pDNA is necessary to do some adaptations in the protocol

used in our laboratory for E. coli. [24]

The first target of this gene knock-out strategy was the nth gene,

which codes for endonuclease III in L. lactis LMG 19460 strain. This strain was firstly chosen because

apparently L. lactis keeps intracellularly plasmids (pTRKH3) more time before the action of the

endogenous endonuclease, like endIII. [76]

The gene knock-out protocol was based in the work of Datsenko and Wanner. [71]

This

procedure is based on the Red system that allows the disruption or inactivation of the target

chromosomal genes in E. coli. The base of this procedure is to replace a chromosomal sequence, in

this case will be the nth gene of L. lactis strain, by a selectable antibiotic resistance gene (insertion

41

cassette) that is generated by PCR by using primers with 36-nt homology extensions. The

replacement of the target gene by the insertion kanamycin cassette (amplified from pKD13 plasmid) is

realized by Red-mediated recombination in these homology extensions. After the selection of the

transformants with this cassette, the resistance gene can be eliminated by the use of a helper plasmid

expressing the FLP recombinase. The Red and FLP helper plasmids (pKD46 and pCP20

respectively) can be simply cured by growth at 37ºC because both are temperature-sensitive

replicons. Although this procedure is well established for E. coli the application of this procedure for

lactic acid bacteria requires several adaptations and optimizations that are explained below. [71]

The modified gene knock-out Datsenko and Wanner protocol implied the transformation of L.

lactis with three different plasmids: pKD13, pCP20 and pKD46. These plasmids were purified from E.

coli DH5α and were checked their general state and their size by the analysis of the agarose gel

electrophoresis (Figure 14). By the observation of this agarose gel is possible to conclude that all the

three plasmids have the expected size and show the three typical isoforms, with predominance of the

supercoiled isoform which is a good indicator of quality of the plasmids.

Figure 14 - Agarose gel electrophoresis with pKD13, pKD46 and pCP20 plasmids purified from E. coli DH5α.

Lane L- Molecular-weight marker (NYZ DNA Ladder III, NYZTech). L1- Three isoforms of pKD13 (linear isoform

with 3,434bp). L2- Three isoforms of pKD46 (linear isoform with 6,329bp). L3- Three isoforms of pCP20 (linear

isoform with 9,400bp).

These plasmids encode different antibiotic resistance genes (kanamycin resistance from

pkD13, chloramphenicol resistance from pCP20 and ampicillin resistance from pKD46), which permit

the selection of the transformants and in the case of the kanamycin resistance gene works as an

insertion cassette that inactivates the endonuclease target gene. In this sense, the first parameter that

was needed to check was the minimal concentration of these three antibiotics in which the wild type L.

lactis strain don’t show resistance and only the cells harboring each of the different plasmids can

grow.

42

In order to determine the minimal concentration of kanamycin L. lactis electrocompetent cells

were grown in different concentrations of this antibiotic: 20, 30, 40, 50, 100, 150, 200, 500 and

1,000µg/ml. However, in all of these concentrations L. lactis cells showed resistance. Therefore, due

to this high level of natural resistance neomycin, a structural analog of kanamycin, was tested to grow

L. lactis cells. This substitution was already used by Guchte et al. in order to overtake the natural

resistance of L. lactis to kanamycin. [82]

So it was tested the growth of L. lactis in 500 and 1,000µg/ml

of neomycin and was observed that in the presence of 1,000 µg/ml of neomycin the L. lactis cells

didn’t show resistance.

Additionally it was also tested the growth of L. lactis cells in different concentrations of

chloramphenicol: 40, 50, 60 and 70µg/ml. The L. lactis didn’t show any resistance in all the tested

concentrations of this antibiotic. Finally, it was also determined the minimal inhibitory concentration of

ampicillin for L. lactis cells in four concentrations: 80, 100, 120 and 150µg/ml of ampicillin. The L. lactis

cells didn’t demonstrate endogenous resistance in the four tested concentrations of ampicillin.

With all the concentrations of the three antibiotics optimized for the L. lactis strain, the gene

knock-out protocol was started by the electroporation of L. lactis with the plasmid pKD46. However,

also with this plasmid, as with the pTRKH3, it was needed to test several electroporation conditions to

obtain transformed colonies being the best: 2×109cells of L. lactis electrocompetent cells, 1,000ng of

pKD46, three hours of recuperation in MRS medium and at the final the electroporated cells were

plated in MRS supplemented with 1,000µg/ml of neomycin. However, similarly to L. plantarum strain it

was not possible to isolate the pKD46 plasmid, either due to plasmid degradation and/or

recombination or because a low number of copies of this plasmid inside this strain.

The presence of the pKD46 plasmid in the transformed colonies was also verified for these

colonies by colony PCR (with primers to ampicillin resistance gene present in pKD46). The agarose

gel electrophoresis (Figure 15) of the amplified products shows the presence of a fragment with 614bp

correspondent to the amplification of ampicillin resistance gene (lanes 1 Figure 15), which proves the

successful transformation of L. lactis strain with the plasmid pkD46.

43

Figure 15 - Agarose gel electrophoresis of the product of colony PCR to Lactococcus lactis LMG 19460

transformed with pKD46. Lane L- Molecular-weight marker (NYZ DNA Ladder III, NYZTech). L1 - Colony resulting

from the transformation of L. lactis LMG 19460 with pKD46 in which was verified the presence of the fragment

with 614bp correspondent to the amplification of ampicillin resistance gene.

After the successful electroporation of L. lactis strain with pKD46 the generation of the

kanamycin cassette was performed by a PCR procedure. Figure 16 shows the PCR product from the

amplification of the kanamycin cassette with the expected size of 1,414pb.

Figure 16- Agarose gel electrophoresis of the product of PCR amplification of the kanamycin cassette. Lane L-

Molecular-weight marker (NYZ DNA Ladder III, NYZTech). L1 - Amplified kanamycin insertion cassette with the

expected size (1,414bp).

At this moment, we are trying to transform L. lactis cells with the previously amplified

kanamycin resistance cassette, inducing at the same time the recombination between the nth gene

and the kanamycin cassette.

44

3.5. Molecular distinction of Lactococcus lactis LMG 19460 and

Lactobacillus plantarum CCUG 61730

In order to verify the identity and to avoid possible exchanges during the experimental

manipulation of the two LAB strains used in this work (L. lactis LMG 19460 and L. plantarum CCUG

61730) a PCR method based in Salbi et al., was established.. This method used two species-specific

primers, one primer for recA gene for Lactobacillus species and other primer for hisG gene for

Lactococcus species. These species-specific primers give rise to fragments with different sizes, the

primer for hisG gene originates one amplified fragment with 933bp and the primer for recA gene

originates one amplified fragment with 318bp, which makes it possible to distinguish these two strains

that belong to different species of LAB (Table 13). [72]

The amplification of these PCR products was verified through the observation of an agarose

gel electrophoresis (Figure 17). The PCR products that resulted from the amplification of both specific

primers (recA and hisG) in both strains showed the expected differences although some unspecific

amplifications were observed (Figure 17).

Table 13 - Summary table with the amplicons sizes from the genes that were used for species identification.

Strain Gene Size of amplified

fragment

Lactococcus lactis

LMG 19460

hisG 933bp

Lactobacillus plantarum

CCUG 61730

recA 318bp

Figure 17 - Agarose gel electrophoresis of the products of PCR reaction with primers hisG and recA in both

strains. Lane L- Molecular-weight marker (NYZ DNA Ladder III, NYZTech). Lane 1- L. plantarum CCUG 61730

with primer recA; Lane 2 - L. plantarum CCUG 61730 with primer hisG; Lane 3 - L. lactis LMG 19460 with primer

45

recA; Lane 4 - L. lactis LMG 19460 with primer hisG; Lane 5 - L. lactis LMG 19460 transformed with pTRKH3 with

primer recA; Lane 6 - L. lactis LMG 19460 transformed with pTRKH3 with primer hisG.

In a closer look to this agarose gel, is possible to see an amplification of the fragment

correspondent to recA gene, with 318bp for the strain L. plantarum CCUG 61730 (Lane 1 in the blue

square of the Figure 17). However, in the adjacent lane, L. plantarum CCUG 61730 with primer for

hisG gene no amplification is seen correspondent to the hisG gene. This fact shows that the primer for

recA gene have specificity for the L. plantarum strain but in the the hisG primer, which is specific for

the other strain, don’t have specificity for L. plantarum strain. The opposite situation is verified for L.

lactis strain that showed amplification with the primer for hisG gene (marked with an orange square in

the lanes 4 and 6, Figure 17). Although for L. lactis strain it was verified some amplification of the gene

recA (lanes 3 and 5) which shows that the gene of recA is present in both strains but the gene hisG is

more strain specific.

It is also noteworthy that both strains with both primers have some unspecific amplification.

This unspecific amplification is more notorious in L. lactis strain especially in the presence of the

primer for recA gene (lanes 3 and 5), maybe because this strain can contain a higher number of

recombinase genes (e.g. pi111, xerD and ymFD). [76]

But besides this fact this molecular method is

adequate to distinguish these two strains because the patterns of amplification are very different

between these two strains.

Later on, when the L. lactis LMG 19460 was transformed with each of the three modified

plasmids (pTRKH3_3nuc, pTRKH3_4nuc and pTRKH3_5nuc) and with the pkD46 plasmid, the same

PCR procedure was carried out with the specific primer hisG, for these transformed cells to guarantee

that during all the process of transformation the identity of the strain was maintained. By the analysis

of agarose gel with the product of this PCR it was showed that both the L. lactis wt strain and all the L.

lactis transformed cells with the different plasmids (pTRKH3, pTRKH3_3nuc, pTRKH3_4nuc,

pTRKH3_5 and pKD46) amplified the fragment correspondent to the hisG gene, with 933bp (Lane 2-7

of the agarose gel of the Figure 18).

46

Figure 18 - Agarose gel electrophoresis of the products of PCR reaction with primers hisG in L. lactis strain

transformed with the different plasmids. Lane L- Molecular-weight marker (NYZ DNA Ladder III,NYZTech). Lane

1- Negative control of PCR reaction (the reaction mixture was equal with the exception instead of gDNA was used

PCR grade water). Lane 2 - L. lactis LMG 19460 with primer hisG. Lane 3 - L. lactis LMG 19460 transformed with

pTRKH3 with primer hisG. Lane 4- L. lactis LMG 19460 transformed with pTRKH3_3nuc with primer hisG. Lane

5- L. lactis LMG 19460 transformed with pTRKH3_4nuc with primer hisG. Lane 6- L. lactis LMG 19460

transformed with pTRKH3_5nuc with primer hisG. Lane 7 - L. lactis LMG 19460 transformed with pKD46 with

primer hisG.

3.6. Optimization of L. lactis LMG 19460 growth conditions to study

pDNA copy numbers

3.6.1. Optimization of culture volume in microplate and shake-flask systems

Miniaturized growth systems, like 24-well microplates, are very useful culture systems to study

in parallel the pDNA copy numbers of different plasmids (pTRKH3, pTRKH3_3nuc, pTRKH3_4nuc and

pTRKH3_5nuc) because reduce demands in the incubation space and medium, and make possible to

study at the same time various parameters which influences the production of pDNA by L. lactis strain.

For the evaluation of plasmid copy numbers it was first necessary to optimize the cell growth

conditions in the microplate system namely the culture volume, culture media by monitoring O.D.600nm

and pH variation. [83, 84]

The culture volume was the first parameter to optimize in the microplate system. For this

optimization it was tested L. lactis cell growth in four well volumes. The chosen criteria was based in

the recommended culture volume per well from the manufacturer which was 2.5ml, the other volumes

tested corresponded to 50% (1.25ml), 150% (3.75ml) and 200% (5ml) in relation to the recommended

volume. [74]

Figure 19 shows the growth curves of L. lactis in different well culture volumes.

47

Figure 19 - Growth curves of L. lactis in the different well culture volumes (5ml, 3.75ml, 2.5ml and 1.25ml) in a

microplate system. The error bars of the graph represents the standard error of the mean (SEM) at times of the

cell growth in which the measure of optical density was realized in duplicates.

By the analysis of the Figure 19 is possible to observe that the lowest optical density was

obtained in the well with a culture volume of 1.25ml (O.D.600nm=1.1 after ten hours of cell growth). In the

other hand, the other three well culture volumes reache higher optical densities (O.D.600nm=2.8±0.4 after

10 hours of cell growth ). Despite the fluctuations between some points of a single cell growth the well

culture volume of 3.75ml was chosen for the next step of cell growth optimization in this system

because a balance between volume and optical density was obtained.

Additionally it was also made an optimization of the culture volume in a shake-flask system,

even though a more expensive amount of medium and time involved in the inoculation of the many

shake-flasks necessary to test the same number of parameters of the microplate system.

The volume optimization for the shake-flask system was performed by growing L. lactis

transformed with pTRKH3 in 100ml shake-flasks with 25ml, 50ml or 75ml of culture medium. In the

Figure 20 are shown the growth curves of L. lactis in the different shake-flask growth culture volumes.

Figure 20 - Growth curve (A) and pH variation (B) of L. lactis transformed with pTRKH3 in the different shake-

flask culture volumes (25 ml, 50ml and 75ml). The error bars of the graph represents the standard error of the

mean (SEM) in the times of the cell growth in which optical density was measured in duplicate.

B A

48

By the observation of the Figure 20 is possible to see that after 10h 30min of cell growth the

shake-flask with 25ml of volume reaches an optical density of 1, the 50ml shake-flask arrives to 1.8

and the shake-flask with 75ml reaches an optical density of 2.4. These data are in agreement with the

pH data, in which at 10h 30min of cell growth the shake-flask with a lower pH corresponds to the

shake-flask with a higher optical density (75ml shake-flask) and in opposition the higher pH

corresponds to the shake-flask with a lower optical density (25ml). This pH variation in which the

volume with a higher cell growth presents a more accentuated decrease in the pH values remains

constant along all the cell growth. The decreasing in the pH along with L. lactis cell growth was related

with the production of lactic acid, leading to an acidification of the culture medium. This acidification

conduces to an inhibition of the cellular metabolism (and growth) because the majority of LAB strains

cannot growth below pH 4. [94,95]

In addition, it was also made the purification of pTRKH3 plasmid, from the samples collected

at 10h 30min of cell growth, in order to select the ideal shake-flask culture volume to produce pDNA

(Table 14).

Table 14 - pTRKH3 purification concentrations after 10h 30min of cell growth in the different shake-flask culture

volumes.

Shake-flask culture volume

pDNA (ng/µl) per O.D.600nm

25 ml 55.7

50 ml 70.8

75ml 99.7

Through the analysis of the Table 14 it was possible to conclude that the shake-flask with the

75ml of culture medium besides reaching higher optical density values also produced the higher

concentration of pTRKH3 plasmid (99.7ng/µl) when compared to 25ml and 50ml volume growth

conditions (55.7ng/µl and 70.8ng/µl respectively). So it was selected the shake-flask culture volume of

75ml to carry out the following optimizations.

3.6.2. Optimization of growth medium in microplate

In order to optimize the type of growth medium in the microplate cell growth system, L. lactis

transformed with the unmodified plasmid (pTRKH3) was grown in six selected growth media: MRS, M-

17, Elliker, MRS supplemented with 5g/l of lactose, M-17 supplemented with 20g/l of glucose and M-

17 supplemented with 20g/l of glucose and 13.2mM of sodium citrate.

L. lactis strain as many other Lactic Acid Bacteria strains, are reported to be very fastidious

organisms with several growth requirements generally present in complex media like MRS and M-17,

which contain several compounds like amino acids, peptides, vitamins and nucleic acids. [85, 86]

By this

reason and by the fact that MRS and M-17 media have already been extensively used in our

laboratory for the current cell growth of L. lactis and other LAB strains, these two media were selected

to perform the cell growth optimization of L. lactis transformed with pTRKH3 in order to achieve the

49

suitable growth conditions for the study of plasmid copy numbers of pTRKH3, pTRKH3_4nuc,

pTRKH3_3nuc and pTRKH3_5nuc.

In addition these two media were supplemented with lactose in the case of MRS and with

glucose and citrate in the case of M-17 medium. The supplementation of MRS with lactose was

chosen to take advantage of LAB capacity to use lactose as energy source by the activity of lactase

which breaks down the lactose and by the fact that many growth media used for these bacteria are

generally supplemented with lactose (e.g. M-17). In the other hand, M-17 medium was supplemented

with glucose because L. lactis use glucose as main energy source and M-17 medium has already

lactose in its composition but don’t have glucose. Finally the use of citrate as supplement is able to

stimulate the specific glucose consumption rate, the maximum specific growth rate and maintain the

culture pH at 4.5 preventing the alkalinization of the medium. [87, 88]

In addition it was tested the Elliker medium, despite this medium has never been used in our

laboratory with LAB strains, this slightly acidic medium was generally recommended for culturing LAB

strain with importance in the dairy industry. The composition of this medium also contains the growth

requirements essentially for LAB, namely: the peptone and gelatin which provide nitrogen and amino

acids; yeast extract as vitamin source; glucose, lactose and sucrose as fermentable carbohydrates;

and sodium acetate as a selective agent against gram-negative bacteria. [75]

In the Figure 21, Table 15 and Figure 22, the growth curves, the maximum specific growth rates

and the pH variation are shown, respectively, for L. lactis transformed with pTRKH3 in the six pre-

selected culture media.

Figure 21- Growth curve of L. lactis transformed with pTRKH3 in the six different mediums (MRS, M-17, Elliker,

MRS supplemented with 5g/l of lactose, M-17 medium supplemented with 20g/l of glucose, M-17 medium

supplemented with 20g/l of glucose and 13.2mM of sodium citrate) by using microplate system. The error bars of

the graph represent the standard error of the mean (SEM) in the times of the cell growth in which the measure of

optical density was realized in a duplicated manner.

50

Table 15- Maximum specific growth rates in the six different media (MRS, M-17, Elliker, MRS supplemented with

5g/l of lactose, M-17 medium supplemented with 20g/l of glucose, M-17 medium supplemented with 20g/l of

glucose and 13.2mM of sodium citrate).

Culture Medium µmax (h-1

)

MRS 0.11

M-17 0.15

Elliker 0.10

MRS_lactose 0.13

M17_glucose 0.29

M17_glucose_citrate 0.46

4

5

6

7

0 5 10 15 20 25

pH

Time (h)

MRS

M17

Elliker

MRS_lactose

M17_glucose

M17_glucose_citrate

Figure 22 - pH variation of the six different media (MRS, M-17, Elliker, MRS supplemented with 5g/l of lactose, M-

17 medium supplemented with 20g/l of glucose, M-17 medium supplemented with 20g/l of glucose and 13.2mM of

sodium citrate) during the cell growth of L. lactis transformed with pTRKH3 in microplate system.

By the analysis of Figure 21 is possible to observe that at the end of the exponential phase of

cell growth (10h 30min of growth), the M-17 medium supplemented with glucose and with glucose plus

citrate reached to higher optical densities, with values of 2.4 and 2.6 respectively, when compared

with the other four culture media, which have optical densities of 0.9 in case of MRS medium, 1.1 in

case of M-17 medium and 1.4 in the case of Elliker medium. These results are concordant with the

values of maximum specific growth rates (µmax), present in Table 15, in which the M-17 medium with

the two different supplementations achieves higher µmax values, 0.29 for the M-17 medium

supplemented with glucose and 0.46 for the M-17 medium supplemented with glucose and citrate.

Also the lower maximum specific growth rates were achieved in MRS medium (µmax=0.11), M-17

medium (µmax=0.15) and in Elliker medium (µmax=0.10).

In addition, the analysis of pH variation of cell growth in the different media is present in Figure

22 showing the three M-17 mediums starting the cell growth with higher and very similar pH values

51

(6.83 in the case of M-17 medium without supplements and 6.82 and 6.83 in the case of medium with

glucose and citrate respectively). Along the cell growth, the Elliker medium presents the most

accentuated decreasing in the pH values. Although in the final of the exponential growth phase (10h

30min of cell growth) the majority of the media have pH values between 4.46 and 4.99. The only

exception is the M-17 medium, which presents an extremely stable pH values along the 24 hours of

cell growth with a mild decrease from 6.83 to 6.08. Other data that should be noted is that the three M-

17 media present a less marked decline in pH until the final of the exponential growth phase which is

associated with higher optical densities, probably because the acidification of these media was less

pronounced leading to a later inhibition of fermentation. [94, 95]

After the analysis of all these data it was select the M-17 supplemented with 20g/l of glucose

for the first cell growth of L. lactis transformed with the pTRKH3 and its derivatives (pTRKH3_4nuc,

pTRKH3_3nuc and pTRKH3_5nuc). The reasons of this choice were related with the fact that in this

medium L. lactis transformed with pTRKH3 achieves one of the highest optical densities at the final of

the exponential cell growth phase and the second highest µmax. The fact that the choice wasn't the M-

17 medium supplemented with glucose plus citrate, the medium with the higher values of optical

density and µmax, is because the small different of values in relation to the M-17 medium only

supplemented with glucose doesn't justify the use of one more compound in the growth medium

resulting in the increasing in the cost especially when in the future the cell growth scale increases (e.g.

fermenter).

3.7. Cell growth in the optimized conditions of L. lactis LMG 19460

transformed with pTRKH3 and its derivatives to study pDNA copy numbers in

the microplate and shake-flask systems

In the continuity of all the cell growth optimizations two cell cultures of L. lactis transformed

with pTRKH3 and its derivatives (pTRKH3, pTRKH3_4nuc, pTRKH3_3nuc and pTRKH3_5nuc) were

performed in M-17 medium supplemented with 20g/l of glucose, one carried out in the microplate

system and other in the shake-flask system. The growth curves and the maximum specific growth

rates of these cell growths were illustrated in the Figure 23 and in the Table 16 respectively.

52

Figure 23 - Growth curve of L. lactis transformed with pTRKH3, pTRKH3_4nuc, pTRKH3_3nuc and

pTRKH3_5nuc in M-17 medium supplemented with 20g/l of glucose in microplate (A) and shake-flask systems

(B). The error bars represent the standard error of the mean (SEM) in the times of the cell growth in which the

measurement of optical density was made in duplicates.

Table 16 - Maximum specific growth rates of L. lactis transformed with pTRKH3, pTRKH3_4nuc, pTRKH3_3nuc

and pTRKH3_5nuc in M-17 medium supplemented with 20g/l of glucose in microplate and shake-flask systems.

By the analysis of Figure 23 is possible to observe that at the final of the exponential growth

phase (at 10h 30min of growth), in the M-17 medium supplemented with glucose, all the four cell

populations (L. lactis transformed with pTRKH3, pTRKH3_4nuc, pTRKH3_3nuc and pTRKH3_5nuc)

reaches at very similar optical densities both in microplate (O.D.600nm between 2.3 and 2.6) and in

shake-flask system (O.D.600nm between 2.6 and 2.8). In addition, it was also possible to verify that

L. lactis transformed

with:

µmax in Microplate

system (h-1

)

µmax in Shake-Flask system (h

-1)

pTRKH3 0.29 0.49

pTRKH3_4nuc 0.32 0.50

pTRKH3_3nuc 0.48 0.55

pTRKH3_5nuc 0.38 0.58

53

besides the similarities between the four populations it was also verified a high level of similarity in

terms of optical densities and growth curves in both cell culture systems.

In the other hand by the analysis of Table 16 is possible to conclude that in the shake flask

system the values of the maximum specific growth rates are slightly higher when compared with the

same cell population in the microplate system, which aren’t translated in differences in the optical

densities between the two systems. This slight difference between the two culture systems was

already been described in microplate and shake-flask cell cultures of E. coli although the present

significant differences in terms of biomass were not observed. [96]

Finally, in the Figure 24 is represented the pH variation during these cell growths in the two

distinct systems.

Figure 24 - pH variation of L. lactis transformed with pTRKH3, pTRKH3_4nuc, pTRKH3_3nuc and pTRKH3_5nuc

in M-17 medium supplemented with 20g/l of glucose in microplate (A) and shake-flask systems (B).

Through the observation of pH variation in the both cell growth systems (Figure 22) is noted

that at the final of the exponential growth phase in both systems and again all the four different cell

populations showed a very similar behavior reaching pH values between 4.6 and 4.7.

In addition to the above cell growth it was carried out the cell growth of L. lactis transformed

with pTRKH3 and its derivatives in more three of the pre-tested media: the MRS, the M-17 and the

MRS supplemented with 5g/l of lactose; in both cell growth systems. The objective of these

experiments was to ascertain if the expected lower optical densities were related to a higher metabolic

burden due to higher plasmid copy numbers. The growth curves corresponding to the four cell

populations in MRS medium, M-17 medium and the MRS medium supplemented with 5g/l of lactose in

both cell growth systems were illustrated in the Figures 25, 26 and 27 respectively.

54

Figure 25 - Growth curve of L. lactis transformed with pTRKH3, pTRKH3_4nuc, pTRKH3_3nuc and

pTRKH3_5nuc in MRS medium in microplate (A) and shake-flask systems (B). The error bars of the graph

represent the standard error of the mean (SEM) in the times of the cell growth in which the measure of optical

density was made in duplicates.

Figure 26 - Growth curve of L. lactis transformed with pTRKH3, pTRKH3_4nuc, pTRKH3_3nuc and

pTRKH3_5nuc in M-17 medium in microplate (A) and shake-flask systems (B). The error bars of the graph

represent the standard error of the mean (SEM) in the times of the cell growth in which the measure of optical

density was made in duplicates.

Figure 27 - Growth curve of L. lactis transformed with pTRKH3, pTRKH3_4nuc, pTRKH3_3nuc and

pTRKH3_5nuc in MRS supplemented with 5g/l of lactose in microplate (A) and shake-flask systems (B). The

error bars of the graph represent the standard error of the mean (SEM) in the times of the cell growth in which the

measure of optical density was made in duplicates.

By the analysis of the growth curves in the MRS medium (Figure 25) is possible to conclude

that at the final of the exponential growth phase the optical densities of the four cell populations were

55

very similar, ranging from 0.6 to 0.9 in the case of the microplate system and between 1.1 and 1.4 in

the case of shake-flask system.

An identical behaviour was observed from the growth curves in M-17 medium without

supplements (Figure 26) in which at the same time of cell growth all the cell populations showed very

similar values of optical density with a little degree of variation between 0.9 and 1.2 in the microplate

system and the same is observed in the shake-flasks with optical densities varying between 0.8 to 1.1.

Finally, the growth curves with MRS medium supplemented with lactose at the final at the

exponential growth phase (Figure 27) showed the same growth curve profiles with no significant

differences between the four cell populations and with optical densities ranging from 0.8 to 1.0 in the

microplate and from 1.1. to 1.4 in the shake-flasks.

Additionally, in the Figures 28 and 29 was presented the pH variation of the cell populations in

these three growth media in microplate and shake-flask systems, respectively.

Figure 28 - pH variation of L. lactis transformed with pTRKH3, pTRKH3_4nuc, pTRKH3_3nuc and pTRKH3_5nuc

in MRS (A), M-17 (B) and MRS medium supplemented with 5g/l of lactose (C) in microplate system.

Figure 29 - pH variation of L. lactis transformed with pTRKH3, pTRKH3_4nuc, pTRKH3_3nuc and pTRKH3_5nuc

in MRS (A), M-17 (B) and MRS medium supplemented with 5g/l of lactose (C) in shake-flask system.

By the analysis of the pH variation in the three aforementioned media, illustrated in the Figures

28 and 29, is possible to observe that in the both culture systems the two MRS media (with and

without supplementation) starts with pH around 6 and in the final of the exponential growth phase the

pH arrives near to 5-5.2. In the other hand the M-17 medium stats with pH around 7 and in the final of

the exponential growth phase reaches pH values around 4.9 -6.3 in both cell growth systems.

At the final of the cell growths analyses is important take in to account that the most important

is the plasmid copy number evaluation of the modified vectors (pTRKH3_4nuc, pTRKH3_3nuc and

pTRKH3_5nuc) in comparison with the non modified vector (pTRKH3) harbored by the L. lactis strain

in the different cell growth conditions. Also important to have in mind is that a higher and faster cell

growth could not be synonymous of the best conditions to produce pDNA.

56

3.8. Plasmid Copy Number Quantification of L. lactis transformed with

pTRKH3 and its derivatives

3.8.1. Preliminary Plasmid Copy Number Quantification by Miniprep

A preliminary analysis of plasmid copy numbers (PCN) of pTRKH3 and its derivatives in different

cell growth conditions was based in the concentration of plasmid obtained by the miniprep purification

in the samples collected from various cell growth cultures performed, as already illustrated in the

materials and methods section.

In Figure 30, is illustrated the result of this preliminary PCN quantification by the use of miniprep

in the case of the microplate cell growth of L. lactis transformed with pTRKH3 in the six different

growth media.

Figure 30 - Plasmid copy number of pTRKH3 in the six different media (MRS, M-17, Elliker, MRS supplemented

with lactose, M-17 supplemented with glucose and M-17 supplemented with glucose and citrate) in the final of the

exponential phase of cells grown in microplates (10h 30min) according to the miniprep quantification.

By the analysis of the Figure 30 is possible to conclude that the M-17 medium allowed the

higher plasmid copy number of pTRKH3 (at the final of the exponential growth phase) with 341 of

plasmid copies per cell. In the other hand, the growth medium with the lower number of plasmid

copies is the Elliker with 47 molecules of pTRKH3 per cell in the sample analysed. In addition the

other four growth media tested (MRS, MRS supplemented with lactose, M-17 supplemented with

glucose and M-17 supplemented with glucose and citrate) exhibited similar PCN varying between 111

and 219 in each one of the four analysed samples. Although this analysis was based in a single

experiment, in order to evaluate the influence of the growth medium in the plasmid copy number it was

necessary to do a larger number of analysis with a higher number of samples of pTRKH3 and its three

derivatives. Therefore, PCN determination was performed by miniprep quantification of pTRKH3 and

its derivatives in three of the growth mediums previous analysed: M-17 medium, which seems give the

higher PCN, MRS medium and MRS medium supplemented with lactose; in the two cell growth

systems (Figure 31).

57

Figure 31- Plasmid copy number of pTRKH3, pTRKH3_4nuc, pTRKH3_3nuc and pTRKH3_5nuc in the MRS

medium, M-17 medium and MRS medium supplemented with lactose in microplate (A) and shake-flask system

(B), in the final of the exponential phase of cell growth (10h 30min), according to miniprep quantification.

Through the observation of the graphs present in the Figure 31 is difficult to observe

consistent differences between the three growth media and among the plasmids, apparently by these

preliminary analysis the cell growth in M-17, MRS and MRS medium supplemented with lactose don’t

result in notorious differences in terms of plasmid copy numbers for any of the plasmids, in the both

cell growth systems (microplate and shake-flask).

In this sense and before starts the quantification by other methods two last plasmid copy

number quantifications by miniprep were made but focused in the samples arising from the cell growth

of L. lactis transformed with each of the four plasmids in the M-17 medium supplemented with

glucose. This medium consistently resulted in higher optical densities, in the microplate system

(Figure 32) and in the shake-flask system (Figure 33).

Figure 32 - Plasmid copy number of pTRKH3, pTRKH3_4nuc, pTRKH3_3nuc and pTRKH3_5nuc in M-17

medium supplemented with glucose in microplate system (B), at two different of cell growth times (10h 30min and

24h), according to miniprep quantification.

By the analysis of the Figure 32, is possible to conclude that similarly with the previous results

also using M-17 medium supplemented with glucose the PCN for the different plasmids is not

consistently different, at the two cell growth times analysed.

Finally, by the analysis of Figure 33, is possible to observe that the four plasmids presents

similar numbers of copies in M-17 medium supplemented with glucose in the shake-flask system. This

analysis appears to be more consistent in relation to the previous, because quantification was

58

replicated for each one of the different plasmids (arising from two shake-flask that were prepared in

parallel in the same conditions and in the same day) and is possible to observe that the two different

shake-flasks (represented in the graph as Replicate_A and Replicate_B) don’t show accentuated

differences. The major difference between shake-flask occurs in the pTRKH3 plasmid with one

difference of 47 copies between the replicate shake-flasks.

Figure 33 - Plasmid copy number of pTRKH3, pTRKH3_4nuc, pTRKH3_3nuc and pTRKH3_5nuc in M-17

medium supplemented with glucose in two shake-flasks, according to miniprep quantification.

In conclusion, this method of plasmid copy number quantification based in miniprep

purification is not sufficient sensitive and precise to quantify the differences in plasmid copy number of

the different plasmids in the different conditions of cell growth and systems (microplate and shake-

flask). One of the major reasons is because the miniprep quantification can be associated to the

problems with the incomplete lysis of the bacterial cells and with the saturation of the columns during

the purification process resulting in the suboptimal elution of the pDNA in the final of the purification

process. These problems can be the reason of unreliable plasmid copy numbers of the different

plasmids because in the calculation of plasmid copy number it was used the relation between the

optical density and the number of cells (previous determined) and if the miniprep don’t result in the

purification of the pDNA from all the cells the results can be underestimated.

By all the above reasons the quantitative real-time technique was used in order to achieve a

method of quantification with a higher sensitivity and precision and which use smaller amounts of

samples allowing the analysis of higher number of samples. [60, 61, 62]

3.8.2. Quantitative Real-Time PCR for determination of plasmid copy number -

Standard Curve Method

The first method used in the quantification of plasmid copy number by quantitative real time

PCR technology was based in the absolute standard curve method, in which the quantification was

done by comparing the CT values of the unknown samples to the CT values of the standard curve and

obtaining the value of plasmid copy number. [62]

In this case, the standard curve was constructed

placing the log values of five known concentrations values of pTRKH3 versus the corresponding

threshold cycles values obtained. The standard curve used for the application of the method is

illustrated in Figure 34.

59

Figure 34 - Standard curve based in the erm gene amplification used to quantify the plasmid copy number of

pTRKH3 and its derivatives (pTRKH3, pTRKH3_4nuc, pTRKH3_5nuc). The error bars of the graph represent the

standard error of the mean (SEM).

Figure 34 shows the standard curve obtained based in the amplification of five known

concentrations of of the erythromycin gene from pTRKH3. A linear regression analysis was performed

to this standard curve presenting an R2 of 0.9956. This standard curve was used for the determination

of plasmid copy number of the different plasmids in the different growth conditions (by applying the

equation present in the Materials and Methods section). In Figure 35 is illustrated the quantification of

plasmid copy numbers, by these method, of the four plasmid originated in two shake-flasks of cells

grown in M-17 medium supplemented with glucose.

Figure 35 - Plasmid copy number of pTRKH3, pTRKH3_4nuc, pTRKH3_3nuc and pTRKH3_5nuc in M-17

medium supplemented with 20 g/l of glucose in two shake-flasks, according to the Standard Curve Method. The

error bars of the graph represent the standard error of the mean (SEM).

By the analysis of the Figure 35, the most remarkable thing is the high levels of plasmid copy

numbers achieved. In addition, these high levels of plasmid copy numbers were also obtained in other

cell growth conditions when it was applied this method of quantification (data not shown). These

values are extremely elevated when compared with the results obtained by the miniprep quantification

and also if based in the literature in which the non-modified pTRKH3 presents on average 45 to 85

copies per cell. [53]

From these two data sets is possible to conclude that this method of quantification

presents an accentuated overestimation in the quantification, which highlights the necessity to

optimize the method of quantification used in the real time procedure.

60

Besides this various attempts were made in order to improve accurateness of the

quantification by real-time PCR. One of this attempts consist in performing a previous cell lysis with

lysozyme digestion in order to ensure that all the cells present in the samples were lysed, but the

presence of trace amounts of lysozyme apparently inhibit the PCR reaction.[77]

3.8.3. Improved method of Quantitative Real- Time PCR for determination of

plasmid copy number – based in a endogenous control

With the objective to overcome the serious overestimation in the quantification of plasmid

copy numbers obtained by using the absolute Standard Curve Method a relative method of

quantification was established, in which was used a single-copy housekeeping gene, feoA, as

reference. In these sense the quantification of plasmid copy number of the different samples was

carried out by the amplification of erm gene (the target gene in plasmids) in relation to the

amplification of the single-copy feoA gene ( the reference gene present in the genome of L. lactis

strain). The use of a reference gene present from the L. lactis genome overtake one of the major

drawbacks of the absolute quantification methods in which the inter- and intra-sample variability is not

taking into account. In this work the most crucial variability that should be controlled is the variation in

relation to the number of cells between samples. In this sense by using the reference gene in

comparison to the target gene we obtain the plasmid copy number per L. lactis chromosome avoiding

some problems like the incomplete cell lysis.[62,89]

Figure 36 - Standard curve based in the endogenous single-copy gene amplification (feoA gene) used to quantify

the plasmid copy number of pTRKH3 and its derivatives (pTRKH3, pTRKH3_4nuc, pTRKH3_5nuc). The error

bars of the graph represent the standard error of the mean (SEM).

Figure 36 shows the standard curve obtained based in the amplification of the housekeeping

feoA gene by using five known concentrations of gDNA of L. lactis strain. A linear regression analysis

was performed to this standard curve presenting an R2 of 0.9973.

61

With the necessary standard curves obtained, the PCN was determined using the equation 5,

considering the different amplification efficiencies (E) and the threshold cycles (CTf/ CTe) of samples

with primer for feoA and erm genes respectively.

PCN EfCtf

EeCte (5)

Although, the application of the equation (5) implies the calculation of the amplification

efficiency for each gene based in the slopes of the respective standard curves, for this the equation (6)

was applied:

E 10 (-

1

slope) (6)

With the equation 6 was obtain the following values of efficiency for each one of the genes:

Ef = 1.998

Ee = 1.948

Finally with the amplification efficiencies achieved it was calculated the PCN in the different

samples. It should be noted that this method takes into account the differences in amplification

efficiencies between the target and reference genes, giving origin to a higher precision in the

quantification of PCN. As previous studies showed small differences in efficiency for both genes

originate substantial changes in PCN values which was intensified in PCN˃100. For example, one

error of 5% in the determination of efficiencies of target or reference genes leads to misestimates in

PCN values of 40-50%. In order to overtake errors of incorrect calculation of efficiencies, a PCR

amplification of each point of the standard curves was realized in a triplicate manner in order to

achieve average values and finally obtain the slope with a higher degree of precision. [77]

In the Figure 37, is presented the plasmid copy number quantification obtained with this

relative method in the samples at the end of the exponential growth phase of L. lactis transformed with

pTRKH3 in the six different growth media in the microplate system.

Figure 37- Plasmid copy number of pTRKH3 in the six different media (MRS, M-17, Elliker, MRS supplemented

with lactose, M-17 supplemented with glucose and M-17 supplemented with glucose and citrate) according to the

62

quantitative Real-Time Method which use the relation of amplification between the plasmid gene (erm) and the

endogenous single-copy gene (feoA). The error bars represent the standard error of the mean (SEM).

By the analysis of Figure 37, the most notorious data is the range of plasmid copy number.

Now, the range of PCN values obtained with this new method of real-time PCR is in agreement with

the literature regarding of plasmid copy numbers of pTRKH3 per cell and also with the miniprep

quantification method. [53]

In relation to PCN of pTRKH3 in the different growth media obtained with

this method, it seems that the higher values were obtained in Elliker (PCN = 221), and M-17 medium

supplemented with glucose and citrate (PCN= 85) and in MRS supplemented with lactose (PCN = 81).

In relation to M-17 supplemented with glucose and MRS supplemented with lactose the PCN obtained

was in coherence to the miniprep quantification in which these medium already present higher values

of PCN. But the PCN value obtained in the Elliker medium probably is not real because this

quantification was only realized based in one sample and have a high standard error of mean

associated. Also when the pDNA purified from the Elliker samples was visualized in a agarose gel its

was very degraded which can lead to an overestimation by the nanodrop.

In addition, in the Figure 38 is presented the PCN obtained by this relative method of the

pTRKH3 and its derivatives in M-17 medium, MRS medium and MRS medium supplemented with

lactose; in the two cell growth systems.

Figure 38 - Plasmid copy number of pTRKH3, pTRKH3_4nuc, pTRKH3_3nuc and pTRKH3_5nuc in the MRS

medium, M-17 medium and MRS medium supplemented with lactose in microplate (A) and shake-flask system

(B) according to the Quantitative Real-Time Method which use the relation of amplification between the plasmid

gene (erm) and the endogenous single-copy gene (feoA). The error bars represent the standard error of the mean

(SEM).

By the analysis of the PCN values obtained with the different plasmid in the three media in

both cell growth systems (Figure 38), it isn’t possible to identify a plasmid with a significant high

number of plasmid copies or at least select the best medium for the plasmid production. Therefore,

these data are based in a single real-time reaction for each sample and the differences obtained are

apparently not consistent in the both cell growth systems (microplate and shake-flask). The only

conclusion that is possible to establish is the slight tendency of a higher plasmid copy number of the

63

pTRKH3_3nuc in the majority of the media and in both cell growth systems, only a single exception

was found in the shake-flask of M-17 medium.

Furthermore, in the Figure 39 is analysed the PCN values of the four plasmids in the M-17

medium supplemented with glucose, the medium in which was obtained the higher optical densities

values, in two different times of the cell growth in the microplate system.

Figure 39- Plasmid copy number of pTRKH3, pTRKH3_4nuc, pTRKH3_3nuc and pTRKH3_5nuc in M-17

medium supplemented with glucose in microplate system , at two different of cell growth times (10h 30min and

24h) according to the Quantitative Real-Time Method which use the relation of amplification between the plasmid

gene (erm) and the endogenous single-copy gene (feoA). The error bars represent the standard error of the mean

(SEM).

Through the analysis of Figure 39, is verified the same tendency already noted in the previous

cell growth (Figure 39), in which the pTRKH3_3nuc shows the higher values of pDNA copies in the

both cell growth times in analysis, with 242 pDNA copies at 10h 30min and 107 copies at 24 hours. In

this cell growth the difference in PCN in the pTRKH3_3nuc is more consistent when compared with

cell growth of Figure 39 because now it was considered two different times of cell growth, which are

mutually consistent, and the real-time reaction was realized in a duplicated manner. However, this

difference of the PCN values of pTRKH3_3nuc in relation to the others plasmids are not statistically

significant, maybe because the well-to well variations associated with this system that are especially

problematic in quantitative screening to identify high-activity mutants that can display only small

differences. [83]

Other interesting result showed in this cell growth is that the maximum value of PCN in the

different plasmids was achieved in the final of the exponential growth phase (10h 30min), fact that has

already been verified in previous studies and was related with the fact that during the late exponential

phase the cell growth slowed down while plasmid replication continued arriving to the maximum value.

In opposition, was also verified that in the late stationary growth phase (24hours) the values of PCN

decrease (in the case of the modified plasmids) or remained constant (in the case of pTRKH3). These

data were also in accordance with the previous studies, in which was affirmed that during the

stationary phase there was almost no plasmid replication because the depletion of limiting substrate

leads to a slight decrease or the maintenance in the PCN values. [77, 97]

64

Finally in the Figure 40, is showed the PCN obtained by this relative real-time method in the

different plasmids originated from two shake-flask growths in the M-17 medium supplemented with

glucose.

Figure 40 - Plasmid copy number of pTRKH3, pTRKH3_4nuc, pTRKH3_3nuc and pTRKH3_5nuc in M-17

medium supplemented with glucose in two shake-flasks, according to the Quantitative Real-Time Method which

use the relation of amplification between the plasmid gene (erm) and the endogenous single-copy gene (feoA).

The error bar of the graph represents the standard error of the mean (SEM).

By the analysis of Figure 40 is now clear the consistent higher number of plasmid copies of

the pTRKH3_3nuc with number of copies varying between 238 (in the shake-flask A) and 298 (in

shake-flask B) plasmid copy numbers per cell transformed with this plasmid. This analysis considered

two shake-flask of each plasmid and the real-time amplification of the all the samples of this cell

growth was performed in a triplicate manner. The number of plasmid copies obtained in all the

reactions and in the both shake-flask of pTRKH3_3nuc were statically compared with plasmid copies

correspondent for each one of the other plasmids and was verified that the pTRKH3_3nuc is

significantly different in relation to the non-modified plasmid (p˂0.05). By all these reasons the results

point to the pTRKH3_3nuc being the plasmid with a higher number of copies with an average more

190 pDNA copies when compared with the average plasmid copies numbers present in the non-

modified plasmid (pTRKH3).

In conclusion, apparently we face with an unexpected result in which the higher PCN values was

obtained with pTRKH3_3nuc, the plasmid with an incomplete modified RBS sequence according to

the RBS strength prediction of Anderson Library, in comparison to the most stronger RBS sequence

predicted by this tool (pTRKH3_4nuc). However, this result can be explained by two reasons, the first

can be related to some lack of prediction for LAB as this tool was developed for E. coli, which can be

different for the case of L. lactis strain, a Gram-positive bacteria. The second possible reason can be

the higher degree of similarity of RBS sequence of the pTRKH3_3nuc with the already described in

some studies as consensus RBS sequences of LAB. [58, 90, 91, 92]

65

4. Conclusion

In order to establish an efficient Lactic Acid Bacteria/plasmid platform for the production of

pDNA vaccines many drawbacks needed to be overtake. Besides the normal problems related to the

cell growth conditions and the low efficiency of transformation of LAB, the most important drawback

that is necessary overcome is the low copy number of plasmids per LAB cell, which leads to low

plasmid yields when compared with the E. coli, actually the most suitable host for pDNA production.

With the objective to overcome the low plasmid yields, in this work was established a site-directed

mutagenesis approach to modify the ribosome binding site (RBS) of the pAMβ1 origin of replication of

the pTRKH3 vector, increasing the level of production of the RepE protein which subsequent

increases the plasmid copy number in LAB cells. [4, 5, 55, 56, 57, 58, 64, 65]

After performing site-directed mutagenesis in the RBS sequence the major challenge that was

necessary overcome was the transformation of L. lactis strain with the modified plasmids. However, to

make electroporation procedure possible several optimization steps were required, namely the electric

pulse conditions, the number of cells, the pDNA concentration and the conditions for cell recuperation.

Besides these optimizations the efficiency of transformation was low and only a few number of

transformant colonies were obtained.

Then with the different plasmids inside the L. lactis cells an optimization of cell culture

conditions was done in order to determine the plasmid copy number of the different plasmids. Thus,

two cell culture systems (microplate and shake-flask) with different volumes and types of cell growth

media were tested being selected the M-17 medium supplemented with 20g/l of glucose that allowed

higher optical densities and higher levels of pDNA production, in both cell growth systems.

In addition, a quantitative Real-Time PCR relative method was developed to quantify plasmid

copy number in the samples. This was based in the ratio between the amplification of erm gene of the

pTRKH3 (target gene) and the amplification of the single-copy feoA gene (reference gene present in

the genome of L. lactis strain), taking in account the differences in the amplification efficiencies of both

target and reference genes. . This optimized method for the quantification of the plasmid copy number

allows overtaking the accentuated overestimation in the quantification performed by the absolute

quantification method, Standard Curve Method, in which the quantification is only based in the

amplification of the target gene present in the plasmid. [62, 77, 89]

By the application of this optimized relative real-time PCR method of quantification it was

possible to conclude that cells growing in M-17 medium supplemented with 20g/l of glucose in shake-

flask, produce more copies per cell of the modified pTRKH3_3nuc 262 vs. 72 copies of the non-

modified plasmid (pTRKH3). A similar difference between pTRKH3 and pTRKH3_3nuc was also

verified in the cells grown in M-17 medium supplemented with 20g/l of glucose in the microplate

system. Although, these differences only have statically significance (p˂0.05) in the shake-flask

system.

66

A possible explanation for the higher number of plasmid copies shown bypTRKH3_3nuc, which

was not the stronger RBS according to the predoiction from the Anderson library, may be related to

fact that this library was developed for E. coli and not for Gram-positive bacteria. Another possible

reason for this result can be the higher degree of similarity of RBS sequence of the pTRKH3_3nuc

with the already described in some studies as consensus RBS sequences of LAB. [58, 90, 91, 92]

These results highlight the possibility to establish, after several steps of improvement, Lactic Acid

Bacteria as suitable and safer host for the production of pharmaceutical-grade pDNA to be used in

DNA vaccination taking benefits of their GRAS status, their probiotics characteristics and the absence

of lipopolysaccharides in their membranes.

5. Future Work

Further work from this project will go through the continuation of the work already started in the

modification of the RBS sequence of the pAMβ1 origin of the pTRKH3 vector in order to modify the

RBS sequence of pTRKH3_3nuc to a even more similar RBS sequence to one of the already

described consensus RBS sequences of LAB with a higher percentage of purine nucleotides.[90, 91, 92]

Moreover, a strategy to continue improving the plasmid copy numbers and consequently the pDNA

yields could be to change the PDE promoter for another with higher strength which can gives origin to

higher replication efficiency and consequently a higher plasmid copy number. Another strategy could

be inhibiting the translational repressor CopF of the pAMβ1 replicon. In the other hand, can also be

interesting to find out the influence of different species/strains of LAB in the yield of pDNA.

In parallel the optimization and adaptation the gene knock-out strategy of the nth gene, which

codes for endonuclease III in the L. lactis strain will also be continued in order to improve the yield and

the quality of the pDNA.

Finally, it would be also necessary to perform some optimizations and adaptations in the

production and purification methodologies, like the development of a fermentation strategy for LAB

pDNA producers because nowadays these procedures are only well-established for E. coli.

67

6. References

1. Carattoli, A. (2011). Plasmids in Gram negatives: molecular typing of resistance plasmids. International Journal of Medical Micro iology : IJMM, 301(8), 654–8.

2. Solar, G., & Espinosa, M. (2000). Plasmid copy number control: an ever-growing story. Molecular Microbiology: 37 (3), 492–500.

3. Plasmid glossary by Nature Education [Online] http://www.nature.com/scitable/definition/plasmid-plasmids-28 (Accessed January 15, 2015).

4. Gram, G., Fomsgaard, A., Thorn, M., Madsen, S., Glenting, J. (2007). Immunological analysis of a Lactococcus lactis- based DNA vaccine expressing HIV gp120. Genetic Vaccines and Therapy: 5:3.

5. Gonçalves, G. a L., Bower, D. M., Prazeres, D. M. F., Monteiro, G. a., & Prather, K. L. J. (2012). Rational engineering of Escherichia coli strains for plasmid biopharmaceutical manufacturing. Biotechnology Journal, 7, 251–261. 7.

6. Williams, J. (2013). Vector Design for Improved DNA Vaccine Efficacy, Safety and Production. Vaccines, 1, 225–249.

7. Jagger, P., Lawlor, K., Brockhaus, M., Gebara, M. F., & Sonwa, D. J. (2011). DNA Vaccines: Immunology, Application, and Optimization. Annual Reviews Immunology, 18:927–974.

8. Ferreira, G. N., Monteiro, G. a, Prazeres, D. M., & Cabral, J. M. (2000). Downstream processing of plasmid DNA for gene therapy and DNA vaccine applications. Trends in Biotechnology, 18, 380–388.

9. Desmet, C. J., & Ishii, K. J. (2012). Nucleic acid sensing at the interface between innate and adaptive immunity in vaccination. Nature Reviews Immunology, 12(7), 479–491.

10. Erridge, C., Bennett-Guerrero, E., Poxton, I. (2002) Structure and function of lipopolysaccharides. Microbes and Infection (4), 837–851.

11. Dixon, D. R., & Darveau, R. P. (2005). Lipopolysaccharide heterogeneity: innate host responses to bacterial modification of lipid a structure. Journal of Dental Research, 84, 584–595.

12. Raetz, C. R. H., & Whitfield, C. (2002). Lipopolysaccharide endotoxins. Annual Review of Biochemistry, 71, 635–700.

13. Needham, B. D., & Trent, M. S. (2013). Fortifying the barrier: the impact of lipid A remodelling on bacterial pathogenesis. Nature Reviews. Microbiology,11(7), 467–81.

14. Freitas, S., Canário, S., Santos, J. a L., & Prazeres, D. M. F. (2009).Alternatives for the intermediate recovery of plasmid DNA: Performance, economic viability and environmental impact. Biotechnology Journal, 4(2), 265–278.

15. Luttrell, C., Loft, L., & Gebara, M. F. (2011). Antibiotic Resistance of Probiotic Strains of Lactic Acid Bacteria Isolated from Marketed Foods and Drugs. Biomedical and Environmental Sciences, 22, 401–412.

16. Patel, a R., Shah, N. P., & Prajapati, J. B. (2012). Antibiotic Resistance Profile of Lactic Acid Bacteria and Their Implications in Food Chain. World Journal of Dairy & Food Sciences, 7(2), 202–211.

17. Pontes, D. S., de Azevedo, M. S. P., Chatel, J.-M., Langella, P., Azevedo, V., & Miyoshi, A. (2011). Lactococcus lactis as a live vector: Heterologous protein production and DNA delivery systems. Protein Expression and Purification, 79(2), 165–175.

18. Wells, J. M., & Mercenier, A. (2008). Mucosal delivery of therapeutic and prophylactic molecules using lactic acid bacteria. Nature Reviews. Microbiology, 6, 349–362.

68

19. Bermúdez-Humarán, L. G., Aubry, C., Motta, J. P., Deraison, C., Steidler, L., Vergnolle, N., Langella, P. (2013). Engineering lactococci and lactobacilli for human health. Current Opinion in Microbiology, 16, 278–283.

20. Florou-Paneri, P., Christaki, E., Bonos, E. (2013). Lactic Acid Bacteria as Source of Functional Ingredients. Lactic Acid Bacteria – R & D for Food, Health and Livestock Purposes, Chapter 25.

21. Wang, T. T., & Lee, B. H. (1997). Plasmids in Lactobacillus. Critical Reviews in Biotechnology, 17(3), 227–272.

22. Wells, J. (2011). Mucosal Vaccination and Therapy with Genetically Modified Lactic Acid Bacteria. Annual Review of Food Science and Technology, 2, 423–445.

23. Del Rio, B., Dattwyler, R. J., Aroso, M., Neves, V., Meirelles, L., Seegers, J. F. M. L., & Gomes-Solecki, M. (2008). Oral immunization with recombinant Lactobacillus plantarum induces a protective immune response in mice with Lyme disease. Clinical and Vaccine I unology : CVI, 15(9), 1429–1435.

24. Hummel, A. S., Hertel, C., Holzapfel, W. H., & Franz, C. M. a P. (2007). Antibiotic resistances of starter and probiotic strains of lactic acid bacteria. Applied and Environmental Microbiology, 73(3), 730–739.

25. Steidler, L., & Rottiers, P. (2006). Therapeutic drug delivery by genetically modified Lactococcus lactis. Annals of the New York Academy of Sciences, 1072, 176–186.

26. Kojic, M., Lozo, J., Jovcic, B., Strahinic, I., Fira, D., & Topisirovic, L. (2010). Construction of a new shuttle vector and its use for cloning and expression of two plasmid-encoded bacteriocins from Lactobacillus paracasei subsp. paracasei BGSJ2-8. International Journal of Food Microbiology, 140(2-3), 117–124.

27. Yang, X., Zhao, Y., Chen, X., Jiang, B., & Sun, D. (2013). The protective effect of recombinant Lactococcus lactis oral vaccine on a Clostridium difficile -infected animal model. BMC Gastroenterology, 13(1), 117.

28. Biotechnology of Lactic Acid Bacteria and Their Role in Food Industry. Indonesia Society for Lactic Acid Bacteria. (2010) [Online] http://islab.tp.ugm.ac.id/index.php/2010/10/22/biotechnology-of-lactic-acid-bacteria-and-their-role-in-food-industry/ (Accessed October 15, 2015).

29. Bermúdez-Humarán, L. G., Kharrat, P., Chatel, J.-M., & Langella, P. (2011). Lactococci and lactobacilli as mucosal delivery vectors for therapeutic proteins and DNA vaccines. Microbial Cell Factories, 10(Suppl 1), S4.

30. Seegers, J. F. M. L. (2002). Lactobacilli as live vaccine delivery vectors: Progress and prospects. Trends in Biotechnology, 20(12), 508–515.

31. Gil, M., Pérez-Arellano, I., Buesa, J., Pérez-Martínez, G. (2001).Secretion of the rotavirus VP8* protein in Lactococcus lactis. Federation of European Microbiological Societies Microbiology Letters. 203, 269–274.

32. Langella, P., Miyoshi, a, Gruss, a, Guerra, R. T., Oca-luna, R. M. De, & Loir, Y. Le. (2002). Production of Human Papillomavirus Type 16 E7 Protein in Lactococcus lactis. Applied and Environmental Microbiology, 68(2), 917–22.

33. Bahey-El-Din, M., Gahan, C. G. M., & Griffin, B. T. (2010). Lactococcus lactis as a Cell Factory for Delivery of Therapeutic Proteins. Current Gene Therapy 10, 34-35

34. Mathur, S., & Singh, R. (2005). Antibiotic resistance in food lactic acid bacteria - A review. International Journal of Food Microbiology, 105, 281–295.

35. Kranenburg, R. Van, Golic, N., Bongers, R., Leer, R. J., Vos, W. M. De, Siezen, R. J., & Kleerebezem, M. (2005). Functional Analysis of Three Plasmids from Lactobacillus plantarum. Applied and Environmental Microbiology, 71(3), 1223–1230.

36. Zhou, H., Hao, Y., Xie, Y., Yin, S., Zhai, Z., & Han, B. (2010). Characterization of a rolling-circle replication plasmid pXY3 from Lactobacillus plantarum XY3. Plasmid, 64(1), 36–40.

69

37. Langella, P., Miyoshi, a, Gruss, a, Guerra, R. T., Oca-luna, R. M. De, & Loir, Y. Le. (2002). Production of Human Papillomavirus Type 16 E7 Protein in Lactococcus lactis. Applied and Environmental Microbiology, 68(2), 917–22.

38. Sørvig, E., Skaugen, M., Naterstad, K., Eijsink, V. G. H., & Axelsson, L. (2005). Plasmid p256 from Lactobacillus plantarum represents a new type of replicon in lactic acid bacteria, and contains a toxin-antitoxin-like plasmid maintenance system. Microbiology, 151, 421–431.

39. DeNap, J., Hergenrother, P., (2005). Bacterial death comes full circle: targeting plasmid replication in drug-resistant bacteria. Organic Biomolecular Chemistry, 3, 959–966.

40. Zhang, H., Hao, Y., Zhang, D., & Luo, Y. (2011). Characterization of the cryptic plasmid pTXW from Lactobacillus paracasei TXW. Plasmid, 65(1), 1–7.

41. Solar, G., Moscoso, M., Espinosa, M. (1993). Rolling circle-replicating plasmids from Gram-positive and Gram-negative bacteria: a wall falls. Molecular Microbiology,8(5). 789-796.

42. Del Solar, G., Giraldo, R., Ruiz-Echevarría, M. J., Espinosa, M., & Díaz-Orejas, R. (1998). Replication and control of circular bacterial plasmids. Micro iology and Molecular Biology Reviews : MMBR, 62(2), 434–464.

43. [Online] https://geminiviridae.files.wordpress.com/2011/03/rcr-2.jpg (Accessed October 1, 2015).

44. Cummings, B. (2008) Colleague of Arts and Sciences- University of Miami. [Online] http://www.bio.miami.edu/dana/pix/replication_origins.jpg (Accessed January 17, 2015).

45. Biswas, I., Jha, J. K., & Fromm, N. (2008). Shuttle expression plasmids for genetic studies in Streptococcus mutans. Microbiology, 154, 2275–2282.

46. Pérez-Arellano, I., Zúñiga, M., & Pérez-Martínez, G. (2001). Construction of compatible wide-host-range shuttle vectors for lactic acid bacteria and Escherichia coli. Plasmid, 46, 106–116.

47. Renault, P., Corthier, G., Goupil, N., Delorme, C., Ehrlich, S. (1996). Plasmid vectors for Gram-positive bacteria switching from high to low copy number. Gene, 183. 175-182

48. Chatelier, E., Ehrtich, S., Janniere, L. The pAMβ1 CopF repressor regulates plasmid copy number by controlling transcription of the repE gene. Molecular Microbiology, 14(3), 463-471.

49. Batna, U., & Constantine, U. (1993). The Mode of Replication is a Major Factor in Segregational Plasmid Instability in Lactococcus lactis. Applied and Environmental Microbiology, 59 (2), 358- 364.

50. Bruand, C., Ehrlich, S. (1998). Transcription-driven DNA replication of plasmid pAMβ1 in Bacillus subtilis. Molecular Microbiology. 30(1), 135–14.

51. Rao Thumu, S. C., & Halami, P. M. (2012). Presence of erythromycin and tetracycline resistance genes in lactic acid bacteria from fermented foods of Indian origin. Antonie van Leeuwenhoek, International Journal of General and Molecular Microbiology, 102, 541–551.

52. Lizier, M., Sarra, P. G., Cauda, R., & Lucchini, F. (2010). Comparison of expression vectors in Lactobacillus reuteri strains. FEMS Microbiology Letters, 308, 8–15.

53. O’Sullivan, D., Klaenhammer, T. (1 3). High- and low-copy-number Lactococcus shuttle cloning vectors with features for clone screening. Gene, 137, 227-231.

54. Papagianni, M., Avramidis, N., & Filioussis, G. (2007). High efficiency electrotransformation of Lactococcus lactis spp. lactis cells pretreated with lithium acetate and dithiothreitol. BMC Biotechnology,7,15.

55. Ribosomal Binding Site Sequence Requirements. Thermo Fisher Scientific - Life technologies. [Online] http://www.lifetechnologies.com/pt/en/home/references/ambion-tech-support/translation-systems/general-articles/ribosomal-binding-site-sequence-requirements.html (Accessed January 19, 2015).

70

56. Shultzaberger, R. K., Bucheimer, R. E., Rudd, K. E., & Schneider, T. D. (2001). Anatomy of Escherichia coli ribosome binding sites. Journal of Molecular Biology, 313, 215–228.

57. Arpino, J. a J., Hancock, E. J., Anderson, J., Barahona, M., Stan, G. B. V, Papachristodoulou, A., & Polizzi, K. (2013). Tuning the dials of synthetic biology. Microbiology (United Kingdom), 159, 1236–1253.

58. Registry of Standard Biological Parts - Ribosome Binding Sites/Prokaryotic/Constitutive/Anderson. iGem [Online] http://parts.igem.org/Ribosome_Binding_Sites/Prokaryotic/Constitutive/Anderson (Accessed October 17, 2015).

59. Kareeson, T. (2010).Prokaryotic Cell Arrangements & Anatomy: emphasis on Cell Wall. Omninggin.[Online]

http://omninoggin.com/microbiology/prokaryotes-bacteria-and-prokaryotic-cell-anatomy/ (Accessed September

20, 2015).

60. Carapuça, E., Azzoni, A. R., Prazeres, D. M. F., Monteiro, G. A., & Mergulhão, F. J. M. (2007). Time-course determination of plasmid content in eukaryotic and prokaryotic cells using real-time PCR. Molecular Biotechnology, 37(2), 120–6.

61. Lee, C., Lee, S., Shin, S. G., & Hwang, S. (2008). Real-time PCR determination of rRNA gene copy number: Absolute and relative quantification assays with Escherichia coli. Applied Microbiology and Biotechnology, 78(2), 371–376.

62. Lee, C., Kim, J., Shin, S. G., & Hwang, S. (2006). Absolute and relative QPCR quantification of plasmid copy number in Escherichia coli. Journal of Biotechnology, 123(3), 273–280.

63. Friehs, K. (2004). Plasmid Copy Number and Plasmid Stability. Adv Biochem Engin/Biotechnol, 86: 47–82.

64. Jana, S., & Deb, J. K. (2005). Strategies for efficient production of heterologous proteins in Escherichia coli. Applied Microbiology and Biotechnology, 67(3), 289–298.

65. Salis, H. M., Mirsky, E. A., & Voigt, C. A. (2009). Automated design of synthetic ribosome binding sites to control protein expression. Nature Biotechnology, 27(10), 946–950.

66. Quick Change Primer. Agilent Technologies. [Online]

http://www.genomics.agilent.com/primerDesignProgram.jsp. (Accessed March 10, 2015).

67. Andrade, S. M. J. (2014) Production of therapeutic Plasmid DNA by Lactic Acid Bacteria. Master Thesis in

Molecular Biology and Genetics. Universidade de Lisboa – Faculdade de Ciências.

68. Palomino, M. M., Allievi, M. C., Prado-Acosta, M., Sanchez-Rivas, C., & Ruzal, S. M. (2010). New method for

electroporation of Lactobacillus species grown in high salt. Journal of Microbiological Methods, 83 (2), 164–167.

69. Papagianni, M., Avramidis, N., & Filioussis, G. (2007). High efficiency electrotransformation of Lactococcus lactis spp. lactis cells pretreated with lithium acetate and dithiothreitol. BMC Biotechnology,7,15.

70. Aymerich, M. T., Hugas, M., Garriga, M., Vogel, R. F., & Monfort, J. M. (1993). Electrotransformation of meat lactobacilli. Effect of several parameters on their efficiency of transformation. Journal of Applied Bacteriology, 75, 320–325.

71. Datsenko, K. a, & Wanner, B. L. (2000). One-step inactivation of chromosomal genes in Escherichia coli K-12 using PCR products. Proceedings of the National Academy of Sciences of the United States of America, 97, 6640–6645.

72. Salbi, R. A., Serhan, M., & Bassil, M. (2014). Molecular Verification of Two Potent Bacteria Isolated from Darfiyeh Cheese : Lactococcus lactis subsp . Lactis and Lactobacillus plantarum. Advances in Microbiology, 4, 609-615.

73. Jones, S. E., & Versalovic, J. (2009). Probiotic Lactobacillus reuteri biofilms produce antimicrobial and anti-inflammatory factors. BMC Microbiology, 9, 35.

71

74. System Duetz- Maintenance, replication and growth in microplates [Online] http://www.enzyscreen.com/microplates_24_well_mtps.htm (Accessed July 13, 2015).

75. Ronald M. Atlas. (2010) Handbook of Microbiological Media. Fourth Edition. CRC Press. 632.

76. Bolotin,A., Wincker,P., Mauger,S., Jaillon,O., Malarme,K., Weissenbach,J., Ehrlich,S.D. and Sorokin,A. (2001)

The complete genome sequence of the lactic acid bacterium Lactococcus lactis ssp. lactis IL1403. Genetique

Microbienne 11 (5), 731-753. [Online] http://www.ncbi.nlm.nih.gov/nuccore/AE005176 (Accessed October 9,

2014).

77. Skulj, M., Okrslar, V., Jalen, S., Jevsevar, S., Slanc, P., Strukelj, B., & Menart, V. (2008). Improved determination of plasmid copy number using quantitative real-time PCR for monitoring fermentation processes. Microbial Cell Factories, 7(1), 6.

78. Calculations: Converting from nanograms to copy number

[Online] http://eu.idtdna.com/pages/decoded/decoded-articles/pipet-tips/decoded/2013/10/21/calculations-converting-from-nanograms-to-copy-number (Accessed September 9, 2015).

79. Posno, M., Leer, R. J., Luijk N. V., Giezen, M. J. F. V, Heuvelamns, B.C., Lokman, B. C., Pouwels, P.

H.(1991). Incompatibility of Lactobacillus Vectors with Replicons Derived from Small Cryptic Lactobacillus

Plasmids and Segregational Instability of the Introduced Vectors. Applied and Environmental Microbiology, 57

(6),1822-1828.

80. Heravi, R. M., Nasiraii, L.R., Sankian, M., Kermanshahi, H., Varasteh, A. R. (2012) Optimization and comparasion of two electrotransformation methods for Lactobacilli. Biotechnology, 11 (1), 50-54.

81. Wang,Y., Chen,C., Ai,L., Zhou,F., Zhou,Z., Wang,L., Zhang,H.,Chen,W. and Guo,B.(2011) Complete Genome Sequence of the Probiotic Lactobacillus plantarum ST-III. Journal Bacteriology. 193 (1), 313-314 (2011) [Online] http://www.ncbi.nlm.nih.gov/nuccore/CP002222.1 (Acessed May 20, 2015).

82. M van de Guchte, J M van der Vossen, J. K. and G. V. (1989). Construction of a lactococcal expression vector : expression of hen egg white lysozyme Construction of a Lactococcus lactis subsp . lactis. Applied and Environmental Microbiology, 55(1), 224.

83. Duetz, W.A, Ruedi, L., Hermann, R., O’Connor, K. Buchs, J. Witholt, B.(2000). Methods for Intense Aeration, Growth, Storage, and Replication of Bacterial Strains in Microtiter Plates. Applied and Environmental Microbiology, 66(6), 2641–2646.

84. Duetz, W. A. (2007). Microtiter plates as mini-bioreactors: miniaturization of fermentation methods. Trends in Microbiology, 15(10), 469–475.

85. Krzywonos, M., & Eberhard, T. (2011). High density process to cultivate Lactobacillus plantarum biomass using wheat stillage and sugar beet molasses. Electronic Journal of Biotechnology, 14.

86. Jensen, P. R., & Hammer, K. (1993). Minimal Requirements for Exponential Growth of Lactococcus lactis. Applied and Environmental Microbiology, 59(12), 4363–4366.

87. Milk as a growth Medium [Online] https://www.uoguelph.ca/foodscience/book-page/milk-growth-medium(Accessed October 10, 2015).

88. Sánchez, C., Neves, A. R., Cavalheiro, J., dos Santos, M. M., García-Quintáns, N., López, P., & Santos, H. (2008). Contribution of citrate metabolism to the growth of Lactococcus lactis CRL264 at low pH. Applied and Environmental Microbiology, 74(4), 1136–44.

89. De Coste, N. J., Gadkar, V. J., & Filion, M. (2011). Relative and absolute quantitative real-time PCR-based quantifications of hcnC and phlD gene transcripts in natural soil spiked with Pseudomonas sp. strain LBUM300. Applied and Environmental Microbiology, 77(1), 41–47.

72

90. Siezen, R. J., Siezen, R. J., Renckens, B., Renckens, B., Swam, I. Van, Swam, I. Van, … Vos, W. M. De. (2005). Complete Sequences of Four Plasmids of Lactococcus lactis subsp.cremoris SK11 Reveal Extensive Adaptation to the Dairy Environment. Applied and Environmental Microbiology, 71(12), 8371–8382.

91.Tilsala-Timisjärvi, A., & Alatossava, T. (1998). Strain-specific identification of probiotic Lactobacillus rhamnosus with randomly amplified polymorphic DNA-derived PCR primers. Applied and Environmental Microbiology, 64(12), 4816–4819.

92. Yeng, H. W., Shamsudin, M. N., & Rahim, R. A. (2009). Construction of an expression vector for Lactococcus lactis based on an indigenous cryptic plasmid. African Journal of Biotechnology, 8(21), 5621–5626.

93. Tan-A-Ram, P., Cardoso, T., Daveran-Mingot, M. L., Kanchanatawee, S., Loubière, P., Girbal, L., & Cocaign-Bousquet, M. (2011). Assessment of the diversity of dairy Lactococcus lactis subsp. lactis Isolates by an integrated approach combining phenotypic, genomic, and transcriptomic analyses. Applied and Environmental Microbiology, 77(3), 739–748.

94. Marques, S. S. M. O. (2011) L(+)- Lactic Acid Production From Recycled Paper Sludge. phD Thesis in Biotechnology . Universidade de Lisboa - Instituto Superior Técnico.

95. Hutkins, R. W., Nannen. L. N.(1993).pH homeostasis in lactic acid bacteria. J. Dairy Sci., 76, 2354–2365.

96. Micheletti, M., Barrett, T., Doig, S. D., Baganz, F., Levy, M. S., Woodley, J. M., & Lye, G. J. (2006). Fluid mixing in shaken bioreactors: Implications for scale-up predictions from microlitre-scale microbial and mammalian cell cultures. Chemical Engineering Science, 61(9), 2939–2949.

97. Lee, C. L., Ow, D. S. W., Steve. K. W. O. (2006). Quantitative real-time polymerase chain reaction for determination of plasmid copy number in bacteria. Journal of Microbiological Methods, 65(2), 258–267.

73

Appendix

Appendix I- Agarose electrophoresis gel with the products of real-time PCR procedure.

Figure A.1 - Agarose gel electrophoresis of the products of real-time PCR reaction with primers feoA and

erm in L. lactis strain transformed with the different plasmids originated from shake-flask cell growth in M-17

medium supplemented with 20g/l of glucose. Lane L- Molecular-weight marker (NYZ DNA Ladder III,NYZTech).

Lane 1- L. lactis LMG 19460 transformed with pTRKH3 with primer erm. Lane 2 - L. lactis LMG 19460

transformed with pTRKH3 with primer feoA. Lane 3- L. lactis LMG 19460 transformed with pTRKH3_4nuc with

primer erm. Lane 4 - L. lactis LMG 19460 transformed with pTRKH3_4nuc with primer feoA. Lane 5 - L. lactis

LMG 19460 transformed with pTRKH3_3nuc with primer erm. Lane 6 - L. lactis LMG 19460 transformed with

pTRKH3_3nuc with primer feoA. Lane 7 - L. lactis LMG 19460 transformed with pTRKH3_5nuc with primer erm.

Lane 8 - L. lactis LMG 19460 transformed with pTRKH3_5nuc with primer feoA.

Appendix II- Melting curves of the two real-time PCR products.

Figure A.2- Melting peaks for samples originated in the shake-flask cell growth in M-17 medium

supplemented with glucose of L. lactis transformed with the pTRKH3 and its derivatives with feoA primers

(Tm≈83ºC) and with erm primers (Tm ≈84ºC).