Recombinant influenza A H3N2 viruses with mutations of HAtransmembrane cysteines exhibited altered virologicalcharacteristics

Jianqiang Zhou • Shun Xu • Jun Ma •

Wen Lei • Kang Liu • Qiliang Liu • Yida Ren •

Chunyi Xue • Yongchang Cao

Received: 2 September 2013 / Accepted: 6 November 2013

� Springer Science+Business Media New York 2013

Abstract Influenza A H3N2 virus as the cause of 1968

pandemic has since been circulating in human and swine.

Our earlier study has shown that mutations of one or two

cysteines in the transmembrane domain of H3 hemagglu-

tinin (HA) affected the thermal stability and fusion activity

of recombinant HA proteins. Here, we report the successful

generation of three recombinant H3N2 mutant viruses

(C540S, C544L, and 2C/SL) with mutations of one or two

transmembrane cysteines of HA in the background of

A/swine/Guangdong/01/98 [H3N2] using reverse genetics,

indicating that the mutated cysteines were not essential for

virus assembly and growth. Further characterization

revealed that recombinant H3N2 mutant viruses exhibited

larger plaque sizes, increased growth rate in cells,

enhanced fusion activity, reduced thermal and acidic

resistances, and increased virulence in embryonated eggs.

These results demonstrated that the transmembrane cyste-

ines (C540 and C544) in H3 HA have profound effects on

the virological features of H3N2 viruses.

Keywords Influenza virus � Hemagglutinin �Transmembrane domain � Cysteine � Reverse genetics

Introduction

In the twentieth century, there were three influenza pan-

demics caused by influenza A viruses, including the 1918

H1N1 virus, the 1957 H2N2 virus, and the 1968 H3N2

virus [1–3]. Since 1968, H3N2 virus has caused the global

persistence of influenza virus circulating in human and

swine population [4–6]. Influenza A viruses contain eight

segments of single-stranded, negative-sense RNA that

encode for more than 11 proteins [7, 8] including hemag-

glutinin (HA). The HA gene is a genetic determinant of

pathogenicity, whose introduction and adaptation from an

animal host to humans contributed to these pandemics.

HA is a spike glycoprotein present on the viral mem-

brane and recognized as the major surface antigen. HA

initiates viral infection by binding to sialylated cell surface

receptors, undergoes endocytosis, and mediates the fusion

of the viral and endosomal membranes, allowing viral

RNAs to enter the cytoplasm [9, 10]. HA is present as a

homotrimer, and each monomer contains a long ectodo-

main, a transmembrane (TM) domain, and a short cyto-

plasmic domain. HA monomer is synthesized as a single

polypeptide, HA0, and cleaved into the disulfide-linked

polypeptides, HA1 and HA2 [11–13].

Previous studies have indicated that HA TM domain

plays roles in viral entry, HA-mediated membrane fusion,

and HA apical sorting [14, 15]. When HA TM domain was

substituted with a glycosylphosphatidylinositol (GPI)

anchor, the expressed GPI-anchored HA in cells could

support only hemifusion to target membranes at low pH

[15, 16], implying a role for the TM domain in transi-

tioning membrane hemifusion to full fusion. When the TM

domain was replaced by the TM domain of the fusogenic

glycoprotein F of Sendai virus, the fusion activity of the

chimeric protein was not altered [17]. On the other hand, a

Electronic supplementary material The online version of thisarticle (doi:10.1007/s11262-013-1011-2) contains supplementarymaterial, which is available to authorized users.

J. Zhou � S. Xu � J. Ma � W. Lei � K. Liu � Q. Liu � Y. Ren �C. Xue � Y. Cao (&)

State Key Laboratory of Biocontrol, Life Sciences School,

Guangzhou Higher Education Mega Center, Sun Yat-sen

University, Guangzhou 510006, People’s Republic of China

e-mail: caoych@mail.sysu.edu.cn

123

Virus Genes

DOI 10.1007/s11262-013-1011-2

mutational study demonstrated a stringent TM domain

length requirement for supporting full membrane fusion

[18], strongly suggesting that the TM domain needed to

span both inner and outer leaflets to fulfill its function. In

addition, it has been found that the residues within HA TM

domain are important for raft association as sequence

substitutions in the TM domain ablated HA association

with rafts (nonraft HA) [19].

HA protein of H3N2 virus among 16 subtypes of

influenza A viruses is the only one containing two cysteine

residues (C540 and C544) in its TM domain [20–22]. Our

earlier study has shown that mutations of one or two of

these two cysteines affected the thermal stability and fusion

activity of recombinant H3 HA proteins [20]. The enticing

and necessary question was what effects of the incorpora-

tion of these recombinant mutant HAs would be on the

recombinant H3N2 viruses. In this study, we generated

three recombinant H3N2 mutant viruses (wildtype, C540S,

C544L, and 2C/SL) carrying mutations of one or two TM

cysteines (C540 and C544) in the HA TM domain and one

wildtype (WT) recombinant H3N2 virus in the background

of A/swine/Guangdong/01/98 [H3N2] using reverse

genetics. The results showed that the mutations affected

various characteristics of the recombinant H3N2 viruses

including growth rate, fusion activity, thermal and acidic

resistances, and infectivity and virulence in embryonated

eggs.

Materials and methods

Cells and viruses

Human embryonic kidney cells (293T) and MDCK cells

were cultured in Dulbecco’s modified Eagle’s medium

(DMEM; Invitrogen) supplemented with 10 % fetal bovine

serum (FBS; Invitrogen), GlutaMAX (200 mM; Invitro-

gen), penicillin (100 units/ml), and streptomycin (100 lg/ml)

in an atmosphere of 5 % CO2 at 37 �C.

The H3N2 strain (A/swine/Guangdong/01/98 [H3N2])

was isolated in Guangdong province, China in 1998; the

nucleotide sequences are available from GenBank under

accession numbers FJ830852.1–FJ830859.1.

The handling of experiments with live viruses was

conducted in a biosafety 2 plus facility under the guidelines

issued by China authority.

Plasmids and constructs

The eight genome-sense (pHH21) plasmids (a gift from Y.

Kawaoka, University of Wisconsin-Madison) and four

protein-expressing (pcDNA3.0) plasmids used to generate

influenza virus by reverse genetics have been described

previously [23–25]. For rescue of recombinant H3N2

viruses, eight genome-sense plasmids together with

expression plasmids encoding the RNP complex (pcDNA–

PB1, pcDNA–PB2, pcDNA–PA, and pcDNA–NP) were

transfected into 293T cells using Lipofectamine2000

(Invitrogen). The transfected cell culture supernatant was

collected at 48–60 h post-transfection and used to passage

onto MDCK cells or 10-days-old embryonated chicken

eggs for the propagation of the recombinant viruses. Virus

production was monitored by hemagglutination titer.

To generate pHH21 encoding the mutant HAs (C540S,

C544L, and 2C/SL), the pHH21 vector encoding WT HA

was subjected to site-directed mutagenesis using the

Stratagene Quick-Change mutagenesis kit (Stratagene, La

Jolla, CA, USA). Primers used in the generation of these

constructs were as follows: 50GATTTCCTTTGCCAT AT

CAAGCTTTTTGCTTTGTGTTG30 [forward (fo)] and

50CAACACAAAGCAA AAAGCTTGATATGGCAAAG

GAAATC30 [reverse (re)] for exchange of cysteine at

position 540; 50CATATCATGCTTTTTGCTTCTTGTTG

TTTTGCTGGGGTTC30 (fo) and 50GAACCCCAGCAAA

ACAACAAGAAGCAAAAAGCATGATATG30 (re) for

exchange of cysteine at position 544; 50CATATCAAGCT

TTTTGCTTCTTGTT GTTTTGCTGGGGTTC30 (fo) and

50GAACCCCAGCAAAACAACAAGAAGCA AAAAGC

TTGATATG30 (re) for exchange of cysteines at position

540 and 544 (the mutation sites are indicated by the

underlined characters).

The recombinant mutant viruses were generated as

described above and the entire genome of the recombinant

viruses was confirmed by sequencing.

Virus growth and plaque assay

MDCK cells were grown in 24-well plates and inoculated

in triplicate with viruses at a multiplicity of infection

(MOI) of 0.001 per well in phosphate-buffered saline

(PBS) containing 0.2 % BSA for 1 h. Unbound viruses

were washed away, and 0.5 ml serum-free medium con-

taining 0.2 % BSA and 2 lg/ml TPCK-trypsin was added

to each well. The supernatants were collected every 12 h

until 72 h post-infection. The viral titers in the supernatants

were determined by plaque assay on MDCK cells.

For plaque assays, MDCK cells in 6-well plates were

infected with serial tenfold dilutions of the recovered

viruses for 1 h at 37 �C. After washing, the media in the

dish were then replaced with MEM-1 % agarose containing

2 lg/ml of trypsin. Plaques were formed by incubation for

3 days at 37 �C. Cells were stained with 0.01 % neutral red

and the formed plaques were photographed.

Virus Genes

123

Virus purification, immunoblotting, and electron

microscopy

The WT and mutant viruses were propagated in embryonated

eggs and purified by centrifugation on 20–60 % sucrose

density gradients [26]. Purified virions were boiled for 5 min

at 100 �C in the loading buffer (50 mM Tris, 100 mM

dithiothreitol, 2 % SDS, 0.1 % bromophenol blue, and 10 %

glycerol). And viral proteins were separated by 10 % SDS

polyacrylamide gel electrophoresis. After that proteins were

transferred to polyvinylidene fluoride membrane (Millipore,

Billerica, MA). Membranes were blocked in 3 % BSA and

then incubated with mouse sera against virus A/swine/GD/

01/98 (1:3,000) for 2 h, followed by incubation with horse-

radish peroxidase-conjugated secondary antibody for 1 h.

Proteins were detected with the commercial ECL kit

(Pierce). The intensity of each band was quantified using

GeneTools software (SynGene).

The procedure of the negative staining of purified viri-

ons was done as described [27]. In brief, purified recom-

binant viruses were attached onto parlodion-coated nickel

grids for 2 min. And the virions were stained by the

phosphotungstic acid buffer for 2 min. The shape of the

viruses was photographed by the JEOL JEM-100 CX-II

electron microscope.

Virus resistance assays

In the thermal resistance assay, the viruses with the same HA

titers were incubated at a temperature ranging from 48 to

60 �C for 30 min in a Peltier Gradient Thermal Cycler (Bio-

Rad, Richmond, CA); then the HA titers were measured. In

the acidic resistance assay, the viruses with the same PFUs

were incubated in an acidic buffer (10 mM HEPES, 10 mM

MES in PBS) at pH 7.4, 5.2, or 5.0 at 37 �C for 30 min; then

the solutions were adjusted to pH 7.0; then MDCK cells were

infected with the recombinant viruses in 24-well plates at a

MOI of 2; mock-infected wells were negative controls. After

30 min of adsorption at 37 �C, cells were washed three times

with PBS and replaced with the serum-free medium con-

taining 2 lg/ml TPCK-trypsin. The infected plates were

fixed with 4 % paraformaldehyde at 5 h post-infection for

15 min at room temperature and permeabilized with 0.2 %

Triton X-100 in PBS for 15 min followed by staining using

the FITC-labeled mAb against NP (Abcam, Cambridge,

UK). Images were observed under the Zeiss Observer Z1

inverted fluorescence microscope.

Virus–cell fusion assay

The virus–cell fusion assay has been described [28]. In

brief, the WT and mutant viruses were standardized to HA

256 units and incubated with chicken red blood cells

(RBC) (2 % RBC concentration) on ice for 10 min. Then

the pH was lowered from 5.8 to 4.6 by addition of the

sodium citrate buffer. After incubation at room temperature

for 30 min, the chicken RBC were removed by centrifu-

gation (3,000 rpm for 3 min) and supernatants were

transferred to an ELISA plate for determination of NADPH

content by optical density measurement (340 nm) with a

Bio-Tek (Bio-Tek Instruments, Inc., Winooski, VT, USA)

ELISA plate reader. NADPH was present in the superna-

tant as a function of fusion-induced red blood cell lysis.

Baseline NADPH activity values were derived from sam-

ples without viruses that underwent identical treatment.

Characterization of recombinant viruses

in embryonated chicken eggs

According to the standard protocol [29], 9 or 10-days-old

specific-pathogen-free (SPF) embryonated eggs were

inoculated with a series of tenfold dilution of recombinant

virus stocks, respectively. All recombinant virus stocks had

a titer of 5 9 106 pfu per ml. The dilutions of 100, 10-1,

10-2, 10-3, and 10-4 for assaying 50 % egg lethal doses

(ELD50). And the samples of every dilution were tested for

the infection rate and mortality in the following 5 days.

Values of ELD50 were calculated by the Reed–Muench

method [30].

HA receptor-binding assay in MDCK cells

As previously described [31, 32], HA receptor-binding

affinity of recombinant viruses was determined using

MDCK cells. MDCK cells in 24-well plates were inoculated

with the four recombinant viruses at a MOI of 1.0 for 30 min.

The infected cells were washed three times with PBS and

incubated at 33 �C for 6 h with the medium containing

1 lg/ml TPCK-trypsin. The inoculated plates were then

fixed with 1 % paraformaldehyde, permeabilized with 0.2 %

Triton X-100 in PBS, and stained with anti-NP monoclonal

antibodies. The cell images were captured by the Zeiss Observer

Z1 inverted fluorescence microscope and the percentage of

infected cells was analyzed by the Image-Pro Plus software

(Media Cybernetics, Silver Springs, MD, USA).

Ethics statement

The viruses propagation studies in embryonated eggs were

approved by the Institutional Animal Care and Use Com-

mittee of Sun Yat-sen University and the Institutional

Animal Ethics Committee of Sun Yat-sen University

(Permit Number: IACUC-2012-0701). Research was con-

ducted in compliance with guidelines of the Ordinance on

Laboratory Animals Management set by the State Scien-

tific and Technological Commission of China.

Virus Genes

123

Statistical analysis

Data are presented as mean ± SEM from at least three

independent experiments. All statistical analysis was done

using OriginPro 8 SR3 (Origin Lab Corp.). The differences

between groups were determined by the Student’s t test with

two-tailed t test when only two groups were compared. When

more than two groups were compared, they were analyzed by

one-way analysis of variance (ANOVA). Differences were

considered statistically significant at P \ 0.05.

Results

Generation of recombinant WT and mutant influenza

H3N2 viruses (C540S, C544L, and 2C/SL)

Our earlier study has demonstrated that the two cysteines

(C540 and C544) in H3 HA TM domain affected the

thermal stability and fusion activity of H3 HA proteins

[20]. Since serine (S) at position 540 and leucine (L) at

position 544 are common in most of the subtypes including

H1, H5, and H9, the two cysteines (C540 and C544) in the

H3 HA TM were mutated into serine or leucine individu-

ally (C540S and C544L) or in combination (2C/SL)

(Fig. 1). The eight genomic segments from A/swine/

Guangdong/01/98 (H3N2) were cloned and the HA was

mutated using site-directed mutagenesis. To facilitate the

recovery of mutant viruses, we used a well-characterized

reverse genetics system in which 293T cells and MDCK

cells were co-cultured and transfected with eight genome-

encoding plasmids and four protein (PB1, PB2, PA, and

NP)-expressing plasmids [24, 33]. The authenticity of the

recombinant viruses was confirmed by sequencing all

genome segments (data not shown). The generated

recombinant viruses showed the typical phenotype of

influenza viruses with surface spikes under electron

microscope (Fig. 2a). As showed in Fig. 2c, the recombi-

nant viruses produced the plaques with different sizes; the

cysteines mutant viruses formed larger plaques than the

WT virus, especially the C540S and 2C/SL mutants. The

results taken together indicated that the mutations

introduced into the TM domain did not impede the

assembly and propagation of recombinant H3N2 viruses.

Cysteine mutations did not significantly alter the viral

protein compositions of virions

The four recombinant H3N2 viruses (WT, C540S, C544L,

and 2C/SL) were propagated in embryonated eggs and

purified. The viral proteins of all four purified virions were

separated on reduced SDS-PAGE gel, and the separated

proteins were blotted by the sera from whole inactivated

H3N2 virus-immunized mice (Fig. 2b). The results showed

that HA1, HA2, NP, and M1 proteins were present and

their individual expression levels were comparable in all

four recombinant viruses (Fig. S1), demonstrating that the

mutations of cysteines in H3 HA TM did not significantly

alter the viral protein compositions of the virions.

Recombinant mutant viruses (C540S, C544L,

and 2C/SL) had increased growth rate

We next analyzed the growth rate of four recombinant

viruses by infecting MDCK cells with viruses at a low

multiplicity of infection (MOI of 0.001) and measured the

titers of plaque-forming units (pfu) at 0, 12, 24, 36, 48, 60,

and 72 h after infection. The results showed that the pfu

titers of all three recombinant mutant viruses were higher

than that of the recombinant WT virus (Fig. 3). In partic-

ular, the pfu titers of C540S, C544L, and 2C/SL mutant

viruses at 48 h were significantly higher than that of WT

virus (P \ 0.05), while the pfu titer of C544L mutant virus

at 48 h was lower than that of C540S and 2C/SL mutant

viruses but higher than that of WT virus (about twofold

increase) at the 48 h post-infection. In summary, C540S,

C544L, and 2C/SL recombinant viruses showed increased

growth rates in MDCK cells.

Recombinant mutant viruses showed increased fusion

activity

We next investigated the fusion activities of all four

recombinant viruses using virus-induced erythrocyte

Fig. 1 Schematic diagram of

WT and mutant HAs. The

nomenclature of the

recombinant viruses is shown

on the left

Virus Genes

123

hemolysis assay [28]. When all four recombinant viruses

were subjected to the virus-induced erythrocyte hemolysis

assay at a pH range of 4.6, 4.8, 5.0, 5.2, 5.4, 5.6 and 5.8, the

mutant viruses (C540S, C544L, and 2C/SL) showed sig-

nificant higher fusion activity than that of WT virus in the

pH range from 4.6 to 5.0 (P \ 0.01) (Fig. 4). The data

indicated that there was no difference in the HA activation

pH between the mutants and WT virus; instead, the dif-

ference was the extent of membrane fusion. These results

were in line with our earlier study [20], validating the

usefulness of using recombinant HA proteins to study the

HA functions.

Fig. 2 Verification of the

recombinant viruses.

a Negatively stained purified

influenza virions. Images are at

980,000 (Bar 200 nm.).

b Western blot analysis of SDS-

PAGE separated viral

polypeptides. Blots were probed

with antiserum for A/swine/GD/

98. The recombinant viruses

were grown in embryonated

eggs and purified through

sucrose gradients. c Plaque

phenotypes of recombinant

viruses. MDCK cell monolayers

were inoculated with viruses

and subsequently covered with

an agarose-containing medium

overlay. After 3 days of

incubation, plaques were

visualized by staining with

neutral red

Fig. 3 Growth curves of

recombinant H3N2 viruses.

Monolayers of MDCK cells

were inoculated at a MOI of

0.001. The amount of infectious

viruses in the supernatants

harvested at the indicated times

was determined by plaque

assay. Error bars represent the

standard deviation from

triplicate experiments. *on WT

means P \ 0.05, compared with

all mutant viruses

Virus Genes

123

Recombinant mutant viruses exhibited reduced thermal

and acidic resistances

We then used the thermal resistance assay [34] to examine

the thermal resistance of recombinant viruses at the tem-

perature range of 48, 50, 52, 54, 56, 58, and 60 �C. The

temperature range was chosen after our preliminary studies

showed that all four recombinant viruses had similar

thermal resistance below 50 �C and retained no HA titers

over 60 �C. All four recombinant viruses with the same HA

titers were incubated at the designated temperatures for

30 min, and their HA titers were measured after cooling to

room temperature. The results showed that all four

recombinant viruses started to lose their HA titers from

50 �C, and gradually to completely lose their HA titers at

60 �C (Fig. 5). More importantly, the three recombinant

mutant viruses (C540S, C544L, and 2C/SL) lost signifi-

cantly more HA titers than the WT recombinant virus at 56

and 58 �C (P \ 0.05), indicating that the recombinant

mutant viruses had reduced thermal resistances (Fig. 5).

We also examined whether the treatment with acidic

solutions prior to infections would affect the infectivity of

the recombinant viruses. All four recombinant viruses with

the same PFUs were treated with a buffer of pH 5.0, 5.2,

and 7.4 at 37 �C for 30 min; and then their infectivity was

tested by infecting MDCK cells. In the pH range tested, pH

5.0 distinguished the WT recombinant virus from all three

recombinant mutant viruses, where only the WT recom-

binant virus retained partial infectivity while all other three

completely lost their infectivity (Fig. 6).

In summary, the mutations of either one or both of the

two TM cysteines rendered the recombinant mutant viruses

with reduced thermal and acidic resistances.

All recombinant viruses shared similar receptor-binding

affinity

We then investigated whether the mutations of the TM

cysteines would affect the receptor-binding affinity of the

recombinant viruses. For assaying the receptor-binding

Fig. 4 Fusion activities of

recombinant H3N2 viruses.

Fusion activity was measured

by the red blood cell fusion

assay. Viruses standardized to

256 HA units were mixed with

2 % chicken red blood cells and

then the buffer was replaced

with the acidic buffer which

varied between 4.6 and 5.8. The

hemolysis representing the

fusion activity was expressed as

the optical density at 340 nm

(OD340) minus the baseline

NADPH value obtained from no

virus treatment condition. Error

bars represent the standard

deviation from triplicate

experiments. At pH 4.6, 4.8, 5.0,

**P \ 0.01, compared with all

mutant viruses

Fig. 5 Thermal resistance of recombinant H3N2 viruses. For four

recombinant viruses, the preparations which had originally 256 HA

units were incubated at indicated temperatures for 30 min in the

thermal cycler. And their HA titers were measured by hemaggluti-

nation. *P \ 0.05, compared with all mutant viruses

Virus Genes

123

affinity, MDCK cells were infected at an MOI of 1.0 with

viruses and immuno-stained with anti-NP monoclonal

antibodies after 6 h [31, 32]. The receptor-binding affini-

ties were presented by the percentage of the infected cells.

The results showed that all four recombinant viruses had

similar receptor-binding affinities (Fig. 7).

Recombinant mutant viruses manifested higher ELD50

titers than recombinant WT virus

We next examined whether the cysteine mutations affected

the pathogenicity of recombinant mutant viruses. The

mouse model has been widely used for assaying the path-

ogenicity of influenza A viruses. However, our preliminary

studies showed that the H3N2 strain used in our study was

poor in infecting mice and the mutants viruses we

constructed cannot also infect mice; thus we examined the

pathogenicity of recombinant viruses in SPF embryonated

chicken eggs by ELD50 assays [35]. The WT, C540S,

C544L, and 2C/SL viruses had the mean titers of ELD50

-1.5, -3, -2.33, and -2.5, respectively (Table 1). The

results showed that all recombinant mutant viruses (C540S,

C544L, and 2C/SL) exhibited enhanced virulence, indi-

cating that the two cysteines in the TM domain are

involved in regulating the virulence of H3N2 influenza

viruses.

Discussion

This study attempted to investigate the relationship of H3

HA TM domain structure and the biological functions of

Fig. 6 Acidic resistance of

recombinant H3N2 viruses.

Virus samples were incubated

with MES buffer at indicated

pH values for 30 min. And then

samples were returned to neutral

pH (7.4) prior to infection at

MOI = 2. The cells were

processed for

immunofluorescence staining

after 5 h of incubation at 37 �C

Fig. 7 HA receptor-binding affinity of recombinant viruses. The

recombinant viruses were adsorbed to MDCK cells at a MOI of 1.0

for 30 min, washed three times with PBS. The cells were then

processed for immunofluorescence staining after 6 h of incubation at

37 �C. The percentage of infected cells (mean ± standard deviation)

indicated in each image is an average of six images

Virus Genes

123

recombinant H3N2 viruses. More specifically, we gener-

ated by reverse genetics four recombinant H3N2 viruses, of

which three contained a H3 HA with mutation of one or

two TM cysteines (C540S, C544L, and 2C/SL); all four

recombinant H3N2 viruses showed the similar viral com-

position, indicating that these two TM cysteines were not

indispensable for the assembly and propagation of H3N2

viruses. Our results showed that while all four recombinant

H3N2 viruses had similar receptor-binding affinity, the

three recombinant mutant viruses manifested different

biological characteristics than the recombinant WT virus,

including different plaque sizes, higher growth rate,

increased fusion activity, reduced thermal and acidic

resistances, and increased EID50 and ELD50 titers.

During membrane fusion, HA forms a helical structure

consisting of its TM and fusion peptide at the end of the

molecule [36]. For influenza virus HA, a TM domain with

]17 amino acids was able to efficiently promote full

fusion in all HAs [18]. Previous work indicated that addi-

tion of palmitic acid to cysteines, which are highly con-

served among the 16 HA subtypes, located in the TM

domain boundary region may regulate the membrane

fusion [37–40]. Our study for the first time provided direct

evidence showing that the TM cysteines (C540 and C544)

contributed to the regulation of fusion activity of H3N2

viruses, reaffirming previous studies on HA molecules [17,

18].

Takeda et al. [19] had studied the effects of the TM

amino acids of HA on the growth of H3N2 viruses in detail

by alanine scanning mutagenesis. They showed that HA

mutants 530–532 and 533–535 had a slower growth rate

and a titer of about 3 logs lower than WT virus [19].

Interestingly, the HA mutant 539–541 was the only one

showing higher growth rate than WT virus. This strongly

corroborated our results showing that C540S mutant virus

had the higher growth rate than WT virus (Fig. 3), because

the mutant 539–541 in Takeda et al. [19] had the C540

residue changed to alanine. In addition, the positions of the

amino acids in the TM might affect their contributions to

the growth rate. In Takeda et al. [19], different mutants had

different growth rates. Our results also supported this point

by showing that C540S and C544L mutants had different

growth rates. Furthermore, the reasons for the increased

growth rates for C540S, C544L, and 2C/SL mutant H3N2

viruses might be their increased fusion activity. A number

of previous studies reported that the elevated fusion

activity could enhance the virus growth [41–44]. In the

present study, the growth rates of the mutant H3N2 viruses

were correlated with their fusion activities (Figs. 3, 4). This

adds another support for the relationship between the virus

growth rate and their fusion activity.

Previous studies have demonstrated that the conforma-

tional changes of HA proteins might affect the thermal

resistances of influenza viruses [34, 45], and that elevated

pH for membrane fusion could change the stability of the

viruses [42, 44–46]. The results in our study showed that

the recombinant WT H3N2 viruses were more resistant to

elevated temperature exposure or acidic treatment than the

mutant viruses (Figs. 5, 6), indicating that the TM cyste-

ines might contribute to the conformational stability of H3

HA proteins in H3N2 viruses. In addition, for the para-

myxoviruses, the fusion protein activation involves cyto-

plasmic tails signaling to the ectodomain [47, 48] and TM

domain can affect ectodomain stability [49–51]. The HA

TM domain can probably modulate the membrane fusion

by the inside-out signaling. Our results provided a plausible

explanation for the previous studies showing that the TM

domain of the H3N2 strain A/X-31 exhibited a strong

potential for the stable oligomers [52, 53] and more tightly

associated within trimers [54].

The recombinant mutant H3N2 viruses exhibited

increased infectivity and virulence in the embryonated

eggs; this is to the best of our knowledge the first time a

study showing that mutations of one or two TM cysteines

in the H3 HA could increase the infectivity and virulence

of H3N2 viruses. These results should not be surprising

since these recombinant mutants H3N2 viruses have been

shown to have increased growth rate and fusion activity.

Even though we made a strong case for arguing that there is

a causal relationship between the increased infectivity and

virulence and the increased growth rate and fusion activity,

further studies are needed to establish such a relationship.

In summary, our results have demonstrated that muta-

tions of one or two cysteines in the TM domain of H3 HA

protein could alter many characteristics of recombinant

mutant H3N2 viruses including plaque size, increased

growth rate, fusion activity, reduced thermal and acidic

resistances. This study has important practical applications,

for example, the recombinant mutant H3N2 viruses with

increased growth rate could be developed to improve

H3N2 influenza vaccine production. Furthermore, it would

be interesting to know whether an insertion of the corre-

sponding TM cysteines into the TM domains of other

subtype HA proteins could decrease the infectivity and

virulence of the resultant recombinant viruses; for example,

if the infectivity and virulence of H5N1 viruses could be

reduced by such insertions in their HA proteins, it might

Table 1 Pathogenicity of recombinant H3N2 viruses in eggs

Virus Log10 ELD50

rH3N2/A/swine/GD/01/98-HA-WT -1.5

rH3N2/A/swine/GD/01/98-HA-C540S -3

rH3N2/A/swine/GD/01/98-HA-C544L -2.33

rH3N2/A/swine/GD/01/98-HA-2C/SL -2.5

Virus Genes

123

facilitate the development of vaccines against H5N1

viruses.

Acknowledgments This work was supported by grants from the

State Key Laboratory of Biocontrol at Sun Yat-sen University. We

thank George D. Liu for critical review and revision of the manuscript

and Professor A.D. Osterhaus of Erasmus University Medical Center,

Rotterdam and Professor Y. Kawaoka of University of Wisconsin-

Madison for offering the plasmids.

References

1. K. Stohr, Lancet Infect. Dis 2, 517 (2002)

2. M.R. Sandbulte, K.B. Westgeest, J. Gao, X. Xu, A.I. Klimov,

C.A. Russell, D.F. Burke, D.J. Smith, R.A. Fouchier, M.C. Ei-

chelberger, Proc. Natl. Acad. Sci. USA 108, 20748–20753 (2011)

3. J.C. Krause, T. Tsibane, T.M. Tumpey, C.J. Huffman, R. Albr-

echt, D.L. Blum, I. Ramos, A. Fernandez-Sesma, K.M. Edwards,

A. Garcia-Sastre, C.F. Basler, J.E. Crowe Jr, J. Virol. 86,

6334–6340 (2012)

4. C.A. Russell, T.C. Jones, I.G. Barr, N.J. Cox, R.J. Garten, V.

Gregory, I.D. Gust, A.W. Hampson, A.J. Hay, A.C. Hurt, J.C. de

Jong, A. Kelso, A.I. Klimov, T. Kageyama, N. Komadina, A.S.

Lapedes, Y.P. Lin, A. Mosterin, M. Obuchi, T. Odagiri, A.D.

Osterhaus, G.F. Rimmelzwaan, M.W. Shaw, E. Skepner, K.

Stohr, M. Tashiro, R.A. Fouchier, D.J. Smith, Science 320,

340–346 (2008)

5. J. Bahl, M.I. Nelson, K.H. Chan, R. Chen, D. Vijaykrishna, R.A.

Halpin, T.B. Stockwell, X. Lin, D.E. Wentworth, E. Ghedin, Y.

Guan, J.S. Peiris, S. Riley, A. Rambaut, E.C. Holmes, G.J. Smith,

Proc. Natl. Acad. Sci. USA 108, 19359–19364 (2011)

6. R.J. Garten, C.T. Davis, C.A. Russell, B. Shu, S. Lindstrom, A.

Balish, W.M. Sessions, X. Xu, E. Skepner, V. Deyde, M. Okomo-

Adhiambo, L. Gubareva, J. Barnes, C.B. Smith, S.L. Emery, M.J.

Hillman, P. Rivailler, J. Smagala, M. de Graaf, D.F. Burke, R.A.

Fouchier, C. Pappas, C.M. Alpuche-Aranda, H. Lopez-Gatell, H.

Olivera, I. Lopez, C.A. Myers, D. Faix, P.J. Blair, C. Yu, K.M.

Keene, P.D. Dotson Jr, D. Boxrud, A.R. Sambol, S.H. Abid, K. St

George, T. Bannerman, A.L. Moore, D.J. Stringer, P. Blevins,

G.J. Demmler-Harrison, M. Ginsberg, P. Kriner, S. Waterman, S.

Smole, H.F. Guevara, E.A. Belongia, P.A. Clark, S.T. Beatrice,

R. Donis, J. Katz, L. Finelli, C.B. Bridges, M. Shaw, D.B.

Jernigan, T.M. Uyeki, D.J. Smith, A.I. Klimov, N.J. Cox, Science

325, 197–201 (2009)

7. R.A. Lamb, R.M. Krug, in Fields Virology, 4th edn., ed. by D.M.

Knipe, P.M. Howley (Lippincott Williams & Wilkins, Philadel-

phia, 2001), pp. 1487–1532

8. M.L. Grantham, W.H. Wu, E.N. Lalime, M.E. Lorenzo, S.L.

Klein, A. Pekosz, J. Virol. 83, 8655–8661 (2009)

9. J.J. Skehel, D.C. Wiley, Annu. Rev. Biochem. 69, 531–569

(2000)

10. H.D. Klenk, R. Rott, Adv. Virus Res. 34, 247–281 (1988)

11. E.J. Schrauwen, T.M. Bestebroer, V.J. Munster, E. de Wit, S.

Herfst, G.F. Rimmelzwaan, A.D. Osterhaus, R.A. Fouchier, J.

Gen. Virol. 92, 1410–1415 (2011)

12. E.J. Schrauwen, S. Herfst, L.M. Leijten, P. van Run, T.M.

Bestebroer, M. Linster, R. Bodewes, J.H. Kreijtz, G.F. Rim-

melzwaan, A.D. Osterhaus, R.A. Fouchier, T. Kuiken, D. van

Riel, J. Virol. 86, 3975–3984 (2012)

13. W.H. Wu, A. Pekosz, J. Virol. 82, 1059–1063 (2008)

14. P. Scheiffele, M.G. Roth, K. Simons, EMBO J. 16, 5501–5508

(1997)

15. G.W. Kemble, T. Danieli, J.M. White, Cell 76, 383–391 (1994)

16. G.B. Melikyan, J.M. White, F.S. Cohen, J. Cell Biol. 131,

679–691 (1995)

17. B. Schroth-Diez, E. Ponimaskin, H. Reverey, M.F. Schmidt, A.

Herrmann, J. Virol. 72, 133–141 (1998)

18. R.T. Armstrong, A.S. Kushnir, J.M. White, J. Cell Biol. 151,

425–437 (2000)

19. M. Takeda, G.P. Leser, C.J. Russell, R.A. Lamb, Proc. Natl.

Acad. Sci. USA 100, 14610–14617 (2003)

20. S. Xu, J. Zhou, K. Liu, Q. Liu, C. Xue, X. Li, J. Zheng, D. Luo,

Y. Cao, Virus Genes 47, 20–26 (2013)

21. E. Nobusawa, T. Aoyama, H. Kato, Y. Suzuki, Y. Tateno, K.

Nakajima, Virology 182, 475–485 (1991)

22. R.D. Tall, M.A. Alonso, M.G. Roth, Traffic 4, 838–849 (2003)

23. G. Neumann, T. Watanabe, H. Ito, S. Watanabe, H. Goto, P. Gao,

M. Hughes, D.R. Perez, R. Donis, E. Hoffmann, G. Hobom, Y.

Kawaoka, Proc. Natl. Acad. Sci. USA 96, 9345–9350 (1999)

24. E. Fodor, L. Devenish, O.G. Engelhardt, P. Palese, G.G.

Brownlee, A. Garcia-Sastre, J. Virol. 73, 9679–9682 (1999)

25. E. Hoffmann, G. Neumann, G. Hobom, R.G. Webster, Y. Ka-

waoka, Virology 267, 310–317 (2000)

26. H. Jin, K. Subbarao, S. Bagai, G.P. Leser, B.R. Murphy, R.A.

Lamb, J. Virol. 70, 1406–1414 (1996)

27. H. Jin, G.P. Leser, J. Zhang, R.A. Lamb, EMBO J 16, 1236–1247

(1997)

28. T.T. Wang, G.S. Tan, R. Hai, N. Pica, E. Petersen, T.M. Moran,

P. Palese, PLoS Pathog. 6, e1000796 (2010)

29. D.E. Swayne, D.A. Halvorson, Influenza in Diseases of Poultry,

11th edn. (Iowa State Press, Iowa City, 2003)

30. A.K. Thakur, W.L. Fezio, Drug Chem. Toxicol. 4, 297–305

(1981)

31. B. Lu, H. Zhou, D. Ye, G. Kemble, H. Jin, J. Virol. 79,

6763–6771 (2005)

32. B. Lu, H. Zhou, W. Chan, G. Kemble, H. Jin, Vaccine 24,

6691–6693 (2006)

33. E. Hoffmann, G. Neumann, Y. Kawaoka, G. Hobom, R.G.

Webster, Proc. Natl. Acad. Sci. USA 97, 6108–6113 (2000)

34. A. Farnsworth, T.D. Cyr, C. Li, J. Wang, X. Li, Vaccine 29,

1529–1533 (2011)

35. H. Sun, P. Jiao, B. Jia, C. Xu, L. Wei, F. Shan, K. Luo, C. Xin, K.

Zhang, M. Liao, Vet. Microbiol. 152, 258–265 (2011)

36. Z.N. Li, B.J. Lee, W.A. Langley, K.C. Bradley, R.J. Russell, D.A.

Steinhauer, J. Virol. 82, 6337–6348 (2008)

37. L.V. Kordyukova, M.V. Serebryakova, L.A. Baratova, M. Veit, J.

Virol. 82, 9288–9292 (2008)

38. B.J. Chen, M. Takeda, R.A. Lamb, J. Virol. 79, 13673–13684

(2005)

39. R. Wagner, A. Herwig, N. Azzouz, H.D. Klenk, J. Virol. 79,

6449–6458 (2005)

40. T. Sakai, R. Ohuchi, M. Ohuchi, J. Virol. 76, 4603–4611 (2002)

41. S. Murakami, T. Horimoto, M. Ito, R. Takano, H. Katsura, M.

Shimojima, Y. Kawaoka, J. Virol. 86, 1405–1410 (2012)

42. M.L. Reed, H.L. Yen, R.M. DuBois, O.A. Bridges, R. Salomon,

R.G. Webster, C.J. Russell, J. Virol. 83, 3568–3580 (2009)

43. M.L. Reed, O.A. Bridges, P. Seiler, J.K. Kim, H.L. Yen, R.

Salomon, E.A. Govorkova, R.G. Webster, C.J. Russell, J. Virol.

84, 1527–1535 (2010)

44. Y.P. Lin, S.A. Wharton, J. Martin, J.J. Skehel, D.C. Wiley, D.A.

Steinhauer, Virology 233, 402–410 (1997)

45. B.M. Krenn, A. Egorov, E. Romanovskaya-Romanko, M. Wol-

schek, S. Nakowitsch, T. Ruthsatz, B. Kiefmann, A. Morokutti, J.

Humer, J. Geiler, J. Cinatl, M. Michaelis, N. Wressnigg, S.

Sturlan, B. Ferko, O.V. Batishchev, A.V. Indenbom, R. Zhu, M.

Kastner, P. Hinterdorfer, O. Kiselev, T. Muster, J. Romanova,

PLoS One 6, e18577 (2011)

Virus Genes

123

46. R.S. Daniels, J.C. Downie, A.J. Hay, M. Knossow, J.J. Skehel,

M.L. Wang, D.C. Wiley, Cell 40, 431–439 (1985)

47. D.L. Waning, C.J. Russell, T.S. Jardetzky, R.A. Lamb, Proc.

Natl. Acad. Sci. USA 101, 9217–9222 (2004)

48. D.L. Waning, A.P. Schmitt, G.P. Leser, R.A. Lamb, J. Virol. 76,

9284–9297 (2002)

49. S. Seth, A.L. Goodman, R.W. Compans, J. Virol. 78, 8513–8523

(2004)

50. M. Li, Z.N. Li, Q. Yao, C. Yang, D.A. Steinhauer, R.W. Com-

pans, J. Virol. 80, 6106–6114 (2006)

51. M.L. Bissonnette, J.E. Donald, W.F. DeGrado, T.S. Jardetzky,

R.A. Lamb, J. Mol. Biol. 386, 14–36 (2009)

52. S.A. Tatulian, L.K. Tamm, Biochemistry 39, 496–507 (2000)

53. L. Godley, J. Pfeifer, D. Steinhauer, B. Ely, G. Shaw, R. Kauf-

mann, E. Suchanek, C. Pabo, J.J. Skehel, D.C. Wiley et al., Cell

68, 635–645 (1992)

54. L.V. Kordyukova, M.V. Serebryakova, A.A. Polyansky, E.A.

Kropotkina, A.V. Alexeevski, M. Veit, R.G. Efremov, I.Y. Fi-

lippova, L.A. Baratova, Biochim. Biophys. Acta 1808,

1843–1854 (2011)

Virus Genes

123