72
Recent findings from NGS studies in eye diseases Dr.P.Sundaresan Senior Scientist Aravind Medical Research Foundation Aravind Eye Hospital Madurai NGS conference-Genotypic-Bangalroe-11 th Sep.2014

Recent findings from NGS studies in eye diseases · 2014. 9. 19. · Fush’sDystsrophy - COLA2 Diabetic Retinopathy - VEGF, PEDF, eNOS, iNOS, HTRA1, TNF RAGE, ALR2,ERO Oculocutaneous

  • Upload
    others

  • View
    4

  • Download
    0

Embed Size (px)

Citation preview

Page 1: Recent findings from NGS studies in eye diseases · 2014. 9. 19. · Fush’sDystsrophy - COLA2 Diabetic Retinopathy - VEGF, PEDF, eNOS, iNOS, HTRA1, TNF RAGE, ALR2,ERO Oculocutaneous

Recent findings from NGS studies in eye diseases

Dr.P.Sundaresan

Senior Scientist

Aravind Medical Research Foundation

Aravind Eye Hospital

Madurai

NGS conference-Genotypic-Bangalroe-11th Sep.2014

Page 2: Recent findings from NGS studies in eye diseases · 2014. 9. 19. · Fush’sDystsrophy - COLA2 Diabetic Retinopathy - VEGF, PEDF, eNOS, iNOS, HTRA1, TNF RAGE, ALR2,ERO Oculocutaneous
Page 3: Recent findings from NGS studies in eye diseases · 2014. 9. 19. · Fush’sDystsrophy - COLA2 Diabetic Retinopathy - VEGF, PEDF, eNOS, iNOS, HTRA1, TNF RAGE, ALR2,ERO Oculocutaneous

• 285 million people

• USA- direct and indirect costs associated with adult visual disorders is $35.4 billion

• Genetic factors play a significant role in all common ocular diseases.

Page 4: Recent findings from NGS studies in eye diseases · 2014. 9. 19. · Fush’sDystsrophy - COLA2 Diabetic Retinopathy - VEGF, PEDF, eNOS, iNOS, HTRA1, TNF RAGE, ALR2,ERO Oculocutaneous
Page 5: Recent findings from NGS studies in eye diseases · 2014. 9. 19. · Fush’sDystsrophy - COLA2 Diabetic Retinopathy - VEGF, PEDF, eNOS, iNOS, HTRA1, TNF RAGE, ALR2,ERO Oculocutaneous

25,000 genes547 ocular genes

Page 6: Recent findings from NGS studies in eye diseases · 2014. 9. 19. · Fush’sDystsrophy - COLA2 Diabetic Retinopathy - VEGF, PEDF, eNOS, iNOS, HTRA1, TNF RAGE, ALR2,ERO Oculocutaneous
Page 7: Recent findings from NGS studies in eye diseases · 2014. 9. 19. · Fush’sDystsrophy - COLA2 Diabetic Retinopathy - VEGF, PEDF, eNOS, iNOS, HTRA1, TNF RAGE, ALR2,ERO Oculocutaneous

Ocular diseases/leading cause of blindness

worldwide.• Age-related cataract - results from clouding of the lens

• Age-related macular degeneration leads to loss of central vision as a result photoreceptor cell death.

• central corneal thickness (CCT) in. For instance, a thinner CCT is a risk factor for primary open angle glaucoma (POAG) and is also associated with keratoconus (KC)

• Diabetic retinopathy (DR) is the most common microvascular complication of types 1 and 2 diabetes mellitus

• Fuchs endothelial corneal dystrophy (FECD) is characterized by bilateral, progressive loss of corneal endothelial cells and thickening of Descemet’s membrane.

• Primary Open Angle Glaucoma : Glaucoma refers to a heterogeneous group of disorders that are characterized by progressive loss of retinal ganglion cells and their axons that produces characteristic glaucomatousoptic neuropathy.

• Primary angle closure glaucoma (PACG) is characterized by obstruction of the iridocorneal angle by the iris, which leads to impaired aqueous humor outflow and increased IOP.

• Leber hereditary optic neuropathy (LHON) is a mitochondrial-mediated, maternally inherited disease that leadsto degeneration of retinal ganglion cells and loss of central vision in early life.

• Keratoconus (KC) is a degenerative corneal disorder characterized by localized thinning and protrusion of the cornealstroma.

• Leber congenital amaurosis (LCA) is an autosomal recessive disorder that results from dysfunction and degeneration of photoreceptors.

Page 8: Recent findings from NGS studies in eye diseases · 2014. 9. 19. · Fush’sDystsrophy - COLA2 Diabetic Retinopathy - VEGF, PEDF, eNOS, iNOS, HTRA1, TNF RAGE, ALR2,ERO Oculocutaneous
Page 9: Recent findings from NGS studies in eye diseases · 2014. 9. 19. · Fush’sDystsrophy - COLA2 Diabetic Retinopathy - VEGF, PEDF, eNOS, iNOS, HTRA1, TNF RAGE, ALR2,ERO Oculocutaneous

• The Human Genome Project -identified and mapped the 20 000–25 000 human genes

• SNPs can be used as genetic markers in association studies.

• To date the majority of large-scale genetics studies have used somewhere between 500 000 and 2 500 000 SNPs genotyped on high-throughput genotyping arrays.

• Genome-wide association studies (GWAS) are designed to investigate the associations between SNPs and traits or diseases by comparing the frequency of alleles of a group of people with a particular disease (cases) to that of another group without that disease (controls).

Page 10: Recent findings from NGS studies in eye diseases · 2014. 9. 19. · Fush’sDystsrophy - COLA2 Diabetic Retinopathy - VEGF, PEDF, eNOS, iNOS, HTRA1, TNF RAGE, ALR2,ERO Oculocutaneous

• In recent years, there has been a dramatic increase in gene discovery for ocular diseases, driven by large-scale genome-wide association studies (GWASs), powerful meta-analyses, and next-generation sequencing technologies (eg, whole-exome sequencing).

• Gene discovery has also fueled translational researchgeared toward development of gene-based screening tests and targeted gene therapies.

Page 11: Recent findings from NGS studies in eye diseases · 2014. 9. 19. · Fush’sDystsrophy - COLA2 Diabetic Retinopathy - VEGF, PEDF, eNOS, iNOS, HTRA1, TNF RAGE, ALR2,ERO Oculocutaneous

The output of a GWAS can be displayed in a figure, referred to as a

Manhattan plot

Page 12: Recent findings from NGS studies in eye diseases · 2014. 9. 19. · Fush’sDystsrophy - COLA2 Diabetic Retinopathy - VEGF, PEDF, eNOS, iNOS, HTRA1, TNF RAGE, ALR2,ERO Oculocutaneous
Page 13: Recent findings from NGS studies in eye diseases · 2014. 9. 19. · Fush’sDystsrophy - COLA2 Diabetic Retinopathy - VEGF, PEDF, eNOS, iNOS, HTRA1, TNF RAGE, ALR2,ERO Oculocutaneous

KEY POINTS

• Genome-wide association studies have shed considerable insight into the genetic mechanisms of eye disease.

• Recently seven novel genes have been found to be associated with age- related macular degeneration and over 20 genes have been implicated in the development of myopia or refractive error.

• A genome-wide association study of primary angle closure glaucoma identified significant associations at three separate regions

Page 14: Recent findings from NGS studies in eye diseases · 2014. 9. 19. · Fush’sDystsrophy - COLA2 Diabetic Retinopathy - VEGF, PEDF, eNOS, iNOS, HTRA1, TNF RAGE, ALR2,ERO Oculocutaneous
Page 15: Recent findings from NGS studies in eye diseases · 2014. 9. 19. · Fush’sDystsrophy - COLA2 Diabetic Retinopathy - VEGF, PEDF, eNOS, iNOS, HTRA1, TNF RAGE, ALR2,ERO Oculocutaneous

A map of human genome variation from population-scale sequencing

• Nature Volume: 467, Pages: 1061–1073 (28 October 2010)

• The 1000 Genomes Project aims to provide a deep characterization of human genome sequence variation as a foundation for investigating the relationship between genotype and phenotype. Here we present results of the pilot phase of the project, designed to develop and compare different strategies for genome-wide sequencing with high-throughput platforms. We undertook three projects: low-coverage whole-genome sequencing of 179 individuals from four populations; high-coverage sequencing of two mother–father–child trios; and exon-targeted sequencing of 697 individuals from seven populations. We describe the location, allele frequency and local haplotype structure of approximately 15 million single nucleotide polymorphisms, 1 million short insertions and deletions, and 20,000 structural variants, most of which were previously undescribed. We show that, because we have catalogued the vast majority of common variation, over 95% of the currently accessible variants found in any individual are present in this data set. On average, each person is found to carry approximately 250 to 300 loss-of-function variants in annotated genes and 50 to 100 variants previously implicated in inherited disorders. We demonstrate how these results can be used to inform association and functional studies. From the two trios, we directly estimate the rate of de novo germline base substitution mutations to be approximately 10−8 per base pair per generation. We explore the data with regard to signatures of natural selection, and identify a marked reduction of genetic variation in the neighbourhood of genes, due to selection at linked sites. These methods and public data will support the next phase of human genetic research.

Page 16: Recent findings from NGS studies in eye diseases · 2014. 9. 19. · Fush’sDystsrophy - COLA2 Diabetic Retinopathy - VEGF, PEDF, eNOS, iNOS, HTRA1, TNF RAGE, ALR2,ERO Oculocutaneous

Genetics of Eye diseases

Inheritance of cataract gene Albinism family

Single gene diseases Complex gene diseases

Mitochondrial

disease

Congenital cataract,

Albinism ,

Corneal dystrophies

Diabetic Retinopathy, Age related

macular degeneration and

cataract, Leber’s congenital

amaurosis, Glaucoma, Pseudo

exfoliation syndrome,

Microphthalmia, Anophthalmia ,

Coloboma , Keratoconus

Leber’s hereditary

optic neuropathy

(LHON)

Page 17: Recent findings from NGS studies in eye diseases · 2014. 9. 19. · Fush’sDystsrophy - COLA2 Diabetic Retinopathy - VEGF, PEDF, eNOS, iNOS, HTRA1, TNF RAGE, ALR2,ERO Oculocutaneous

Genetics studies on various eye diseasesPhenotype Gene----------------------------------------------------------------------------------------------------------------Aniridia - PAX6

CRYAA, CRYAB, CRYBA1CRYBA4, Cataract CRYBB1, CRYBB2, CRYGC, CRYGD,

CRYGS, GJA3, GJA8, BFSP1 and HSF4.Primary Open Angle Glaucoma - MYOC, OPTN, WDR36Congenital Glaucoma - CYP1B1Exfoliation glaucoma - LOXL1Biomarker study on GlaucomaCongenital Hereditary Endothelial Dystrophy - SLCA411Fush’s Dystsrophy - COLA2Diabetic Retinopathy - VEGF, PEDF, eNOS, iNOS, HTRA1, TNF

RAGE, ALR2,ERO Oculocutaneous and Ocular Albinism - TYR, P, MC1R , TYRP1, MATP, GPCR143BPES - FOXL2Retinoschisis - RS1FEVR - FZD4 LCA - CRX, RPE65, LHON - MCA – GDR6RP - RPE65 Duane Syndrome - SALL4Congenital Rubella Syndrome - E2

Page 18: Recent findings from NGS studies in eye diseases · 2014. 9. 19. · Fush’sDystsrophy - COLA2 Diabetic Retinopathy - VEGF, PEDF, eNOS, iNOS, HTRA1, TNF RAGE, ALR2,ERO Oculocutaneous

Disease Gene No.of variations identifiedAniridia PAX6 14

Primary open angle glaucoma (POAG) MYOC 9

OPTN 1

OPTC 4

CYP1B1 3

Congenital glaucoma CYP1B1 12

Congenitaland cataract GJA3 2

GJA8 2

Age related cataract EPHA2 3

ARMS2 2

HTRA1 2

Microphthalmia,Anaphthalmia,Coloboma (MAC) GDF3 1

GDF6 2

Oculocutaneous Albinism TYR 20

P 4

MC1R 7

TYRP1 1

MATP 3

Ocular Albinism GPR143 1

Blepharophimosis Ptosis Epicanthus inversus Syndrome FOXL2 12

Diabetic retinopathy (DR) VEGF 4

eNOS 1

PEDF 4

RAGE 3

CFH 2

HTRA1 1

ARMS2 1

ALR2/AKRIBI 3

EDN1 1

ICAM-1 1

HFE 0

EPO 1

Leber's hereditary optic neuropathy (LHON) ND1 0

ND4 2

ND6 1

Leber's congenital amaurosis (LCA) RPE65 2

X-linked retinoschisis RS1 10

Familial exudative vitreoretinopathy FZD4 3

Age related macular degeneration (AMD) CFH 1

Congenital hereditary endothelial dystrophy (CHED) SLC4A11 17

Fuchs endothelial corneal dystrophy (FECD) COL8A2 5

SLC4A11 5

Keratoconus VSX1 4

Pseudoexfoliation LOXL1 2

Total 179

Page 19: Recent findings from NGS studies in eye diseases · 2014. 9. 19. · Fush’sDystsrophy - COLA2 Diabetic Retinopathy - VEGF, PEDF, eNOS, iNOS, HTRA1, TNF RAGE, ALR2,ERO Oculocutaneous

Indian Genetic Disease Database

• Eye Disorders

• (www.igdd.iicb.res.in).

Page 20: Recent findings from NGS studies in eye diseases · 2014. 9. 19. · Fush’sDystsrophy - COLA2 Diabetic Retinopathy - VEGF, PEDF, eNOS, iNOS, HTRA1, TNF RAGE, ALR2,ERO Oculocutaneous

2. Fragment genomic DNA 3. Capture target sequences

4. Elute target-enriched

sample

5. Perform next

generation

sequencing

~10 million reads

6. Align reads to

reference

sequenceTACATTTGGGAAAAGTAAATTTGCTGAAAATAATCCCGGT

AAGAAAGAAACACTTTTCATGTAATTAGCTTTTTTACATC

AAACTTCAGAACCCAAAGTCATTGAGAATATTAGGGATCA

CAGAACCACATGAGTCAGAATCATCAGAATATCCCACCAA

AGGAGAAGGAAGGAGCAGAGGATTCAAAAGGAAATGGAAT

GATGAATATGAAGAAATGTCAGAAATGAAAGAAGGGAAAG

GAAATTGAATTCGATGAAATAAATGATACTTGCTTATCTG

...

...

16 fold coverage

1. Collect sample

Page 21: Recent findings from NGS studies in eye diseases · 2014. 9. 19. · Fush’sDystsrophy - COLA2 Diabetic Retinopathy - VEGF, PEDF, eNOS, iNOS, HTRA1, TNF RAGE, ALR2,ERO Oculocutaneous

Next Generation Sequencing Challenges

Page 22: Recent findings from NGS studies in eye diseases · 2014. 9. 19. · Fush’sDystsrophy - COLA2 Diabetic Retinopathy - VEGF, PEDF, eNOS, iNOS, HTRA1, TNF RAGE, ALR2,ERO Oculocutaneous

Highlight the use of NGS technology

the problem,

choice of technology,

how the technology helped

Page 23: Recent findings from NGS studies in eye diseases · 2014. 9. 19. · Fush’sDystsrophy - COLA2 Diabetic Retinopathy - VEGF, PEDF, eNOS, iNOS, HTRA1, TNF RAGE, ALR2,ERO Oculocutaneous

Genetic Basis for Ocular Health and Disease?

Refractive Error

Concomitant and Non-Concomitant Strabismus

Corneal Disorders

• Anterior Segment Dysgenesis

• Corneal Dystrophies

Glaucoma• PCG•JOAG•PDS/PG

•PXF•POAG•NTG•CCT

Lens

• Congenital Cataract

•Age related cataract

•Subluxation/Dislocation

Vitreous

•Stickler

•Wagner

•FEVR

Retinal Degeneration

• Retinal Dystrophy

•Macular Dystrophy

•AMD

Optic Nerve

Degeneration

• Optic Atrophy

•LHON

Phakomatosis

• NF1/2

•Tuberous Sclerosis

•VHL

Page 24: Recent findings from NGS studies in eye diseases · 2014. 9. 19. · Fush’sDystsrophy - COLA2 Diabetic Retinopathy - VEGF, PEDF, eNOS, iNOS, HTRA1, TNF RAGE, ALR2,ERO Oculocutaneous

SLC4A11

100 KDa

R7

55

W, R

75

5Q

891 aa1

SLC4A11

K1

18

Tfs

X1

1

R1

25

C, R

12

5H

R1

58

Pfs

X3

A1

60

T

C2

18

Kfs

X4

9A

26

9V

C3

86

R

R6

05

X

P7

73

L

Q8

36

X

R8

69

CL8

73

P

A8

87

P

GC box

A1

35

A

R1

61

RS2

13

S

N5

53

N

V6

58

V

Congenital Hereditary Endothelial Dystrophy

20p13

Page 25: Recent findings from NGS studies in eye diseases · 2014. 9. 19. · Fush’sDystsrophy - COLA2 Diabetic Retinopathy - VEGF, PEDF, eNOS, iNOS, HTRA1, TNF RAGE, ALR2,ERO Oculocutaneous

Mutations in sodium-borate cotransporter SLC4A11

cause recessive congenital hereditary endothelial

dystrophy (CHED2).

*Vithana EN, *Morgan P, *Sundaresan P, Ebenezer ND, Tan

DT, Mohamed D, Anand S, Khine KO, Venkataraman D,

Yong VH, Salto-Tellez M, Venkatraman A, Guo K, Hemadevi

B, Srinivasan M, Prajna V, Khine M, Casey JR, Inglehearn

CF, Aung T.

Nature Genetics. 2006 Jul;38(7):755-7.

* These authors contributed equally to this work

Page 26: Recent findings from NGS studies in eye diseases · 2014. 9. 19. · Fush’sDystsrophy - COLA2 Diabetic Retinopathy - VEGF, PEDF, eNOS, iNOS, HTRA1, TNF RAGE, ALR2,ERO Oculocutaneous

Genetic loci linked to glaucoma

Chromosomal GenBankLocus location OMIM no. Gene accession no. Reference

____________________________________________________________________________________________________

GLC1A (JOAG1) 1q 21-31 137750 Myocilin NM 000261 Sheffield et al. 1993

GLC1B 2cen-q31 606689 - - Stoilova et al. 1996 GLC1C 3q 21-24 601682 - - Wirtz et al. 1997 GLC1D 8p 23 602429 - - Trifan et al. 1998 GLC1E 10p 15-14 602432 Optineurin NM 021980 Sarfarazi et al. 1998 GLC1F 7q 35-q36 603383 - - Wirtz et al. 1999 GLC1G 5q 22.1 609887 WDR36 NM 139281 Monemi et al. 2005 GLC1H 14q11-q13 611276 - - Suriyapperuma et al. 2007

GLC1I 15q11-13 609745 - - Allingham et al. 2005 GLC1J (JOAG2) 9q22 608695 - - Wiggs et al. 2004

GLC1K (JOAG3) 20p12 608696 - - Wiggs et al. 2004

GLC1L (JOAG4) 3p21-22 137750 - - Baird et al. 2005 GLC1M (JOAG5) 5q22.1-q32 610535 - - Pang et al. 2006 GLC1N (JOAG6) 15q22-q24 61274 - - Wang et al. 2006b

- 19q12 - - - Wiggs et al. 2000 - 17q25.1-17q25.3 - - - Wiggs et al. 2000 - 14q11.1-14q11.2 - - - Wiggs et al. 2000 - 14q21.1-q21.3 - - Wiggs et al. 2000 - 17p13 - - - Wiggs et al. 2000 - 10p12.33-p12.1 - - - Nemesure et al. 2003 - 2q33.1-q33.3 - - Nemesure et al. 2003 - 2p14 - - - Wiggs et al. 2000 - 2p15-16 - - Lin et al. 2008 - 1p 32 - - - Charlesworth et al. 2005

- 10q 22 - - - Charlesworth et al. 2005

Page 27: Recent findings from NGS studies in eye diseases · 2014. 9. 19. · Fush’sDystsrophy - COLA2 Diabetic Retinopathy - VEGF, PEDF, eNOS, iNOS, HTRA1, TNF RAGE, ALR2,ERO Oculocutaneous

Genes reported to be associated with POAG• Gene symbol Gene name OMIM no. Chromosomal location Reference • AGTR2 Angiotensin II receptor, type 2 300034 Xq22-q23 Hashizume et al. 2005• APOE Apolipoprotein E 107741 19q13.2 Copin et al. 2002• IL1A Interluekin 1 alpha 147760 2q14 Wang et al. 2006a • EDNRA Endothelin receptor, type A 131243 4q31.2 Ishikawa et al. 2005 • GSTM1 Glutathione S-transferase, mu-1 138350 1p13.3 Juronen et al. 2000 • IGF2 Insulin-like growth factor II 147470 11p15.5 Tsai et al. 2003 • IL1B Interluekin 1 beta 147720 2q14 Lin et al. 2003b • MTHFR 5,10-methylenetetra-hydrofolate reductase 607093 1p36.3 Junemann et al. 2005 • NOS3 Nitric oxide synthase 3 163729 7q36 Tunny et al. 1998 • NPPA Natriuretic peptide precursor A 108780 1p36.2 Tunny et al. 1996 • OCLM Oculomedin 604301 1q31.1 Fujiwara et al. 2003 • OLFM2 Olfactomedin 2 - 19p13.2 Funayama et al. 2006 • OPA1 Optic atrophy 1 605290 3q28-q29 Aung et al. 2002 • TAP1 Transporter, ATP-binding cassette, major 1170260 6p21.3 Lin et al. 2004 • histocompatibility complex, • TNF Tumour necrosis factor 191160 6p21.3 Lin et al. 2003a • TP53 Tumour protein p53 191170 17p13.1 Lin et al. 2002 • OPTC Opticin 605127 1q32.1 Acharya et al. 2007 • CYP2D6 Cytochrome P450, Subfamily IID, Polypeptide 124030 22q13.1 Yang et al. 2009 • 6 • PON1 Paraoxonase 1 168820 7q21.3 Inagaki et al. 2006a • CDH-1 Cadherin 1 192090 16q22.1 Lin et al. 2006 • LMX1B Lim Homeobox Transcription Factor 1 602575 9q34.1 Park et al. 2009 • ANP Atrial natriuretic polypeptide 108780 1p36.2 Tunny et al. 1996 • P21 P21 116899 6p21.2 Tsai et al. 2004 • HSPA1A Heat shock 70 kDa protein 1A 140550 6p21.3 Tosaka et al. 2007 • TLR4 Toll-like receptor 4 603030 9q32-q33 Shibuya et al. 2008 • CYP46A1 Cytochrome P450, Family 46, Subfamily A, 604087 14q32.1 Fourgeux et al. 2009 • Polypeptide 1 • PAI-1 plasminogen activator inhibitor-1 173360 7q21.3-q22 Mossbock et al. 2008 • ADRB1 beta-adrenergic receptors 1 109630 10q24-q26 Inagaki et al. 2006b • ADRB2 beta-adrenergic receptors 2 109690 5q32-q34 Inagaki et al. 2006b

Page 28: Recent findings from NGS studies in eye diseases · 2014. 9. 19. · Fush’sDystsrophy - COLA2 Diabetic Retinopathy - VEGF, PEDF, eNOS, iNOS, HTRA1, TNF RAGE, ALR2,ERO Oculocutaneous

Pathways involved in pathogenesis of POAG

Page 29: Recent findings from NGS studies in eye diseases · 2014. 9. 19. · Fush’sDystsrophy - COLA2 Diabetic Retinopathy - VEGF, PEDF, eNOS, iNOS, HTRA1, TNF RAGE, ALR2,ERO Oculocutaneous

Pedigree of the recruited family

Page 30: Recent findings from NGS studies in eye diseases · 2014. 9. 19. · Fush’sDystsrophy - COLA2 Diabetic Retinopathy - VEGF, PEDF, eNOS, iNOS, HTRA1, TNF RAGE, ALR2,ERO Oculocutaneous
Page 31: Recent findings from NGS studies in eye diseases · 2014. 9. 19. · Fush’sDystsrophy - COLA2 Diabetic Retinopathy - VEGF, PEDF, eNOS, iNOS, HTRA1, TNF RAGE, ALR2,ERO Oculocutaneous
Page 32: Recent findings from NGS studies in eye diseases · 2014. 9. 19. · Fush’sDystsrophy - COLA2 Diabetic Retinopathy - VEGF, PEDF, eNOS, iNOS, HTRA1, TNF RAGE, ALR2,ERO Oculocutaneous

Molecular Genetics of Globe

Anomalies in Indian Population

Page 33: Recent findings from NGS studies in eye diseases · 2014. 9. 19. · Fush’sDystsrophy - COLA2 Diabetic Retinopathy - VEGF, PEDF, eNOS, iNOS, HTRA1, TNF RAGE, ALR2,ERO Oculocutaneous

BACKGROUND

Page 34: Recent findings from NGS studies in eye diseases · 2014. 9. 19. · Fush’sDystsrophy - COLA2 Diabetic Retinopathy - VEGF, PEDF, eNOS, iNOS, HTRA1, TNF RAGE, ALR2,ERO Oculocutaneous

• Complex aetiology with chromosomal, monogenic and

environmental causes identified

• Diverse patterns of genetic inheritance and variable

severity due to genetic heterogeneity of ocular

malformations

• Of the large number of genes (> 65), SOX2, OTX2, RAX,

PAX6, CHX10, STRA6, GDF3 and GDF6 are important

candidate genes

MAC: ETIOLOGY

Page 35: Recent findings from NGS studies in eye diseases · 2014. 9. 19. · Fush’sDystsrophy - COLA2 Diabetic Retinopathy - VEGF, PEDF, eNOS, iNOS, HTRA1, TNF RAGE, ALR2,ERO Oculocutaneous

A cluster of ano/micro has been reported from a

small area of Bihar in >45 babies in the year 2009-2010

MICROPHTHALMIA AND ANOPHTHALMIA

CLUSTER FROM BIHAR

Page 36: Recent findings from NGS studies in eye diseases · 2014. 9. 19. · Fush’sDystsrophy - COLA2 Diabetic Retinopathy - VEGF, PEDF, eNOS, iNOS, HTRA1, TNF RAGE, ALR2,ERO Oculocutaneous

Anophthalmia and Microphthalmia

combined : 30 in 100,000 population

Microphthalmia: 11 % of blind children

Coloboma: 3.2-11.2 % of blind children

MAC: Prevalence

Madhya Pradesh 18.80 %

Tamilnadu 20.60 %

Karnataka 28.70 %

Andhrapradesh 18 %

North East 30.60 %

Delhi 27.40 %

Maharashtra 35.00 %

Uttar Pradesh 33 %

Page 37: Recent findings from NGS studies in eye diseases · 2014. 9. 19. · Fush’sDystsrophy - COLA2 Diabetic Retinopathy - VEGF, PEDF, eNOS, iNOS, HTRA1, TNF RAGE, ALR2,ERO Oculocutaneous

To find out the spectrum of genetic variations in candidate

genes in patients with microphthalmia, anophthalmia and

coloboma (MAC) in Indian cohorts

PURPOSE

Page 38: Recent findings from NGS studies in eye diseases · 2014. 9. 19. · Fush’sDystsrophy - COLA2 Diabetic Retinopathy - VEGF, PEDF, eNOS, iNOS, HTRA1, TNF RAGE, ALR2,ERO Oculocutaneous

STUDY SUBJECTS

MAC patients from South Indian cohort clinically

diagnosed at Aravind eye hospital , Madurai and

patients from Bihar state were recruited for the study

Total number of clinically well diagnosed MAC cases

=120 (25 from Bihar state and 95 from South India)

Total number of family members

=200 (including both Bihar and South Indian cohorts)

Total number of healthy control = 100

METHODOLOGY

Page 39: Recent findings from NGS studies in eye diseases · 2014. 9. 19. · Fush’sDystsrophy - COLA2 Diabetic Retinopathy - VEGF, PEDF, eNOS, iNOS, HTRA1, TNF RAGE, ALR2,ERO Oculocutaneous

METHODOLOGY

1. TARGETED RE-SEQUENCING

9 genes screened by targeted re-sequencing in 56 samples

Steps in targeted re-sequencing:

Capture specific regions of interest PCR amplification

Template preparation

Sequencing and imaging By Illumina MiSeq

Data analysis

2. SANGER SEQUENCING

5 genes (SOX2, OTX2, PAX6, RAX & ABCB6 ) were

screened by Sanger sequencing in 64 MAC samples

Page 40: Recent findings from NGS studies in eye diseases · 2014. 9. 19. · Fush’sDystsrophy - COLA2 Diabetic Retinopathy - VEGF, PEDF, eNOS, iNOS, HTRA1, TNF RAGE, ALR2,ERO Oculocutaneous

Custom Target Enrichment and multiplex sequencing

of 9 genes (SOX2, OTX2, CRYBA4, VSX2, FOXE3,

GDF3, BMP4, STRA6 and GDF6) for 56 DNA samples

Custom amplicon seq. on Illumina MiSeq platform

2 μg of purified genomic DNA

Total number of primer probes designed to amplify

targeted regions (9 genes) = 181(100% coverage)

1. TARGETED RE-SEQUENCING

Page 41: Recent findings from NGS studies in eye diseases · 2014. 9. 19. · Fush’sDystsrophy - COLA2 Diabetic Retinopathy - VEGF, PEDF, eNOS, iNOS, HTRA1, TNF RAGE, ALR2,ERO Oculocutaneous

Library Preparation:

Amplicon Seq. on MiSeq

Bar-coded samples

Paired end Seq.

Page 42: Recent findings from NGS studies in eye diseases · 2014. 9. 19. · Fush’sDystsrophy - COLA2 Diabetic Retinopathy - VEGF, PEDF, eNOS, iNOS, HTRA1, TNF RAGE, ALR2,ERO Oculocutaneous

Analysis Pipeline

Quality Check &

Filter

Variant Annotation

Alignment

Variant Calling

Quality Check and Filter

Average Q30 score was used as a

cutoff to remove low quality bases

Alignment

The filtered reads were aligned to

the reference genome

(GRCh37/hg19) using BWA

program

Page 43: Recent findings from NGS studies in eye diseases · 2014. 9. 19. · Fush’sDystsrophy - COLA2 Diabetic Retinopathy - VEGF, PEDF, eNOS, iNOS, HTRA1, TNF RAGE, ALR2,ERO Oculocutaneous

Variant Calling

Samtools mpileup program

The variants with quality score >= 50 and read depth of at

least 5 were taken further for annotation

Annotation

The variants found in the sample were annotated using in-

house pipeline (VariMAT)

The variants found were compared with various databases

including OncoMD (www.scigenom.com), OMIM, ClinVar

(http://www.ncbi.nlm.nih.gov/clinvar) and SNPedia for

identifying clinically relevant variants

Page 44: Recent findings from NGS studies in eye diseases · 2014. 9. 19. · Fush’sDystsrophy - COLA2 Diabetic Retinopathy - VEGF, PEDF, eNOS, iNOS, HTRA1, TNF RAGE, ALR2,ERO Oculocutaneous
Page 45: Recent findings from NGS studies in eye diseases · 2014. 9. 19. · Fush’sDystsrophy - COLA2 Diabetic Retinopathy - VEGF, PEDF, eNOS, iNOS, HTRA1, TNF RAGE, ALR2,ERO Oculocutaneous
Page 46: Recent findings from NGS studies in eye diseases · 2014. 9. 19. · Fush’sDystsrophy - COLA2 Diabetic Retinopathy - VEGF, PEDF, eNOS, iNOS, HTRA1, TNF RAGE, ALR2,ERO Oculocutaneous
Page 47: Recent findings from NGS studies in eye diseases · 2014. 9. 19. · Fush’sDystsrophy - COLA2 Diabetic Retinopathy - VEGF, PEDF, eNOS, iNOS, HTRA1, TNF RAGE, ALR2,ERO Oculocutaneous

Gene

# of

sample change

Amino

Acid

Change

Variant

Class Phenotype

VSX2 1 G>A p.G289D Missense

RE- micro with cyst, LE-

normal

STRA6 1 A>C p.L645R Missense RE- clinical anop, LE- micro

STRA6 2 A>T p.L152M Missense

1.Micro & ON coloboma 2.

Micro & CR coloboma

STRA6 1 T>C p.Y374C

Missense

BE- Microphthalmos

CRYBA4 2 T>A p.F25L Missense BE- microphthalmos

GDF6 1 C>T p.A242T Missense Clinical anophthalmos

OTX2 1 Ins C

Frame

shift Insertion BE- anophthalmos

Targeted re-sequencing: List of variations

Page 48: Recent findings from NGS studies in eye diseases · 2014. 9. 19. · Fush’sDystsrophy - COLA2 Diabetic Retinopathy - VEGF, PEDF, eNOS, iNOS, HTRA1, TNF RAGE, ALR2,ERO Oculocutaneous

Identification of Mutations in SOX2, OTX2, RAX, PAX6

& ABCB6

2. SANGER SEQUENCING

DNA isolation Direct sequencing ClustalW

64 MAC samples (20 from Bihar and 44from South India)were screened for mutations in SOX2, OTX2, RAX, PAX6 andABCB6 genes

PCR Blast Functional analysis of ABCB6 mutation

Page 49: Recent findings from NGS studies in eye diseases · 2014. 9. 19. · Fush’sDystsrophy - COLA2 Diabetic Retinopathy - VEGF, PEDF, eNOS, iNOS, HTRA1, TNF RAGE, ALR2,ERO Oculocutaneous

S.N. Gene Location Type of variation Phenotype1 RAX Exon-2 Novel Homozygous subs

p. Arg 179 TrpBilateral

anophthalmos2 OTX2 Exon-3 Novel Compound

heterozygous mutation

p. Gln104 X, p. Gln106 His

RE :Micro. with irregular pupil

3 OTX2 Exon-3 Novel heterozygous frame shift Mutation (deletion)

p. Thr186 Fs

RE: anop., LE: microphthalmos

4ABCB6 Exon1 Novel Heterozygous

Mutation (subs)p. Ala 57 Thr

coloboma

5PAX6 Intron 5

c.141+4heterozygous substitution

Splicing errorLens coloboma &

aniridia

Sanger sequencing: List of variations

Page 50: Recent findings from NGS studies in eye diseases · 2014. 9. 19. · Fush’sDystsrophy - COLA2 Diabetic Retinopathy - VEGF, PEDF, eNOS, iNOS, HTRA1, TNF RAGE, ALR2,ERO Oculocutaneous

Gene Mutation PolyPhen SIFT

RAX p.R179W PROBABLY

DAMAGING (1.00)

AFFECT PROTEIN

FUNCTION (0.00)

OTX2 p.Q106H PROBABLY

DAMAGING (0.970)

AFFECT PROTEIN

FUNCTION (0.01)

ABCB6 p.A57T BENIGN (0.001) AFFECT PROTEIN

FUNCTION (0.00)

VSX2 p.G289D BENIGN (0.040) TOLERATED (0.59)

STRA6 p.L645R PROBABLY

DAMAGING (0.999)

AFFECT PROTEIN

FUNCTION (0.00)

STRA6 p.Y374C PROBABLY DAMAGING

(0.999)

AFFECT PROTEIN

FUNCTION (0.00)

GDF6 p.A242T BENIGN (0.047) TOLERATED (0.94)

PolyPhen and SIFT score for missense mutations

Page 51: Recent findings from NGS studies in eye diseases · 2014. 9. 19. · Fush’sDystsrophy - COLA2 Diabetic Retinopathy - VEGF, PEDF, eNOS, iNOS, HTRA1, TNF RAGE, ALR2,ERO Oculocutaneous

Novel p. Ala57Thr Mutation in ABCB6

Page 52: Recent findings from NGS studies in eye diseases · 2014. 9. 19. · Fush’sDystsrophy - COLA2 Diabetic Retinopathy - VEGF, PEDF, eNOS, iNOS, HTRA1, TNF RAGE, ALR2,ERO Oculocutaneous

Morpholino Knockdown of abcb6 in

Zebrafish and Rescue Studies

The abcb6 transcripts are expressed in the developing

CNS tissue, including that of the eyes, suggesting a

function for abcb6 in eye development

To test the hypothesis that disruption of the normal

function of ABCB6 can cause coloboma, zebrafish model

was developed to study eye development

Page 53: Recent findings from NGS studies in eye diseases · 2014. 9. 19. · Fush’sDystsrophy - COLA2 Diabetic Retinopathy - VEGF, PEDF, eNOS, iNOS, HTRA1, TNF RAGE, ALR2,ERO Oculocutaneous

MO knockdown by using two specific antisense

oligonucleotides targeting..

abcb6 ATG-inhibition (5’-CACAGAAACTCTTCATCTCCACCAT-3’)(abcb6MO1),

abcb6 splice-blocking (5’-TGCTACCAGCAAGCGTACCTGTTGC-3’) (abcb6MO2)

and standard control (5’-CCTCTTACCTCAGTTACAATTTATA-3’)

morpholinos injected into the egg yolk of 1–2-cell-stage embryos

For rescue studies, MOs were coinjected into 1–2-cell-

stage zygotes with either wild type (WT) or mutant ABCB6

mRNA

Page 54: Recent findings from NGS studies in eye diseases · 2014. 9. 19. · Fush’sDystsrophy - COLA2 Diabetic Retinopathy - VEGF, PEDF, eNOS, iNOS, HTRA1, TNF RAGE, ALR2,ERO Oculocutaneous

Morpholino Knockdown of abcb6 Rescue Studies

Page 55: Recent findings from NGS studies in eye diseases · 2014. 9. 19. · Fush’sDystsrophy - COLA2 Diabetic Retinopathy - VEGF, PEDF, eNOS, iNOS, HTRA1, TNF RAGE, ALR2,ERO Oculocutaneous

Graph depicting the proportions of embryos with coloboma associated with the

injection of either abcb6MO1 or abcb6MO2 and the proportions rescued by

coinjection of MOs with WT and mutant ABCB6 mRNA

Page 56: Recent findings from NGS studies in eye diseases · 2014. 9. 19. · Fush’sDystsrophy - COLA2 Diabetic Retinopathy - VEGF, PEDF, eNOS, iNOS, HTRA1, TNF RAGE, ALR2,ERO Oculocutaneous
Page 57: Recent findings from NGS studies in eye diseases · 2014. 9. 19. · Fush’sDystsrophy - COLA2 Diabetic Retinopathy - VEGF, PEDF, eNOS, iNOS, HTRA1, TNF RAGE, ALR2,ERO Oculocutaneous

CONCLUSIONS

All pathogenic mutations identified in South Indian population

No mutations identified in Bihar patient (strongly suggests

the involvement of teratogens in Bihar A/M cluster)

This study identified 12 mutations (9 novel) in 12 genes as; 3

in OTX2, 3 in STRA6, 1 in RAX, 1 in PAX6, 1 in VSX2, 1 in

ABCB6, 1 in CRYBA4 and 1 in GDF6.

Seven Mutations were identified by NGS technique whereas

five mutations by Sanger sequencing

Mutations in SOX2 are rare in Indian population (as no

mutations were identified in 120 MAC cases)

Page 58: Recent findings from NGS studies in eye diseases · 2014. 9. 19. · Fush’sDystsrophy - COLA2 Diabetic Retinopathy - VEGF, PEDF, eNOS, iNOS, HTRA1, TNF RAGE, ALR2,ERO Oculocutaneous

First report of association of ABCB6 gene with globe anomalies

The phenotype caused by disruption of ABCB6 can be

explained by haploinsufficiency

- Mutation identified in ABCB6 is heterozygous

- Decreased mRNA expression caused by morpholino

knockdown in zebrafish replicates the coloboma

phenotype

- Knockdown phenotype can be corrected with the

coinjection of MOs with WT mRNA, but not with

mutant ABCB6 mRNA

CONCLUSIONS

Page 59: Recent findings from NGS studies in eye diseases · 2014. 9. 19. · Fush’sDystsrophy - COLA2 Diabetic Retinopathy - VEGF, PEDF, eNOS, iNOS, HTRA1, TNF RAGE, ALR2,ERO Oculocutaneous

Establishment of Human Retinal

Mitoscriptome Gene Expression Signature

for Diabetic Retinopathy and Diabetic

Using Human Cadaver Eye

Page 60: Recent findings from NGS studies in eye diseases · 2014. 9. 19. · Fush’sDystsrophy - COLA2 Diabetic Retinopathy - VEGF, PEDF, eNOS, iNOS, HTRA1, TNF RAGE, ALR2,ERO Oculocutaneous

* A circular molecule

* Genome size: ~16569bp

* Maternally inherited

* Genes:

-2 rRNAs

-22 tRNAs

-13 proteins

* Only non-coding region is d-loop

* Other proteins encoded by nuclear DNA!

mtDNA: Genome & Organization

Page 61: Recent findings from NGS studies in eye diseases · 2014. 9. 19. · Fush’sDystsrophy - COLA2 Diabetic Retinopathy - VEGF, PEDF, eNOS, iNOS, HTRA1, TNF RAGE, ALR2,ERO Oculocutaneous

Complex I

Complex II

Complex IIIComplex IV

Complex V

Apoptosis

Lipid Metabolism

Nucleotide Metabolism

Amino Acid Metabolism

Carbohydrate Metabolism

Electron Transport Chain

RNA Polymerase

Ribosome

tRNAs

Nucleus

Mitochondria

CELL

Variations

? ?

http://blog.openhelix.com/wp-content/uploads/2008/11/nhgri_cnv_cyndy_post2.jpghttp://spittoon.23andme.com/wp-content/uploads/2009/09/prostatemen.jpg

mtDNA variations: Structural and Functional complexity

Genotype-Phenotype correlation

Page 62: Recent findings from NGS studies in eye diseases · 2014. 9. 19. · Fush’sDystsrophy - COLA2 Diabetic Retinopathy - VEGF, PEDF, eNOS, iNOS, HTRA1, TNF RAGE, ALR2,ERO Oculocutaneous

Mitochondria & COMPONENTS

22 tRNAs

2 rRNAs

13 proteins

NOT SUFFICIENT FOR OPTIMAL FUNCTIONS

Page 63: Recent findings from NGS studies in eye diseases · 2014. 9. 19. · Fush’sDystsrophy - COLA2 Diabetic Retinopathy - VEGF, PEDF, eNOS, iNOS, HTRA1, TNF RAGE, ALR2,ERO Oculocutaneous

HAS TO BE IMPORTEDAS PER REQUIREMENT

>1500 proteins

5S rRNA

tRNAs

ncRNA.....smallRNAs??

Page 64: Recent findings from NGS studies in eye diseases · 2014. 9. 19. · Fush’sDystsrophy - COLA2 Diabetic Retinopathy - VEGF, PEDF, eNOS, iNOS, HTRA1, TNF RAGE, ALR2,ERO Oculocutaneous

Objectives

To under the role of Mitochondria’s involvement in development of Diabetic Retinopathy

• To obtain the retinal mitoscriptome gene expression

signature using “Agilent - microarray” for diabetic

and diabetic retinopathy human cadaver eye

Page 65: Recent findings from NGS studies in eye diseases · 2014. 9. 19. · Fush’sDystsrophy - COLA2 Diabetic Retinopathy - VEGF, PEDF, eNOS, iNOS, HTRA1, TNF RAGE, ALR2,ERO Oculocutaneous

Methodology:

I. Clinical Characterization -Cadaver Eye Dr. R. Kim – AEH, Madurai

Dr. S.R.Karthick – AEH, Madurai

Stereomicroscope examination

Digitised images

III. Custom based Microarray

AMADID number: G2509F_045815

RNA extraction

cRNA Conversion

Performed Microarray (Agilent – 8*15K platform ) – Around 1500 mitoscriptome gene

probes (GSE53257)

III. Microarray data - Validation AMRF, Madurai

Taqman Relative quantification - Real time PCR

Genotypic Pvt Limited, Bengaluru, India

Page 66: Recent findings from NGS studies in eye diseases · 2014. 9. 19. · Fush’sDystsrophy - COLA2 Diabetic Retinopathy - VEGF, PEDF, eNOS, iNOS, HTRA1, TNF RAGE, ALR2,ERO Oculocutaneous

Experimental Design

In present study, we have compared three biological conditions to obtain

human mitoscriptome gene expression signature for DR and diabetes

Each group includes 4 biological replicates with additional technical

replicate to validate the microarray experiment

Comparison was carried out between retinas of:

DR (n=6) and age matched normal control (n=5) groups

Diabetic (n=5) and age matched normal control (n=5) groups

DR (n=6) and diabetic (n=5) groups

Page 67: Recent findings from NGS studies in eye diseases · 2014. 9. 19. · Fush’sDystsrophy - COLA2 Diabetic Retinopathy - VEGF, PEDF, eNOS, iNOS, HTRA1, TNF RAGE, ALR2,ERO Oculocutaneous

Hierarchical cluster shows differentially expressed genes among postmortem DR, Diabetic and age matched normal control group retinas

Notes: The red color indicates up- regulated genes and the greencolor indicates down regulated genes

Page 68: Recent findings from NGS studies in eye diseases · 2014. 9. 19. · Fush’sDystsrophy - COLA2 Diabetic Retinopathy - VEGF, PEDF, eNOS, iNOS, HTRA1, TNF RAGE, ALR2,ERO Oculocutaneous

Results-Gene expression analysisDifferences in human mitoscriptome gene expression between DR and age

matched normal control groups

• Among 1100 genes 59 genes were differentially expressed in DR cadaver retinas as compared to normal control group retinas

• In those 59 genes, 8 (≥0.6) were up regulated and 51 (≤0.6) were down regulated

Differences in human mitoscriptome gene expression between diabetic and age matched normal control groups

• Among 1100 genes 39 genes were differentially expressed in diabetic cadaver retinas as compared to normal control retina

• In those 39 genes, 8 were up regulated and 31 were down regulated

Differences in human mitoscriptome gene expression between DR and diabetic groups

• Among 1100 genes 39 genes were differentially expressed in DR cadaver retinas as compared to diabetic control retina

• In those 39 genes, 3 were up regulated and 36 were down regulated

Page 69: Recent findings from NGS studies in eye diseases · 2014. 9. 19. · Fush’sDystsrophy - COLA2 Diabetic Retinopathy - VEGF, PEDF, eNOS, iNOS, HTRA1, TNF RAGE, ALR2,ERO Oculocutaneous

Expected Outcome

• Understand the role of Mitochondria’s involvement in

development of DR

• Identification of valuable biomarkers in health and disease

condition

• Developing new diagnostic methods and therapeutic

approaches to their prevention and treatment

Page 70: Recent findings from NGS studies in eye diseases · 2014. 9. 19. · Fush’sDystsrophy - COLA2 Diabetic Retinopathy - VEGF, PEDF, eNOS, iNOS, HTRA1, TNF RAGE, ALR2,ERO Oculocutaneous

• Performing molecular diagnosis for

• Aniridia ,

• Oculocutanous & ocular albinism and

• LHON patients

Page 71: Recent findings from NGS studies in eye diseases · 2014. 9. 19. · Fush’sDystsrophy - COLA2 Diabetic Retinopathy - VEGF, PEDF, eNOS, iNOS, HTRA1, TNF RAGE, ALR2,ERO Oculocutaneous

• Understanding the outcome of the project

• Pooling the samples

• Reseqencing

• Positive control

• validation

• Huge data

• Pathway analysis

• Sample size and cost

Page 72: Recent findings from NGS studies in eye diseases · 2014. 9. 19. · Fush’sDystsrophy - COLA2 Diabetic Retinopathy - VEGF, PEDF, eNOS, iNOS, HTRA1, TNF RAGE, ALR2,ERO Oculocutaneous

Thank you